Bacillus thuringiensis CMS-B11 and application thereof

Abstract

The invention discloses bacillus thuringiensis CMS-B11, the classification name of the bacillus thuringiensis CMS-B11 is bacillus thuringiensis, the bacillus thuringiensis CMS-B11 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC 35312, and the preservation date is July 21, 2025. The bacillus thuringiensis strain CMS-B11 directly separated and screened from a coastal soil sample in Hainan carries three insecticidal protein coding genes, namely Cry3Aa, Ssp1Aa and Vpb4Ca, not only is high in insecticidal toxicity and good in insecticidal effect, but also has a certain effect of inhibiting fungal diseases, can be widely applied to prevention and control of agricultural diseases and pests, and has a good application prospect. The sustainable development of green agricultural production is promoted.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological control, and particularly relates to Bacillus thuringiensis CMS-B11 and its application, and particularly relates to Bacillus thuringiensis for inhibiting Chinese cabbage sclerotinia disease and / or killing Phyllotreta striolata. BACKGROUND

[0002] Phyllotreta striolata belongs to the family of Chrysomelidae in the order of Coleoptera, and is commonly known as dog flea, vegetable flea, ground hopper, etc. Phyllotreta striolata mainly harms cruciferous vegetables such as Chinese cabbage, radish, mustard, and cabbage. Phyllotreta striolata has 7-8 generations in a year in Hainan Province, with overlapping generations, and harms Chinese cabbage all year round in the form of adults and larvae. The damage is the most serious in the seedling stage, and adults can also cause the spread of Chinese cabbage soft rot, black rot and other diseases. With the adjustment of the planting structure in Hainan Province, the area of vegetable planting is continuously expanding. As of 2024, the annual vegetable planting area in the province is about 150,000 mu, and the mode of continuous cropping and intercropping of vegetables is common in most areas, which creates a suitable environment for continuous damage by Phyllotreta striolata, and Phyllotreta striolata has become one of the main pests of vegetables in Hainan Province.

[0003] Sclerotinia sclerotiorum (Lib.) de Bary is a dead body nutrition type of plant fungal pathogen, and its host range is very wide, which can harm more than 6,000 plants of 75 families, including different types of cruciferous vegetables, legume vegetables, peanuts, etc. Chinese cabbage sclerotinia disease is an important disease caused by Sclerotinia sclerotiorum, which seriously affects the yield and quality of Chinese cabbage, and can cause Chinese cabbage tissue to rot, lodge, and even whole plant death. Chemical fungicides are the most effective means to control sclerotinia disease, but with the increasingly serious environmental problems and resistance problems, biological control has become a sustainable and effective control strategy because of its environmental friendliness and non-resistance. At present, the main biological control factors include fungi, bacteria and fungal viruses. Fungi mainly include Trichoderma, Coniothyrium minitans, etc. Bacteria mainly include Bacillus and Pseudomonas. Bacillus plays an important role in the prevention and control of many diseases due to its wide distribution, strong genetic stability and strong stress resistance.

[0004] Bacillus thuringiensis (Bt) is a species of Gram-positive spore-forming bacillus widely found in soil, rhizosphere, water, and insect bodies. It produces insecticidal crystal proteins and possesses high insecticidal activity, making it widely used to control Lepidoptera, Hemiptera, and Coleoptera pests. In biological control, Bt formulations are the most widely used and successful biological insecticides, accounting for approximately 3% of the insecticide market (Li et al., 2024). Bt has significant practical value in controlling the striped flea beetle. In recent years, Bacillus thuringiensis (Bt) has made significant progress in suppressing fungal diseases as an important biocontrol resource. Its antibacterial mechanism has surpassed traditional insecticidal crystal proteins, and has been found to involve multi-pathway and multi-molecular synergistic effects. Current research is progressing from strain screening to the identification of its antibacterial active ingredients, the analysis of its mechanism of action, and genetic modification. Enhancing the production of antibacterial substances such as chitinase through genetic engineering has become a hot topic. Meanwhile, developing highly efficient and stable compound microbial pesticides by combining Bt formulations with other biocontrol bacteria or low-dose chemical pesticides is an important direction for promoting its field application. These advances have laid a solid foundation for Bt to become a green pesticide for controlling fungal diseases.

[0005] Nevertheless, screening for more novel, specific, and highly effective insecticidal strains targeting specific pests remains an important task in the development of biocontrol microbial products. Summary of the Invention

[0006] To address the shortcomings of existing technologies and practical needs, this invention provides a novel Bacillus thuringiensis and applies it to suppressing sclerotinia stem rot in Chinese cabbage and / or killing the Coleoptera pest, the yellow-striped flea beetle.

[0007] Specifically, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides a Bacillus thuringiensis CMS-B11, which is named Bacillus thuringiensis and is deposited at the China General Microbiological Culture Collection Center with accession number CGMCC 35312 and deposit date of July 21, 2025.

[0009] In one or more embodiments, the strain carries three insecticidal protein encoding genes: Cry3Aa, Ssp1Aa, and Vpb4Ca; the nucleotide sequence of the Cry3Aa gene is shown in SEQ ID NO: 1, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 2; the nucleotide sequence of the Ssp1Aa gene is shown in SEQ ID NO: 3, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 4; the nucleotide sequence of the Vpb4Ca gene is shown in SEQ ID NO: 5, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 6.

[0010] Secondly, the present invention provides a microbial preparation containing Bacillus thuringiensis as described in the present invention, or containing fermentation broth of Bacillus thuringiensis, or containing lyophilized powder of Bacillus thuringiensis, or containing inactivated cells of Bacillus thuringiensis, or containing lysate of Bacillus thuringiensis, or containing extract of Bacillus thuringiensis.

[0011] It should be understood that microbial strains used for biocontrol generally produce certain special products during their growth or fermentation process, such as antibiotics, bacteriocins, proteins, or other antibacterial substances. Therefore, the scope of protection of this invention should also include the products of Bacillus thuringiensis, including but not limited to Bacillus thuringiensis fermentation broth, Bacillus thuringiensis lyophilized powder, inactivated Bacillus thuringiensis cells, Bacillus thuringiensis lysates, and Bacillus thuringiensis extracts.

[0012] Thirdly, the present invention provides the application of the Bacillus thuringiensis or the microbial preparations described herein in inhibiting vegetable diseases and / or killing Coleoptera pests.

[0013] The Bacillus thuringiensis described in this invention not only inhibits vegetable diseases but can also be used to kill coleopteran pests. As mentioned above, the scope of protection of this invention also includes the products of the Bacillus thuringiensis. Therefore, any product containing the Bacillus thuringiensis, or a fermentation broth containing the Bacillus thuringiensis, or a freeze-dried powder containing the Bacillus thuringiensis, or inactivated cells containing the Bacillus thuringiensis, or lysates containing the Bacillus thuringiensis, or an extract containing the Bacillus thuringiensis, can also be used to inhibit vegetable diseases and / or kill coleopteran pests.

[0014] Fourthly, the present invention provides the application of the Bacillus thuringiensis or the microbial preparations described herein in the preparation of pesticides for inhibiting vegetable diseases and / or killing coleopteran pests.

[0015] In one or more embodiments, the vegetable disease is sclerotinia stem rot of Chinese cabbage; the coleopteran pest is the yellow-striped flea beetle.

[0016] In one or more embodiments, the culture temperature of the Bacillus thuringiensis is 30°C.

[0017] Fifthly, the present invention provides a pesticide formulation comprising at least one of the Bacillus thuringiensis and the microbial formulation described herein.

[0018] In one or more embodiments, the pesticide formulation further includes other microbial agents that have a synergistic effect with the Bacillus thuringiensis described in this invention.

[0019] It should be understood that although the Bacillus thuringiensis described in this invention can inhibit vegetable diseases and kill coleopteran pests, it is not excluded that it can be used in combination with other biocontrol bacteria with similar functions or other pathogen control functions, so that the pesticide of this invention has a stronger effect in inhibiting vegetable diseases and / or killing coleopteran pests, or has a broader function in controlling other pathogens.

[0020] In one or more embodiments, the pesticide formulation is a suspension concentrate, an oil suspension concentrate, a powder, a wettable powder, or a granule.

[0021] It should be understood that the pesticide formulations described in this invention refer to compositions that utilize beneficial microorganisms to kill or suppress the number of pathogenic organisms to control the occurrence and development of plant diseases. The pesticide formulations described in this invention contain the aforementioned Bacillus thuringiensis or the aforementioned microbial preparations, and can be prepared into formulations of different forms according to reagent requirements. Furthermore, the pesticide formulations of the present invention may, as needed, include appropriate carriers or excipients such as solvents, propellants, solubilizers, co-solvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, integrators, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants and anti-flocculation agents, filter aids, release inhibitors, etc. Of course, the addition of these carriers or excipients should not affect the original biological control effect of the Bacillus thuringiensis or the microbial formulations.

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] The present invention directly isolates and screens the Bacillus thuringiensis strain CMS-B11 from coastal soil samples in Hainan. This strain carries three insecticidal protein encoding genes: Cry3Aa, Ssp1Aa, and Vpb4Ca. It not only has strong insecticidal toxicity and good insecticidal effect, but also has a certain inhibitory effect on fungal diseases. It can be widely used in the prevention and control of agricultural pests and diseases, and promote the sustainable development of green agricultural production. Attached Figure Description

[0024] Figure 1 The cell and crystal morphology of the Bacillus thuringiensis CMS-B11 strain described in this invention.

[0025] Figure 2 This is the experimental result of the antibacterial activity of Bacillus thuringiensis CMS-B11 described in this invention against Sclerotinia sclerotinia in Chinese cabbage. Detailed Implementation

[0026] Bacillus thuringiensis, or Bt for short, is a Gram-positive bacterium widely found in soil worldwide. It is currently the most thoroughly researched, widely used, and successful microbial pesticide in the world, playing a crucial role in organic agriculture and integrated pest management. The most unique feature of Bacillus thuringiensis is that while forming spores (a dormant form that helps the bacteria resist adverse environments), it produces a crystalline protein toxic to specific insects, also known as "δ-endotoxin" or "insectic crystalline protein."

[0027] Although existing technologies disclose that Bacillus thuringiensis can be used to control a variety of crop pests, there are no reports that the bacterium can be used to suppress vegetable diseases and kill coleopteran pests at the same time.

[0028] It should be understood that in this invention, Bacillus thuringiensis CMS-B11, Bacillus thuringiensis CMS-B11, Bacillus thuringiensis CMS-B11, or the abbreviated description "CMS-B11" are all different names for the same strain, and those skilled in the art would not consider these strains with different names to be different strains.

[0029] Examples

[0030] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0031] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.

[0032] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0033] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0034] The pathogen of sclerotinia stem rot in the following examples was obtained from the National Engineering Research Center for Pesticides at Nankai University; the adult flea beetle was collected from a field vegetable base.

[0035] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0036] Example 1: Isolation, screening, identification and preservation of Bacillus thuringiensis

[0037] 1.1 Separation and Screening

[0038] Take an appropriate amount of soil sample (sample collected from coastal soil in Hainan) and add it to isolation medium (1 / 2 LB). Incubate at 30℃ and 200 rpm for 10 h on a shaker, then incubate at 80℃ for 15 min. Spread 100 µL of each of the four concentrations (stock solution, stock solution diluted 10 times, 100 times, and 1000 times) onto solid 1 / 2 LB plates (two plates for each concentration). Pour in small glass beads and shake to evenly spread the bacterial solution. After incubating at room temperature for 10 min, place the plates in a 30℃ incubator. After 48 h, observe the colony morphology. Select colonies similar to Bt, stain with fuchsin, and examine under an oil immersion microscope for the presence of spores and parasporal crystals. Bacillus thuringiensis strains detected from the same isolate are selected based on their colony morphology and color, vegetative cells, and spore crystal morphology. One strain of each morphology is purified and stored for future use.

[0039] One of the strains (later named CMS-B11) formed single colonies after 48 hours of cultivation on 1 / 2 LB medium. The colonies were milky white, round or nearly round, with neat edges, thicker in the center and gradually thinning towards the edges. After 30 hours, the bacterial cells of this strain were observed under a scanning electron microscope; they were long rods, the spores were oblong rods, and the crystals were square (e.g., ...). Figure 1 (As shown).

[0040] 1.2 Identification

[0041] Genomic DNA was extracted from strain CMS-B11, and a bacterial framework diagram was constructed by Shanghai Sangon Biotech Co., Ltd. The insecticidal genes contained in the strain were analyzed using the Bt Toxin database (http: / / bcam.hzau.edu.cn / BtToxin_scanner / index.php). Full-length primers were designed (see Table 1) to clone the full-length insecticidal genes. Sequencing results were analyzed by NCBI Blast sequence alignment and DNAMAN 5.2 software using Multiple Sequence Alignment. Morphological and molecular biological identification revealed that this strain is Bacillus thuringiensis, containing three insecticidal genes: Cry3Aa, Ssp1Aa, and Vpb4Ca. The nucleotide sequence of the Cry3Aa gene is shown in SEQ ID NO: 1, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 2. The nucleotide sequence of the Ssp1Aa gene is shown in SEQ ID NO: 3, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 4. The nucleotide sequence of the Vpb4Ca gene is shown in SEQ ID NO: 5, and the amino acid sequence of the insecticidal protein it encodes is shown in SEQ ID NO: 6.

[0042] According to NCBI BLAST comparison, the maximum amino acid sequence similarity of Cry3Aa, Ssp1Aa and Vpb4Ca contained in CMS-B11 strain to known Bacillus strains is 99%, 98% and 100%, respectively, and Cry3Aa is a new gene.

[0043] Table 1. Primers for full-length genes

[0044] Primer Sequence Cry3Aa-5 5'- ATGAATCCGAACAATCGAAGTGAACAT -3' (SEQ ID NO: 7) Cry3Aa-3 5'- TTAATTCACTGGAATAAATTCAATTTTGTCT -3' (SEQ ID NO: 8) Ssp1Aa-5 5'- GTGATTTTTCTGAATATTAAGAAAAACA -3' (SEQ ID NO: 9) Ssp1Aa-3 5'- TTAATGACTAATACTAGCTGTTGGGTATA -3' (SEQ ID NO: 10) Vpb4Ca-5 5'- ATGATGAAAAAAATCCCTCATAAACTACT -3' (SEQ ID NO: 11) Vpb4Ca-3 5'- TCAGTTCATTATATTTTGTACTTTGTCT -3' (SEQ ID NO: 12)

[0045] 1.3 Preservation

[0046] The strain CMS-B11 was deposited on July 21, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC 35312, and classified as Bacillus thuringiensis.

[0047] Example 2: Pretreatment of CMS-B11 fermentation broth and quantification of parasporal crystal proteins

[0048] 2.1 Fermentation broth pretreatment

[0049] The CMS-B11 strain preserved in glycerol tubes was inoculated into 5 mL (approximately 10 μL) of sterilized LB liquid medium and cultured at 30°C for 8–12 h (OD600 > 0.8) to obtain seed culture. This seed culture was then inoculated at a volume fraction of 5% into sterilized beef extract peptone fermentation medium and fermented at 30°C with shaking for 48–50 h. The supernatant was used for indoor antibacterial activity testing. The fermentation broth was centrifuged at 4500 rpm for 15 min, and the supernatant was concentrated 10-fold for indoor and field control trials.

[0050] 2.2 Quantitative analysis of parasporal crystal proteins

[0051] Collect 10 ml of CMS-B11 concentrated bacterial culture by centrifuging at 10,000 rpm for 8 min in a low-temperature refrigerated centrifuge. Use 1 g of Bacillus thuringiensis G033A wettable powder as a control standard. Resuspend the bacterial cells in 40 ml of 1M NaCl and centrifuge at 10,000 rpm for 8 min, then discard the supernatant. Wash the precipitate with sterile distilled water. Resuspend the precipitate in 50 mM Na2CO3 and 50 mM EDTA (5% mercaptoethanol, pH 9.5-10.5) and incubate on ice at 100 rpm for at least 4 hours. Centrifuge at 10,000 rpm for 10 min and collect the supernatant. Add 1 / 10 volume of 3M NaAc to the supernatant to adjust the pH to 4.5-5.0, mix well, and incubate on ice for at least 2 hours. Centrifuge at 10,000 rpm for 10 min and collect the precipitate. Wash the protein with sterile distilled water until no mercaptoethanol remains. Dissolve the precipitate in an appropriate amount of 50 mM Na2CO3 (pH 10.2) and incubate on ice for 1 hour. After dissolving CMS-B11 and G033A proteins, SDS-PAGE and BSA were compared for quantification. The protein content of CMS-B11 was 134.67 μg / mL, and the protein content of G033A wettable powder was 29.13 μg / mL.

[0052] Example 3: Determination of the indoor antibacterial activity of CMS-B11 against Sclerotinia stem rot in Chinese cabbage

[0053] Indoor antibacterial activity was determined using the confrontation method and the Oxford cup method. The pathogenic fungus (Sclerotinia sclerotiorum var. sclerotiorum) was placed in the center of a petri dish, with three Oxford cups placed at equal intervals. Each Oxford cup was inoculated with 50 μL of fresh Bt fermentation broth. After 5 days, the size of the bacterial colony was measured. Each treatment was repeated three times.

[0054] Colony diameter was measured using the cross-multiplication method. The target bacterial colony diameter was denoted as D, and the control group colony diameter was denoted as Do. The mycelial growth inhibition rate of the pathogen was calculated using the following formula:

[0055] Mycelial growth inhibition rate (%) = (Do - D) / (Do - 4) x 100%

[0056] The results are as follows Figure 2 As shown, the calculated inhibition rate of CMS-B11 against the pathogen of Sclerotinia stem rot in Chinese cabbage is 83.1%.

[0057] Example 4: Field control efficacy of CMS-B11 against sclerotinia stem rot in Chinese cabbage

[0058] The experiment was conducted at the Yongfa Experimental Base in Chengmai County. The tested vegetable variety was black-leaf bok choy (purchased from Hainan Linzhongmin Vegetable Seed Co., Ltd.). The experimental site was red soil with a moderate organic matter content. Sprinkler irrigation was used in the experimental garden, with moderate planting density and uniform management across all experimental plots. The lettuce was in the transplanting and survival stage when the first pesticide was applied.

[0059] Agent: Bacillus thuringiensis CMS-B11, a bacterial suspension, diluted at 500 and 1000 times.

[0060] Cell arrangement: random; Cell area: 20m² greenhouse 2 Number of repetitions: 4.

[0061] For foliar spraying, the operator should walk back and forth at a constant speed in the field with the sprayer on their back to ensure even application of the pesticide to the target areas of the plants. Start with the blank control area and apply the pesticide from low to high concentration. Alternatively, follow the protocol requirements and label instructions. Do not overfill the sprayer to avoid leakage; the pesticide prepared on the same day should be used on the same day. Apply the pesticide twice, on August 10th and 14th, 2024, for a total of two applications. Apply the pesticide per 667m². 2 The volume of the pesticide solution used was 60L. No fungicides were used within one week prior to the experiment, and the results of this experiment were not affected by previous pesticide use. No other pesticides were applied during the experiment to control other pests and diseases.

[0062] On August 21, 2024, seven days after the second application of fungicide, the incidence of sclerotinia stem rot in Chinese cabbage was investigated. The investigation was conducted in accordance with the "Field Efficacy Trial of Fungicides for the Control of Sclerotinia Stem Rot in Chinese Cabbage" published by our unit. All plants in each plot were investigated, and the total number of plants investigated and the number of diseased plants were recorded.

[0063] Methods for calculating drug efficacy:

[0064]

[0065] In the formula: CK1 is the disease incidence rate in the control area after application of the pesticide. PT1 is the disease incidence rate in the treatment area after application of the pesticide.

[0066] The results are shown in Table 2. The control efficacy of CMS-B11 stock solution at a dilution of 500 times and 1000 times against sclerotinia in Chinese cabbage was 62.1% and 43.4%, respectively, showing good field control effect against sclerotinia disease in Chinese cabbage.

[0067] Table 2. Field control efficacy of Bt inoculant against sclerotinia stem rot in Chinese cabbage.

[0068]

[0069] Example 5: Indoor insecticidal activity determination of CMS-B11 against the striped flea beetle

[0070] The leaf-immersion method was used on March 11, 2024. Protein solutions were extracted according to the method described in Example 2, and five experimental concentration gradients were set: 120 μg / mL, 60 μg / mL, 30 μg / mL, 15 μg / mL, and 7.5 μg / mL. The leaves of the Chinese cabbage were washed with clean water and dried. Fresh, uniform leaves were selected and immersed in the protein solutions of each concentration for 10 min, then dried and placed in bioassay boxes. Each box contained 20 2nd-3rd instar larvae. Each treatment was repeated three times. The boxes were incubated at 25℃ in a biochemical incubator for 96 h. The number of dead and live larvae was then investigated, and the feeding behavior of the larvae was observed.

[0071] Bioassay results showed that CMS-B11 protein had high insecticidal activity against the yellow-striped flea beetle. The poisoned yellow-striped flea beetles turned black and died, with their entire bodies turning black and rotting. In contrast, the control insects showed a larger appetite, were more active, and developed normally.

[0072] The results are shown in Table 3. The LC50 of the protein solution was 30.73 μg / mL with a confidence level of 95%, and the LC90 was 211.4 μg / mL, indicating that the CMS-B11 strain has strong toxicity to flea beetles.

[0073] Table 3. Indoor insecticidal activity assay of CMS-B11 against the striped flea beetle.

[0074] Virulence regression curve Correlation coefficient LC 50 μg / mL 95% confidence limits (LC 50 ) pg / mL Standard error LC 95 μg / mL y = 2.0787 + 1.9638X 0.8784 30.73 26.33~35.87 2.42 211.46

[0075] Example 6: Field insecticidal activity assay of CMS-B11 against the striped flea beetle

[0076] 6.1. Use foliar spraying method

[0077] The cultured Bacillus thuringiensis CMS-B11 bacterial suspension (16000 IU / mg) was used. Specific experimental products and dosages are shown in Table 4. Each treatment was replicated twice, for a total of 5 plots, each 30 m², arranged in a randomized block design. Uniform spraying was performed on the Chinese cabbage plants using an MBS151 electric sprayer (pressure 1.0 MPa), with a nozzle diameter of 0.5 mm, 7 days before the peak emergence of adult flea beetles. The spraying rate was 600 L / hm².

[0078] Table 4. Experimental Treatments

[0079] Treatment Product name Specification Dosage (ml or g) per mu Water dosage (kg) per mu Application method 1 CMS-B11 16000IU / g 100 15 Spray 2 CMS-B11 16000IU / g 200 15 Spray 3 BtG033A 32000IU / g 100 15 Spray 4 GeliGao 100g / L 15 15 Spray 5 CK (negative) - 15 Spray

[0080] 6.2 Survey Methods

[0081] The field efficacy trial was conducted in accordance with the guidelines for pesticide field efficacy trials. A diagonal 5-point sampling method was used, with 4 Chinese cabbage plants taken at each point. 20 plants were investigated in each plot. The leaf damage index of each plant was recorded and calculated according to the following grading method.

[0082] The foliar spray test investigation method is the same as above. A baseline survey is conducted before application, and surveys are conducted at 3, 5, and 7 days after application. The leaf damage index is recorded and calculated according to the following grading method (grading standard):

[0083] Level 0: No damage; Level 1: Scattered damage on leaves; Level 3: Less than one-third of the leaf area is damaged; Level 5: One-third to one-half of the leaf area is damaged; Level 7: One-half to two-thirds of the leaf area is damaged; Level 9: More than two-thirds of the leaf area is damaged.

[0084] Leaf damage index =

[0085] Leaf spraying control efficacy (100%) =

[0086] In the formula, CK0: leaf damage index in the blank control area before application; CK1: leaf damage index in the control area after application; PT0: leaf damage index in the treatment area before application; PT1: leaf damage index in the treatment area after application.

[0087] The experimental results are shown in Table 5. At different application rates of CMS-B11, foliar spraying showed significantly lower efficacy against the yellow-striped flea beetle at 3 and 5 days post-application compared to the control chemical agent, Glico, but no significant difference compared to Jinweijun. At 7 days post-application, there was no significant difference in control efficacy between 200 g / mu of CMS-B11 suspension and 15 ml / mu of Glico against the yellow-striped flea beetle. Similarly, there was no significant difference in control efficacy between 100 g / mu of CMS-B11 suspension and 100 g / mu of Jinweijun, indicating comparable control effects. These results demonstrate that CMS-B11 suspension spraying has a significant control effect against the yellow-striped flea beetle.

[0088] Table 5. Control effects of different pesticides on flea beetles in Chinese cabbage.

[0089]

[0090] Note: Data in the table are mean ± standard error. Data in the same column with different lowercase letters indicate significant differences at the 0.05 level.

[0091] Example 7: Sporulation characteristics of CMS-B11 strain

[0092] With a concentration of 1×10 8 CMS-B11 bacterial suspension (cfu / mL) was cultured on 1 / 2 LB medium (100 μL / plate) for 15 days at different temperatures (20℃, 22℃, 24℃, 25℃, 26℃, 27℃, 28℃, 29℃, 30℃, and 35℃). The sporulation rate per unit area was then measured to determine that the optimal sporulation rate of CMS-B11 strain was achieved at 30℃.

[0093] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above...

[0094] The description should not be considered a limitation of the invention. Various modifications and substitutions to the invention will be apparent to those skilled in the art after reading the foregoing. Therefore, the scope of protection of the invention should be defined by the appended claims.

Claims

1. A Bacillus thuringiensis CMS-B11 strain, characterized in that, The Bacillus thuringiensis described in the CMS-B11 classification is named Bacillus thuringiensis. It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC 35312 and deposit date of July 21, 2025.

2. The Bacillus thuringiensis as described in claim 1, characterized in that, The strain carries three insecticidal protein encoding genes: Cry3Aa, Ssp1Aa, and Vpb4Ca. The nucleotide sequence of the Cry3Aa gene is shown in SEQ ID NO: 1; the nucleotide sequence of the Ssp1Aa gene is shown in SEQ ID NO: 3; and the nucleotide sequence of the Vpb4Ca gene is shown in SEQ ID NO:

5.

3. A microbial preparation, characterized in that, The microbial preparation contains Bacillus thuringiensis as described in claim 1, or contains fermentation broth of Bacillus thuringiensis, or contains lyophilized powder of Bacillus thuringiensis, or contains inactivated cells of Bacillus thuringiensis, or contains lysate of Bacillus thuringiensis, or contains extract of Bacillus thuringiensis.

4. The use of Bacillus thuringiensis as described in claim 1 or 2, or the microbial preparation as described in claim 3, in inhibiting vegetable diseases and / or killing Coleoptera pests.

5. The use of Bacillus thuringiensis as described in claim 1 or 2, or the microbial preparation as described in claim 3, in the preparation of pesticides for inhibiting vegetable diseases and / or killing coleopteran pests.

6. The application as described in claim 4 or 5, characterized in that, The vegetable disease mentioned is sclerotinia stem rot in Chinese cabbage; the Coleoptera pest mentioned is the yellow-striped flea beetle.

7. The application as described in claim 4 or 5, characterized in that, The culture temperature of the Bacillus thuringiensis was 30℃.

8. A pesticide formulation, characterized in that, The pesticide formulation comprises at least one of Bacillus thuringiensis as described in claim 1 or 2, and the microbial formulation as described in claim 3.

9. The pesticide formulation as described in claim 8, characterized in that, The pesticide formulation also includes other microbial agents that have a synergistic effect with Bacillus thuringiensis as described in claim 1 or 2.

10. The pesticide formulation according to claim 8, characterized in that, The pesticide formulation is one of the following: suspension concentrate, oil suspension concentrate, powder, wettable powder, and granules.

Images