Application of GABRR1 as a tumor marker and a target molecule

By utilizing GABRR1 as a tumor marker and target molecule, targeted drugs were screened, solving the challenges in the diagnosis and treatment of dermatofibrosarcoma protuberans and achieving highly efficient tumor suppression and specific therapeutic effects.

CN121023015BActive Publication Date: 2026-05-26ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHEJIANG UNIV
Filing Date
2025-08-15
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing antitumor drugs are insufficient to effectively meet the diagnostic and treatment needs of dermatofibrosarcoma protuberans, especially in terms of local recurrence and distant metastasis, as there is a lack of highly effective and specific targets and drugs.

Method used

By using GABRR1 as a tumor marker and target molecule, monoclonal antibodies, peptides, or small molecule drugs can be screened to target GABRR1 protein or mRNA, thereby enabling the diagnosis and treatment of dermatofibrosarcoma protuberans, including CAR-T, CAR-DC therapy, and mRNA therapy.

Benefits of technology

GABRR1, as a tumor marker and target molecule, can effectively inhibit the invasion and metastasis of dermatofibrosarcoma protuberans, providing highly specific diagnostic and therapeutic effects, reducing side effects on normal cells, and improving treatment outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121023015B_ABST
    Figure CN121023015B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biomedicine and discloses the application of GABRR1 as a tumor marker and a target molecule. The present invention firstly discovers that GABRR1 serves as a marker for tumor invasion and metastasis and participates in the processes of tumor growth, invasion and metastasis. Therefore, GABRR1 can be used as a target in the diagnosis and / or treatment of tumors; the present invention uses the GABRR1 protein as a tumor target to screen tumor therapeutic drugs such as monoclonal antibodies, polypeptides or small molecule drugs that can overexpress GABRR1.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to the application of GABRR1 as a tumor marker and target molecule. Background Technology

[0002] Dermatofibrosarcoma protuberans (DFSP) is a rare, locally aggressive soft tissue sarcoma of the skin. Although the incidence of DFSP metastasis is low (<5%), the risk of local recurrence is high and closely related to the completeness of surgical excision. Distant metastasis (such as to the lungs, brain, or bones) is even rarer and usually occurs in patients who have experienced multiple local recurrences or incomplete excision. The distant metastasis rate of classic DFSP is approximately 1%, while the rate is higher in aggressive variants. According to data from the SEER database from 1992 to 2004, DFSP is the second most common soft tissue sarcoma of the skin after Kaposi's sarcoma.

[0003] DFSP presents with diverse clinical manifestations and is easily confused with other diseases. The risk of local recurrence in DFSP with simple resection (i.e., conservative margins) is as high as 50%, with an even higher recurrence rate when margins are positive. The rarity of DFSP and its frequent occurrence of delayed diagnosis further increases the likelihood of recurrence. Although locally recurrent tumors can usually be treated with reoperation, recurrent lesions tend to invade deeper into the fascia, muscles, or bones, leading to inadequate resection and potentially causing functional or cosmetic defects. Furthermore, patients with local recurrence have a relatively higher risk of distant metastasis. While DFSP responds to radiotherapy to some extent, it is not a substitute for surgical resection. Preoperative or postoperative radiotherapy can reduce the risk of local recurrence to some extent, but its effectiveness is limited. Although DFSP rarely leads to patient death, complications arising from local recurrence remain a significant concern. Most local recurrences occur within 3 years of treatment, but approximately 25%–30% of recurrences become apparent after 5 years. Therefore, DFSP patients require lifelong follow-up after treatment to detect and manage the risk of recurrence as early as possible.

[0004] The vast majority of dermatofibrosarcomas protuberans (DFSP) exhibit a characteristic chromosomal translocation, t(17;22), leading to persistent activation of the tyrosine kinase PDGF receptor β (PDGFRB). Imatinib, a targeted drug against PDGFRB, has shown some efficacy in advanced DFSP. However, the optimal duration and dosage of imatinib as neoadjuvant therapy remain inconclusive, and related phase II clinical trials are ongoing. Although some DFSP patients may benefit from imatinib treatment, overall, existing anti-tumor drugs still fall short of fully meeting clinical needs.

[0005] Targeted cancer therapy is a crucial strategy in cancer treatment, its core being the principle of "targeting"—efficiently and precisely targeting the cancer itself to achieve effective therapeutic results. Identifying highly effective and specific targets related to invasion and metastasis is key to targeted therapy. Currently, several therapeutic targets associated with tumor invasion and metastasis have been publicly reported. These targets play important roles in the process of tumor invasion and metastasis and have become the basis for novel drug design. However, existing anti-tumor invasion and metastasis drugs cannot fully meet clinical needs, and there is an urgent need to develop more antibody-based anti-tumor invasion and metastasis drugs.

[0006] Existing technology indicates that GABRR1 is a gene encoding the p1 subunit of the γ-aminobutyric acid (GABA) receptor, belonging to an atypical subtype of the GABA(A) receptor (GABA(A)R) family. GABA(A) receptors are receptors for GABA, a major inhibitory neurotransmitter in the central nervous system, and their mechanism of action primarily involves regulating the opening of Cl⁻ ion channels. However, compared to the classic GABA(A) receptor, the p1 subtype encoded by GABRR1 exhibits significant differences in pharmacological and functional properties. GABRR1 is highly expressed primarily in the retina, playing a crucial role in the regulation of visual signal transduction. Furthermore, GABRR1 is also distributed in other neuronal and non-neuronal tissues, such as the brain and spinal cord, participating in various physiological and pathological processes. However, there are currently no studies on the role of GABRR1 protein or its mRNA in tumor targeting. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention provides the application of GABRR1 as a tumor marker and target molecule. This invention is the first to discover that GABRR1 serves as a marker for the invasion and metastasis of dermatofibroma protuberans, participating in the tumor's growth, invasion, and metastasis processes. Therefore, GABRR1 can serve as a target in the diagnosis and / or treatment of dermatofibroma protuberans. Furthermore, this invention utilizes the GABRR1 protein as a tumor target screening tool to obtain tumor therapeutic drugs that can overexpress GABRR1, such as monoclonal antibodies, peptides, or small molecule drugs.

[0008] The specific technical solution of this invention is as follows:

[0009] In a first aspect, the present invention provides the application of GABRR1 as a tumor marker or tumor target molecule.

[0010] Based on existing research and clinical experience, an ideal tumor treatment target should generally meet the following conditions as much as possible: (1) Tumor-specific expression: high expression in tumor cells, while the expression level in normal cells is significantly low; (2) Suitable subcellular localization: the target is located on the cell membrane surface or other locations that are easy to bind to the drug, so that the drug can bind to it efficiently; (3) Selective anti-tumor effect: after entering the human body, the drug can selectively bind to the target, inhibit tumor growth or metastasis, while minimizing the impact on normal cells; (4) Low toxicity: even if the drug occasionally binds to a small number of targets in normal cells, it will not cause obvious side effects; (5) Moderate target content in serum: for targets located in tumor cells, their content in the serum of tumor patients should not be too high, so as to avoid non-specific diffusion of drug effects.

[0011] This invention, through its research, has for the first time discovered that GABRR1, as a marker of tumor invasion and metastasis, participates in the growth, invasion, and metastasis processes of tumors. Furthermore, this invention finds that GABRR1 meets the criteria for an ideal target (especially in dermatofibrosarcoma protuberans): (1) it is highly expressed in dermatofibrosarcoma protuberans tissue compared to normal skin tissue; (2) GABRR1 is expressed on the cell membrane surface, thus exerting its effect; (3) GABRR1 is highly expressed in dermatofibrosarcoma protuberans tumor tissue, while no high expression is observed in other normal cell populations, demonstrating its specificity; and (4) it has low toxicity. Therefore, GABRR1 can serve as a target in the diagnosis and / or treatment of tumors, used for screening drugs against tumor invasion and metastasis.

[0012] Furthermore, this invention has discovered that GABRR1 can not only serve as a potential target for tumor invasion and metastasis, but also as an independent prognostic biomarker. Studies have shown that GABRR1 is involved in the process of tumor invasion and metastasis, and inhibiting the function of this protein can effectively block tumor invasion and metastasis. This discovery opens up new directions for targeted cancer therapy.

[0013] Secondly, this invention provides the application of GABRR1 as a tumor marker or tumor target molecule in the preparation of tumor diagnostic products.

[0014] Thirdly, this invention provides the application of substances capable of quantitatively detecting GABRR1 in the preparation of tumor diagnostic products.

[0015] Preferably, the tumor diagnostic product is a tumor diagnostic kit.

[0016] Fourthly, this invention provides the application of GABRR1 as a tumor marker or tumor target molecule in the screening or preparation of tumor therapeutic drugs.

[0017] Based on the above findings, GABRR1, in the form of a cell membrane protein or mRNA, can be used as a tumor marker for screening drugs against tumor invasion and metastasis. By targeting GABRR1, specific antitumor drugs can be screened to inhibit tumor invasion and metastasis. Specific applications may include:

[0018] (1) Drug screening: Anti-tumor drugs are screened using GABRR1 protein as a tumor target. The screened drugs can be monoclonal antibodies, peptides, or small molecule drugs. In addition, therapeutic substances such as radionuclides can be conjugated to high-affinity targeted drugs, such as monoclonal antibodies against GABRR1 protein, to achieve therapeutic effects.

[0019] (2) Targeted therapy: Monoclonal antibodies based on the cell membrane GABRR1 protein are prepared for targeted therapy of tumors. Monoclonal antibodies with high specificity can be effectively used for the treatment of tumors.

[0020] (3) CAR-T and CAR-DC therapies: Chimeric antigen receptor T-cell (CAR-T) therapy and chimeric antigen receptor dendritic cell (CAR-DC) therapy are cell-based personalized technologies. Currently, this technology requires the removal of some of the patient's own white blood cells, including T cells and myeloid cells, for gene processing to generate special receptors for chimeric antigen receptors (CARs). This enables T cells / DCs to specifically recognize markers on the surface of cancer cells and target and eliminate tumor cells, thereby achieving the goal of precision cancer treatment.

[0021] (4) mRNA therapy: mRNA needs to be packaged in a vector to avoid degradation by nucleases and to be absorbed by the cell across the cell membrane. This involves using mRNA to express proteins with therapeutic effects or to degrade harmful proteins.

[0022] (5) Drug combination: A drug composition containing an anti-GABRR1 protein monoclonal antibody, which enhances the anti-tumor effect by combining with other therapeutic drugs, specifically in the following ways: (a) Reduced dosage requirements: The dosage of GABRR1 monoclonal antibody or other therapeutic drugs can be reduced while achieving the same therapeutic effect; (b) Synergistic effect: The combination of anti-GABRR1 protein monoclonal antibody with other therapeutic drugs can significantly enhance the tumor suppression effect.

[0023] Fifthly, the present invention provides the use of substances capable of overexpressing GABRR1 in the preparation of tumor therapeutic drugs.

[0024] Preferably, the tumor treatment drug is a monoclonal antibody against GABRR1 protein, a peptide or small molecule drug, siRNA / shRNA targeting GABRR1 mRNA, CAR-DC or CAR-T targeting GABRR1 protein.

[0025] Preferably, the tumor therapeutic agent includes a substance capable of overexpressing GABRR1 and a pharmaceutically acceptable carrier and / or excipient.

[0026] Preferably, the drug is administered via intravenous injection, subcutaneous injection, intradermal injection, or oral administration.

[0027] Preferably, the formulation of the drug includes injectable liquid dosage forms, semi-solid dosage forms, special dosage forms, and biological agents; wherein, injectable liquid dosage forms include liposome injections, microemulsion injections, and injections; semi-solid dosage forms include creams, gels, pastes, and patches; special dosage forms include sustained-release formulations, controlled-release formulations, transdermal patches, implants, microspheres, and nanoparticles; and biological agents include monoclonal antibody drugs, gene drugs, and cell therapy preparations.

[0028] Preferably, the tumor is a tumor that highly expresses the GABRR1 protein.

[0029] Further preferred, the tumor is a dermatofibroma protuberans.

[0030] Compared with the prior art, the beneficial effects of the present invention are:

[0031] This invention is the first to discover that GABRR1 can be used as a tumor marker for dermatofibroma protuberans, and therefore can be used as a target in the diagnosis and / or treatment of dermatofibroma protuberans. Attached Figure Description

[0032] Figure 1 To detect the mRNA expression of GABRR1 in dermatofibrosarcoma protuberans, normal skin tissue, and keloids using bulk-RNA seq sequencing.

[0033] Figure 2 To detect the mRNA expression of GABRR1 in normal skin, keloids, and dermatofibrosarcoma protuberans using in situ hybridization.

[0034] Figure 3 To detect the expression of GABRR1 mRNA in normal tissue, adjacent tumor tissue, and tumor tissue in dermatofibrosarcoma protuberans using in situ hybridization.

[0035] Figure 4 To detect the expression of GABRR1 protein in dermatofibrosarcoma protuberans tissue using immunohistochemistry with polyclonal antibodies.

[0036] Figure 5 To detect the distribution of GABRR1 expression in dermatofibrosarcoma protuberans tissue using GABRR1 protein polyclonal antibody immunofluorescence.

[0037] Figure 6 To detect the distribution of exogenously expressed GABRR1 in human primary skin fibroblasts using GABRR1 protein polyclonal antibody immunofluorescence.

[0038] Figure 7 This image shows the results of detecting specific cellular components in dermatofibrosarcoma protuberans using single-cell sequencing technology.

[0039] Figure 8 Flowchart for validating the sensitivity and specificity of GABRR1 as a novel tumor marker.

[0040] Figure 9 This is a diagram of the diagnostic scoring system in Example 6. Detailed Implementation

[0041] The present invention will be further described below with reference to embodiments.

[0042] General Implementation Examples

[0043] In a first aspect, the present invention provides the application of GABRR1 as a tumor marker or tumor target molecule.

[0044] Secondly, this invention provides the application of GABRR1 as a tumor marker or tumor target molecule in the preparation of tumor diagnostic products.

[0045] Thirdly, this invention provides the application of substances capable of quantitatively detecting GABRR1 in the preparation of tumor diagnostic products.

[0046] Preferably, the tumor diagnostic product is a tumor diagnostic kit. Only fresh, PFA-fixed, or fresh or frozen at -80°C or less is required. (1) Detection of the distribution of GABRR1 protein and mRNA in tissue sections (fresh or PFA-fixed skin tumor tissue). The expression of GABRR1 protein in tissue sections is detected by using a GABRR1 antibody (OriGene, TA323067); the mRNA level in tissue sections is located by using a human GABRR1 probe (Entrez gene ID: 2569, target region [base pairs (bp)]: 542 - 2266); (2) Quantitative detection of GABRR1 mRNA level in tumor tissue by qPCR (fresh or frozen at -80°C or less). The primer sequences for detecting GABRR1 mRNA include: 1. (forward primer) TGTGTTCGTGTTCCTCTCGG, (reverse primer) CATCCTGTCGGGCTTCTCTC. 2. (Forward primer) GTGTTCGTGTTCCTCTCGGT, (Reverse primer) AGCTGCACCATCATCCTGTC.

[0047] Fourthly, this invention provides the application of GABRR1 as a tumor target molecule in the screening or preparation of tumor therapeutic drugs.

[0048] Fifthly, the present invention provides the use of substances capable of overexpressing GABRR1 in the preparation of tumor therapeutic drugs.

[0049] Preferably, the tumor treatment drug is a monoclonal antibody against GABRR1 protein, a peptide or small molecule drug, siRNA / shRNA targeting GABRR1 mRNA, CAR-DC or CAR-T targeting GABRR1 protein.

[0050] Preferably, the tumor therapeutic agent includes a substance capable of overexpressing GABRR1 and a pharmaceutically acceptable carrier and / or excipient.

[0051] In some preferred embodiments, the route of administration of the drug is intravenous injection, subcutaneous injection, intradermal injection, or oral administration.

[0052] In some preferred embodiments, the formulation of the drug includes injectable liquid dosage forms, semi-solid dosage forms, special dosage forms, and biological agents; wherein, injectable liquid dosage forms include liposome injections, microemulsion injections, and injections; semi-solid dosage forms include creams, gels, pastes, and patches; special dosage forms include sustained-release formulations, controlled-release formulations, transdermal patches, implants, microspheres, and nanoparticles; and biological agents include monoclonal antibody drugs, gene therapy drugs, and cell therapy agents.

[0053] In some preferred embodiments, the tumor is a tumor that highly expresses the GABRR1 protein.

[0054] In some more preferred embodiments, the tumor is a dermatofibroma protuberans.

[0055] Specific embodiments and comparative examples

[0056] Example 1: Increased expression of GABRR1 mRNA and GABRR1 protein in tumor tissues

[0057] This example investigated the expression of GABRR1 mRNA and GABRR1 protein in dermatofibrosarcoma protuberans tissue. The specific steps are as follows:

[0058] (1) Tissue microarray preparation and processing: The tissue of dermatofibrosarcoma protuberans was prepared into a paraffin-embedded tissue microarray, and after sectioning, it was subjected to routine paraffin sectioning. After dewaxing with xylene, the sections were hydrated with alcohol in a stepwise gradient.

[0059] (2) Blocking endogenous peroxidase activity: The slices were treated with 3% hydrogen peroxide solution at room temperature for 10 minutes to block endogenous peroxidase activity.

[0060] (3) Antigen retrieval: The slides were placed in citrate buffer (0.01M, pH=6.0) and antigen retrieval was performed by microwave heating.

[0061] (4) Blocking non-specific binding sites: Block with 10% normal goat serum at room temperature for 30 minutes, then discard the blocking solution.

[0062] (5) Antibody incubation: Add 1 μg / mL rabbit polyclonal antibody against GABRR1 protein and incubate overnight at 4°C. Then wash three times with PBS for 5 minutes each time.

[0063] (6) Secondary antibody and signal amplification: Add biotin-labeled goat anti-rabbit secondary antibody at a ratio of 1:100, incubate at room temperature for 30 minutes, and then wash with PBS 3 times for 5 minutes each time. Then add HRP-labeled streptavidin and incubate at room temperature for 30 minutes.

[0064] (7) Color development and staining: After DAB color development, the sections were counterstained with hematoxylin, mounted and observed under a microscope.

[0065] (8) Results analysis: In dermatofibrosarcoma protuberans tissue, GABRR1 protein staining results showed that its expression was significantly higher than that in the corresponding normal tissue (e.g., Figure 4 (As shown in the image). This result indicates that the expression level of GABRR1 protein is significantly increased in dermatofibrosarcoma protuberans. This study provides valuable experimental evidence for the potential function of GABRR1 in tumor tissues.

[0066] Example 2: Bulk-RNA sequencing reveals elevated expression of GABRR1 mRNA in tumor tissues

[0067] This embodiment investigated the expression of GABRR1 gene mRNA in dermatofibrosarcoma protuberans tissue using Bulk-RNA sequencing. The results showed that its expression level was significantly higher than that in normal tissue and keloid tissue. The specific methods are as follows:

[0068] (1) Sample collection and preparation

[0069] (1.1) RNA extraction and detection:

[0070] Human skin tissue was immersed overnight in 0.5% Dispase solution at 4°C to separate the epidermis and dermis, and impurities such as culture medium and enzymes were removed as much as possible. Total RNA was extracted from the dermis using TRIZOL reagent, and RNA integrity was detected by agarose gel electrophoresis and Agilent 2100 Bioanalyzer.

[0071] (1.2) Library construction and quality control:

[0072] Total RNA was used as the starting material to construct a library using Illumina's NEBNext® Ultra™ RNA Library Prep Kit. After library preparation, quality was assessed using a Qubit 2.0 Fluorometer and an Agilent 2100 Bioanalyzer, and the effective concentration of the library was quantified by qRT-PCR to ensure library quality.

[0073] (1.3) Sequencing:

[0074] After the library passes quality control, it is sequenced using the Illumina sequencing platform. During sequencing, the instrument captures fluorescence signals and converts these signals into sequencing peaks using computer software, thereby obtaining the sequence information of the fragment to be sequenced.

[0075] (2) RNA-seq data analysis

[0076] (2.1) Data quality control:

[0077] Image data generated from high-throughput sequencing is converted into FASTQ format reads using CASAVA software, containing sequence information and sequencing quality data of the sequencing fragments. Low-quality data is then cleaned to generate high-quality Clean Data for subsequent analysis.

[0078] (2.2) Sequence alignment:

[0079] Download reference genomes and gene annotation files from public databases, construct a reference genome index using HISAT2 (v2.0.5), and align Clean Reads to the reference genome.

[0080] (2.3) Quantitative analysis of gene expression levels:

[0081] The featureCounts function was used to calculate the readings for each gene, and the FPKM (million-mapped readings per kilobase transcript) was calculated in conjunction with the gene length. The results were used to measure gene expression levels.

[0082] (2.4) Differential expression analysis:

[0083] The DESeq2 software (v1.16.1) was used to analyze gene expression differences among different samples. DESeq2 is based on a negative binomial distribution model, and the adjusted p-value was calculated. A p-value < 0.05 and |log2FoldChange| > 1.5 were used as thresholds for significant differential expression. Significantly differentially expressed genes included those that were significantly upregulated and those that were significantly downregulated.

[0084] (3) Results analysis:

[0085] Figure 1 Bulk-RNA sequencing results were presented for dermal tissues of dermatofibrosarcoma protuberans, normal individuals, and keloids, showing that the expression level of GABRR1 gene mRNA was significantly increased in dermatofibrosarcoma protuberans tissues.

[0086] Example 3: RNA fluorescence in situ hybridization (RNAscope) revealed high expression of GABRR1 mRNA in tumor tissue and clear tumor boundary definition.

[0087] This embodiment uses RNAscope multichannel second-generation fluorescence in situ hybridization technology to study the expression of GABRR1 mRNA in dermatofibrosarcoma protuberans and analyze its distribution characteristics in tumor tissue. The results show that GABRR1 mRNA is highly expressed in dermatofibrosarcoma protuberans and can define the tumor boundary. The specific process is as follows:

[0088] (1) Sample preparation and processing

[0089] (1.1) Sample fixation and section preparation: Immediately after collection, the samples were immersed in 4% PFA solution and fixed at 4°C for 24 hours. The samples were then paraffin-embedded using standard procedures. The embedded tissue was then sectioned into 4 μm sections using a microtome.

[0090] (1.2) Paraffin embedding and sectioning: After embedding according to standard procedure, the sections were placed in a 45°C water bath to retrieve them and attached to a glass slide. After air drying at room temperature overnight, the sections were baked at 60°C for 1 hour.

[0091] (1.3) Dewaxing of slides: In a fume hood, treat the slides with xylene and 100% ethanol to ensure complete dewaxing, and then dry the slides for later use.

[0092] (2) RNAscope detection process

[0093] (2.1) Pretreatment: The slides were pretreated using RNAscope® target repair reagent. RNAscope hydrogen peroxide was added to cover the sample, and the slides were incubated at room temperature for 10 minutes, followed by washing with ultrapure water.

[0094] (2.2) Preparation of hydrophobic rings: Draw hydrophobic rings around the slices using a hydrophobic pen, and carry out subsequent experiments after drying.

[0095] (2.3) Protease treatment: Add RNAscope protease Plus reagent to cover the slice and incubate at 40°C for the specified time.

[0096] (2.4) C1 probe hybridization: RNAscope probe C1 was dropped onto the slide and incubated at 40°C for 2 hours. Then, fluorescence amplification steps were performed in sequence, including Amp 1, Amp 2, Amp 3 treatment and HRP-C1 staining. Each step was incubated at 40°C for the specified time and washed with buffer.

[0097] (2.5) Fluorescence counterstaining and mounting: Counterstain sections with DAPI, incubate at room temperature for 30 seconds, wash, add anti-fluorescence quenching mounting medium, cover with coverslip and fix. After completion, store the slides in the dark.

[0098] (3) Results Analysis

[0099] (3.1) Expression distribution of GABRR1 mRNA: as shown Figure 2 As shown, compared with normal tissue and keloid tissue, dermatofibrosarcoma protuberans tissue exhibits diffuse punctate GABRR1 mRNA signals, confirming its high-level expression in tumor tissue.

[0100] (3.2) Delineation of tumor boundaries: Figure 3 The study presented tissue sections from the same patient. GABRR1 mRNA signaling was not observed in the epidermis, but was diffusely distributed throughout the tumor tissue, clearly defining tumor boundaries. This finding provides evidence for the potential application of GABRR1 in tumor boundary marking.

[0101] Example 4: Immunohistochemistry reveals high expression of GABRR1 protein in dermatofibrosarcoma protuberans.

[0102] This embodiment used immunohistochemistry to detect the expression level of GABRR1 protein in dermatofibrosarcoma protuberans tissue. The results showed that it exhibited significant diffuse high expression in the tumor tissue. The specific process is as follows:

[0103] (1) Cell fixation and permeabilization treatment: After washing with PBS, the cells were treated with PBS solution containing 0.3% Triton-X100 for 3 minutes to increase cell membrane permeability. The cells were then washed with PBS again.

[0104] (2) Blocking non-specific binding sites: Incubate cells with 10% goat blocking serum at room temperature for 60 minutes to block non-specific antibody binding sites.

[0105] (3) Primary antibody incubation: Add a specific primary antibody against GABRR1 (OriGene, TA323067, concentration 1:400) and incubate overnight at 4°C. Afterward, wash the cells three times with PBS.

[0106] (4) Secondary antibody incubation: Add polymerized HRP-labeled anti-rabbit IgG, incubate at room temperature and bind to target protein.

[0107] (5) Staining and counterstaining: DAB high-sensitivity substrate chromogenic agent was used for staining, followed by hematoxylin counterstaining to observe the cell nuclear structure.

[0108] (6) Rinsing and mounting: After staining, rinse the sample in clean water for 15 minutes, and then dehydrate it through an alcohol gradient. Finally, mount the sample in a fume hood with neutral resin and let it air dry before storing it in a slide box for later use.

[0109] Figure 4 The results showed that, compared with normal dermal tissue and keloid dermal tissue, the expression of GABRR1 protein was significantly enhanced in the dermal tissue of dermatofibrosarcoma protuberans, exhibiting a diffuse distribution. This indicates that the expression level of GABRR1 protein in dermatofibrosarcoma protuberans is significantly higher than in other tissues.

[0110] Example 5:

[0111] Single-cell sequencing technology revealed that tumor cells in dermatofibrosarcoma protuberans specifically highly express PENK, FAM150B, and GABRR1. The single-cell sequencing workflow is as follows:

[0112] 1. Sample preparation

[0113] (1) Tissue collection: Skin from the tumor area of ​​dermatofibrosarcoma protuberans, skin from the tumor area of ​​keloid scars, and normal skin were collected and soaked overnight in 0.5% Dispase solution at 4°C. The epidermis and dermis were then separated. The dermis was digested into a single-cell suspension using collagenase IV reagent, and the cell viability had to be higher than 80%.

[0114] 2. Single-cell sequencing

[0115] (1) Single-cell capture and library construction: Single-cell suspensions were loaded into the 10x GenomicsChromium™ single-cell isolation system. Individual cells were encapsulated in water-in-oil microdroplets, along with transcriptome capture beads containing unique molecular identifiers (UMIs). The captured mRNA was reverse transcribed to generate cDNA, which was then amplified by PCR. Finally, the cDNA was fragmented, adapters were added, and a library was constructed for high-throughput sequencing.

[0116] (2) High-throughput sequencing: Sequencing was performed using the NovaSeq PE150 sequencing strategy. The raw image files obtained from high-throughput sequencing were converted into sequencing reads by CASAVA base recognition and stored in FASTQ format.

[0117] 3. Data Analysis

[0118] (1) Data preprocessing: Cell Ranger aligns the previously generated FastQ sequencing data to the reference genome to perform cell and UMI counting, generating a cell-gene expression matrix. Filtering low-quality cells: Cells with excessively low or high transcript counts (e.g., less than 200 or more than 2500 genes) and cells with excessively high mitochondrial gene expression (e.g., >10%) are removed, indicating that they may be dead cells or fragments.

[0119] (2) Cluster analysis: Seurat was used to analyze the gene expression matrix:

[0120] 1. Normalization: Normalize gene expression in each cell and correct for differences in sequencing depth.

[0121] 2. Dimensionality reduction analysis: t-SNE / UMAP: Reduces high-dimensional data to 2D or 3D for visualization.

[0122] 3. Clustering: Cluster the cell population using K-means or graph-based clustering methods.

[0123] 4. Cell type labeling: Based on the differentially expressed genes in each cluster, cell populations are labeled by comparing them with known cell marker genes.

[0124] (3) Differential expression analysis: FindMarkers was used to identify differentially expressed genes.

[0125] (4) Cellular component analysis: Based on the clustering results, the proportions of various cell types were calculated, and the differences in cellular components in dermatofibrosarcoma protuberans were compared. Furthermore, as... Figure 7 As shown, t-SNE plots are used to display the cell clustering and cell type labeling results. Figure 7 The cell population circled in red dotted circle is specific to dermatofibrosarcoma protuberans and specifically expresses PENK, FAM150B, and GABRR1.

[0126] Example 6: Sensitivity and Specificity Validation

[0127] Currently, the diagnosis of dermatofibrosarcoma protuberans (DFSP) primarily relies on H&E staining or immunohistochemistry, heavily depending on the pathologist's experience and expertise, especially in cases where DFSP is suspected but not yet definitively diagnosed, or when histological features are atypical or clinically abnormal. In such cases, because most patients exhibit genomic rearrangements such as t(17;22) translocations, COL1A1 / PDGFB fusion gene testing can provide crucial information for clinical diagnosis (Naeem R, Lux ML, Huang SF, Naber SP, Corson JM, Fletcher JA. Ring chromosomes indermatofibrosarcoma protuberans are composed of interspersed sequences from chromosomes 17 and 22. Am J Pathol 1995;147:1553-8.). However, many patients still lack these typical molecular diagnostic features, leading to potential misdiagnosis and challenges in clinical decision-making. Therefore, more effective diagnostic methods are needed to ensure accurate diagnosis and prevent overtreatment or undertreatment.

[0128] Therefore, this invention validated the novel tumor marker GABRR1, and the specific validation process is as follows: Figure 8 As shown. Specifically, in this multicenter diagnostic accuracy study, the present invention employed a single-arm fully paired design. We included 90 DFSP samples (diagnosed by pathologists) to ensure the validity of our results. All patients were diagnosed with DFSP and the corresponding pathological sections were examined by experienced dermatologists. The overall workflow is outlined as follows: Figure 8 As shown. For specificity analysis, we included 40 control cases: 17 healthy controls, 13 keloids, 8 benign dermal fibromas, 1 pleomorphic sarcoma, 1 myofibroma, 1 low-grade malignant fibroblastoma, 1 superficial CD34-positive fibroblastoma, and 1 atypical xanthoma. To evaluate the efficacy of GABRR1 testing for surgical margin clearance, we also included paraffin sections from 16 DFSP surgeries with negative margins.

[0129] Table 1: Clinical and demographic characteristics of 90 cases of dermatofibrosarcoma protuberans

[0130]

[0131] Table 1 lists the basic clinical characteristics of 90 DFSP samples. All 90 DFSP patients were diagnosed by experienced pathologists using H&E staining or immunohistochemistry (IHC). Of these, 46 / 90 (51.11%) were male and 44 / 90 (48.89%) were female. The median age was 35.50 years (range: 30.75–45.00 years). The most common site of occurrence was the abdomen (16 / 90, 17.78%), followed by the shoulder (12 / 90, 13.33%). The axilla, groin, and scalp were the least affected sites, with an incidence of only 2.22%. Postoperative recurrence occurred in 6 of the 90 patients.

[0132] Table 2: Results of COL1A1 / PDGFB fusion gene detection and GABRR1 mRNA detection

[0133]

[0134] Table 2 summarizes the number of GABRR1 mRNA tests. Among samples diagnosed as DFSP by experienced pathologists, 84 were positive for GABRR1 mRNA and 6 were negative. 63 were positive for the COL1A1 / PDGFB fusion gene and 27 were negative. For non-DFSP cases, both GABRR1 and COL1A1 / PDGFB fusion gene tests were negative.

[0135] Table 3: Comparison of different diagnostic methods

[0136]

[0137] Note: CI is the confidence interval.

[0138] The results of diagnostic performance metrics, including sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV), are shown in Table 3. The GABRR1 mRNA assay and the COL1A1 / PDGFB fusion gene assay showed the same specificity (100%). The GABRR1 mRNA assay had higher sensitivity, at 93.3% (95% CI: 88.2%–98.5%), while the COL1A1 / PDGFB fusion gene assay had a sensitivity of 70.0% (95% CI: 60.5%–79.5%). Both assays showed the same PPV, but the NPV of the GABRR1 mRNA assay (87.0%, 95% CI: 77.2%–96.7%) was significantly higher than that of the COL1A1 / PDGFB fusion gene assay (59.7%, 95% CI: 48.0%–71.4%).

[0139] To assess the accumulation of GABRR1 mRNA in DFSP tumor regions, we established a five-layer semi-quantitative scoring system. Using 40x magnified images of paraffin sections, scores were assigned according to predefined criteria, with each sample receiving the highest applicable score (e.g., ...). Figure 9 (As shown). Of the 90 DFSP samples analyzed, 6 (6.67%) were scored 0, indicating that less than 10% of the tumor cells each expressed at least one GABRR1 mRNA signal. 7 (7.78%) scored 1. Most samples showed moderate to high accumulation of GABRR1 mRNA signal. 40 samples (44.44%) scored 2, 19 (21.11%) scored 3, and 18 (20.00%) reached the highest expression level. The scoring system is helpful for assessing tumor boundaries, evaluating surgical margins, and diagnosing DFSP.

[0140] In summary, the experimental data provided above demonstrate that GABRR1 is indeed a tumor marker with high sensitivity and specificity (especially for DFSP).

[0141] Example 7: Preparation of tumor antigens

[0142] like Figure 6 As shown:

[0143] 1. The cDNA coding sequence of the GABRR1 gene was cloned, constructed on the expression vector pcDNA3.1(+), and the puromycin resistance gene was inserted to obtain the GABRR1 target plasmid.

[0144] 2. Plasmid extraction and concentration determination: Packaging plasmid (psPAX2) and envelope plasmid (pMD2.G) were extracted using an endotoxin-free plasmid extraction kit.

[0145] 3. Cell culture and passage: After Hek293T cells were cultured to about 90% confluence, they were passaged and transfected during the process.

[0146] 4. Mixing plasmids and transfection reagents: Dissolve 10 μg of packaging plasmid (psPAX2), 5 μg of envelope plasmid (pMD2.G), and 10 μg of transfer plasmid (carrying the target gene GABRR1) in 1 ml of serum-free, antibiotic-free Opti-MEM medium and mix gently. Add 25 μl of Roche X-tremeGENE HP DNA transfection reagent to the plasmid solution at a ratio of 1 μg DNA to 1 μl, mix well, and incubate at room temperature for 20 minutes.

[0147] 5. Transfection procedure: 6 ml of 10% FBS-DMEM high-glucose medium was added to Hek293T cells cultured in 10 cm culture dishes. 1 ml of the transfection complex was added dropwise to the culture dish and gently mixed using a cross-hatching motion. The mixture was then incubated at 37°C in 5% CO2.

[0148] 6. Incubate for 72 hours and collect the viral supernatant.

[0149] 7. Virus concentration: After filtering the supernatant through a 0.45 μm microporous membrane, add a Millipore UFC905096 ultrafiltration tube and centrifuge at 4000×g until concentrated to about 500 μl.

[0150] 8. Dispensing and storage: Transfer the concentrated virus solution to a 1.5 ml EP tube, mix well, and store at -80℃.

[0151] 9. Cell inoculation: Viral titer was estimated by flow cytometry using the infection efficiency of Hek293T cells and the number of cells inoculated (assuming MOI=1).

[0152] 10. Human fibroblast plating: Plating 24 hours in advance to ensure a cell density of approximately 70% at the time of infection.

[0153] 11. Based on the target MOI value of the cells, add the virus to 250 μl of serum-containing complete culture medium and mix well. Dilute Polybrene to the working concentration (10 μg / ml), mix it into 250 μl of serum-containing complete culture medium, and gently mix.

[0154] 12. Mix the virus solution with the polybrene solution, add it to the cell culture wells, and infect the cells.

[0155] 13. Replace with fresh serum-containing complete culture medium 24 hours after infection.

[0156] 14. Observe the infection effect after 72 hours and conduct subsequent expression identification or drug screening.

[0157] 15. Untransfected cells were seeded into 24-well plates. A puromycin concentration gradient was set up at 0 µg / mL, 0.1 µg / mL, 0.2 µg / mL, 0.5 µg / mL, 1.0 µg / mL, 1.5 µg / mL, 2.0 µg / mL, 2.5 µg / mL, 3.0 µg / mL, 3.5 µg / mL, 4.0 µg / mL, 4.5 µg / mL, and 5.0 µg / mL. Cell viability was observed daily to determine the minimum drug concentration required for 100% cell death within 72 hours. The final selection concentration was determined to be 2 µg / mL.

[0158] 16. Add 2.0 µg / mL puromycin to the transfected cells. Selection continues for approximately 6 days, during which the culture medium containing puromycin is replaced to remove untransfected cells or cells that have not integrated the resistance gene. Cells that survive the drug selection are positive cells that successfully overexpress GABRR1.

[0159] The constructed overexpression sequence is shown in SEQ ID NO:1, as follows:

[0160]

Claims

1. The application of a substance capable of quantitatively detecting GABRR1 mRNA levels in the preparation of tumor diagnostic products, characterized by: The tumor is a dermatofibroma protuberans.

2. The application according to claim 1, characterized in that: The substance capable of quantitatively detecting GABRR1 mRNA levels includes: The forward primer has the nucleotide sequence TGTGTTCGTGTTCCTCTCGG; The reverse primer has the following nucleotide sequence: CATCCTGTCGGGCTTCTCTC.

3. The application according to claim 1, characterized in that: The substance capable of quantitatively detecting GABRR1 mRNA levels includes: The forward primer has the nucleotide sequence GTGTTCGTGTTCCTCTCGGT; The reverse primer has the nucleotide sequence AGCTGCACCATCATCCTGTC.

4. The application according to claim 1, characterized in that: The tumor diagnostic product is a reagent kit.

5. The application according to claim 4, characterized in that: The substance capable of quantitatively detecting GABRR1 mRNA levels includes: The forward primer has the nucleotide sequence TGTGTTCGTGTTCCTCTCGG; The reverse primer has the following nucleotide sequence: CATCCTGTCGGGCTTCTCTC.

6. The application according to claim 4, characterized in that: The substance capable of quantitatively detecting GABRR1 mRNA levels includes: The forward primer has the nucleotide sequence GTGTTCGTGTTCCTCTCGGT; The reverse primer has the nucleotide sequence AGCTGCACCATCATCCTGTC.

Citation Information

Patent Citations

  • Use of microvesicles in diagnosis, prognosis and treatment of medical diseases and conditions

    CN102084000A

  • Methods of diagnosis of cancer, compositions and methods of screening for modulators of cancer

    EP1497454A2