Production technology flow of largemouth bass with delayed gonad development

Abstract

The invention discloses a production technology flow of largemouth bass with delayed gonad development, and belongs to the technical field of aquatic animal biological breeding. The method comprises the following steps: breeding parents, designing an antisense RNA sequence, amplifying, preparing a transfection reagent, carrying out artificial insemination on the micropterus salmoides, and introducing the antisense RNA sequence of a sex development key gene, thereby creating a new germplasm of the micropterus salmoides with remarkably improved growth speed, remarkably reduced gonad index and better muscle quality and flavor; the technical support is provided for promoting the high-quality sustainable development of the largemouth bass industry.

Description

TECHNICAL FIELD

[0001] The present application relates to a set of production technical process of delayed gonadal development of largemouth bass, belonging to the technical field of aquatic animal biological breeding. BACKGROUND

[0002] Largemouth bass is a representative of China's characteristic aquatic economic fish. China's largemouth bass aquaculture technology has broken through the geographical limitations, and the aquaculture area has gradually expanded, widely distributed from south to north, and the industry has great development potential. With the rapid development of largemouth bass aquaculture industry, the unfavorable factors hindering the sustainable expansion and development of the industry are also increasing. In some areas, the winter temperature is relatively low, and the breeding period is longer, generally reaching the market size the next year. When fed to 6 months old, the ovaries of largemouth bass begin to develop, and the gonadal index is maintained at 2%. When fed to 3-5 months old the next year, the gonadal index is as high as more than 10%, resulting in slower growth rate of female largemouth bass, higher feed conversion ratio. At the same time, the female largemouth bass with swollen abdomen has poor body shape, is easy to "shake seeds" and causes "postpartum syndrome", and has a high mortality rate. Cultivating largemouth bass with delayed gonadal development is one of the most effective methods to solve the above problems. Largemouth bass gonadal development delay germplasm can fundamentally solve the series of production problems caused by the development of female gonad, and meet the urgent needs of the largemouth bass industry for quality improvement and sustainable development.

[0003] In aquaculture, delaying fish gonadal development to improve growth rate and yield is a feasible strategy. However, there is no strong evidence to support the view that delaying gonadal development can improve meat quality. Studies have shown that in tilapia and large yellow croaker, delaying gonadal development not only failed to significantly improve flavor, but also may lead to a decrease in key flavor substances, a hardening of meat, and a decrease in deliciousness. This indicates that there is no necessary positive correlation between gonadal development and meat flavor, and the influencing mechanism is complex and species-specific. Therefore, it is extremely challenging to achieve the three goals of delaying development, accelerating growth, and improving deliciousness at the same time through a single means, and it is necessary to understand the mechanism and carry out multi-target coordinated regulation.

[0004] There is a lack of method for constructing largemouth bass with delayed gonadal development, fast growth rate, and delicious meat in the prior art. SUMMARY

[0005] The present application silences the key genes (dmrt1, Tekt1; btg4, hsd17b12a) of female and male gonadal development of largemouth bass through antisense RNA technology, thereby obtaining new germplasm with delayed gonadal development, and providing a new perspective for solving the bottleneck problem of "postpartum syndrome" of largemouth bass.

[0006] The present application provides a method for delaying gonadal development of largemouth bass, improving growth rate and / or improving meat flavor, and reducing the expression of dmrt, Tekt1, Btg4 and / or Hsd17b12a in largemouth bass.

[0007] In an embodiment, the expression of dmrt, Tekt1, Btg4 and / or Hsd17b12a in the fertilized eggs of Micropterus salmoides is reduced by antisense RNA sequences. Then the Micropterus salmoides with delayed development of gonad, increased growth rate and / or improved meat flavor are obtained by hatching and breeding.

[0008] In an embodiment, the method comprises the following steps:

[0009] (1) Constructing a recombinant vector expressing antisense RNA sequences of dmrt, Tekt1, Btg4 or Hsd17b12a, respectively;

[0010] (2) Transfecting the recombinant vector of step (1) into the eggs of Micropterus salmoides, and then in vitro fertilization to obtain fertilized eggs;

[0011] (3) Hatching and breeding the fertilized eggs of step (2) to obtain Micropterus salmoides.

[0012] In an embodiment, the antisense RNA sequence of the gene dmrt is shown as SEQ ID NO. 1 and SEQ ID NO. 2; the antisense RNA sequence of the gene Tekt1 is shown as SEQ ID NO. 3 and SEQ ID NO. 4; the antisense RNA sequence of the gene Btg4 is shown as SEQ ID NO. 5; and the antisense RNA sequence of the gene Hsd17b12a is shown as SEQ ID NO. 6.

[0013] In an embodiment, a recombinant vector expressing antisense RNA sequences shown as SEQ ID NO. 1-SEQ ID NO. 6 is constructed, and the obtained recombinant vector is transfected into the eggs of Micropterus salmoides.

[0014] In an embodiment, the expression level of the genes dmrt, Tekt1, Btg4 and / or Hsd17b12a is reduced by more than 80%.

[0015] In an embodiment, the recombinant vector of step (1) includes but is not limited to pcDNA3.1 expression vector containing CMV promoter.

[0016] In an embodiment, the transfection of step (2) is mixing a nano-lipid carrier solution with the recombinant vector to obtain a mixed solution, and adding the mixed solution into the eggs; the nano-lipid carrier solution contains phosphatidylcholine, cholesterol and phosphate buffer solution.

[0017] In an embodiment, 5-7 mL of the mixed solution is added per 10,000 eggs.

[0018] In an embodiment, 0.5-1 mL of sperm is added to 1,000 eggs after transfection to obtain fertilized eggs.

[0019] In an embodiment, the incubation conditions are water temperature of 23-24℃ and water flow rate of 3-7 L / min.

[0020] In an embodiment, the cultivation conditions are water temperature of 25-27℃, dissolved oxygen of ≥7.5 mg / L, and total ammonia nitrogen and nitrite of ≤0.03 mg / L.

[0021] The application also provides use of the genes dmrt, Tekt1, Btg4 and / or Hsd17b12a in delaying gonadal development of Micropterus salmoides, improving growth rate and / or meat flavor of Micropterus salmoides.

[0022] Advantages:

[0023] The method can significantly improve growth performance and meat yield, improve feed conversion rate, enhance overwintering survival rate, and effectively improve meat flavor. After 600 days of cultivation, the growth rate of female and male fish in the gonadal development delay group is 21.46% and 20.51% higher than that of the control group, respectively, showing excellent growth performance. After 360 days of cultivation, the content of 1-pentanol, 3-methyl-3-buten-1-ol, 2,3-butanediol, 2-butanone, and hydroxyacetone in the muscle flavor substance of the gonadal development delay group is significantly increased, and the content of n-butyraldehyde, n-pentanal, nonanal, and n-octanal is significantly reduced, which reduces the fishy smell of fish meat and increases the fruit flavor and milk flavor, which is more attractive to consumers, and is conducive to large-scale industrial promotion. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 Determination of positive transfection rate of female and male fish. A. A1-A6 are female fish treatment groups with added transfection reagent, A7-A12 are male fish treatment groups with added transfection reagent; B. B1-B6 are female fish negative controls, B7-B12 are male fish negative controls; C. C1-C6 are female fish in the control group, C7-C12 are male fish in the control group.

[0025] Figure 2 Determination of the transcription level of Btg4, Hsd17b12a, dmrt1 and Tekt1 genes of female and male fish after 360 days of cultivation.

[0026] Figure 3 Comparison of growth performance of female and male fish. A, C: final body weight of female and male fish after 360 days of cultivation; B, D: gonadal index of female and male fish after 360 days of cultivation; E-F: final body weight of female and male fish after 600 days of cultivation; G: observation of the phenotype of female gonad; H: observation of the phenotype of male gonad.

[0027] Figure 4 Serum and gonadal sex hormone levels were determined in male largemouth bass at 360 days of age.

[0028] Figure 5 Serum and gonadal sex hormone levels were determined in female largemouth bass at 360 days of age.

[0029] Figure 6 Gonadal histological observation of male and female largemouth bass at 360 days of age. DETAILED DESCRIPTION

[0030] The present application will be further described in conjunction with specific examples, but the embodiments of the present application are not limited to the scope represented by the examples.

[0031] The "gene silencing rate" or "reduced expression level" referred to in the present application refers to the degree of reduction in the transcription level of a gene in the tissue of a largemouth bass after regulation compared with a normal largemouth bass that has not been subjected to gene regulation.

[0032] Example 1: Construction of gonadal development delayed largemouth bass fry

[0033] 1. Parental breeding of largemouth bass

[0034] Select 24-month-old or older parents that are robust in size, eat well, have no injuries on the body surface, have obvious sexual characteristics, and weigh more than 600 g. Select a dedicated parent breeding pond to ensure that the dissolved oxygen is ≥5 mg / L, the ammonia nitrogen is <0.2 mg / L, the sub-salt is <0.1 mg / L, and the temperature is controlled at 15±1℃. Intensify the feeding of the parents 2 months before the breeding season, with a feed protein content of more than 45%, a fat content of more than 3%, and a combination of vitamins, minerals, and unsaturated fatty acids, etc., with a daily feeding rate of 1.5%-3.0%. During the parental breeding period, daily patrol and disease prevention and control work are done to breed parents with well-developed gonads, strong reproductive capacity, and high-quality healthy fry.

[0035] 2. Design and synthesis of antisense RNA sequences

[0036] The gonadal development key genes for creating gonadal development delayed development in male fish (dmrt1, Tekt1) and female fish (btg4, hsd17b12a) are designed according to the mRNA of the above genes. The dmrt1 gene mRNA (XM_038703752.1) contains 2 introns and 1 exon, and 2 antisense RNA sequences are designed at the connection of the intron and the exon to interfere with the mRNA transcription process, and the specific sequences are as follows:

[0037] 1) anti-dmrt1-1 (SEQ ID NO. 1):

[0038] CCTGGGCAGGTCTAGCAGTTGGCATCAGACTTTTTGTTGTTTCATTCTCAGTAAGGTTAGCCATGAGCAAGGACAAGCAGAGCAAGCAAGTGCCGGAGTGCACTGG.

[0039] 2) anti-dmrt1-2 (SEQ ID NO. 2):

[0040] TGAGTGCGAGGCCAGCAGCGAGACTCCAAACTTCACAGTCAACTCCATCATCGAC GCCACCAAATAAAAGAAGCTAAGGAAAGCGTTATTAAAAATAATCATTGTGAGATCAGT TGAGCAGAAAAC.

[0041] The Tekt1 gene mRNA (XM_038693036.1) comprises 2 introns and 1 exon, and 2 antisense RNA sequences are designed at the connection of the intron and the exon, to interfere with the mRNA transcription process, and the specific sequences are as follows:

[0042] 3) anti-Tekt1-1 (SEQ ID NO. 3):

[0043] GTAAAAAAACAGAGACGTCTCGGTGTTTTTCAGCCGCACGGAACAAGTGACAGAC CACCAGTGGAGAACCATGTCTGTCCCGGACCGCACTCATGGTGGTAGACCCAGTCTAG.

[0044] 4) anti-Tekt1-2 (SEQ ID NO. 4):

[0045] CATCTGCGCCCAGCACAGGGAAACCATTATCATACATAACTTCTGAAAGGTCCACCT ATACCAAGTATTACTTTCAAAATGCAGTTGTATTAAAATTCTCTTTAAAAT.

[0046] The Btg4 gene mRNA (XM_038709490.1) comprises 1 intron and 1 exon, and 1 antisense RNA sequence is designed at the connection of the intron and the exon, to interfere with the mRNA transcription process, and the specific sequence is as follows:

[0047] 5) anti-Btg4-1 (SEQ ID NO. 5):

[0048] TCACCTTTGCTGGGCCTCGTGTTGACAAGTACCATTGGGTCAGCAAATCCCGGTCCT AGAGTGAGCCGCGCCTTCAACATGGAACCGCAGTCGGGTTACTGCTTGGGACGGCAGC CGTGATG.

[0049] The Hsd17b12a gene mRNA (XM_038706744.1) contains 1 intron and 1 exon, and 1 antisense RNA sequence is designed at the junction of the intron and the exon, interfering with the mRNA transcription process, and the specific sequence is as follows:

[0050] 6) anti-Hsd17b12a-1 (SEQ ID NO. 6):

[0051] GATACCTGCAGAGGAGAAAGCTCCGGGAGCAGAAGAATGGAGCAAACTTCAAGA GTGACTAGGAAAGACGGGTGACGAATATGCAGGCAGCAACTCTGTTCTGACCCGGTGA AGCATTAAAGGAAA.

[0052] The 6 antisense RNA sequences are synthesized by Yixin Biotechnology (Shanghai) Co., Ltd.

[0053] 3. Vector construction and PCR amplification

[0054] The synthesized antisense RNA sequence is cloned into the pcDNA3.1 expression vector containing a high-efficiency CMV promoter. The cloning site is located between the Xho I and Xba I restriction sites, which is used as a template for subsequent PCR amplification. The sequence between the cloning sites is about 900 bp in length, the antisense RNA coding sequence is about 100 bp, and the total length of the transfection vector containing the inserted fragment is about 1000 bp. The specific primers PolyAF1 (GCTTAGGGTTAGGCGTTTTGC) and polyAR1 (TCCCCAATCCTCCCTTGCTG) are designed for PCR amplification. The total system of the amplification reaction is 50 μL, including 2×Mastermix 25 μL, 2.5 μL of forward and reverse primers, 18 μL of ultrapure water, and 2 μL of template (antisense RNA fragment vector). The PCR amplification reaction program is as follows: pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 30 seconds, annealing at 50°C for 30 seconds, extension at 72°C for 2 minutes, 35 cycles; extension at 72°C for 5 minutes. The 6 PCR products are mixed in equal volumes (1:1:1:1:1:1) and stored at -4°C for later use. In the negative control (NC) group, the blank expression vector is amplified using the PCR program.

[0055] 4. Preparation of transfection reagent

[0056] The nanoliposome carrier solution was prepared by accurately weighing 3 g of phosphatidylcholine and 1.5 g of cholesterol into 60 mL of anhydrous ethanol, heating to 30°C using a rotary evaporator, and continuously rotating at 0.01 MPa until a thin film was formed at the bottom of the flask. Then, an equal volume of phosphate buffer solution (pH = 7.4) was added, hydrated for 10 min, and then ultrasonically emulsified for 4 min (ultrasonic 5 s, interval 1 s, power 20%). The nanoliposome carrier solution was mixed with the PCR amplification product at a volume ratio of 10:1 to obtain a nanoliposome-PCR product mixture, which was placed in a freezer at -20°C for storage.

[0057] 5. Artificial insemination and seed cultivation

[0058] The parents of the largemouth bass were selected for good early gonadal development, and the water temperature was raised to 24 ± 1°C. The parents were artificially induced after the first injection at 6:00 in the morning, and the second injection was 12 hours later at 6:00 in the evening. The same combination of oxytocin was used for both injections, i.e., 600 units / kg of chorionic gonadotropin (HCG), 6 mg / kg of domperidone (DOM), and 6 μg / kg of luteinizing hormone-releasing hormone analogue (A2). After injection of oxytocin, the parents were continuously observed for signs of mating and egg laying. When the female parent showed signs of egg laying, she was selected and gently squeezed to collect mature eggs into a dry container. The number of eggs was weighed, and 5-7 mL of the nanoliposome-PCR product mixture was added to every 10,000 eggs. The egg transfection operation of the PCR amplification product was completed by gently shaking for 6-8 minutes. Then, a male parent with good gonadal development was selected, and the sperm was collected by gently squeezing the abdomen. 0.5-1 mL of sperm was added to every 10,000 eggs after transfection, and the whole insemination process was completed after shaking for another 30 seconds. After using 200 mL of talcum powder solution (10 g / mL) for every 10,000 fertilized eggs for debinding treatment, the fertilized eggs were poured into a hatching barrel for hatching. Twenty to thirty million fertilized eggs were placed in every 10 L hatching barrel, and the water temperature was controlled at 23-24°C with a water flow rate of 3-7 L / min. The fertilized eggs obtained by the above method were named the gonadal development delay group (female (-) and male (-)).

[0059] The fertilized eggs were obtained by referring to the above method, with the difference that after the eggs were collected, no transfection operation was performed, and the fertilized eggs obtained under natural conditions were named the control group (Con). The fertilized eggs were obtained by referring to the above method, with the difference that the blank expression vector amplified by PCR was mixed with the nanoliposome for transfection, and the negative control group (NC) was named.

[0060] The fish fry is hatched 48-60 hours after the fertilized egg is hatched, and is transferred to the fry cultivation pool after the fish fry swims normally. The brine shrimp is used for opening, and the brine shrimp is fed 4 times a day, starting at 6:30 am, with a 4-hour interval between each feeding. After 8-10 days of continuous feeding of the brine shrimp, the fry is trained to eat, and the fry is replaced with different particle sizes of compound feed according to the growth rate of the fry, until the fry can normally eat the granular feed, that is, the training is completed. The initial fry uses feed with a protein content of more than 48% and a fat content of more than 5%. After the training is completed, the fry is continuously cultivated for 360 days until the fry reaches the sexual maturity specification. During the whole cultivation period, the water temperature is maintained at 26±1℃, the dissolved oxygen is ≥7.5 mg / L, the total ammonia nitrogen and nitrite are ≤0.03 mg / L, and the light cycle is 14L:10D. The commercial feed (crude protein ≥47%, crude fat ≥3%) is fed twice a day at 8:00 am and 4:30 pm.

[0061] Example 2: Characterization of the gonadal development delayed largemouth bass fry

[0062] The gonadal development delayed largemouth bass fry is constructed according to the method of Example 1, and the fry is characterized.

[0063] 1. Transfection positive rate detection

[0064] At 120 days of age, 6 female fish and 6 male fish were randomly selected from the control group, negative control (NC) and gonadal development delay group, and the fish was deeply anesthetized with 200 mg / L MS-222 solution, and the gonadal tissue was dissected and quickly frozen in liquid nitrogen for storage at -80℃. The genomic DNA of the gonadal tissue was extracted using the universal genomic DNA extraction kit of Nanjing Nuo Weizan Biological Technology Co., Ltd. After the DNA was qualified, it was used for PCR amplification, and the amplification system was 20 μL of 0.5 μL of upstream and downstream primers, 1 μL of genomic DNA, 10 μL of premix Taq enzyme and 8 μL of ultrapure water. The PCR reaction program is as follows: 94℃ pre-denaturation for 2 minutes, 95℃ denaturation for 30 seconds, 50℃ annealing for 30 seconds, 72℃ extension for 2 minutes, 35 cycles; 72℃ extension for 5 minutes. The sequences of the used upstream and downstream primers are as follows: F: TTTTGCGCTGCTTCGCGATGTAC; R: TCCCAATCCTCCCCCTTGCTG. Then, the positive transfection rate of the amplification product is detected by 1% agarose gel electrophoresis.

[0065] At 120 days of age, the gonadal time can be observed, and the gonadal tissue of the three treatment groups of female and male fish is detected for transfection positive rate using the four specific primer sequences shown in Table 1. After detection by agarose gel electrophoresis, as shown in FIG. A, the treatment group has a specific band at about 1000 bp, and the NC group has a specific band at 900 bp. Figure 1 A, the treatment group has a specific band at about 1000 bp, and the NC group has a specific band at 900 bp.Figure 1 B), the control group had no band between 900 bp and 1000 bp Figure 1 C), the positive transfection rates of the female and male treatment groups were both 100%. The amplified bands of the agarose gel were excised, purified and then ligated into a cloning vector plasmid. Single clone plasmids were obtained by transforming E. coli and 10 single clone colonies were selected for sequencing by Yixing Biotechnology (Shanghai) Co., Ltd. The results confirmed that the antisense RNA sequences were present in the female and male fish of the treatment groups.

[0066] 2. Identification of gene transcription level

[0067] At 360 days of age, 6 female fish and 6 male fish were randomly selected from the control group, negative control (NC) and gonadal development delay group. The fish were deeply anesthetized with 200 mg / L MS-222 solution and their gonadal tissues were dissected and quickly frozen in liquid nitrogen for storage at -80°C. Total RNA was extracted using the Trizol method. After removing DNA contamination with DNase I enzyme, the integrity of the RNA sample was detected by 1% agarose gel electrophoresis, and the purity and concentration of the RNA were detected using a Nano Photometer N50 microspectrophotometer. Referring to the information of the genome of Micropterus salmoides, specific primers for qPCR amplification were designed using Primer 6.0. The extracted RNA was used as a template to synthesize cDNA, and RT-qPCR was used to detect the transcription level changes of the four genes after transfection. The RT-qPCR reaction system was as follows: 2x SYBR Primix Ex Taq TM , 12.5 μL; 1 μL of each of the upstream and downstream primers; 50x ROX reference Dye II, 0.5 μL; cDNA, 2 μL; RNase-free ddH2O, 8 μL. The PCR reaction program was as follows: 95°C pre-denaturation for 30 seconds, 95°C denaturation for 5 seconds, 60°C annealing for 30 seconds, 72°C extension for 2 minutes, 40 cycles; 72°C extension for 5 minutes. β-actin was used as an internal reference gene, each sample was repeated 3 times, and the gene expression level was statistically analyzed using 2 –ΔΔCt The primer information of dmrt 1, Tekt1, Btg4, Hsd17b12a and β-actin is as follows:

[0068] Table 1: Primer information for RT-qPCR

[0069]

[0070] The results showed that, at 360 days of age when the largemouth bass reached normal sexual maturity, the transcription levels of gonadal development genes were measured in the gonadal tissues of the delayed gonadal development group, the negative control group, and the control group. In females, the transcription levels of Btg4 and Hsd17b12a genes in the delayed gonadal development group (females (-)) were significantly lower than those in the negative control and the control group, while there was no significant difference in transcription levels between the negative control and the control group. The silencing rates of Btg4 and Hsd17b12a genes were 83.4% and 85.5%, respectively. In males, the transcription levels of dmrt1 and Tekt1 genes in the delayed gonadal development group (males (-)) were also significantly lower than those in the negative control and the control group, while there was no significant difference in transcription levels between the negative control and the control group. The silencing rates of dmrt1 and Tekt1 genes were 88.8% and 88.2%, respectively. These results demonstrate that the introduction of antisense RNA fragments successfully reduced the transcription levels of key developmental genes in the gonadal tissues of both male and female fish, leading to gene downregulation and silencing.

[0071] 3. Growth performance testing

[0072] After 360 days of rearing, the growth performance data of 60 experimental fish in each treatment group (30 females and 30 males, sex confirmed by dissection) were recorded after anesthesia with 200 mg / L MS-222. Subsequently, the entire visceral mass was rapidly dissected on crushed ice, and the gonadal tissue was separated and weighed separately for calculating the Gonadal Index (GSI). After 600 days of continued rearing, the growth performance of 60 fish in each treatment group was measured again. The GSI index calculation formula is as follows:

[0073] GSI(%) = (G w / B w )×100.

[0074] Gw is the gonadal weight at the end of cultivation; Bw is the final body weight at the end of cultivation.

[0075] At 360 days of rearing, the growth performance of the delayed gonadal development group, the negative control group, and the control group in both male and female fish was measured. The results are as follows: Figure 3 As shown, in female fish, the final body weight of the delayed gonadal development group (566.47±33.25g) was significantly higher than that of the negative control group (496±17.5g) and the control group (509.45±32.88g) (P<0.05), and the growth rate was 11.2% higher than that of normal female fish. The gonadal index of female fish in the negative control group and the control group reached 8.74% and 8.82% respectively at 360 days, while the gonadal index of female fish in the delayed gonadal development group was only 0.37%, showing a highly significant decrease. Figure 3G, the ovaries of the control group developed normally, filled the entire abdominal cavity, and the development of the gonads of the delayed development group was significantly delayed. In male fish, the final body weight of the gonadal development delay group (654.30 ± 19.00 g) was significantly higher than that of the negative control group (615.34 ± 28.83 g) and the control group (616.45 ± 26.23 g) (P < 0.05), and the growth rate was increased by 6.39% compared with normal male fish. The gonadal index of the negative control group and the control group was 0.71% and 0.73% respectively at 360 days, while the gonadal index of the gonadal development delay group was only 0.03%, and the gonadal index was also significantly decreased. As shown in Figure 3 H, the testis of the control group developed normally as thick strips, while the gonad of the gonadal development delay group was only two thin filaments, which was in the early stage of gonadal development, and the testis development was significantly delayed.

[0076] At 600 days of cultivation, the body weight data of the gonadal development delay group, the negative control group and the control group were continuously observed. As shown in Figure 3 E and 3F, in male and female fish, the body weight of the gonadal development delay group (female 794.24 ± 11.50 g, male 888.83 ± 9.93 g) was significantly higher than that of the negative control group (female 651.79 ± 38.18 g, male 738.68 ± 25.63 g) and the control group (female 653.90 ± 32.27 g, male 737.57 ± 29.25 g), and the growth rate was increased by 21.46% and 20.51% respectively compared with the control group, showing excellent growth performance.

[0077] These results show that the gonads of largemouth bass in the gonadal development delay group are significantly delayed, and the growth rate does not decrease but increases, among which the delayed development of female gonads can effectively solve the problem of high mortality caused by body bloated, slow growth and post-wintering syndrome due to gonadal development, which is of great significance to the production and breeding end.

[0078] 4. Determination of sex hormone level

[0079] After 360 days of cultivation, 12 fish (6 females and 6 males) were randomly selected from the control group, negative control (NC), and gonadal development delay group. 1.5 mL of blood was drawn from the tail vein. After standing for 2 hours, the samples were centrifuged at 5000 rpm for 15 minutes at 4°C to separate the serum, which was then stored at -20°C for later use. After blood sampling, gonadal tissue was dissected and collected, then divided in two. One portion was flash-frozen in liquid nitrogen for gonadal hormone level determination. The other portion was washed with physiological saline, fixed in 4% paraformaldehyde solution, and stored at -4°C for histopathological observation. The levels of estradiol (E2), vitellogenin (VTG), follicle-stimulating hormone (FSH), and luteinizing hormone (LH) in the serum and gonads of female fish were determined by enzyme-linked immunosorbent assay (ELISA), as were the levels of 11-ketotestosterone (11-KT), testosterone (T), follicle-stimulating hormone (FSH), and luteinizing hormone (LH) in the serum and gonadal tissues of male fish.

[0080] Fish sex steroid hormones can directly or indirectly regulate sex differentiation in fish. For example... Figure 4 As shown, the levels of estradiol, vitellogenin, follicle-stimulating hormone (FSH), and luteinizing hormone (LH) in serum and gonadal tissue were significantly lower in the delayed gonadal development group than in the negative and control groups (P<0.05). These sex hormones play important roles in regulating oocyte growth, vitellogenesis, maturation, and ovulation. These results indicate that transfection with antisense RNA fragments significantly reduced sex hormone levels, thereby delaying ovarian development in largemouth bass.

[0081] In male fish, the same changes in sex hormone levels as in female fish were observed. Figure 5 The levels of 11-ketotestosterone, testosterone, follicle-stimulating hormone, and luteinizing hormone in serum and gonadal tissues were significantly lower in the delayed gonadal development group than in the negative and control groups (P<0.05). These sex hormones play a synergistic role at different stages of testicular development and are closely related to spermatogonial proliferation, meiosis, and spermatogenesis. Further evidence in male fish showed that inhibition of antisense RNA significantly reduced sex hormone levels, thereby delaying testicular development in largemouth bass.

[0082] 5. Histological observation of gonads

[0083] After the fixed gonadal tissue was prepared into paraffin sections for histological observation, the HE staining process involved stepwise dehydration of the gonadal tissue in ethanol solutions of different concentrations (70-100%), clearing in a xylene:ethanol (1:1) solution, embedding it twice in molten paraffin, and preparing 4μm thick sections after solidification. Hematoxylin-eosin staining was then performed, followed by mounting in neutral resin. The sections were observed using an Olympus CX22LED optical microscope, with each tissue section examined three times, capturing three fields of view per section. Image J (1.54d) software was used to observe the development of the ovaries and testes.

[0084] like Figure 6 As shown, in the control and negative control groups, the ovaries developed to stage V, with relatively isolated oocytes, filled with a large number of oocytes in late development. These oocytes were filled with numerous yolk granules and lipid droplets, the radial bands thickened, and the nuclei polarized, indicating a transition to maturity. The double follicular membranes were clearly defined. In contrast, in the delayed gonadal development group, ovarian development was significantly delayed, with oocytes predominantly in stages II and III, and fewer oocytes in stage IV. The nuclei had not yet contracted and polarized, and the ovaries were filled with numerous atretic follicles.

[0085] In the control and negative control groups, spermatocyte development in the testes had reached stage IV. The cells in the testes mainly consisted of spermatocytes, spermatids, and secondary spermatocytes, with a few primary spermatocytes and a single spermatogonium. Spermatids and secondary spermatocytes were located on the walls of the renal tubules, characterized by their small size and deep staining. Mature spermatids were stored in the lumen for eventual release. In the delayed gonadal development group, testicular development was also delayed, with normal arrangement of spermatid lobules, but the sperm arrangement in the lumen began to become sparse, with some large areas of blank space, thickened interstitial tissue, and a significant reduction in spermatids and sperm count.

[0086] 6. Determination of volatile flavor compounds

[0087] To investigate the effect of delayed gonadal development on the flavor quality of largemouth bass muscle, the following methods were used: The volatile organic compounds in the muscle of the control group, negative control (NC) and gonadal development delay group were detected. The muscle samples of 2 g from the same part were placed in 20 mL headspace bottles, 3 samples from each group were detected, the magnetic cover was sealed after 45°C incubation for 20 min, 500 uL sample was injected into the GC inlet after the injection needle was heated to 85°C. The GC conditions were: MXT-5 chromatographic column (15.00 m x 0.53 mm, 1.00 um), column temperature 60°C, high-purity N2 (99.999%) as carrier gas and drift gas, carrier gas flow rate 2 mL / min initially, increased to 10 mL / min after 2 min, increased to 100 mL / min after 8 min, and maintained for 10 min. The IMS conditions were: drift tube 45°C, linear voltage 500 V / cm, drift flow rate 150 mL / min. Based on the retention index (RT) and drift time (DT) of the sample, the volatile organic compounds were analyzed according to the NIST and IMS databases using LAV v.2.2.1 software.

[0088] The results are shown in Table 2, a total of 62 volatile compounds were identified, of which 17 were alcohols, 13 were aldehydes, 12 were esters, 7 were ketones, and 13 were other compounds (acids, sulfides, pyrazines, thiazoles and alkanes, etc.). Aldehydes have an important influence on fish flavor, unsaturated aldehydes have unique aroma such as grassy, fruity, etc., and the unique fishy smell of fish is mainly from saturated aldehydes such as pentanal, nonanal and octanal, etc. The proportion of aldehyde compounds in the control group is higher, among which the contents of nonanal, octanal, pentanal and butanal are significantly higher than those in the diapause group, which indicates that the diapause group of largemouth bass can effectively reduce the fishy smell of fish, making it more popular with consumers. Alcohol compounds are the most detected in this application, which are usually generated by fat decomposition and exhibit pleasant odors such as fruit aroma, floral aroma, etc. Compared with short straight-chain alcohols, long straight-chain or branched-chain alcohols have a lower odor threshold and have a greater impact on the flavor of largemouth bass muscle. 1-pentanol has a grassy flavor, 2,3-butanediol has a fruity and creamy flavor, and 3-methyl-3-buten-1-ol is an important precursor of synthetic carotenoids and citral. The proportion of alcohol compounds with pleasant odor in the diapause group is higher, which also plays a key role in improving the flavor of fish. Ketones are the least different compounds, but they can contribute important flavor compounds. 2-butanone and hydroxyacetone can impart buttery, sweet and mushroom flavors to largemouth bass. Overall, gonadal development delay can effectively reduce aldehydes, increase alcohols and ketones, and thus reduce the fishy smell of fish and increase the fruity, creamy and other more attractive flavors of consumers.

[0089] Table 2: Qualitative results of volatile compounds in the muscle of largemouth bass in the control group and diapause group

[0090]

[0091]

[0092] Example 1: Growth performance and transcriptional level determination of micropterus salmoides after single gene and conventional sex determination gene combined knockdown

[0093] The fertilized eggs of the micropterus salmoides for constructing the knockdown gene are constructed and the fry is cultivated according to the specific implementation manner of example 1, and the difference lies in that the type of the knockdown gene is changed. The common female sex determination gene of fish cyp19a1a is closely related to the ovary development and gonadal differentiation of female fish, and has been proved to be a key gene for ovary development of various fish; the male sex determination gene gsdf also plays a role in sex differentiation and spermatogenic cell proliferation. In order to compare the knockdown effect of the female gonadal development key gene combination (btg4, hsd17b12a) and the male gonadal development key gene combination (dmrt1, Tekt1) used in the present application, single gene female (btg4) and male (dmrt1) knockdown, single gene conventional sex determination gene knockdown (female knockdown cyp19a1a, male knockdown gsdf) and conventional sex determination gene combined female (btg4, cyp19a1a) and male (dmrt1, gsdf) knockdown are used respectively, and the terminal weight and gonadal index of the micropterus salmoides after single gene and conventional sex determination gene combined knockdown are also statistically analyzed at the time of 360 days of cultivation.

[0094] The antisense RNA sequence used for knocking down the cyp19a1a gene is AGACGCACCGGCTTCATTCCACAGGGCTGGAGCAGATCACCTGCCATAAGAACGGATGGAGAAGCAAGTCTAAAGCCTCTGAACTGCAGACGTACACTT, and the antisense RNA sequence used for knocking down the gsdf gene is TTTGGACACGCCAGGTGGCTCAGCTTCACACAATTTTGACAAACCCCTGCCTACTTTTTGCTGGGCTGCTGGGCGCTGCCCGGTCCACAGCCGCAGCCGCGAGCCAGCTGCACCGAG. The transcription level of the btg4 gene in the single-gene female fish (btg4) knocking-down group is 24.97% of that in the control group, the transcription level of the cyp19a1a gene in the cyp19a1a knocking-down group is 19.63% of that in the control group, the transcription level of the dmrt1 gene in the single-gene male fish (dmrt1) knocking-down group is 28.94% of that in the control group, and the transcription level of the gsdf gene in the gsdf knocking-down group is 25.85% of that in the control group. The transcription levels of the btg4 and cyp19a1a genes in the conventional gender-determination gene combined female fish (btg4, cyp19a1a) knocking-down group are 28.04% and 18.48% of those in the control group, respectively, and the transcription levels of the dmrt1 and gsdf genes in the conventional gender-determination gene combined male fish (dmrt1, gsdf) knocking-down group are 28.55% and 26.20% of those in the control group, respectively.

[0095] As shown in Table 3, the single genes btg4, cyp19a1a, dmrt1 and gsdf are used to interfere with the development of female and male gonads, and the final body weight has no significant difference from that of the control group and the negative control group. Meanwhile, the gonadal index decreases, but the decrease is low and has no significant difference from that of the control group and the negative control group, indicating that the single genes cannot achieve the effect of delaying gonadal development. The combination of btg4 / cyp19a1a and dmrt1 / gsdf is used to inhibit the development of the gonads of the largemouth bass, and the growth performance of the two kinds of conventional gender-determination gene combined knocking-down largemouth bass is counted at 360 days of cultivation. The results show that the combination of btg4 / cyp19a1a and dmrt1 / gsdf cannot significantly increase the body weight and reduce the gonadal index, and cannot achieve the technical effect in Embodiment 2.

[0096] The above results show that the gender development of the largemouth bass may be jointly regulated by multiple genes, and the conventional gender-determination genes have no significant effect on the growth and development, which further reflects the innovation of the present application in cultivating the largemouth bass with delayed gonadal development.

[0097] Table 3: Growth performance and transcript level determination of Micropterus salmoides after single gene combined with conventional sex determination gene knockdown

[0098]

[0099]

[0100] Although the present application has been disclosed in its preferred embodiments as described above, it is not intended to limit the present application thereto, and it is understood that any modification and alteration thereto is possible without departing from the spirit and scope of the present application, and the scope of protection of the present application should be defined by the appended claims.

Claims

1. A method of delaying the development of the gonads of large-mouth bass, increasing the rate of growth and / or improving the flavor of the flesh, characterized in that, Reducing expression of dmrt, Tekt1, Btg4 and / or Hsd17b12a in Micropterus salmoides.

2. The method of claim 1, wherein, The method comprises the following steps: (1) constructing a recombinant vector expressing an antisense RNA sequence of dmrt, Tekt1, Btg4 or Hsd17b12a, respectively; (2) transfecting the recombinant vector of step (1) into M. salmoides ova, and then in vitro fertilizing to obtain zygotes; (3) hatching and culturing the zygotes of step (2) to obtain M. salmoides.

3. The method of claim 2, wherein, The antisense RNA sequence of the gene dmrt is shown in SEQ ID NO. 1 and SEQ ID NO. 2; the antisense RNA sequence of the gene Tekt1 is shown in SEQ ID NO. 3 and SEQ ID NO. 4; the antisense RNA sequence of the gene Btg4 is shown in SEQ ID NO. 5; the antisense RNA sequence of the gene Hsd17b12a is shown in SEQ ID NO. 6; and the expression level of the genes dmrt, Tekt1, Btg4 and / or Hsd17b12a is reduced by more than 80%.

4. The method of claim 3, wherein, The recombinant vector of step (1) includes but is not limited to a pcDNA3.1 expression vector containing a CMV promoter.

5. The method of claim 4, wherein, The transfection of step (2) is performed by mixing a nano-lipid carrier solution with the recombinant vector to obtain a mixture, and adding the mixture into the ova; the nano-lipid carrier solution contains phosphatidylcholine, cholesterol and a phosphate buffer solution.

6. The method of claim 5, wherein, 5-7 mL of the mixture is added to 10,000 ova.

7. The method of claim 6, wherein, 0.5-1 mL of sperm is added to 10,000 ova after transfection to obtain zygotes.

8. The method of claim 7, wherein, The hatching conditions are water temperature of 23-24°C and water flow rate of 3-7 L / min.

9. The method of claim 8, wherein, The culturing conditions are water temperature of 25-27°C, dissolved oxygen of ≥7.5 mg / L, and total ammonia nitrogen and nitrite of ≤0.03 mg / L.

10. Use of the genes dmrt, Tekt1, Btg4 and / or Hsd17b12a in delaying gonadal development of M. salmoides, improving growth rate and / or meat flavor of M. salmoides.

Images