Monoclonal antibody DIDA55 aiming at hog cholera virus as well as preparation method and application thereof
By developing the monoclonal antibody DIVA55 and its antigen-binding fragment, the problem of lack of specificity and sensitivity in existing classical swine fever vaccines has been solved, enabling efficient identification and detection of classical swine fever virus E2 protein, and supporting rapid, simple large-scale sample testing and disease eradication.
Patent Information
- Application Number
- CN202511562833.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-30
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2045-10-30
AI Technical Summary
The lack of specific and highly sensitive serological diagnostic kits for differentiating between existing classical swine fever (CSF) attenuated live vaccine and E2 protein subunit vaccine, as well as CSFV wild-type strain infection, makes it difficult to achieve CSFV eradication.
A monoclonal antibody, DIVA55, and its antigen-binding fragment, containing specific amino acid sequences of the light and heavy chain variable regions, were developed for use in the preparation of kits to distinguish between classical swine fever E2 protein-labeled subunit vaccination and wild-type virus infection. The antibody was expressed and purified in different host cells using genetic engineering techniques.
It achieves specific identification and sensitivity detection of the E2 protein of classical swine fever virus, enabling rapid and convenient large-scale sample testing with high sensitivity and specificity, supporting serological identification of CSFV immunity and infection and disease eradication.
Smart Images

Figure CN121064321A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a monoclonal antibody DIVA55 against porcine fever virus, its preparation method and application in the field of medical preparations. BACKGROUND
[0002] Classical swine fever (CSF) is one of the major animal diseases of pigs caused by classical swine fever virus (CSFV) infection, with high morbidity and mortality. The disease seriously threatens the healthy development of the pig industry and is listed as one of the animal diseases that must be reported by the World Organization for Animal Health and as a class II infectious disease by China's animal health regulations. Therefore, the prevention and purification of CSF is the key to improving the core competitiveness of pig breeding enterprises. Currently, the marketed CSF rabbitized attenuated vaccine (C strain) and E2 protein subunit vaccine do not have a specific and sensitive serological differential diagnosis kit for distinguishing between vaccination and CSFV wild strain infection, which is a major obstacle to the realization of CSF purification. SUMMARY
[0003] The main problem to be solved by the present application is how to distinguish between E2 protein subunit vaccine vaccination and CSFV wild strain infection to achieve serological differential diagnosis and purification of CSFV.
[0004] To solve the above problems, the present application provides an antibody.
[0005] The antibody provided by the present application is a monoclonal antibody or an antigen binding fragment thereof, which comprises a heavy chain variable region and a light chain variable region; the amino acid sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region of the antibody are sequentially shown in SEQ ID No: 4 24-34, 50-56, 89-97, and the LCDR1, LCDR2 and LCDR3 are complementarity determining regions; the amino acid sequences of HCDR1, HCDR2 and HCDR3 in the heavy chain variable region of the antibody are sequentially shown in SEQ ID No: 5 31-35, 50-65, 95-102; and the HCDR1, HCDR2 and HCDR3 are complementarity determining regions.
[0006] In the present invention, "antigen-binding fragment" refers to an antigen-binding fragment of an antibody, which generally includes at least a part of the antigen-binding region or variable region (e.g., one or more CDRs) of a parental antibody. The antigen-binding fragment retains at least some of the binding specificity of the parental antibody. Generally, the antigen-binding fragment retains at least 10% of the binding activity of the parental antibody, when activity is expressed on a molar basis. Specifically, the antigen-binding fragment retains at least 20%, 50%, 70%, 80%, 90%, 95%, or 100% or more of the binding affinity of the parental antibody to the target.
[0007] The antigen-binding fragment can be a whole antibody, a fusion antibody, an antibody drug conjugate, a Fab fragment, a Fv fragment, a Fab' fragment, a F(ab')2 fragment, a single chain antibody (ScFv), or a minimum recognition unit (MRU) containing the nanobody.
[0008] In the present invention, "Fab fragment" is a heterodimer that consists of a heavy chain Fd and a complete light chain, which are bound by disulfide bonds, and contains only one antigen-binding site. The heavy chain Fd refers to about 1 / 2 of the H chain portion in Fab (about 225 amino acid residues, including VH, CH1, and part of the hinge region).
[0009] In the present invention, "Fv fragment" refers to a vector containing VH and VL genes, respectively, which are co-transfected into cells to be expressed separately, and then assembled into a functional Fv antibody; or a stop codon is provided between VH and VL in the vector, two small protein fragments are expressed separately, and then combined by non-covalent bonds to form an Fv antibody (Fv fragment).
[0010] In the present invention, "Fab' fragment" contains one light chain and a part of one heavy chain containing a VH domain and a CH1 domain, and a region between CH1 and CH2 domains, so that an interchain disulfide bond can be formed between the two heavy chains of two Fab' fragments to form a F(ab')2 molecule.
[0011] In the present invention, "F(ab')2 fragment" contains two light chains and two heavy chains containing a part of the constant region between CH1 and CH2 domains, so that an interchain disulfide bond is formed between the two heavy chains. Therefore, the F(ab')2 fragment is composed of two Fab' fragments held together by a disulfide bond between the two heavy chains.
[0012] In the present invention, "single chain antibody (ScFv)" refers to a polypeptide obtained by linking a light chain variable region and a heavy chain variable region. The polypeptide can spontaneously fold into a native conformation, retaining the specificity and affinity of Fv.
[0013] In the present application, the light chain variable region (VL) or the heavy chain variable region (VH) of the antibody is composed of "framework" regions separated by three "complementarity determining regions" or "CDRs". The framework regions serve to align the CDRs that specifically bind to the epitope of the antigen. The CDRs include the amino acid residues in the antibody that are primarily responsible for antigen binding. Both the VL domain and the VH domain comprise the following framework regions (FRs) and CDR regions from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The CDR1, CDR2, and CDR3 of the VL domain are also referred to herein as LCDR1, LCDR2, and LCDR3, respectively; and the CDR1, CDR2, and CDR3 of the VH domain are also referred to herein as HCDR1, HCDR2, and HCDR3, respectively.
[0014] In the above antibody, the heavy chain type of the antibody is IgG2b; and / or the light chain type of the antibody is kappa.
[0015] The CDRs in the above antibody are sequences defined according to the Kabat numbering system.
[0016] Further, the amino acid sequence of the light chain variable region of the antibody is SEQ ID No: 4; and / or the amino acid sequence of the heavy chain variable region of the antibody is SEQ ID No: 5.
[0017] Further, the monoclonal antibody or antigen-binding fragment thereof can further comprise a heavy chain constant region (CH) and a light chain constant region (CL). The heavy chain constant region can be selected from the heavy chain constant regions of IgG, IgA, IgM, IgD, and IgE. The heavy chain constant region can also be selected from the CH1, Fc, and CH3 domains. The light chain constant region can be selected from the kappa (κ) and lambda (λ) type light chain constant regions. The heavy chain constant region and the light chain constant region can be derived from a human or a non-human mammal (such as a mouse, a rat, a guinea pig, a rabbit, a sheep, a camel, etc.).
[0018] Further, the heavy chain constant region can be the heavy chain constant region of mouse IgG2a.
[0019] Further, the light chain constant region can be the kappa (κ) type light chain constant region of a mouse.
[0020] Further, the nucleotide sequence of the heavy chain constant region can be as shown in SEQ ID No: 11.
[0021] Further, the nucleotide sequence of the light chain constant region can be as shown in SEQ ID No: 12.
[0022] The present application also provides a biological material, which is any one of the following: A1) a nucleic acid molecule encoding the heavy chain variable region and the light chain variable region of the monoclonal antibody or antigen-binding fragment thereof described above; A2) an expression cassette containing the nucleic acid molecule of A1); A3) a recombinant vector containing the nucleic acid molecule of A1); A4) a recombinant microorganism containing the nucleic acid molecule of A1); A5) a recombinant host cell containing the nucleic acid molecule of A1).
[0023] Further, in the nucleic acid molecule of (A1), the nucleotide sequences encoding LCDR1, LCDR2 and LCDR3 of the light chain variable region of the antibody are as shown in SEQ ID No: 9, in order, from 70 to 102, 148 to 168, and 265 to 291. and / or In the nucleic acid molecule of (A1), the nucleotide sequences encoding HCDR1, HCDR2 and HCDR3 of the heavy chain variable region of the antibody are as shown in SEQ ID No: 10, in order, from 91 to 105, 148 to 198, and 295 to 330.
[0024] Further, the DNA molecule shown in SEQ ID No: 10 encodes the heavy chain variable region of the amino acid sequence of SEQ ID No: 5. The DNA molecule shown in SEQ ID No: 9 encodes the light chain variable region of the amino acid sequence of SEQ ID No: 4.
[0025] Further, the vector can be selected from a prokaryotic expression vector (including, but not limited to, E. coli (such as BL21, M15, Top10 and Origami expression cells) expression vectors) and a eukaryotic expression vector (including, but not limited to, yeast (such as X33 cells, GS115 cells and SMD1168 cells) expression vectors, insect cells (such as Sf21 cells, Sf-9 cells and Hi-5 cells) expression vectors, and mammalian cells (such as HET293 cells and CHO cells) expression vectors).
[0026] The antibody is monoclonal antibody DIVA55.
[0027] The present application also provides a kit for identifying antibody detection of swine fever E2 protein marker subunit vaccination and wild strain infection, which comprises the antibody or antigen-binding fragment thereof described above.
[0028] The detection sample of the kit can be an environmental sample, a blood sample (such as whole blood, plasma, serum), a sputum sample, a tissue sample, a cell sample, a fecal sample, etc., but is not limited thereto.
[0029] Further, the environmental sample can include a feed mill environmental sample (such as a silo, a conveyor belt, a workbench, a ground, etc.), a breeding environmental sample (such as sludge, breeding feed, soil, a feeding trough, a cloth for wiping the environment, a swab, breeding water, air, etc.), and a surrounding environmental sample (such as a transport vehicle, a surrounding farmland, etc.).
[0030] The kit can be a chemiluminescence immunoassay kit, an enzyme-linked immunoassay kit, an immunoprecipitation assay kit, an immunoblotting assay kit, an immunochromatography assay kit, a flow cytometry assay kit, an immunohistochemistry assay kit, a colloidal gold immunoassay kit, or a fluorescent immunoassay kit, but is not limited thereto.
[0031] Further, the kit can further include reagents required for immunodetection, such as a labeled antibody or antigen, magnetic particles, a blocking solution, a dilution solution, a washing solution, a color developing solution, a termination solution, etc., but is not limited thereto.
[0032] The various reagent components of the kit can be present in separate containers, or can be pre-combined, in whole or in part, into a reagent mixture.
[0033] The components of the kit can be provided in solution, for example, in the form of an aqueous solution. In the case of being present in the form of an aqueous solution, the concentration or content of these components can be readily determined by one skilled in the art according to different needs. For example, for the purpose of storage, the components can be present in a higher concentration, and when in a working state or in use, the concentration can be reduced to a working concentration by diluting the above-mentioned solution of higher concentration.
[0034] The kit can further comprise, for example, a buffer, a preservative, or a protein stabilizer. The kit can further comprise components necessary for detecting a detectable label, such as an enzyme or a substrate. The kit can also contain a control sample or a series of control samples, which can be measured and compared with the test sample. The kit can comprise written material on or in the kit container. The written material describes how to use the reagents contained in the kit.
[0035] In a specific embodiment, the kit is a blocking ELISA kit, and the detection mode when using the kit is serological detection.
[0036] The porcine fever virus can be a CSFV wild strain of each genotype and a porcine fever rabbitized attenuated vaccine C strain (HCLV).
[0037] The present application also provides an antibody conjugate, comprising an antibody portion and a conjugate portion, the antibody portion being a monoclonal antibody or an antigen binding fragment thereof as described above, and the conjugate portion being a detectable label.
[0038] Further, the antibody moiety and the conjugated moiety can be directly linked, or covalently linked through a linker (e.g. a hydrazone bond, a disulfide bond, a thioether bond, a peptide bond).
[0039] Further, the detectable label includes, but is not limited to, an enzyme (e.g. horseradish peroxidase (HRP), alkaline phosphatase (AP), β-galactosidase, etc.), a chemiluminescent reagent (e.g. acridinium ester compounds, acridinium sulfonamide compounds, luminol and its derivatives, ruthenium derivatives, etc.), a fluorescent dye (e.g. AMCA, FITC, CFSE, GFP, DAPI, 7-AAD, Hoechst 33342, Pacific Blue, PE, PE-TR, PE-Cy7, PE-Cy5, PI, PerCP-Cy5.5, APC, APC-CY7, APC-H7, V500, Alexa 700, BV605, BV480, BV785, BV510, BV711, BV421, etc.), a near-infrared dye (e.g. cyanine dyes, BODIPY, rhodamine, squarine, porphyrin dyes, etc.), a radionuclide (e.g. 125I, 18F, 11C, 99mTc, 123I, etc.), biotin, a magnetic resonance imaging nanoparticle, a magnetic resonance imaging quantum dot, a magnetic substance (e.g. magnetic beads, gadolinium-containing complex nanoparticles, superparamagnetic iron oxide nanoparticles), and colloidal gold, etc.
[0040] As known by those skilled in the art, the conjugate and fusion antibody expression product includes a conjugate formed by combining a drug, a toxin, a cytokine, a radionuclide, an enzyme, and other diagnostic or therapeutic molecules with the antibody or fragment thereof of the present application. The present application also includes a cell surface marker or antigen combined with the monoclonal antibody or fragment thereof.
[0041] The antigen of the present application is a porcine fever virus E2 protein. The amino acid sequence of the E2 protein is GenBank: AY526732, position 1171-2259, updated on July 26, 2016.
[0042] The antibody conjugate can be an HRP-DIVA55 conjugated antibody.
[0043] The present application also provides the use of the antibody described above in any one of the following: (B1) preparing a product for recognizing or assisting in recognizing a porcine fever virus E2 protein; (B2) preparing a product for binding or assisting in binding a porcine fever virus E2 protein; (B3) detecting or assisting in detecting whether a sample to be tested contains a porcine fever virus E2 protein; (B4) preparing a product for detecting or assisting in detecting whether a sample to be tested contains a porcine fever virus E2 protein; (B5) preparing a product for serologically differentiating between immunization with a marker subunit vaccine of E2 protein of swine fever virus and infection with a wild strain; (B6) preparing a product for differentiating between diseases caused by immunization with a marker vaccine strain of E2 of swine fever virus and infection with a wild strain; (B7) detecting or assisting in detecting the content of E2 protein of swine fever virus in a sample to be tested; (B8) detecting or assisting in detecting the content of antibody of E2 protein of swine fever virus in a sample to be tested; (B9) preparing a product for detecting or assisting in detecting the content of E2 protein of swine fever virus in a sample to be tested; (B10) preparing a product for detecting or assisting in detecting the content of antibody of E2 protein of swine fever virus in a sample to be tested.
[0044] The present application also provides the use of the biological material as described above in any one of the following: (B1) preparing a product for recognizing or assisting in recognizing E2 protein of swine fever virus; (B2) preparing a product for binding or assisting in binding E2 protein of swine fever virus; (B3) detecting or assisting in detecting whether a sample to be tested contains E2 protein of swine fever virus; (B4) preparing a product for detecting or assisting in detecting whether a sample to be tested contains E2 of swine fever virus; (B5) preparing a product for serologically differentiating between immunization with a marker subunit vaccine of E2 protein of swine fever virus and infection with a wild strain; (B6) preparing a product for differentiating between diseases caused by immunization with a marker vaccine strain of E2 of swine fever virus and infection with a wild strain; (B7) detecting or assisting in detecting the content of E2 protein of swine fever virus in a sample to be tested; (B8) detecting or assisting in detecting the content of antibody of E2 protein of swine fever virus in a sample to be tested; (B9) preparing a product for detecting or assisting in detecting the content of antibody of E2 protein of swine fever virus in a sample to be tested (B10) preparing a product for detecting or assisting in detecting the content of antibody of E2 protein of swine fever virus in a sample to be tested.
[0045] The product for recognizing or assisting in recognizing E2 protein and antibody of swine fever virus can be a detection kit.
[0046] In the present application, the product that binds or assists in binding the E2 protein of the porcine pestivirus can be an E2 protein inhibitor, or a product for isolating or purifying the E2 protein, but is not limited thereto. For example, the monoclonal antibody or antigen-binding fragment thereof of the present application can be prepared into an immunoaffinity chromatography column. Based on the principle that the antigen can be captured by the antibody when passing through the chromatography column, and the antigen can be dissociated from the column under the condition of changing the pH value, etc., the E2 protein can be isolated and screened out.
[0047] In the present application, the serum samples immunized with the marker subunit vaccine of the E2 protein of the porcine pestivirus and infected with the wild strain can be obtained from the immunized pigs and the infected pigs, respectively. Then, the antibody blocking ELISA kit developed based on the monoclonal antibody or antigen-binding fragment thereof is used to detect whether the E2 protein antibody of the porcine pestivirus or the content of the E2 protein antibody of the porcine pestivirus exists in the serum sample, and the identification of the marker subunit vaccine immunization and the wild strain infection of the E2 protein of the porcine pestivirus is performed according to the detection results.
[0048] In the present application, the detection or assistance in detecting the content of the E2 protein of the porcine pestivirus in the sample to be detected includes any in vivo or in vitro detection of the E2 protein based on the principle of specific reaction between the antigen and the antibody. The detection of the E2 protein can be the detection of whether the E2 protein exists in the sample to be detected and / or the detection of the content of the E2 protein in the sample to be detected.
[0049] The product described in the present application can include reagents, kits, chips, test papers, detection cards, and immunosensors.
[0050] In the present application, the method for detecting the E2 protein and the antibody thereof can be for the purpose of disease diagnosis, disease prognosis, and / or disease treatment, or can be for the purpose of non-disease diagnosis, non-disease prognosis, and non-disease treatment.
[0051] The non-disease diagnosis purpose, non-disease prognosis purpose, and non-disease treatment purpose can be the detection of whether the porcine pestivirus exists in the environmental sample.
[0052] The subject can be a human or a non-human animal (such as a pig, a cow, a sheep, a rabbit, a cat, a horse, a deer, a monkey, a chicken, a dog, etc.). The antibody in the present application can be prepared by various methods known in the art, for example, by genetic engineering recombination technology. For example, a DNA molecule encoding the heavy chain and light chain genes of the antibody of the present application is obtained by chemical synthesis or PCR amplification. The obtained DNA molecule is inserted into an expression vector, and then the host cell is transfected, the transfected host cell is cultured under specific conditions, and the antibody of the present application is expressed. The host cell, the expression vector, the method of introducing the expression vector into the host cell, and the method of isolating and purifying the antibody can be selected according to the needs of those skilled in the art.
[0053] The application also provides a method for preparing the antibody as described above, comprising expressing the monoclonal antibody or antigen-binding fragment thereof as described above in a host cell, and recovering or isolating the monoclonal antibody or antigen-binding fragment thereof.
[0054] The host cell can be a microbial cell or a eukaryotic cell, such as a bacterium (e.g., E. coli), a yeast, an alga, or a fungus.
[0055] Further, the host cell can be a 293T cell.
[0056] The application also provides a method for detecting antibodies against E2 protein of wild strains of classical swine fever virus, comprising detecting the antibodies against E2 protein of wild strains of classical swine fever virus using the monoclonal antibody or antigen-binding fragment thereof as described above, the kit, or the antibody conjugate.
[0057] The application prepares the monoclonal antibody DIVA55 through genetic engineering. The monoclonal antibody (DIVA55) specifically reacts with E2 protein of wild strains of classical swine fever virus, but does not react with E2 protein of marker vaccines of classical swine fever virus. A blocking ELISA method for differentiating immunization with E2 protein marker subunit vaccines of classical swine fever virus and infection with wild strains of classical swine fever virus is established by using the antibody DIVA55. The monoclonal antibody DIVA55 of the application can be used in the fields of serological diagnosis, evaluation of immunization effect, and related experiments of CSFV immunization and wild strain infection. The operation steps are simple, large-scale sample detection can be quickly performed, the antibody has high sensitivity and specificity for specific antibodies, and the cost is low. The application provides an antibody resource for serological differentiation of CSFV immunization and infection and disease purification. BRIEF DESCRIPTION OF DRAWINGS
[0058] Figure 1 PCR identification of the E2 recombinant protein expression plasmid of classical swine fever virus.
[0059] Figure 2 Immunological identification of the E2 recombinant protein of classical swine fever virus.
[0060] Figure 3 SDS-PAGE verification result of the purification of the monoclonal antibody DIVA55.
[0061] Figure 4 Western blot experiment result of the monoclonal antibody DIVA55 and E2 protein of wild strains of classical swine fever virus and unmutated E2 protein.
[0062] Figure 5 IFA verification result of the expression activity of the monoclonal antibody DIVA55. Wherein HCLV, lapinized attenuated vaccine of classical swine fever virus (C strain); SM, SM virulent strain of classical swine fever virus; WH303, positive control antibody of E2 protein; DIVA55, E2 protein monoclonal antibody.
[0063] Figure 6 Clinical score for the protection efficacy test of the E2 protein marker subunit vaccine of CSFV.
[0064] Figure 7 Viral copy number of each tissue for the protection efficacy test of the E2 protein marker subunit vaccine of CSFV.
[0065] Figure 8 E2 antibody level for the protection efficacy test of the E2 protein marker subunit vaccine of CSFV. Wherein A, E2 antibody level change after immunization twice of E2 protein marker subunit vaccine (first group) and E2 protein subunit vaccine TWJ-E2 (third group) and challenge of JL23 strain; B, E2 antibody level change after immunization once of C strain (second group) and challenge of JL23 strain; C, E2 antibody level change of unimmunized pigs (fourth group) challenge of JL23 strain and unimmunized pigs without challenge (fifth group). DETAILED DESCRIPTION
[0066] The application will be further described in detail below with specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.
[0067] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.
[0068] In the following examples, unless otherwise specified, quantitative tests are set up with three repeated experiments, and the results are averaged.
[0069] In the following examples, the pcDNA3.1 vector is purchased from Shengong Bioengineering (Shanghai) Co., Ltd., item number A339023.
[0070] In the following examples, the CSFV broad-spectrum antibody WH303 is described in the following literature: Mi Shijiang. Identification of monoclonal antibodies and broad-spectrum monoclonal antibodies for differentiating wild strains and vaccine strains of CSFV and epitope analysis [D]. Jilin University, 2022. The biological material can be obtained from the applicant, and is only used for repeating the experiments of the application, and cannot be used for other purposes.
[0071] In the following examples, the protein tag antibody anti-His Tag mAb is purchased from Solabio, item number K200060M.
[0072] The CSFV SM strain, the porcine epidemic rabies vaccine (HCLV, also known as C strain), the vaccine strain LPC strain and the wild strain JL23 strain in the following examples have been described in Shijiang Mi, Lihua Wang, Hongwei Li, et al. Characterization of monoclonal antibodies that specifically differentiate field isolates from vaccine strains of classical swine fever virus. Frontiers in Immunology, 2022, 13, 930631. The biological material can be obtained from the applicant, which is only used for repeating the experiments of the present application and cannot be used for other purposes.
[0073] Example 1, preparation of recombinant porcine epidemic rabies virus E2 protein Based on the E2 genes of the domestic and foreign classical strains and wild strains (such as the vaccine C strain, the LPC strain and the wild strains SM strain and JL23 strain), the present application mutates the amino acids 193P, 195V, 197T, 200L and 203Q of the LPC E2 protein to 193V, 195K, 197V, 200P and 203K, and finally obtains a nucleic acid molecule (the nucleotide sequence is SEQ ID No: 2) encoding the recombinant E2 protein of the porcine epidemic rabies virus, which can express the recombinant E2 protein of the porcine epidemic rabies virus, and the amino acid sequence is shown as SEQ ID No: 1.
[0074] 1. Mutation of porcine epidemic rabies virus E2 gene and construction of eukaryotic expression vector Based on the amino acid sequence (SEQ ID No: 3) of the E2 protein of the classical swine fever virus (CSFV) vaccine strain LPC (CSFV-LPC), the amino acid mutations of 193P, 195V, 197T, 200L and 203Q of the LPC E2 protein (the genomic nucleotide sequence is SEQ ID No: 6) were changed to 193V, 195K, 197V, 200P and 203K, to obtain the nucleotide sequence SEQ ID No: 2. In addition to the enzyme digestion site, a Kozak sequence 5'-GCCACC-3' and an LPC E2 signal peptide sequence 5'-ATGTCAACCACGGCATTTCTCATCTGCTTGGTAAAAGTATTAAGAGGACAGATCGTGCAAGGTGTGATATGGCTGCTATTAGTAACTGGGGCACAAGGC-3' (SEQ ID No: 17) were added at the 5' end, and a His tag (the His tag nucleotide sequence is 5'-CATCATCACCATCACCAT-3', SEQ ID No: 18) and an enzyme digestion site were added at the 3' end Bam H I (sequence 5'-GGATCC-3'), to obtain the nucleotide sequence SEQ ID No: 7. After sequence synthesis, the result was confirmed by PCR amplification and agarose gel electrophoresis, as shown in Figure 1 .
[0075] The amplified target E2 (mutant) gene fragment was recovered by a gel recovery kit. After the correct target E2 gene fragment was identified, it was digested with enzymes, mixed with the pcDNA3.1 vector in a molar ratio of 3:1 with T4 ligase, and then placed in a metal bath at 16°C overnight for ligation. 2 μL of the ligation product was mixed with 50 μL of DH5α E. coli competent cells, transformed, and single colony culture was performed. Positive colonies were identified by bacterial liquid PCR, and were confirmed by sequencing to obtain the recombinant expression plasmid pcDNA3.1-E2 (mutant).
[0076] The structure of the pcDNA3.1-E2 (mutant) vector is described as follows: the DNA fragment of SEQ ID No: 7 is inserted between the two enzyme digestion sites of the eukaryotic expression vector pcDNA3.1 Eco R I and Bam H I, and the other sequences of the vector pcDNA3.1 remain unchanged to obtain the recombinant vector.
[0077] Based on the E2 protein genomic sequence (nucleotide sequence is SEQ ID No: 6) of the vaccine strain LPC (CSFV-LPC), the recombinant expression plasmid obtained by the same operation procedure is pcDNA3.1-E2, which is used as a control.
[0078] The difference between pcDNA3.1-E2 vector and pcDNA3.1-E2 (mutant) vector is that the DNA molecule described in SEQ ID No: 7 is replaced by the DNA molecule described in SEQ ID No: 8.
[0079] 2. Expression and identification of target protein CHO cells (ATCC number: CCL-61) were cultured at a cell density of 3-4 x 10 6 CFU / mL in 50 mL ExpiCHO™ expression medium (purchased from Gibco™ company, item number 10743029) at 37°C in a carbon dioxide shaking incubator with 8% CO2 overnight, according to the ExpiFectamine TM CHO Transfection Kit (purchased from Gibco™ company, item number A29129) instructions to transfect pcDNA3.1-E2 and pcDNA3.1-E2 (mutant) recombinant plasmids into CHO cells: 2 mL of pre-cooled OptiPRO™ SFM buffer was added to 2 15 mL centrifuge tubes, respectively, 160 μL of ExpiFectamine™ CHO transfection reagent was added to one of the 15 mL centrifuge tubes, and 50 μg of the plasmid to be transfected was added to the other 15 mL centrifuge tube, each was mixed thoroughly, then mixed again, and then incubated at room temperature for 5 min; the complex of ExpiFectamine™ CHO transfection reagent and the plasmid to be transfected was added to the CHO cells, mixed gently, and incubated at 37°C with 8% CO2 for 18 to 22 h; 12 mL of ExpiCHO™ Feed reagent and 300 μL of ExpiFectamine™ CHO Enhancer reagent were mixed thoroughly and added to the transfected CHO cells, which were then cultured for another 8 d. The cell sample was collected and centrifuged at 6000 rpm at 4°C for 30 min, and the supernatant was collected and the total protein content in the sample was determined by the Bicinchoninic Acid (BCA) method.
[0080] The expressed protein was verified by Western blot experiment, and the steps were as follows: ① Protein treatment: E2 protein (mutant recombinant protein, non-mutant recombinant protein) was added to 4x loading buffer in proportion and boiled for 10 min.
[0081] ② Protein electrophoresis: The treated protein (10 μL per lane) was loaded into a 10% SDS-PAGE gel for protein electrophoresis, and the program was 55 V-50 min and 110 V-80 min.
[0082] ③ Transfer: The proteins after electrophoresis were transferred to NC membrane (purchased from GE, item number 10600002) by semi-dry transfer method with the procedure of 23 V-25 min. 10600002), procedure of 23 V-25 min.
[0083] ④ Blocking: 5 g of skimmed milk powder (purchased from BD, item number 232100) was added to 100 mL of PBS and shaken well to make blocking solution. 5 mL of the blocking solution was added to a self-sealing bag and the NC membrane was blocked in the bag on a shaker at room temperature for 1 h.
[0084] ⑤ Incubation of primary antibody: Anti-His Tag antibody was diluted with the blocking solution at 1:3000 and incubated on a shaker at 4°C overnight.
[0085] ⑥ Incubation of secondary antibody: The membrane was washed with PBS for 3 times, Alexa Fluor 680 labeled fluorescent secondary antibody (purchased from Invitrogen, item number 8310-16) was added at a dilution of 1:5000 and incubated on a shaker at room temperature in the dark for 1 h.
[0086] ⑦ Scanning of NC membrane: The membrane was washed with PBS for 3 times and scanned in a dual-color infrared laser imaging system and the pictures were saved.
[0087] The results are shown in Figure 2 : The specific bands of the recombinant E2 protein appeared at about 45 kDa and 90 kDa, indicating that the recombinant protein was successfully expressed.
[0088] 3. Preparation of vaccine Expression of recombinant E2 marker protein of CSFV: CHO cells transfected with pcDNA3.1-E2 (mutant) plasmid were cultured in a bioreactor. After optimization of the conditions, the dissolved oxygen concentration of the bioreactor was between 40%-50%, the temperature was 27°C, the rotation speed was 40-120 rpm, the cell density was 2x10 6 6 / mL during expression, and more than 140 μg / mL of stable expression was obtained after 150 h of culture, which was 20 μg higher than that obtained by conventional shake flask culture. After removing cell debris, the supernatant was collected to obtain the marker CSFV E2 protein solution.
[0089] Emulsification of CSFV E2 protein and 563VG (Sabin Vaccine Institute, item number: 36025H) to prepare vaccine: First, the 563VG oil adjuvant was sterilized at 121°C, 15 pa for 20 min, then the protein antigen was mixed with the adjuvant at a mass ratio of 1:1, emulsified at a rotation speed of 5000 rpm for 10 min, stopped for 10 min, and then emulsified at a rotation speed of 5000 rpm for another 10 min, to obtain the marker subunit vaccine of CSFV E2 protein.
[0090] Example 2, genetically engineered preparation of antibodies The hybridoma cells secreting DIVA55 were sent to Nanjing Detai Bioengineering Co., Ltd. for sequencing, and the sequence was as follows: The amino acid sequence of the heavy chain variable region of the monoclonal antibody DIVA55 is shown as SEQ ID No: 5, and the nucleotide sequence of the heavy chain variable region encoding gene is shown as SEQ ID No: 10; the amino acid sequence of the light chain variable region of the monoclonal antibody DIVA55 is shown as SEQ ID No: 4, and the nucleotide sequence of the light chain variable region encoding gene is shown as SEQ ID No: 9. Among them: The amino acid sequence of CDR1 of the heavy chain variable region of the monoclonal antibody DIVA55 is shown as positions 31-35 of SEQ ID No: 5; The amino acid sequence of CDR2 of the heavy chain variable region of the monoclonal antibody DIVA55 is shown as positions 50-65 of SEQ ID No: 5; The amino acid sequence of CDR3 of the heavy chain variable region of the monoclonal antibody DIVA55 is shown as positions 95-102 of SEQ ID No: 5; The amino acid sequence of CDR1 of the light chain variable region of the monoclonal antibody DIVA55 is shown as positions 24-34 of SEQ ID No: 4; The amino acid sequence of CDR2 of the light chain variable region of the monoclonal antibody DIVA55 is shown as positions 50-56 of SEQ ID No: 4; The amino acid sequence of CDR3 of the light chain variable region of the monoclonal antibody DIVA55 is shown as positions 89-97 of SEQ ID No: 4.
[0091] 1. Construction of recombinant expression plasmid To express the monoclonal antibody DIVA55, heavy chain expression vector and light chain expression vector were prepared respectively: the nucleotide sequence of the heavy chain gene of the monoclonal antibody DIVA55 was obtained by directly connecting the nucleotide sequence of the heavy chain variable region encoding gene (SEQ ID No: 10) with the mouse-IgG2a template sequence (heavy chain constant region sequence, SEQ ID No: 11). The nucleotide sequence of the light chain gene of the monoclonal antibody DIVA55 was obtained by directly connecting the nucleotide sequence of the light chain variable region encoding gene (SEQ ID No: 9) with the mouse-kappa template sequence (light chain constant region sequence, SEQ ID No: 12).
[0092] The monoclonal antibody DIVA55 heavy chain gene and light chain gene were cloned into the vector pcDNA3.4, respectively, to obtain the heavy chain expression vector pcDNA3.4-H and the light chain expression vector pcDNA3.4-L, and the recombinant vectors pcDNA3.4-H (expressing heavy chain) and pcDNA3.4-L (expressing light chain) were synthesized by Nanjing Detai Biological Engineering Co., Ltd.
[0093] The structure of pcDNA3.4-H is described as follows: a DNA fragment with the sequence of SEQ ID No: 13 is inserted between the Xbal and BamH I enzyme cutting sites of the eukaryotic expression vector pcDNA3.4, and the other sequences of the vector pcDNA3.4 remain unchanged to obtain the recombinant vector. The pcDNA3.4-H vector can express the heavy chain of the DIVA55 antibody, and the amino acid sequence thereof is SEQ ID No: 15.
[0094] The structure of pcDNA3.4-L is described as follows: a DNA fragment with the sequence of SEQ ID No: 14 is inserted between the Xbal and BamH I enzyme cutting sites of the eukaryotic expression vector pcDNA3.4, and the pcDNA3.4-L vector can express the light chain of the DIVA55 antibody, and the amino acid sequence thereof is SEQ ID No: 16.
[0095] 2. Expression of the antibody a) Freshly digested 293T cells (purchased from Sibeli, item number HEMCL-032) were inoculated into 175 cm 2 culture bottles, and 35 mL of DMEM culture medium containing 8% FBS (Corning, item number 10-013-CVRC) was added to culture the cells to a density of 90%.
[0096] b) 200 μg of the vector plasmid containing the light chain and the heavy chain (100 μg each) and 200 μL of QuickShuttle-293 cell-specific transfection reagent (Boluo Long Company, item number KX0110044) were diluted into 1 mL of normal saline, respectively.
[0097] c) The two solutions in step b) above were combined and mixed to obtain a complex.
[0098] d) The above complex was directly added to the cell culture medium in step a), and mixed by pipetting.
[0099] e) The cell plate was moved to a 37ºC / 5% CO2 incubator for culture, and the culture supernatant was collected after 3 days of culture.
[0100] 3. Purification of the antibody a) Buffer preparation: add Na2HPO4·12H2O into sterile ddH2O to make the final concentration of 0.2 M, shake well to mix.
[0101] b) Pre-elution buffer preparation: add 0.1 M citric acid into the buffer to make the volume ratio of citric acid 20%.
[0102] c) Elution buffer preparation: add 0.1 M citric acid into the buffer to make the volume ratio of citric acid 60%.
[0103] d) Sample treatment: take 30 mL of cell expression supernatant verified in step 3), add the buffer prepared in step a) at a volume ratio of 1:1, and prepare for column loading after filtration using a pore size of 0.22 μm.
[0104] e) Column equilibration: use a constant flow pump to slowly pass 10 mL of buffer through the Protein A / G4FF pre-packed chromatography column (purchased from Shengong Company, item number C600983) at a flow rate of 1 mL / min.
[0105] f) Sample loading: use a constant flow pump to slowly pass the solution in step d) through the Protein A / G column at a flow rate of 1 mL / min.
[0106] g) Washing: use a constant flow pump to slowly pass 10 mL of washing buffer through the Protein A / G column at a flow rate of 1 mL / min.
[0107] h) Pre-elution: use a constant flow pump to slowly pass 10 mL of pre-elution buffer through the Protein A / G column at a flow rate of 1 mL / min.
[0108] i) Elution: use a constant flow pump to slowly pass 15 mL of elution buffer through the Protein A / G column at a flow rate of 1 mL / min, and sub-pack the eluted product into 1.5 mL centrifuge tubes.
[0109] IFA experiment was performed to verify whether the antibody was expressed. The expression supernatant was used as the primary antibody, and the CSFV broad-spectrum antibody WH303 was used as the control. Indirect immunofluorescence assay (IFA) was performed with CSFV wild strain SM and swine fever rabbitized attenuated vaccine C strain (HCLV). The specific steps are as follows: ① Cell infection: inoculate CSFV cell virus into 96-well plates at 100 TCID 50 / well, and add PK-15 cells into the 96-well plates, and incubate at 37℃ in a 5% CO2 incubator for 72 h.
[0110] ②Cell fixation: Discard the cell culture supernatant, wash each well of the 96-well plate with 200 μL of PBS for 3 times, add 50 μL of 80% cold acetone stored at -20°C to each well, and fix in the -20°C refrigerator for 1 h.
[0111] ③Primary antibody incubation: discard the cold acetone fixative, wash each well with 200 μL of PBS for 3 times, add 100 μL of hybridoma cell culture supernatant to each well, and incubate at 37°C for 1 h.
[0112] ④Secondary antibody incubation: discard the primary antibody incubation solution, wash each well with 200 μL of PBS for 3 times, dilute the Alexa Fluor 488 fluorescent secondary antibody with PBS at 1:500, add 0.01% Evans blue and 5% FBS at the same time, mix well, and add 100 μL of the mixture to each well of the cell plate, and incubate at 37°C for 1 h.
[0113] ⑤Fluorescence observation: discard the secondary antibody incubation solution, wash each well with 200 μL of PBS for 3 times, and observe the reaction of the serum antibody with the infected cells under a fluorescence microscope.
[0114] The results are shown in Figure 5 The control antibody reacted with the cells infected with the wild-type SM strain and the cells infected with the vaccine strain HCLV to produce obvious green fluorescence, indicating that the infection was successful. The supernatant of the 293T cells expressing the antibody reacted with the cells infected with the wild-type SM strain and the cells infected with the vaccine strain HCLV to also produce obvious green fluorescence, indicating that the antibody DIVA55 was successfully expressed.
[0115] 3. Verification of purified antibody Take the purified antibody DIVA55, add it to the reducing Buffer containing DTT according to the proportion, and perform SDS-PAGE experiment, the results are shown in Figure 3 After the antibody is treated with the reducing Buffer, there are two obvious bands of light chain and heavy chain at about 25 kDa and 50 kDa, indicating that the antibody is well purified.
[0116] Perform Western blot experiment on the purified antibody DIVA55 and the mutant and non-mutant LPC E2 proteins, the results are shown in Figure 4 The purified antibody reacts with the non-mutant E2 protein, and there is a band at 90 kDa in lane 2, while it does not react with the mutant E2 protein, and there is no specific band in lane 3.
[0117] 4. Preparation of HRP-conjugated antibody HRP-DIVA55 Use the HRP conjugation kit (Shenguo, D601047) to conjugate DIVA55 with HRP: (1) 500 μL HRP solution and 200 μL HRP activation buffer were mixed well by inverting on a shaker at room temperature for 30 min.
[0118] (2) 200 μL HRP coupling buffer was added, and the mixture was allowed to stand at room temperature for 30 min.
[0119] (3) 1 mg of purified DIVA55 was placed in a dialysis bag and dialyzed in 2 L of dialysis solution at room temperature for 2 h.
[0120] (4) 100 μL of reducing agent was added to the dialysis product, which was allowed to stand at room temperature for 2 h, and was gently mixed once every 30 min. The coupling product HRP-DIVA55 was aliquoted and stored.
[0121] Example 3, Verification of the Immune Effect of the Marker Subunit Vaccine of the Classical Swine Fever Virus E2 Protein 1. Safety Test of the Marker Subunit Vaccine of the Classical Swine Fever Virus E2 Protein Ten healthy weaned piglets (5-6 weeks old) with negative nucleic acid and antibody of the classical swine fever virus were selected (Tiankang Animal Husbandry Technology Co., Ltd.), and five of them were injected with 30 μg of the marker subunit vaccine of the classical swine fever virus E2 protein (V1, V2, V3, V4, and V5) in the back of the ear and the neck muscle, and the other five were not injected as negative controls (C1, C2, C3, C4, and C5). The pigs were continuously observed for 14 days, and the rectal temperature was measured every day. The body temperature is shown in Table 1. The body temperature of the vaccine immunization group and the control group was not higher than 40℃, and no death occurred, and the mental state was normal, and so on.
[0122]
[0123] 2. Protection Efficacy Test of the Marker Subunit Vaccine of the Classical Swine Fever Virus E2 Protein Twenty-five healthy weaned piglets with negative nucleic acid and antibody of the classical swine fever virus were selected and treated as follows: The first group (5 pigs, 1-1, 1-2, 1-3, 1-4, and 1-5) was immunized with the marker subunit vaccine of the classical swine fever virus E2 protein, and was injected in the neck muscle twice, with each injection of the protein (30 μg) emulsified with an adjuvant. The second group (5 pigs, 2-1, 2-2, 2-3, 2-4, and 2-5) was immunized with the attenuated live vaccine of the classical swine fever virus (C strain, cell-derived passage), and was injected in the neck muscle once, with a dose of 1 head (1 mL). The third group (5 pigs, 3-1, 3-2, 3-3, 3-4, and 3-5) was immunized with the marker subunit vaccine of the classical swine fever virus E2 protein (TWJ-E2, purchased from Tiankang Pharmaceutical Co., Ltd., product name: Tianwenjing), and was injected in the neck muscle twice, with each injection of the protein (30 μg) emulsified with an adjuvant. The fourth group (5 pigs, 4-1, 4-2, 4-3, 4-4, and 4-5) was a non-immune challenge group, and 1 mL of wild virus was injected into the neck muscle; The fifth group (5 pigs, 5-1, 5-2, 5-3, 5-4, and 5-5) was a healthy control group without immunization and challenge, and was raised in isolation under the same conditions.
[0124] The method for obtaining the vaccine serum of the second group and the third group is described in the following document: Gong W, Li J, Wang Z, et al. Commercial E2 subunit vaccine provides full protection to pigs against lethal challenge with 4 strains of classical swine fever virus genotype 2. Vet Microbiol. 2019; 237: 108403.
[0125] The E2 protein marker subunit vaccine (first group) prepared in Example 1 and the E2 protein subunit vaccine TWJ-E2 (third group) were immunized twice 21 days after the first immunization, and the immunized pigs were injected with 1 mL (containing 10 5 MLD) of the wild strain JL23 of the porcine pestivirus for challenge 14 days after the interval. The C strain (second group) was challenged 14 days after the first immunization. After the challenge, the rectal temperature and clinical manifestations were measured and observed every day for 24 days, and a clinical score was performed.
[0126] During the challenge, the experimental pigs that were close to death or died, and the experimental pigs that were still alive at the end of the experiment were dissected to observe the pathological conditions of the tonsils, larynx, lymph nodes, kidneys, spleen, and ileum.
[0127] The results are shown in Table 1. Figure 6 As shown in Table 1, the test pigs of the first, second, and third groups, i.e., the porcine pestivirus E2 protein marker subunit vaccine group, the porcine pestivirus lapinized attenuated vaccine (passage cell source) group, and the porcine pestivirus E2 subunit vaccine group, did not show clinical symptoms of porcine pestivirus, while all the pigs of the fourth group, i.e., the control group, were sick, mainly showing high fever, dyspnea, conjunctivitis, anorexia, listlessness, patchy hemorrhage on the lower limbs, and other symptoms, and all the sick pigs died within 14 to 22 days. In addition, the healthy control pigs (fifth group) without immunization and challenge did not show clinical symptoms. No hemorrhagic spots or other abnormalities were observed in the immunized and challenged pigs, while in the control group (fourth group) after the challenge, the tonsils, larynx, lymph nodes, and kidneys had hemorrhagic spots or patches, the spleen had marginal infarction, the ileocecal valve had button-shaped ulcers, the lymph nodes were enlarged, and the cross-section showed a marble-like appearance with red and white.
[0128] Virus copy number of each organization as follows Figure 7 As shown, the viral load in each tissue of the first, second, and third groups was significantly lower than that in the fourth group (non-immunized challenge group), and was basically the same as that in the healthy control group (non-immunized and non-challenged).
[0129] The E2 antibody test results for each group are as follows: The E2 antibody test results for Group 1 and Group 3, i.e., the experimental groups immunized with the classical swine fever virus E2 protein-labeled subunit vaccine and TWJ-E2 respectively, are as follows: Figure 8 As shown in Figure A, E2 antibody levels generally showed a continuous upward trend after immunization, with a slight decline during days 1-12 after challenge. The E2 antibody detection results for the second group, the experimental group immunized with the classical swine fever rabbit-attenuated live vaccine, are as follows: Figure 8 As shown in B, the E2 antibody levels remained consistently high, slightly lower than in groups one and three after challenge; while the E2 antibody test results in group four (non-immunized and challenged) and group five (non-immunized and non-challenged healthy control group) after challenge were as follows: Figure 8 As shown in C, it remains at a low level.
[0130] The above results demonstrate that the classical swine fever virus E2 protein-labeled subunit vaccine, classical swine fever rabbit-modified attenuated live vaccine strain C, and classical swine fever E2 subunit vaccine of the present invention provide comparable protection for pigs. Mutation of the E2 protein does not substantially alter its overall immunogenicity.
[0131] Example 4: Application of monoclonal antibody DIVA55 in immunization with classical swine fever virus E2 protein-labeled subunit vaccine and serological identification of wild-type strain infection. This embodiment utilizes the monoclonal antibody DIVA55 to establish a blocking ELISA method for distinguishing between classical swine fever virus E2 protein-labeled subunit vaccine immunization and wild-type strain infection. The specific operation method is as follows: (1) The CSFV LPC strain E2 protein (i.e., the CSFV-E2 protein in Example 1) was coated in the microplate at a concentration of 0.1 μg / mL. After coating, the coating solution was discarded and the plate was sealed in a vacuum.
[0132] (2) Add 50 μL of sample diluent to each well of the coated plate, and then add 50 μL of classical swine fever virus infection sample (numbered 1-5, serum obtained by challenge with classical swine fever virus wild strain AH1), labeled vaccine immunization sample (numbered 6-10, serum obtained by immunization with classical swine fever virus E2 protein labeled subunit vaccine), classical swine fever antibody negative control (classical swine fever antibody negative serum), classical swine fever antibody positive control (serum obtained by challenge with classical swine fever wild strain GD23), and set up duplicate wells for negative control and positive control. Incubate at 37ºC for 1 h.
[0133] The preparation method of the serum in the above positive samples 1-5 and the negative control and positive control serum of porcine fever antibodies in positive samples 6-10 is described in the following document: Gong W, Li J, Wang Z, et al. Commercial E2 subunit vaccine provides full protection to pigs against lethal challenge with 4 strains of classical swine fever virus genotype 2. Vet Microbiol. 2019; 237: 108403.
[0134] (3) After discarding the liquid in each well, wash the plate wells with 300 μL of washing solution for a total of 5 times, and after the last washing, pat dry the washing solution in the wells.
[0135] (4) Add 100 μL of 1:5000 diluted HRP-DIVA55 conjugated antibody to each well of the plate, and incubate at 37°C for 1 h.
[0136] (5) Repeat step (3).
[0137] (6) Add 50 μL of TMB color developing solution to each well, and incubate at room temperature in the dark for 10 min.
[0138] (7) Add 50 μL of stop solution to each well to stop the reaction, and measure the OD value with a microplate reader 450 , calculate the blocking rate, and the calculation formula is (negative serum OD 450 - sample OD 450 ) / negative serum OD 450 × 100%.
[0139] The results are shown in Table 2: for the serum infected with wild strains, the blocking rate is 95.12%, and for the serum immunized with vaccines, the blocking rate is 3.25%, indicating that the blocking ELISA method based on monoclonal antibody DIVA55 can clearly distinguish between porcine fever E2 marker vaccine strains and wild strain infections, and monoclonal antibody DIVA55 can be used for the serological differential diagnosis of porcine fever, and the development and preparation of a blocking ELISA kit.
[0140]
[0141] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the application.
Claims
1. An antibody characterized in that: The antibody is a monoclonal antibody or an antigen-binding fragment thereof, which comprises a heavy chain variable region and a light chain variable region; the amino acid sequences of LCDR1, LCDR2 and LCDR3 in the light chain variable region of the antibody are sequentially shown in SEQ ID No: 4, 24-34, 50-56, 89-97, which are complementarity determining regions; the amino acid sequences of HCDR1, HCDR2 and HCDR3 in the heavy chain variable region of the antibody are sequentially shown in SEQ ID No: 5, 31-35, 50-65, 95-102; and the HCDR1, HCDR2 and HCDR3 are complementarity determining regions.
2. The antibody of claim 1, wherein: The amino acid sequence of the light chain variable region of the antibody is SEQ ID No: 4; and / or the amino acid sequence of the heavy chain variable region of the antibody is SEQ ID No:
5.
3. Biomaterials characterized in that, The biological material is any one of the following: A1) a nucleic acid molecule encoding the heavy chain variable region and the light chain variable region of the monoclonal antibody or the antigen-binding fragment thereof according to claim 1 or 2; A2) an expression cassette containing the nucleic acid molecule according to A1); A3) a recombinant vector containing the nucleic acid molecule according to A1); A4) a recombinant microorganism containing the nucleic acid molecule according to A1); A5) a recombinant host cell containing the nucleic acid molecule according to A1).
4. The biomaterial of claim 3, wherein: In the nucleic acid molecule according to (A1), the nucleotide sequences encoding the LCDR1, LCDR2 and LCDR3 in the light chain variable region of the antibody are sequentially shown in SEQ ID No: 9, 70-102, 148-168, 265-291; and / or In the nucleic acid molecule according to (A1), the nucleotide sequences encoding the HCDR1, HCDR2 and HCDR3 in the heavy chain variable region of the antibody are sequentially shown in SEQ ID No: 10, 91-105, 148-198, 295-330.
5. A kit for serologically differentiating between immunization with a marker subunit vaccine and infection with a field strain of classical swine fever E2 protein, characterized in that, The kit comprises the antibody or the antigen-binding fragment thereof according to claim 1 or 2.
6. The kit of claim 5, wherein The kit is a blocking ELISA kit, and the detection mode when the kit is used is serological detection.
7. An antibody conjugate comprising an antibody moiety and a conjugate moiety, characterized in that, The antibody moiety is the monoclonal antibody or the antigen-binding fragment thereof according to claim 1 or 2, and the conjugated moiety is a detectable label.
8. Use of the antibody according to claim 1 or 2 in any one of the following: (B1) preparing a product for identifying or assisting in identifying the E2 protein of the porcine epidemic diarrhea virus; (B2) preparing a product for binding or assisting in binding the E2 protein of the porcine epidemic diarrhea virus; (B3) detecting or assisting in detecting whether the E2 protein of the porcine epidemic diarrhea virus is contained in a sample to be tested; (B4) preparing a product for detecting or assisting in detecting whether the E2 protein of the porcine epidemic diarrhea virus is contained in a sample to be tested; (B5) preparing a product for serologically distinguishing between immunization with the E2 marker subunit vaccine of the porcine epidemic diarrhea and infection with a wild strain; (B6) preparing a product for distinguishing between diseases caused by immunization with the E2 marker vaccine strain of the porcine epidemic diarrhea and infection with a wild strain; (B7) detecting or assisting in detecting the content of the E2 protein of the porcine epidemic diarrhea virus in a sample to be tested; (B8) detecting or assisting in detecting the content of antibody to E2 protein of swine fever virus in a sample to be tested; (B9) preparing a product for detecting or assisting in detecting the content of E2 protein of swine fever virus in a sample to be tested; (B10) preparing a product for detecting or assisting in detecting the content of antibody to E2 protein of swine fever virus in a sample to be tested.
9. A method of producing the antibody according to claim 1 or 2, characterized by, The preparation method comprises expressing the monoclonal antibody or antigen-binding fragment thereof according to claim 1 or 2 in a host cell, and recovering or isolating the monoclonal antibody or antigen-binding fragment thereof.
10. A method for detecting a field strain of classical swine fever virus or the E2 protein of a field strain of classical swine fever virus, characterized in that, The method comprises detecting the epidemic strain or wild strain or E2 protein of wild strain of swine fever virus by using the monoclonal antibody or antigen-binding fragment thereof according to claim 1 or 2, the kit according to claim 5 or 6, or the antibody conjugate according to claim 7.
Citation Information
Patent Citations
Monoclonal antibody for distinguishing hog cholera lapinized virus vaccine strain and epidemic strain and application thereof
CN119350494A
Anti-pestivirus broad-spectrum neutralizing monoclonal antibody and application thereof
CN119371523A
Chog cholera virus broad-spectrum neutralizing monoclonal antibody and application thereof
CN120058918A
Cited By
Monoclonal antibody 5H4 for detecting classical swine fever virus antibody and application thereof
CN121873216A