SNP (Single Nucleotide Polymorphism) marker and primer group for identifying hybrid authenticity of YLL and MD2 of pineapple and application of SNP marker and primer group

Abstract

The invention belongs to the technical field of pineapple crossbreeding, and particularly relates to a molecular marker, a primer and a method for identifying the authenticity of a pineapple YLL and MD2 hybrid. The SNP marker is located at 12504101 of an LG7 chromosome, and the genotype of the SNP marker is A / C. A primer group designed on the basis of the SNP marker can quickly and effectively identify the authenticity of YLL and MD2 hybrids of pineapples, the identification result is accurate and reliable, and genetic breeding of pineapples is facilitated.

Description

Technical Field

[0001] This invention belongs to the field of pineapple hybridization breeding technology, specifically involving an SNP marker, primer set, and its application for identifying the authenticity of pineapple YLL and MD2 hybrids. Background Technology

[0002] Pineapple is one of the world's three major tropical fruit trees, and my country is one of the top ten pineapple producing countries, making it a pillar industry in tropical regions. However, the main cultivated variety in pineapple production is 'Bali,' which has a history of nearly 100 years. Problems such as variety monoculture and degeneration leading to concentrated harvesting periods and declining quality are becoming increasingly prominent, becoming one of the urgent issues that the industry needs to address. The breeding and promotion of new varieties are effective means of adjusting the variety structure and improving the quality and efficiency of the industry. Currently, artificial hybridization is the main method for breeding new pineapple varieties. However, its breeding cycle is long, and due to open pollination, it is prone to producing false hybrids. Furthermore, identifying the authenticity of hybrids based on field phenotypic traits is time-consuming and laborious, and easily affected by environmental and human factors. With the concentrated use of parent lines, the morphological differences in hybrid offspring are becoming smaller, making it increasingly difficult to identify true and false hybrids using morphological characteristics.

[0003] DNA molecular markers for varietal identification offer advantages such as accuracy, reliability, simplicity, speed, ease of operation, and timeliness. They are widely used for varietal authentication in various fruit trees, including citrus, apple, grape, cherry, peach, and kiwifruit. The International Union for the Protection of New Varieties of Plants (UPOV) has recommended SSR marker technology and single nucleotide polymorphism (SNP) technology as two techniques for varietal identification or seed purity assessment in its BMT molecular testing guidelines. However, SSR technology suffers from drawbacks such as a limited number of detection sites, low throughput, poor result representativeness, and difficulty in data sharing. SNP markers, on the other hand, have a high and uniform distribution density in the genome, enabling high-throughput detection and making them more suitable for database integration and sharing. Therefore, they are considered the most promising molecular marker technology.

[0004] Currently, the identification of pineapple hybrid offspring mainly relies on morphological observations of varieties over many years and at multiple locations. There are no reports on using molecular markers to identify the authenticity of F1 generation hybrid populations. Summary of the Invention

[0005] To address the aforementioned issues, this invention provides an SNP marker for identifying the authenticity of pineapple YLL and MD2 hybrids. The molecular marker is located at 12504101 on chromosome LG7 and has the genotype A / C.

[0006] The present invention also provides a primer set for amplifying the above-mentioned SNP marker, the primer set for amplifying the above-mentioned SNP marker including the sequences shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3.

[0007] The present invention also provides a detection reagent for identifying the above-mentioned SNP markers, including the above-mentioned primer set.

[0008] The present invention also provides a detection kit for identifying the above-mentioned SNP markers, including the above-mentioned primer set or detection reagent.

[0009] This invention also provides a method for identifying pineapple varieties, using the aforementioned molecular markers and primer sets, as well as detection kits and test reagents.

[0010] Furthermore, the pineapple variety identification can be used to verify the authenticity of the pineapple YLL and MD2 hybrid.

[0011] Furthermore, if the genotype of the sample to be tested is homozygous, it is a pseudo-hybrid; if the genotype of the sample to be tested is heterozygous, it is a true hybrid.

[0012] The present invention has the following beneficial effects:

[0013] Primer sets designed based on this SNP marker can quickly and effectively identify the authenticity of pineapple YLL and MD2 hybrids. The identification results are accurate and reliable, which is beneficial to the genetic breeding of pineapple. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0015] Figure 1 The genotyping results of some primers are shown, where blue dots represent the 'MD2' genotype, red dots represent the 'YLL' genotype, and green dots represent the genotype of the F1 generation of the cross.

[0016] Figure 2 Genotyping results of 264 individual plants, where blue dots represent the 'MD2' genotype, red dots represent the 'YLL' genotype, and green dots represent the genotypes of the F1 generation of hybrids; A: Genotyping results of SNP30858; B: Genotyping results of SNP7273.

[0017] Figure 3 Sequencing results of some true and false hybrids. Detailed Implementation

[0018] Various exemplary embodiments of the present invention are now described in detail. Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared using conventional methods. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] 1. Experiment

[0024] 1.1 Materials

[0025] Using 'YLL' as the male parent and 'MD2' as the female parent, artificial pollination was used in March 2020 to hybridize the plants, resulting in 80 hybrid offspring of 'MD2' and 'YLL' (numbered JYA001-JYA080). Using 'MD2' as the male parent and 'YLL' as the female parent, artificial pollination was used in March 2020 to hybridize the plants, resulting in 182 hybrid offspring of 'YLL' and 'MD2' (numbered YJA001-YJL013), which were then planted at the Danzhou Experimental Base of the Institute of Tropical Crop Germplasm Resources, Chinese Academy of Tropical Agricultural Sciences.

[0026] 1.2 Methods

[0027] DNA was extracted from leaves of pineapple parents and offspring using a modified CTAB method. Homozygous SNPs differing between parents were screened from the pineapple resequencing data. Primers were designed using the primer design tool available on the website of Wuhan Jingtai Biotechnology Co., Ltd. (http: / / www.snpway.com) based on the SNP information, and named primers X, Y, and C, respectively. PCR amplification was then performed. DNA fragments of specific alleles were distinguished and amplified based on the difference in the last base at the 3' end of the primers and the fluorescence signal value. Genotyping was then performed by detecting the fluorescence signal value of the target locus. All primers used were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0028] Primer screening was performed using 'YLL', 'MD2', and 16 F1 hybrid single plants. The SNP genotyping reagent PARMS was purchased from Wuhan Jingtai Biotechnology. The reaction system is shown in Table 1.

[0029] Table 1 PCR reaction system

[0030] Element volume 2×PARMS 3ul Primer X 0.1ul Primer Y 0.15ul Primer C 0.15ul DNA template 1ul Double distilled water 1.5ul

[0031] PCR reactions were performed on an ABI QuantStudio 6 QS6 instrument, and genotyping was also performed on the instrument. The reaction procedure is shown in Table 2. Primers that could be used to genotype 16 materials were screened, and two sets of SNP primers that could be used for hybrid authenticity identification were obtained.

[0032] Table 2 PCR thermal cycling program

[0033]

[0034]

[0035] 1.3 Molecular identification of hybrid authenticity

[0036] Genotyping was performed on the genomic DNA of 'YLL', 'MD2', and 262 hybrid progeny (numbered YJA001-JYA080) using the selected primers. The genotype of each sample was counted. A sample with a homozygous genotype was considered a pseudohybrid, and a sample with a heterozygous genotype was considered a true hybrid.

[0037] 1.4 Hybrid Authenticity Verification

[0038] Specific primers were designed 150 bp before and after the candidate marker SNP30858. True and false hybrids were randomly selected for specific PCR amplification, and the PCR products were sequenced. A single peak in the SNP sequencing chromatogram indicates a homozygous genotype; multiple peaks indicate a heterozygous genotype. The primer sequences are as follows:

[0039] Primer name Primer sequence (5'–3') F30858 ACACATCCTCTGATCTCACTGC R30858 CCTCCATAGCTCTCTCCTGAT

[0040] 2 Results and Analysis

[0041] 2.1 Primer screening

[0042] From the pineapple whole-genome resequencing data, homozygous SNP loci differing between parents were screened. Fifteen primer sets were designed (Table 3). Using 'YLL', 'MD2', and 16 F1 hybrid plants as materials, primer screening was performed using the PARMS-SNP marker method. The results showed that the 15 primer sets were distributed on eight chromosomes: LG3, LG7, LG9, LG12, LG16, LG17, LG22, and LG24. After PCR amplification, 13 primer sets could not distinguish the 18 materials; only SNP30858 and SNP7273 could distinguish the 18 materials into three types: blue indicates the homozygous genotype of 'MD2', red indicates the homozygous genotype of 'YLL', and green indicates the heterozygous genotype of the F1 hybrid. Figure 1 This indicates that SNP30858 and SNP7273 can be used for the authenticity identification of 'YLL' and 'MD2' hybrid offspring (Table 4).

[0043] Table 3 shows the SNP marker information for the homozygous loci with differential 'YLL' and 'MD2'.

[0044]

[0045]

[0046]

[0047] Table 4. SNP markers used for hybrid authenticity identification of 'YLL' and 'MD2'

[0048]

[0049] 2.2 Hybrid Authenticity Identification

[0050] PCR amplification was performed on the F1 generation of 262 hybrids from parents 'YLL', 'MD2', and 202 plants using SNP30858 and SNP7273. The results showed that both markers could classify the 264 individual plants into three genotypes. Among them, 2 plants and 4 plants with the same genotype as 'YLL' were identified using SNP30858 and SNP7273, respectively. Figure 2 Based on the two markers, a total of 258 true hybrids and 4 false hybrids were identified, with a true hybridity rate of 98.47% (Table 5).

[0051] Table 5. Statistical results of the 'MD2'×'LL' hybrid authenticity identification

[0052]

[0053] 2.3 Sequencing verification of true and false hybrids

[0054] A pair of specific primers, named F30858 and R30858, were designed at a position 150 bp before and after chromosome 24, 3881791. These primers were used to perform PCR amplification on the pseudohybrids YJB012, YJF008, YJE004, and YJH006, and the true hybrids YJL006, YJH001, and YJH010, identified through genotyping. The PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.

[0055] The results are as follows Figure 3 As shown in the figure, the results indicate that YJF008 has a single peak at position 3881791 with a C base; YJB012, YJE004, and YJH006 have double peaks with a T / C base. This suggests that YJF008 is a pseudohybrid, while YJB012, YJE004, and YJH006 are true hybrids. The sequencing results are largely consistent with the SNP genotyping results, indicating that the SNP genotyping results are stable and reliable.

[0056] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A SNP marker for identifying the authenticity of hybrids of pineapple YLL and MD2, characterized in that, The molecular marker is located at 12504101 on chromosome LG7, with a genotype of A / C.

2. The primer set for amplifying the SNP marker described in claim 1, characterized in that, The primer set for amplifying the above SNP markers includes sequences as shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No.

3.

3. The detection reagent for identifying the SNP marker as described in claim 1, characterized in that, Includes the primer set as described in claim 2.

4. The detection kit for identifying the SNP marker as described in claim 1, characterized in that, Includes the primer set as described in claim 2 or the detection reagent as described in claim 3.

5. A method for identifying pineapple varieties, characterized in that, Identification is performed using the SNP marker as described in claim 1, the primer set as described in claim 2, the detection reagent as described in claim 3 or 4, or the detection kit as described in claim 4.

6. The method according to claim 5, characterized in that, The identification of pineapple varieties can be used to verify the authenticity of pineapple hybrids YLL and MD2.

7. The method according to claim 6, characterized in that, If the genotype of the sample to be tested is homozygous, it is a pseudo-hybrid; if the genotype of the sample to be tested is heterozygous, it is a true hybrid.

Images