A set of production technical process of delayed puberty of largemouth bass
By silencing key genes related to gonadal development in largemouth bass using antisense RNA technology, the problems of slow growth, poor body shape, and unsatisfactory meat quality caused by gonadal development issues in largemouth bass have been solved, achieving the effects of delayed gonadal development, faster growth rate, and delicious meat.
Patent Information
- Application Number
- CN202511029782.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-25
- Publication Date
- 2026-07-10
- Estimated Expiration
- 2045-07-25
AI Technical Summary
Current technology lacks methods to construct largemouth bass with delayed gonadal development, fast growth rate, and delicious meat, resulting in problems such as slower growth rate, poorer body size, easy "egg dropping" and high mortality rate in female largemouth bass.
By silencing key genes dmrt1, Tekt1, btg4, and hsd17b12a for gonad development in largemouth bass using antisense RNA technology, their expression levels were reduced, resulting in largemouth bass with delayed gonad development.
It significantly improves growth rate, reduces gonadal index, enhances meat flavor, increases overwintering survival rate, improves meat flavor, reduces unpleasant flavor substances, and enhances growth performance and meat yield.
Smart Images

Figure CN121065268B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a production technology process for largemouth bass with delayed gonadal development, belonging to the field of aquatic animal biological breeding technology. Background Technology
[0002] Largemouth bass is a representative of my country's distinctive aquatic economic fish. Largemouth bass farming technology in my country has broken through geographical limitations, and the farming area is gradually expanding, widely distributed from south to north, indicating significant industry development potential. However, with the rapid development of the largemouth bass farming industry, unfavorable factors hindering its continued expansion are also increasing. In some areas, low winter temperatures and long farming cycles mean that fish generally don't reach marketable size until the following year. At six months of age, the ovaries of largemouth bass begin to develop, with the gonadal index remaining at 2%. By March to May of the following year, the gonadal index reaches over 10%, leading to slower growth and a higher feed conversion ratio in females. Simultaneously, females with swollen abdomens have poor body shape, are prone to ovulation loss leading to postpartum syndrome, and have a high mortality rate. Breeding largemouth bass with delayed gonadal development is one of the most effective methods to solve these problems. Largemouth bass with delayed gonadal development can fundamentally solve a series of production problems caused by the gonadal development of females, meeting the urgent needs of the largemouth bass industry for quality improvement, efficiency enhancement, and sustainable development.
[0003] In aquaculture, delaying gonadal development in fish to improve growth rate and yield is a feasible strategy. However, there is no strong evidence to support the claim that delaying gonadal development can improve meat quality and nutrition. Studies have shown that in tilapia and large yellow croaker, delaying gonadal development not only failed to significantly improve flavor but may have also led to a reduction in key flavor compounds, tougher meat, and decreased umami. This indicates that there is no necessary positive correlation between gonadal development and meat flavor, and that the influencing mechanisms are complex and species-specific. Therefore, achieving the triple goals of delaying development, accelerating growth, and improving umami simultaneously through a single method is extremely challenging and requires a deep understanding of the mechanisms and multi-target synergistic regulation.
[0004] There is a lack of existing technologies for constructing largemouth bass with delayed gonadal development, fast growth rate, and delicious meat. Summary of the Invention
[0005] This invention uses antisense RNA technology to silence key genes (dmrt1, Tekt1; btg4, hsd17b12a) for gonadal development in largemouth bass, thereby obtaining new germplasm with delayed gonadal development and providing a new perspective for solving the bottleneck problem of "postpartum syndrome" in largemouth bass.
[0006] This invention provides a method for delaying gonadal development, increasing growth rate, and / or improving meat flavor in largemouth bass by reducing the expression of dmrt, Tekt1, Btg4, and / or Hsd17b12a in largemouth bass.
[0007] In one implementation, antisense RNA sequences are used to downexpress dmrt, Tekt1, Btg4, and / or Hsd17b12a in largemouth bass fertilized eggs. The eggs are then hatched and cultured to obtain largemouth bass with delayed gonadal development, improved growth rate, and / or enhanced meat flavor.
[0008] In one implementation, the method includes the following steps:
[0009] (1) Construct recombinant vectors expressing antisense RNA sequences of dmrt, Tekt1, Btg4 or Hsd17b12a respectively;
[0010] (2) Transfect the recombinant vector described in step (1) into largemouth bass eggs, and then fertilize them in vitro to obtain fertilized eggs;
[0011] (3) Hatching and culturing the fertilized eggs described in step (2) yields largemouth bass.
[0012] In one embodiment, the antisense RNA sequence of the gene dmrt is shown in SEQ ID NO.1 and SEQ ID NO.2; the antisense RNA sequence of the gene Tekt1 is shown in SEQ ID NO.3 and SEQ ID NO.4; the antisense RNA sequence of the gene Btg4 is shown in SEQ ID NO.5; and the antisense RNA sequence of the gene Hsd17b12a is shown in SEQ ID NO.6.
[0013] In one embodiment, recombinant vectors expressing the antisense RNA sequences shown in SEQ ID NO.1 to SEQ ID NO.6 are constructed respectively, and the resulting recombinant vectors are simultaneously transfected into largemouth bass eggs.
[0014] In one implementation, the expression levels of genes dmrt, Tekt1, Btg4 and / or Hsd17b12a are reduced by more than 80%.
[0015] In one embodiment, the recombinant vector in step (1) includes, but is not limited to, pcDNA3.1 expression vector containing a CMV promoter.
[0016] In one embodiment, the transfection in step (2) involves mixing the nanolipid carrier solution with the recombinant carrier to obtain a mixture, and then adding the mixture to the oocytes; the nanolipid carrier solution contains phosphatidylcholine, cholesterol, and phosphate buffer solution.
[0017] In one embodiment, 5-7 mL of the mixture is added for every 10,000 eggs.
[0018] In one implementation, 0.5-1 mL of semen is added to every 10,000 transfected eggs to obtain fertilized eggs.
[0019] In one embodiment, the incubation conditions are a water temperature of 23°C-24°C and a water flow rate of 3-7 liters / minute.
[0020] In one embodiment, the cultivation conditions are: water temperature 25-27℃, dissolved oxygen ≥7.5mg / L, and total ammonia nitrogen and nitrite ≤0.03mg / L.
[0021] This invention also provides the application of genes dmrt, Tekt1, Btg4 and / or Hsd17b12a in delaying gonadal development, improving growth rate and / or meat flavor of largemouth bass.
[0022] Beneficial effects:
[0023] The method described in this invention can significantly improve growth performance and meat yield, increase feed conversion rate, enhance overwintering survival rate, and effectively improve meat flavor. After 600 days of cultivation, the growth rates of female and male fish in the gonadal development delay group were 21.46% and 20.51% higher than the control group, respectively, demonstrating excellent growth performance. After 360 days of cultivation, the content of 1-pentanol, 3-methyl-3-buten-1-ol, 2,3-butanediol, 2-butanone, and hydroxyacetone in the muscle flavor compounds of the gonadal development delay group was significantly increased, while the content of undesirable flavor compounds such as n-butyraldehyde, n-pentanaldehyde, nonanaldehyde, and n-octanaldehyde was significantly reduced. This reduced the earthy taste of the fish meat and increased fruity and milky aromas, making it more appealing to consumers and conducive to large-scale industrial promotion. Attached Figure Description
[0024] Figure 1 The positive transfection rate of male and female fish was determined. A. A1-A6 were female fish treated with transfection reagent, and A7-A12 were male fish treated with transfection reagent; B. B1-B6 were female fish used as negative controls, and B7-B12 were male fish used as negative controls; C. C1-C6 were female fish used as control groups, and C7-C12 were male fish used as control groups.
[0025] Figure 2 The transcriptional levels of the Btg4, Hsd17b12a, dmrt1, and Tekt1 genes were determined in male and female fish after 360 days of rearing.
[0026] Figure 3 This study compares the growth performance of male and female fish. A and C: Final body weight of male and female fish after 360 days of rearing; B and D: Gonadal index of male and female fish after 360 days of rearing; EF: Final body weight of male and female fish after 600 days of rearing; G: Phenotypic observation of female gonads; H: Phenotypic observation of male gonads.
[0027] Figure 4 To determine the serum and gonadal hormone levels of female largemouth bass after 360 days of rearing.
[0028] Figure 5 To determine the serum and gonadal hormone levels of male largemouth bass after 360 days of breeding.
[0029] Figure 6 Histological observation of the gonads of male and female largemouth bass at 360 days of breeding. Detailed Implementation
[0030] The present invention will be further described in detail below with reference to specific embodiments, but the implementation of the present invention is not limited to the scope shown in this embodiment.
[0031] The "gene silencing rate" or "reduced expression level" involved in this invention refers to the degree of reduction in gene transcription level in the tissues of largemouth bass after regulation, compared with normal largemouth bass without gene regulation.
[0032] Example 1: Construction of Largemouth Bass Fry with Delayed Gonadal Development
[0033] 1. Breeding of largemouth bass broodstock
[0034] Select robust, well-fed parent stock with no external injuries, obvious sexual characteristics, and a weight greater than 600g, aged 24 months or older. Choose a dedicated parent stock rearing pond, ensuring dissolved oxygen ≥5mg / L, ammonia nitrogen <0.2mg / L, nitrite <0.1mg / L, and temperature controlled at 15±1℃. Two months before the breeding season, provide intensive feeding to the parent stock, with a protein content higher than 45%, a fat content higher than 3%, and supplemented with vitamins, minerals, and unsaturated fatty acids, at a daily feeding rate of 1.5%-3.0%. During the parent stock rearing period, conduct daily inspections and disease control to cultivate parent stock with well-developed gonads, strong reproductive capacity, and the ability to produce high-quality, healthy seedlings.
[0035] 2. Antisense RNA sequence design and synthesis
[0036] For inducing gonadal delay, key gonadal development genes (dmrt1, Tekt1) were used in male and female fish (btg4, hsd17b12a). Antisense RNA sequences were designed based on the mRNA of these genes. The dmrt1 gene mRNA (XM_038703752.1) contains two introns and one exon. Two antisense RNA sequences were designed at the junctions of the introns and exons to interfere with the mRNA transcription process. The specific sequences are as follows:
[0037] 1) anti-dmrt1-1 (SEQ ID NO.1):
[0038] CCTGGGCAGGTCTAGCAGTTGGCATCAGACTTTTTGTTGTTTCATTCTCAGTAAGGT TAGCCATGAGCAAGGACAAGCAGAGCAAGCAAGTGCCGGAGTGCACTGG.
[0039] 2) anti-dmrt1-2 (SEQ ID NO.2):
[0040] TGAGTGCGAGGCCAGCAGCGAGACTCCAAACTTCACAGTCAACTCCATCATCGAC GCCACCAAATAAAAGAAGCTAAGGAAAGCGTTATTAAAAATAATCATTGTGAGATCAGT TGAGCAGAAAAC.
[0041] The Tekt1 gene mRNA (XM_038693036.1) contains two introns and one exon. Two antisense RNA sequences were designed at the junctions of the introns and exons to interfere with the mRNA transcription process. The specific sequences are as follows:
[0042] 3) anti-Tekt1-1 (SEQ ID NO.3):
[0043] GTAAAAAAACAGAGACGTCTCGGTGTTTTTCAGCCGCACGGAACAAGTGACAGAC CACCAGTGGAGAACCATGTCTGTCCCGGACCGCACTCATGGTGGTAGACCCAGTCTAG.
[0044] 4) anti-Tekt1-2 (SEQ ID NO.4):
[0045] CATCTGCGCCCAGCACAGGGAAACCATTATCATACATAACTTCTGAAAGGTCCACCT ATACCAAGTATTACTTTCAAAATGCAGTTGTATTAAAATTCTCTTTAAAAT.
[0046] The Btg4 gene mRNA (XM_038709490.1) contains one intron and one exon. An antisense RNA sequence was designed at the junction of the intron and exon to interfere with the mRNA transcription process. The specific sequence is as follows:
[0047] 5) anti-Btg4-1 (SEQ ID NO.5):
[0048] TCACCTTTGCTGGGCCTCGTGTTGACAAGTACCATTGGGTCAGCAAATCCCGGTCCT AGAGTGAGCCGCGCCTTCAACATGGAACCGCAGTCGGGTTACTGCTTGGGACGGCAGC CGTGATG.
[0049] The Hsd17b12a gene mRNA (XM_038706744.1) contains one intron and one exon. An antisense RNA sequence is designed at the junction of the intron and exon to interfere with the mRNA transcription process. The specific sequences are as follows:
[0050] 6) anti-Hsd17b12a-1 (SEQ ID NO.6):
[0051] GATACCTGCAGAGGAGAAAGCTCCGGGAGCAGAAGAATGGAGCAAACTTCAAGA GTGACTAGGAAAGACGGGTGACGAATATGCAGGCAGCAACTCTGTTCTGACCCGGTGA AGCATTAAAGGAAA.
[0052] All six antisense RNA sequences were sent to Yixin Biotechnology (Shanghai) Co., Ltd. for synthesis.
[0053] 3. Vector construction and PCR amplification
[0054] The synthesized antisense RNA sequence was cloned into the pcDNA3.1 expression vector containing a highly efficient CMV promoter. The cloning site was located between the Xho I and Xba I restriction sites and served as the template for subsequent PCR amplification. The sequence length between the cloning sites was approximately 900 bp, the antisense RNA coding sequence was approximately 100 bp, and the total length of the transfection vector containing the insert fragment was approximately 1000 bp. Specific primers for PCR amplification, PolyAF1 (GCTTAGGGTTAGGCGTTTTGC) and polyAR1 (TCCCCAATCCTCCCTTGCTG), were designed. The total amplification reaction system was 50 μL, including 25 μL of 2×Mastermix, 2.5 μL each of forward and reverse primers, 18 μL of ultrapure water, and 2 μL of template (antisense RNA fragment vector). The PCR amplification reaction program was: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 2 min, 35 cycles; final extension at 72°C for 5 min. The six amplified PCR products were mixed in equal volumes (1:1:1:1:1:1) and stored at -4°C for later use. In the negative control (NC) group, the blank expression vector was amplified using a PCR program.
[0055] 4. Preparation of transfection reagent
[0056] To prepare the nanoliposome carrier solution, accurately weigh 3g of phosphatidylcholine and 1.5g of cholesterol and add them to 60mL of anhydrous ethanol. Heat the solution to 30℃ using a rotary evaporator and continuously evaporate at 0.01MPa until a thin film forms at the bottom of the flask. Then add an equal volume of phosphate buffer solution (pH=7.4), hydrate for 10min, and then sonicate for 4min (5s sonication, 1s interval, 20% power) to obtain the nanoliposome carrier solution. Thoroughly mix the prepared nanoliposome carrier solution with the PCR amplification product at a volume ratio of 10:1 to obtain the nanoliposome-PCR product mixture, and store at -20℃ for later use.
[0057] 5. Artificial insemination and seedling cultivation
[0058] Largemouth bass broodstock with well-developed gonads were selected, and artificial spawning was induced after the water temperature was raised to 24±1℃. The first spawning induction injection was given at 6:00 AM, and the second injection was given 12 hours later at 6:00 PM. Both injections used the same oxytocin combination: 600 units / kg human chorionic gonadotropin (HCG), 6 mg / kg dioxin (DOM), and 6 μg / kg luteinizing hormone-releasing hormone analog (A2). After the oxytocin injection, the broodstock were continuously observed for signs of mating and spawning. Once spawning signs appeared, female broodstock were immediately selected, and mature eggs were collected by gently squeezing their abdomens into a dry container. The number of eggs was weighed, and 5-7 mL of the above-mentioned nanoliposome-PCR product mixture was added for every 10,000 eggs. The eggs were then gently shaken for 6-8 minutes to complete the transfection of the PCR amplification product. Subsequently, male fish with well-developed gonads were selected, and semen was collected by gently squeezing their abdomens. 0.5-1 mL of semen was added to every 10,000 transfected eggs, and the mixture was shaken for 30 seconds to complete the fertilization process. Every 10,000 fertilized eggs were treated with 200 mL of talcum powder solution (10 g / mL) to remove adhesions before being transferred to incubation tanks. Each 10L incubation tank contained 200,000-300,000 fertilized eggs, with the water temperature controlled at 23℃-24℃ and the water flow rate at 3-7 liters / minute. The fertilized eggs obtained using the above method were named the gonadal development delay group (female (-) and male (-)).
[0059] Fertilized eggs were obtained using the same method as described above, except that no transfection was performed after egg collection. These naturally fertilized eggs were named the control group (Con). Fertilized eggs were also obtained using the same method, except that a PCR-amplified blank expression vector was mixed with nanoliposomes for transfection; these were named the negative control group (NC).
[0060] Fertilized eggs hatch 48-60 hours after hatching. Once the fry are swimming horizontally, they are transferred to a fry rearing pond for further rearing. They are initially fed brine shrimp four times a day, starting at 6:30 AM with four-hour intervals between feedings. This brine shrimp feeding continues for 8-10 days. Afterward, acclimation to commercial feed begins, using powdered feed, crushed feed, and pelleted feed, varying the particle size according to the fry's growth rate, until they can normally consume pelleted feed. Initially, the fry are fed a feed with a protein content higher than 48% and a fat content higher than 5%. After acclimation, they are reared for 360 days until they reach sexual maturity. Throughout the rearing period, the water temperature is maintained at 26±1℃, dissolved oxygen ≥7.5mg / L, total ammonia nitrogen and nitrite ≤0.03mg / L, and the photoperiod is 14L:10D. Commercial feed (crude protein ≥47%, crude fat ≥3%) is given twice daily, at 8:00 AM and 4:30 PM.
[0061] Example 2: Characterization of largemouth bass fry with delayed gonadal development
[0062] Largemouth bass fry with delayed gonadal development were constructed using the method described in Example 1, and the fry were characterized.
[0063] 1. Detection of positive transfection rate
[0064] At 120 days of age, 6 female and 6 male fish were randomly selected from the control group, negative control (NC), and gonadal development delay group. The fish were deeply anesthetized with 200 mg / L MS-222 solution, and their gonadal tissues were dissected and rapidly frozen in liquid nitrogen at -80°C for later use. Genomic DNA was extracted from the gonadal tissues using the universal genomic DNA extraction kit from Nanjing Novizan Biotechnology Co., Ltd. After passing quality control, the DNA was used for PCR amplification. The amplification system consisted of 20 μL of 0.5 μL each of forward and reverse primers, 1 μL of genomic DNA, 10 μL of premixed Taq enzyme, and 8 μL of ultrapure water. The PCR reaction program was: 94°C pre-denaturation for 2 minutes, 95°C denaturation for 30 seconds, 50°C annealing for 30 seconds, 72°C extension for 2 minutes, 35 cycles; 72°C extension for 5 minutes. The forward and reverse primer sequences used were: F: TTTTGCGCTGCTTCGCGATGTAC; R: TCCCAATCCTCCCCCTTGCTG. The positive transfection rate of the amplification products was then detected by 1% agarose gel electrophoresis.
[0065] When gonads were observable at 120 days of age, the transfection positivity rate of gonad tissues from the three treatment groups of female and male fish was detected using the four pairs of specific primer sequences shown in Table 1. The results were then analyzed by agarose gel electrophoresis. Figure 1 As shown in Figure A, the treatment group has a specific band at around 1000bp, while the NC group has a specific band at 900bp. Figure 1 B), the control group showed no bands between 900bp and 1000bp. Figure 1 C) The positive transfection rate reached 100% in both the female and male fish treatment groups. The amplified bands on the agarose gel were removed, purified, and ligated into a cloning vector plasmid. Monoclonal plasmids were obtained through transformation with *E. coli*, and 10 monoclonal colonies were selected and sent to Yixin Biotechnology (Shanghai) Co., Ltd. for sequencing. The results confirmed the presence of transfected antisense RNA sequences in both the male and female fish in the treatment groups.
[0066] 2. Identification of gene transcription level
[0067] At 360 days of age, 6 female and 6 male fish were randomly selected from the control group, negative control (NC), and gonadal development delay group. The fish were deeply anesthetized with 200 mg / L MS-222 solution, and their gonadal tissues were dissected and rapidly frozen in liquid nitrogen at -80°C for later use. Total RNA was extracted using the Trizol method. After removing DNA contamination with DNase I, the integrity of the RNA samples was assessed by 1% agarose gel electrophoresis, and the purity and concentration of RNA were determined using a Nano Photometer N50 micro-spectrophotometer. Specific primers for qPCR amplification were designed using Primer 6.0 based on the largemouth bass genome information. cDNA was synthesized using the extracted RNA as a template, and RT-qPCR was used to detect changes in the transcriptional levels of four genes after transfection. The 25 μL RT-qPCR reaction system was as follows: 2×SYBR Primix Ex Taq TM 12.5 μL of reagent; 1 μL each of forward and reverse primers; 0.5 μL of 50× ROX reference Dye II; 2 μL of cDNA; 8 μL of RNase-free ddH2O. The PCR program was: 95℃ pre-denaturation for 30 seconds, 95℃ denaturation for 5 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 2 minutes, 40 cycles; 72℃ extension for 5 minutes. β-actin was used as an internal control gene, and each sample was repeated 3 times. –ΔΔCt The method was used to statistically analyze gene expression levels. Primer information for dmrt1, Tekt1, Btg4, Hsd17b12a, and β-actin is as follows:
[0068] Table 1: Gene Primer Information Used in RT-qPCR
[0069]
[0070] The results showed that, at 360 days of age when the largemouth bass reached normal sexual maturity, the transcription levels of gonadal development genes were measured in the gonadal tissues of the delayed gonadal development group, the negative control group, and the control group. In females, the transcription levels of Btg4 and Hsd17b12a genes in the delayed gonadal development group (females (-)) were significantly lower than those in the negative control and the control group, while there was no significant difference in transcription levels between the negative control and the control group. The silencing rates of Btg4 and Hsd17b12a genes were 83.4% and 85.5%, respectively. In males, the transcription levels of dmrt1 and Tekt1 genes in the delayed gonadal development group (males (-)) were also significantly lower than those in the negative control and the control group, while there was no significant difference in transcription levels between the negative control and the control group. The silencing rates of dmrt1 and Tekt1 genes were 88.8% and 88.2%, respectively. These results demonstrate that the introduction of antisense RNA fragments successfully reduced the transcription levels of key developmental genes in the gonadal tissues of both male and female fish, leading to gene downregulation and silencing.
[0071] 3. Growth performance testing
[0072] After 360 days of rearing, the growth performance data of 60 experimental fish in each treatment group (30 females and 30 males, sex confirmed by dissection) were recorded after anesthesia with 200 mg / L MS-222. Subsequently, the entire visceral mass was rapidly dissected on crushed ice, and the gonadal tissue was separated and weighed separately for calculating the Gonadal Index (GSI). After 600 days of continued rearing, the growth performance of 60 fish in each treatment group was measured again. The GSI index calculation formula is as follows:
[0073] GSI(%) = (G w / B w )×100.
[0074] Gw is the gonadal weight at the end of cultivation; Bw is the final body weight at the end of cultivation.
[0075] At 360 days of rearing, the growth performance of the delayed gonadal development group, the negative control group, and the control group in both male and female fish was measured. The results are as follows: Figure 3 As shown, in female fish, the final body weight of the delayed gonadal development group (566.47±33.25g) was significantly higher than that of the negative control group (496±17.5g) and the control group (509.45±32.88g) (P<0.05), and the growth rate was 11.2% higher than that of normal female fish. The gonadal index of female fish in the negative control group and the control group reached 8.74% and 8.82% respectively at 360 days, while the gonadal index of female fish in the delayed gonadal development group was only 0.37%, showing a highly significant decrease. Figure 3As shown in Figure G, in the control group, the female ovaries developed normally, filling the entire abdominal cavity, while in the gonadal development-delayed group, the ovaries only occupied a small portion of the abdominal cavity, indicating significant delayed development. Similarly, in the male fish, the final body weight of the gonadal development-delayed group (654.30±19.00g) was significantly higher than that of the negative control group (615.34±28.83g) and the control group (616.45±26.23g) (P<0.05), and the growth rate was 6.39% higher than that of normal male fish. At 360 days, the gonadal index of the male fish in the negative control group and the control group was 0.71% and 0.73%, respectively, while the gonadal index of the male fish in the gonadal development-delayed group was only 0.03%, showing a highly significant decrease. Figure 3 In the control group, the male fish had normal testes that were thick and ribbon-like, while the male fish in the delayed gonadal development group had only two thin filaments in their gonads, indicating that they were in the early stage of gonadal development and that the testes were significantly delayed.
[0076] At 600 days of cultivation, the body weight data of the gonadal development delay group, the negative control group, and the control group were continuously observed. Figure 3 As shown in E and 3F, in both male and female fish, the body weight of the delayed gonadal development group (female 794.24±11.50g, male 888.83±9.93g) was significantly higher than that of the negative control group (female 651.79±38.18g, male 738.68±25.63g) and the control group (female 653.90±32.27g, male 737.57±29.25g). Compared with the control group, the growth rate increased by 21.46% and 20.51%, respectively, showing excellent growth performance.
[0077] These results demonstrate that the gonads of the largemouth bass in the delayed gonad development group showed significant delayed development, while their growth rate did not decrease but instead increased. In particular, the delayed development of the female gonads can effectively solve the problems of bloated body shape, reduced growth rate, and high mortality rate caused by postpartum syndrome during winter caused by gonad development, which is of great significance to the production and aquaculture sector.
[0078] 4. Sex hormone level measurement
[0079] After 360 days of cultivation, 12 fish (6 females and 6 males) were randomly selected from the control group, negative control (NC), and gonadal development delay group. 1.5 mL of blood was drawn from the tail vein. After standing for 2 hours, the samples were centrifuged at 5000 rpm for 15 minutes at 4°C to separate the serum, which was then stored at -20°C for later use. After blood sampling, gonadal tissue was dissected and collected, then divided in two. One portion was flash-frozen in liquid nitrogen for gonadal hormone level determination. The other portion was washed with physiological saline, fixed in 4% paraformaldehyde solution, and stored at -4°C for histopathological observation. The levels of estradiol (E2), vitellogenin (VTG), follicle-stimulating hormone (FSH), and luteinizing hormone (LH) in the serum and gonads of female fish were determined by enzyme-linked immunosorbent assay (ELISA), as were the levels of 11-ketotestosterone (11-KT), testosterone (T), follicle-stimulating hormone (FSH), and luteinizing hormone (LH) in the serum and gonadal tissues of male fish.
[0080] Fish sex steroid hormones can directly or indirectly regulate sex differentiation in fish. For example... Figure 4 As shown, the levels of estradiol, vitellogenin, follicle-stimulating hormone (FSH), and luteinizing hormone (LH) in serum and gonadal tissue were significantly lower in the delayed gonadal development group than in the negative and control groups (P<0.05). These sex hormones play important roles in regulating oocyte growth, vitellogenesis, maturation, and ovulation. These results indicate that transfection with antisense RNA fragments significantly reduced sex hormone levels, thereby delaying ovarian development in largemouth bass.
[0081] In male fish, the same changes in sex hormone levels as in female fish were observed. Figure 5 The levels of 11-ketotestosterone, testosterone, follicle-stimulating hormone, and luteinizing hormone in serum and gonadal tissues were significantly lower in the delayed gonadal development group than in the negative and control groups (P<0.05). These sex hormones play a synergistic role at different stages of testicular development and are closely related to spermatogonial proliferation, meiosis, and spermatogenesis. Further evidence in male fish showed that inhibition of antisense RNA significantly reduced sex hormone levels, thereby delaying testicular development in largemouth bass.
[0082] 5. Histological observation of gonads
[0083] After the fixed gonadal tissue was prepared into paraffin sections for histological observation, the HE staining process involved stepwise dehydration of the gonadal tissue in ethanol solutions of different concentrations (70-100%), clearing in a xylene:ethanol (1:1) solution, embedding it twice in molten paraffin, and preparing 4μm thick sections after solidification. Hematoxylin-eosin staining was then performed, followed by mounting in neutral resin. The sections were observed using an Olympus CX22LED optical microscope, with each tissue section examined three times, capturing three fields of view per section. Image J (1.54d) software was used to observe the development of the ovaries and testes.
[0084] like Figure 6 As shown, in the control and negative control groups, the ovaries developed to stage V, with relatively isolated oocytes, filled with a large number of oocytes in late development. These oocytes were filled with numerous yolk granules and lipid droplets, the radial bands thickened, and the nuclei polarized, indicating a transition to maturity. The double follicular membranes were clearly defined. In contrast, in the delayed gonadal development group, ovarian development was significantly delayed, with oocytes predominantly in stages II and III, and fewer oocytes in stage IV. The nuclei had not yet contracted and polarized, and the ovaries were filled with numerous atretic follicles.
[0085] In the control and negative control groups, spermatocyte development in the testes had reached stage IV. The cells in the testes mainly consisted of spermatocytes, spermatids, and secondary spermatocytes, with a few primary spermatocytes and a single spermatogonium. Spermatids and secondary spermatocytes were located on the walls of the renal tubules, characterized by their small size and deep staining. Mature spermatids were stored in the lumen for eventual release. In the delayed gonadal development group, testicular development was also delayed, with normal arrangement of spermatid lobules, but the sperm arrangement in the lumen began to become sparse, with some large areas of blank space, thickened interstitial tissue, and a significant reduction in spermatids and sperm count.
[0086] 6. Determination of volatile flavor compounds
[0087] To investigate the effect of delayed gonadal development on the flavor quality of largemouth bass muscle, the following methods were used: The composition and content of volatile organic compounds (VOCs) in muscle tissue were determined in the control group, negative control (NC), and gonadal development delay group. After 360 days of cultivation, 2g of muscle samples from the same location were weighed and placed in 20mL headspace vials. Three samples were tested per group. After magnetic sealing, the vials were incubated at 45℃ for 20 min. Then, 500µL of sample was injected into the GC inlet after the injection needle was heated to 85℃. GC conditions were as follows: MXT-5 column (15.00m × 0.53mm, 1.00μm), column temperature 60℃, high-purity N2 (99.999%) as carrier and drift gas, initial carrier gas flow rate 2mL / min, increased to 10mL / min after 2 min, then increased to 100mL / min after 8 min, and maintained for 10 min. IMS conditions were: drift tube 45℃, linear voltage 500V / cm, drift flow rate 150mL / min. Volatile organic compounds were analyzed using LAV v.2.2.1 software based on the retention index (RT) and drift time (DT) of the samples, according to the NIST and IMS databases.
[0088] The results are shown in Table 2. A total of 62 volatile compounds were identified, with alcohols being the most numerous (17), followed by aldehydes (13), esters (12), ketones (7), and 13 other compounds (acids, thioethers, pyrazines, thiazoles, and alkanes, etc.). Aldehydes have a significant impact on the flavor of fish. Unsaturated aldehydes have unique aromas such as grassy and fruity notes, while the earthy taste characteristic of fish mainly comes from saturated aldehydes such as pentanal, nonanal, and octanal. The control group had a higher proportion of aldehyde compounds, with nonanal, octanal, pentanal, and butyral all significantly higher than those in the diapause group. This indicates that the diapause group effectively reduced the earthy taste of the largemouth bass, making it more appealing to consumers. Alcohols were the most frequently detected compounds in this invention. They are typically generated from fat decomposition and exhibit pleasant aromas such as fruit and floral notes. Compared to short-chain alcohols, long-chain or branched-chain alcohols have lower odor thresholds and have a greater impact on the flavor of largemouth bass muscle. 1-Pentanol has a grassy aroma, 2,3-butanediol has fruity and creamy aromas, and 3-methyl-3-buten-1-ol is an important precursor for the synthesis of carotenoids and citral. The diapause group had a higher proportion of alcohols with pleasant aromas, which also played a key role in improving the fish's flavor. Ketones were the fewest but contributed significantly to flavor profiles. 2-Butanone and hydroxyacetone, for example, can impart buttery, sweet, and mushroom-like aromas to largemouth bass. Overall, delayed gonadal development effectively reduced aldehydes and increased volatile aromas such as alcohols and ketones, thereby reducing the earthy taste of the fish and increasing fruity and creamy aromas that are more appealing to consumers.
[0089] Table 2: Qualitative results of volatile compounds in the muscle of largemouth bass in the control and diapause groups
[0090]
[0091]
[0092] Comparative Example 1: Determination of growth performance and transcriptional level of largemouth bass after combined knockdown of single gene and conventional sex-determining gene.
[0093] For specific implementation details, refer to Example 1. Largemouth bass zygotes with knocked-down genes were constructed and fry were cultured. The difference lies in changing the type of knocked-down gene. The common female sex-determining gene in fish is cyp19a1a, which is closely related to ovarian development and gonadal differentiation in female fish and has been proven to be a key gene for ovarian development in many fish species. The male sex-determining gene is gsdf, which also plays a role in sex differentiation and testicular germ cell proliferation. To compare the knockdown effects of the key gene combination for female gonadal development (btg4, hsd17b12a) and the key gene combination for male gonadal development (dmrt1, Tekt1) used in this invention, knockdown was performed using single-gene female (btg4) and male (dmrt1) knockdown, single-gene conventional sex-determining gene knockdown (cyp19a1a knockdown in females, gsdf knockdown in males), and conventional sex-determining gene combined with female (btg4, cyp19a1a) and male (dmrt1, gsdf) knockdown. Similarly, the final body weight and gonadal index of largemouth bass after single-gene and conventional sex-determining gene combined knockdown were statistically analyzed after 360 days of cultivation.
[0094] The antisense RNA sequence used to knock down the cyp19a1a gene is: AGACGCACCGGCTTCATTCCACAGGGCTGGAGCAGATCACCTGCCATAAGAACGGATGGAGAAGCAAGTCTAAAGCCTCTGAACTGCAGACGTACACTT. The antisense RNA sequence used to knock down the gsdf gene is: TTTGGACACGCCAGGTGGCTCAGCTTCACACAATTTTGACAAACCCCTGCCTACTTTTTGCTGGGCTGCTGGGCGCTGCCCGGTCCACAGCCGCAGCCGCGAGCCAGCTGCACCGAG. After 360 days of rearing, the transcription level of the btg4 gene in the single-gene female fish (btg4) knockdown group was 24.97% of the control group, the transcription level of the cyp19a1a gene in the cyp19a1a knockdown group was 19.63% of the control group, the transcription level of the dmrt1 gene in the single-gene male fish (dmrt1) knockdown group was 28.94% of the control group, and the transcription level of the gsdf gene in the gsdf knockdown group was 25.85% of the control group. In the conventional sex-determining gene combined with the female fish (btg4, cyp19a1a) knockdown group, the transcription levels of the btg4 and cyp19a1a genes were 28.04% and 18.48% of the control group, respectively. In the conventional sex-determining gene combined with the male fish (dmrt1, gsdf) knockdown group, the transcription levels of the dmrt1 and gsdf genes were 28.55% and 26.20% of the control group, respectively.
[0095] The results are shown in Table 3. Interference with single genes btg4, cyp19a1a, dmrt1, and gsdf to inhibit gonadal development resulted in no significant difference in final body weight compared to the control and negative control groups. While the gonadal index decreased compared to the control and negative control groups, the decrease was minimal and not statistically significant, indicating that single-gene intervention could not achieve the effect of delaying gonadal development. The combination of btg4 / cyp19a1a and dmrt1 / gsdf was used to inhibit gonadal development in largemouth bass. After 360 days of cultivation, the growth performance of largemouth bass with the combined knockdown of two conventional sex-determining genes was statistically analyzed. The results showed that neither the combination of btg4 / cyp19a1a nor dmrt1 / gsdf significantly increased body weight or reduced the gonadal index, nor could it achieve the technical effect described in Example 2.
[0096] The above results indicate that the sex development of largemouth bass may be jointly regulated by multiple genes, while conventional sex-determining genes have no significant impact on its growth and development. This further demonstrates the innovation of the present invention in cultivating largemouth bass with delayed gonadal development.
[0097] Table 3: Determination of growth performance and transcriptional level in largemouth bass after combined knockdown of single gene and conventional sex-determining gene
[0098]
[0099]
[0100] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A method for delaying gonadal development, increasing growth rate, and / or improving meat flavor in largemouth bass, characterized in that, Reduce the expression of largemouth bass dmrt , Tekt1 , Btg4 and Hsd17b12a ; The method includes the following steps: (1) Construct expressions respectively dmrt , Tekt1 , Btg4 or Hsd17b12a Recombinant vectors containing antisense RNA sequences; (2) Transfect the recombinant vector described in step (1) into largemouth bass eggs, and then fertilize them in vitro to obtain fertilized eggs; (3) Hatching and culturing the fertilized eggs described in step (2) yields largemouth bass; Gene dmrt The antisense RNA sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; gene Tekt1 The antisense RNA sequences are shown in SEQ ID NO.3 and SEQ ID NO.4; gene Btg4 The antisense RNA sequence is shown in SEQ ID NO. 5; gene Hsd17b12a The antisense RNA sequence is shown in SEQ ID NO.
6.
2. The method according to claim 1, characterized in that, The recombinant vector in step (1) includes, but is not limited to, the pcDNA3.1 expression vector containing the CMV promoter.
3. The method according to claim 2, characterized in that, The transfection in step (2) involves mixing the nanolipid carrier solution with the recombinant carrier to obtain a mixture, and then adding the mixture to the oocytes; the nanolipid carrier solution contains phosphatidylcholine, cholesterol, and phosphate buffer solution.
4. The method according to claim 3, characterized in that, Add 5-7 mL of the mixture to every 10,000 eggs.
5. The method according to claim 4, characterized in that, Add 0.5-1 mL of semen to every 10,000 transfected eggs to obtain fertilized eggs.
6. The method according to claim 5, characterized in that, The incubation conditions are a water temperature of 23℃-24℃ and a water flow rate of 3-7 liters / minute.
7. The method according to claim 6, characterized in that, The cultivation conditions are: water temperature 25-27℃, dissolved oxygen ≥7.5mg / L, total ammonia nitrogen and nitrite ≤0.03mg / L.
Citation Information
Patent Citations
Set of antisense RNA for inhibiting AMH gene expression and method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain
CN111944817A
Application of NFIB and downstream target gene thereof as target spot for treating or inhibiting hepatic fibrosis
CN119224315A