Escherichia coli recombinant strain with high yield of astaxanthin as well as construction and application of escherichia coli recombinant strain

By overexpressing lycopene cyclase crtY, β-carotene hydroxylase crtZ, and β-carotene ketylase crtW in Escherichia coli and using CRISPR Cas9 technology for gene editing, a high-yield recombinant E. coli strain for astaxanthin production was constructed. This solved the problem of low astaxanthin yield in microbial fermentation and achieved safe and efficient astaxanthin synthesis.

CN121780464APending Publication Date: 2026-04-03QINGDAO AGRI UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202610062935.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-16
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing technologies for producing astaxanthin by microbial fermentation suffer from problems such as low yield, strict requirements for culture conditions, and high culture costs. Furthermore, existing plasmid expression methods pose safety risks and increase costs.

Method used

A recombinant Escherichia coli strain with high astaxanthin production was constructed. By overexpressing lycopene cyclase crtY, β-carotene hydroxylase crtZ, and β-carotene ketylase crtW in E. coli, gene editing was performed using CRISPR Cas9 technology to eliminate plasmids, thereby achieving efficient synergistic effects of the enzyme system and improving the conversion efficiency of the astaxanthin synthesis pathway.

Benefits of technology

This significantly improved the production efficiency of astaxanthin, eliminated the safety hazards and increased costs associated with antibiotics during fermentation, and eliminated the safety hazards and increased costs associated with adding antibiotics during fermentation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121780464A_ABST
    Figure CN121780464A_ABST
Patent Text Reader

Abstract

The invention firstly provides an enzyme system for improving the yield of astaxanthin. The enzyme system comprises beta-carotene hydroxylase crtZ, beta-carotene ketolase crtW and lycopene cyclase crtY which are found by the inventor and have remarkably improved conversion rate. The beta-carotene hydroxylase crtZ has an amino acid sequence as shown in SEQ ID NO: 2, the beta-carotene ketolase crtW has an amino acid sequence as shown in SEQ ID NO: 3, and the lycopene cyclase crtY has an amino acid sequence as shown in SEQ ID NO: 1. On the basis, coding genes of the beta-carotene hydroxylase crtZ, the beta-carotene ketolase crtW and the lycopene cyclase crtY are over-expressed in a basic strain for producing the lycopene, and an escherichia coli recombinant strain for producing the astaxanthin at high yield is constructed. When the recombinant escherichia coli is used for producing astaxanthin through fermentation, the yield and the conversion rate of the astaxanthin are obviously improved; according to the present invention, glycerol is adopted as a substrate, and fermentation is performed in a 5 L fermentation tank for 60 h to obtain 1.54 g / L of astaxanthin (1.18 g / L in the prior art), such that the technical problem of low yield of astaxanthin produced through microbial fermentation in the prior art is solved, the foundation is laid for the industrial production of astaxanthin, and wide application prospects and huge market values are provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and genetic engineering, and relates to a recombinant strain of Escherichia coli, specifically a recombinant strain of Escherichia coli that produces high levels of astaxanthin and its construction and application. Background Technology

[0002] Astaxanthin is a lutein carotenoid, chemically named 3,3'-dihydroxy-4,4'-diketoyl-β,β-carotene. Free astaxanthin is a dark reddish-brown powder crystal with a high melting point, low polarity, and is extremely insoluble in water but readily soluble in fats and most organic solvents. The structure of astaxanthin consists of eight isoprene molecules arranged in a continuous sequence, containing 13 conjugated double bonds; this molecular structure endows it with extremely strong antioxidant capabilities, far exceeding those of other antioxidants such as vitamin C and vitamin E. Studies have shown that astaxanthin possesses various physiological functions, including antioxidant, anti-aging, anti-tumor, immune-enhancing, vision-protecting, and cardiovascular-protective effects, and is currently widely used in medicine, health care, food preservation, and cosmetics.

[0003] Currently, there are three main methods for producing astaxanthin: natural extraction, chemical synthesis, and microbial fermentation. Natural extraction primarily refers to extraction from crustacean processing waste (such as shrimp and crab) or Haematococcus pluvialis. The former suffers from low astaxanthin content and high levels of impurities such as ash and chitin in the extract; the latter, while providing all-trans astaxanthin, suffers from high production costs due to the long growth cycle of algae, the need for light, low biomass, and difficulty in cell wall disruption, hindering large-scale promotion. Due to the technical problems of natural extraction, chemical synthesis is currently the main source in the market, accounting for over 95% of the total market share. However, the selenium produced by chemical synthesis is mainly a cis isomer, with a configuration different from natural astaxanthin. This makes it difficult for the human body to efficiently absorb and utilize it, and it also has low safety and antioxidant activity. Furthermore, the synthesis process is complex and cannot meet consumers' demand for natural and safe products. Compared to the previous two methods, the production of astaxanthin by microbial fermentation has advantages such as short production cycle, no impact from climate and season, easy to achieve high-density industrial cultivation, and the product is of natural configuration. It is considered to be one of the most effective ways to achieve large-scale and low-cost production of natural astaxanthin.

[0004] However, the current production of astaxanthin through microbial fermentation is constrained by low yield, stringent culture requirements, and high culture costs. Strain improvement, particularly metabolic engineering, is key to overcoming these technical challenges. Studies have reported that phytoene desaturase (CrtI), lycopene cyclase (CrtYB), β-carotene hydroxylase (CrtZ), and β-carotene ketolase (CrtW) are key enzyme genes in astaxanthin synthesis. Introducing or overexpressing these key astaxanthin synthesis enzyme genes into the host can optimize the synthesis pathway, thereby increasing astaxanthin yield. Currently, there is still significant room for improvement in the yield and conversion rate of astaxanthin produced using *E. coli* strains. Furthermore, given the advantage of high copy numbers and increased yield from plasmid expression, existing technologies often employ plasmid expression to modify strains. However, plasmid overexpression of key genes requires the addition of antibiotics during fermentation to maintain plasmid stability, increasing both safety risks and fermentation costs. Therefore, developing recombinant strains that utilize chromosomal gene expression modification and can efficiently synthesize astaxanthin is of great significance for industrial production. There have been no related reports yet. Summary of the Invention

[0005] To address the technical problems existing in the microbial fermentation method for astaxanthin production, this application provides a high-yield recombinant *E. coli* strain, its construction, and its application. The inventors discovered lycopene cyclase *crtY*, β-carotene hydroxylase *crtZ*, and β-carotene ketylase *crtW*, which significantly improve conversion rates compared to existing technologies. Based on this, by overexpressing the encoding genes of these three enzymes in a basic strain, a high-yield recombinant *E. coli* strain was constructed, significantly increasing astaxanthin production and representing a significant technological advancement.

[0006] The technical solution of the present invention:

[0007] This application first provides an enzyme system for increasing astaxanthin production, comprising β-carotene hydroxylase crtZ and β-carotene ketylase crtW; wherein the β-carotene hydroxylase crtZ has the amino acid sequence shown in SEQ ID NO: 2, and the β-carotene ketylase crtW has the amino acid sequence shown in SEQ ID NO: 3. The β-carotene hydroxylase crtZ is derived from *Pseudomonas wadenswilerensis*; the β-carotene ketylase crtW is derived from *Mucilaginibacter yixingensis*. It is known to those skilled in the art that the β-carotene hydroxylase and β-carotene ketylase work synergistically to introduce a hydroxyl group (-OH) and a ketone group (=O) onto the β-carotene ring, thereby achieving the conversion of β-carotene to astaxanthin. The enzyme system described in this application, which uses β-carotene hydroxylase CRTZ and β-carotene ketoylase CRTW, is a first-time discovery and disclosure by the inventors. Using this enzyme system significantly improves conversion efficiency, thereby increasing astaxanthin yield. This enzyme system is suitable for β-carotene-producing microorganisms.

[0008] Preferably, the enzyme system further includes lycopene cyclase crtY, which has the amino acid sequence shown in SEQ ID NO: 1. The lycopene cyclase crtY is derived from *Sphingomicrobium lutaoense*. Lycopene β-cyclase catalyzes the cyclization of linear molecules to form a β-ring, providing the sole precursor β-carotene for astaxanthin synthesis. Enhancing the activity of β-cyclase or inhibiting the activity of ε-cyclase is a key strategy to increase carbon flux to astaxanthin synthesis. Similarly, the lycopene cyclase crtY described in this application is also a first-time discovery and disclosure by the inventors. Using the lycopene cyclase crtY significantly improves the conversion efficiency of lycopene to β-carotene, thereby increasing the yield of the astaxanthin precursor β-carotene. Based on this, by combining β-carotene hydroxylase CRTZ and β-carotene ketylase CRTW, a highly efficient conversion of lycopene into β-carotene into astaxanthin was achieved. This enzyme system is suitable for lycopene-producing microorganisms.

[0009] This application also provides isolated recombinant nucleic acids encoding the enzyme system described above.

[0010] Preferably, the encoding genes for lycopene cyclase crtY, β-carotene hydroxylase crtZ, and β-carotene ketylase crtW are all expressed by the Trc promoter.

[0011] This application also provides a transformed microorganism comprising the recombinant nucleic acid as described above. When the recombinant nucleic acid includes only the encoding genes for β-carotene hydroxylase crtZ and β-carotene ketylase crtW, the microorganism is a β-carotene-producing strain. When the recombinant nucleic acid includes the encoding genes for lycopene cyclase crtY, β-carotene hydroxylase crtZ, and β-carotene ketylase crtW, the microorganism is a lycopene or β-carotene-producing strain.

[0012] Preferably, the microorganism is recombinant *Escherichia coli*. The recombinant *E. coli* overexpresses the encoding genes for lycopene cyclase *crtY*, β-carotene hydroxylase *crtZ*, and β-carotene ketolase *crtW*. In this invention, recombinant *E. coli* is preferably used as the starting strain, and gene editing is employed to knock out the pseudogene *yedN* of the starting strain and integrate the encoding gene for lycopene cyclase *crtY* at the *yedN* site; knock out the pseudogene *yciQ* of the starting strain and integrate the encoding gene for β-carotene hydroxylase *crtZ* at the *yciQ* site; knock out the pseudogene *ilvG* of the starting strain and integrate β-carotene ketolase *crtW* at the *ilvG* site. In this invention, the encoding genes for lycopene cyclase *crtY*, β-carotene hydroxylase *crtZ*, and β-carotene ketolase *crtW* are preferably all expressed by a Trc promoter.

[0013] This invention does not specifically limit the gene editing method, but CRISPR-Cas9 technology is preferred. After achieving the gene modification goal using CRISPR / Cas9 technology, the pGRB-gRNA plasmid is removed by inducing pRED-Cas9 plasmid expression to cleave the replication origin of the pGRB-gRNA plasmid. Then, temperature induction inhibits the self-replication of pRED-Cas9, ultimately removing the plasmid from the E. coli in the CRISPR-Cas9 system. The resulting recombinant E. coli AST4 not only achieves overexpression of the encoding genes for lycopene cyclase crtY, β-carotene hydroxylase crtZ, and β-carotene ketylase crtW, but also does not contain plasmids, eliminating the safety risks and increased costs associated with adding antibiotics during fermentation.

[0014] Preferably, the coding genes for the lycopene cyclase crtY are shown in SEQ ID NO:4, the coding genes for the β-carotene hydroxylase crtZ are shown in SEQ ID NO:5, and the coding genes for the β-carotene ketylase crtW are shown in SEQ ID NO:6; all of which have undergone codon optimization to the preference of E. coli.

[0015] This application also provides the application of the aforementioned microorganisms in the fermentation production of astaxanthin.

[0016] This application also provides a method for producing astaxanthin by microbial fermentation, comprising the following steps: (1) inoculating the microorganisms as described above into a seed culture medium and culturing to obtain a seed liquid; (2) inoculating the seed liquid into a fermentation culture medium for aerobic fermentation to obtain a fermentation broth; (3) centrifuging the fermentation broth to collect the bacterial cells, and obtaining the product astaxanthin by cell disruption, extraction and purification.

[0017] Preferably, the inoculation amount in step (1) is 20%, the culture temperature is preferably 30°C, and the culture is accompanied by shaking at a frequency of 500 rpm, with a culture time of 10 hours. After the culture according to the present invention, OD 600 :12-15. The seed culture medium comprises the following components in any concentration: K2HPO4 0.1-10 g / L, KH2PO4 0.1-10 g / L, (NH4)2SO4 0.1-10 g / L, citric acid 0.1-10 g / L, MgSO4 0.1-10 g / L, yeast extract 0.1-20 g / L, tryptone 0.1-20 g / L, vitamin B1 0.1 μg / L-1000 mg / L, biotin 0.1 μg / L-1000 mg / L, and trace elements (containing any concentration of FeSO4, ZnSO4, CuSO4, MnSO4, Na2B4O7, CaCl2, (NH4)6Mo7O) 24 ).

[0018] Preferably, the inoculation volume of the seed liquid in step (2) is preferably 20% of the volume of the fermentation medium. After inoculation, aerobic fermentation is carried out at a temperature of 30 °C and dissolved oxygen of 30%. During the aerobic fermentation process, after the base sugar is exhausted, the residual carbon source is controlled at 0-1 g / L by adding glycerol. The fermentation medium comprises the following components in any concentration: glucose 1-50 g / L or glycerol 1-50 g / L, K2HPO4 0.1-10 g / L, KH2PO4 0.1-10 g / L, (NH4)2SO4 0.1-10 g / L, citric acid 0.1-10 g / L, MgSO4 0.1-10 g / L, yeast extract 0.1-20 g / L, tryptone 0.1-20 g / L, vitamin B1 0.1 μg / L-1000 mg / L, biotin 0.1 μg / L-1000 mg / L, and trace elements (containing any concentration of FeSO4, ZnSO4, CuSO4, MnSO4, Na2B4O7, CaCl2, (NH4)6Mo7O) 24 ).

[0019] Preferably, the fermentation medium uses glucose, glycerol, and other carbon sources that Escherichia coli can grow well as fermentation substrates.

[0020] The beneficial effects of this application are:

[0021] (1) This application first provides an enzyme system for increasing astaxanthin production, including β-carotene hydroxylase crtZ and β-carotene ketylase crtW, which were first discovered and disclosed by the inventors; by using the enzyme system, the conversion efficiency of β-carotene to astaxanthin is significantly improved, thereby increasing the production of astaxanthin.

[0022] (2) The enzyme system provided in this application may also include the lycopene cyclase crtY, which was first discovered and disclosed by the inventors; by using the enzyme system, the conversion efficiency of the high-efficiency conversion of lycopene → β-carotene → astaxanthin is significantly improved, thereby increasing the yield of astaxanthin.

[0023] (3) This application also provides microorganisms represented by recombinant Escherichia coli, which are used to ferment and produce astaxanthin, significantly improving the astaxanthin yield and conversion rate; using glycerol as a substrate, fermentation in a 5L fermenter for 60h yields 1.54 g / L of astaxanthin (1.18 g / L in the prior art), solving the technical problem of low yield of astaxanthin produced by microbial fermentation in the prior art, laying the foundation for the industrial production of astaxanthin, and possessing broad application prospects and huge market value.

[0024] (4) This application provides a plasmid-free recombinant Escherichia coli and its construction method, which eliminates the safety hazards and cost increases caused by adding antibiotics during fermentation. Attached Figure Description

[0025] Appendix Figure 1 The graph shows the astaxanthin yield of the recombinant strain AST4 constructed in Example 2 in a 5L fermenter;

[0026] Figure 2 This is a plasmid diagram of the pGRB vector used in step 1 of Example 1;

[0027] Figure 3 This is a plasmid image of pRED-Cas9 used in step 3 of Example 1.

[0028] Figure 4 This is a high-performance liquid chromatography (HPLC) result from the determination of the final yield in Example 3. Detailed Implementation

[0029] The present invention will be further described below with reference to the embodiments.

[0030] This invention also provides a recombinant Escherichia coli that produces high levels of astaxanthin. The recombinant Escherichia coli overexpresses the encoding genes for lycopene cyclase crtY, β-carotene hydroxylase crtZ, and β-carotene ketylase crtW.

[0031] The recombinant *E. coli* strain of this invention preferably includes *E. coli* K-12W3110. This strain lacks the DNA-binding transcriptional repressor LacI and overexpresses farnesyl pyrophosphate synthase ispA, geranyl-geranyl pyrophosphate synthase crtE, phytoene synthase crtB, phytoene dehydrogenase crtI, and isopentenyl pyrophosphate isomerase idi in a genome-integrated form. Therefore, *E. coli* K-12W3110 can convert glucose in the culture medium into lycopene.

[0032] The present invention also provides a method for constructing the recombinant Escherichia coli, preferably using CRISPR Cas9, and more preferably including: (1) PCR amplification of the upstream and downstream homologous arms of the pseudogene yedN from the genome of Escherichia coli K-12W3110; (2) amplification of the encoding gene of lycopene cyclase crtY using primers crtY-F and crtY-R in Table 1; (3) fusion of the upstream and downstream homologous arms of yedN and the lycopene cyclase crtY fragment driven by the Trc promoter to obtain the yedNup-crtY-yedNdn fragment; (4) transformation of the obtained fusion fragment yedNup-crtY-yedNdn and a vector containing yedN-sgRNA into recombinant Escherichia coli K-12W3110 (abbreviated as AST1) to obtain a recombinant strain in which the pseudogene yedN is knocked out and crtY driven by the Trc promoter is integrated at the yedN site, and the recombinant strain AST2 is obtained after removing the yedN-sgRNA vector;

[0033] (5) The upstream and downstream homologous arms of the pseudogene yciQ were amplified by PCR from the genome of Escherichia coli K-12W3110; (6) The encoding gene of β-carotene hydroxylase crtZ was amplified using the primers crtZ-F and crtZ-R in Table 1; (7) The upstream and downstream homologous arms of yciQ and the β-carotene hydroxylase crtZ fragment driven by the Trc promoter were fused to obtain the yciQup-crtZ-yciQdn fragment; (8) The obtained fusion fragment yciQup-crtZ-yciQdn and the vector containing yciQ-sgRNA were transformed into recombinant Escherichia coli AST2 to obtain a recombinant strain with the pseudogene yciQ knocked out and crtZ driven by the Trc promoter integrated at the yciQ site. After removing the yedN-sgRNA vector, the recombinant strain AST3 was obtained.

[0034] (9) The upstream and downstream homologous arms of the pseudogene ilvG were amplified by PCR from the genome of Escherichia coli K-12W3110; (10) The encoding gene of β-carotene hydroxylase crtZ was amplified using the primers crtW-F and crtW-R in Table 1; (11) The upstream and downstream homologous arms of ilvG and the β-carotene hydroxylase crtZ fragment driven by the Trc promoter were fused to obtain the ilvGup-crtW-ilvGdn fragment; (12) The obtained fusion fragment ilvGup-crtW-ilvGdn and the vector containing ilvG-sgRNA were transformed into recombinant Escherichia coli AST3 to obtain a recombinant strain in which the pseudogene ilvG was knocked out and crtW driven by the Trc promoter was integrated at the ilvG site. After removing the yedN-sgRNA vector, the recombinant strain AST4 was obtained.

[0035] In this invention, the primers shown in Table 1 were used to complete the construction of the recombinant Escherichia coli.

[0036] Table 1. Primer Information

[0037] Primer Sequence 5’-3’ yedNup-F CCGGGCGATGGATATGAGCG yedNup-R ATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAATTTTTTTTGAAGTCATTCGATGCGC yedNdn-F gcgtgctatcatggaaaaagcgtaaCAGGGATTTGCTATGAAAGATCGCAG yedNdn-R CATATTTCCGGCATGCTGCAGC crtY-F CTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCatggcggatcagccggatc crtY-R ttacgctttttccatgatagcacgc yciQup-F CTGATTCCGGCTATGCGC yciQup-R GTGCACGTCAGCGTGGTTAACTTAGCAATGCCTCGGCTCC yciQdn-F GTACTTCAACAAAAACAAATAACTTAGCAATGCCTCGGCTC yciQdn-R GCCAGTCCACCCCATTGC crtZ-F CTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGATTCTGAACCTGGCTGTTTTC crtZ-R TTAACCACGCTGACGTGCAC ilvGup-F GCTGTAGCCCGCTAATTCG ilvGup-R ATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAAGTTAGTTCCCCGTCCTGAATCT ilvGdn-F CTCCGCAGCGTGGTGATTTCTAATGCAACATCAGGTCAATGTATCGG ilvGdn-R GACGGATATAGGCGCTGGTGAG crtW-F CTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGCCGGGTAAAGTTGCACA crtW-R TTAGAAATCACCACGCTGCGGAG pGRB-F gttttagagctagaaatagcaagttaaaataaggc pGRB-R actagtattatacctaggactgagctagc yedN-gRNA-F agtcctaggtataatactagtACCTCTTCCATCCTGGATTGgttttagagctagaa yedN-gRNA-R ttctagctctaaaacCAATCCAGGATGGAAGAGGTactagtattatacctaggact yciQ-gRNA-F agtcctaggtataatactagtGCTCCAGAGATTGCCCGTAAgttttagagctagaa yciQ-gRNA-R ttctagctctaaaacTTACGGGCAATCTCTGGAGCactagtattatacctaggact ilvG-gRNA-F agtcctaggtataatactagtGGAAGAGTTGCCGCGCATCAgttttagagctagaa ilvG-gRNA-R ttctagctctaaaacTGATGCGCGGCAACTCTTCCactagtattatacctaggact

[0038] The following detailed description, with reference to embodiments, illustrates a recombinant Escherichia coli and its construction and fermentation method for synthesizing astaxanthin provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1: Construction of recombinant Escherichia coli strain AST2 for producing carotene

[0040] 1. Construction of sgRNA recombinant plasmid

[0041] Using primers pGRB-F and pGRB-R, from the vector pGRB( Figure 2 The linearized vector L-pGRB was obtained by PCR. PCR amplification was performed using the primers pGRB-F and pGRB-R. The amplification conditions were: 95 ℃ pre-denaturation for 5 min; 98 ℃ denaturation for 10 s, 55 ℃ annealing for 15 s, 72 ℃ extension for 90 s, 30 cycles; final extension at 72 ℃ for 5 min. The PCR amplification system consisted of 1 μL template, 2 μL each of forward and reverse primers, 20 μL sterile double-distilled water, and 25 μL 2×PhantaMax MasterMix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was verified by electrophoresis. The recovered products were stored in 1.5 mL centrifuge tubes at -20 ℃ for later use. The designed sgRNAs (yedN-gRNA-F and yedN-gRNA-R, yciQ-gRNA-F and yciQ-gRNA-R, ilvG-gRNA-F and ilvG-gRNA-R) were ligated with the linearized vector L-pGRB to construct recombinant plasmids yedN-sgRNA, yciQ-sgRNA, and ilvG-sgRNA. The constructed plasmids were stored at -20°C for later use.

[0042] 2. Construction of the fused fragment yedNup-crtY-yedNdn

[0043] Using primers yedNup-F, yedNup-R, yedNdn-F, and yedNdn-R listed in Table 1, upstream and downstream homologous arms of the yedN gene were amplified from the genome of *E. coli* K-12W3110, yielding fragments yedNup (SEQ ID NO: 7) and yedNdn (SEQ ID NO: 8). Using total DNA from *Escherichia coli* W3110 as a template, PCR amplification was performed using the aforementioned primers. The amplification conditions were: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 60 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 1 μL template, 2 μL each of upstream and downstream primers, 20 μL sterile double-distilled water, and 25 μL 2×PhantaMax Master Mix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was verified by electrophoresis. The recovered product was stored in 1.5 mL centrifuge tubes at -20°C for later use.

[0044] The crtY fragment was amplified using primers crtY-F and crtY-R listed in Table 1. The amplification conditions were: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 90 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 1 μL template, 2 μL each of forward and reverse primers, 20 μL sterile double-distilled water, and 25 μL 2×PhantaMax MasterMix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was verified by electrophoresis. The recovered products were stored in 1.5 mL centrifuge tubes at -20℃ for later use.

[0045] The fragments yedNup, crtY, and yedNup were fused by PCR to obtain the fusion fragment yedNup-crtY-yedNdn. Using fragments yedNup, crtY, and yedNup as templates, PCR amplification was performed using the primers yedNup-F and yedNdn-R. The amplification conditions were: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 90 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 1 μL template, 2 μL each of forward and reverse primers, 20 μL sterile double-distilled water, and 25 μL 2×Phanta MaxMaster Mix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was verified by electrophoresis. The recovered products were stored in 1.5 mL centrifuge tubes at -20℃ for later use.

[0046] 3. Construction of recombinant Escherichia coli AST2

[0047] The recombinant plasmid yedN-sgRNA and the fusion fragment yedNup-crtY-yedNdn were transformed into a plasmid containing pRED-Cas9. Figure 3 The Escherichia coli K-12W3110 (AST1) was subjected to colony PCR screening using primers yedNup-F and yedNdn-R. The fusion fragment yedNup-crtY-yedNdn was successfully integrated into the yedN site. After adding 2mM arabinose and culturing at 30℃ for 12h, the recombinant plasmid yedN-sgRNA was removed. Then, the pRED-Cas9 plasmid was removed by high-temperature induction at 42℃, resulting in the recombinant Escherichia coli strain AST2 that can produce carotene.

[0048] Example 2: Construction of recombinant Escherichia coli strain AST4 for astaxanthin production

[0049] Using AST2 constructed in Example 1 as the starting strain, a recombinant Escherichia coli strain that synthesizes astaxanthin was constructed.

[0050] 1. Construction of the fusion fragment yciQup-crtZ-yciQdn

[0051] Using primers yciQup-F, yciQup-R, yciQdn-F, and yciQdn-R listed in Table 1, homologous arms flanking the yciQ gene were amplified from the genome of *E. coli* K-12W3110, yielding fragments yciQup (SEQ ID NO: 9) and yciQdn (SEQ ID NO: 10). Using total DNA from *Escherichia coli* W3110 as a template, PCR amplification was performed using the aforementioned primers. The amplification conditions were: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 60 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 1 μL template, 2 μL each of forward and reverse primers, 20 μL sterile double-distilled water, and 25 μL 2×PhantaMax Master Mix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was verified by electrophoresis. The recovered product was stored in 1.5 mL centrifuge tubes at -20°C for later use.

[0052] The crtY fragment was amplified using primers crtZ-F and crtZ-R listed in Table 1. The amplification conditions were: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 90 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 1 μL template, 2 μL each of forward and reverse primers, 20 μL sterile double-distilled water, and 25 μL 2×PhantaMax MasterMix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was verified by electrophoresis. The recovered products were stored in 1.5 mL centrifuge tubes at -20℃ for later use.

[0053] Fragments yciQup, crtZ, and yciQup were fused using PCR to obtain the fusion fragment yciQup-crtZ-yciQdn. Using fragments yciQup, crtZ, and yciQup as templates, PCR amplification was performed using the primers yciQup-F and yciQdn-R. The amplification conditions were: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 90 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 1 μL template, 2 μL each of forward and reverse primers, 20 μL sterile double-distilled water, and 25 μL 2×Phanta MaxMaster Mix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was verified by electrophoresis. The recovered products were stored in 1.5 mL centrifuge tubes at -20℃ for later use.

[0054] 2. Construction of recombinant Escherichia coli AST3

[0055] The recombinant plasmid yciQ-sgRNA and the fusion fragment yciQup-crtZ-yciQdn were transformed into E. coli containing the pRED-Cas9 plasmid. Figure 3 For AST12, primers yciQup-F and yciQdn-R were used to perform colony PCR to screen transformants. The fusion fragment yciQup-crtZ-yciQdn was successfully integrated into the yciQ site. After adding 2mM arabinose and culturing at 30℃ for 12h, the recombinant plasmid yciQ-sgRNA was removed to obtain the recombinant strain AST3.

[0056] 3. Construction of the fused fragment ilvGup-crtW-ilvGdn

[0057] Using primers ilvGup-F, ilvGup-R, ilvGdn-F, and ilvGdn-R listed in Table 1, upstream and downstream homologous arms of the ilvG gene were amplified from the genome of *E. coli* K-12W3110, yielding fragments ilvGup (SEQ ID NO: 11) and ilvGdn (SEQ ID NO: 12). Using total DNA from *Escherichia coli* W3110 as a template, PCR amplification was performed using the aforementioned primers. The amplification conditions were: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 60 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 1 μL template, 2 μL each of upstream and downstream primers, 20 μL sterile double-distilled water, and 25 μL 2×PhantaMax Master Mix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was verified by electrophoresis. The recovered product was stored in 1.5 mL centrifuge tubes at -20°C for later use.

[0058] The crtY fragment was amplified using primers crtW-F and crtW-R listed in Table 1. The amplification conditions were: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 90 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 1 μL template, 2 μL each of forward and reverse primers, 20 μL sterile double-distilled water, and 25 μL 2×PhantaMax MasterMix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was verified by electrophoresis. The recovered products were stored in 1.5 mL centrifuge tubes at -20℃ for later use.

[0059] The fragments ilvGup, crtW, and ilvGup were fused by PCR to obtain the fusion fragment ilvGup-crtW-ilvGdn. Using fragments ilvGup, crtW, and ilvGup as templates, PCR amplification was performed using the primers ilvGup-F and ilvGdn-R. The amplification conditions were: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 90 s, 30 cycles; and 72℃ final extension for 5 min. The PCR amplification system consisted of 1 μL template, 2 μL each of forward and reverse primers, 20 μL sterile double-distilled water, and 25 μL 2×Phanta MaxMaster Mix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was verified by electrophoresis. The recovered products were stored in 1.5 mL centrifuge tubes at -20℃ for later use.

[0060] 4. Construction of recombinant Escherichia coli AST4

[0061] The recombinant plasmid ilvG-sgRNA and the fusion fragment ilvGup-crtW-ilvGdn were transformed into a transfection medium containing... Figure 3 The pRED-Cas9 plasmid in *E. coli* AST3 was used to screen transformants by colony PCR using primers ilvGup-F and ilvGdn-R. The fusion fragment ilvGup-crtW-ilvGdn was successfully integrated into the yciQ site. After adding 2 mM arabinose and culturing at 30°C for 12 h, the recombinant plasmid ilvG-sgRNA was removed. Then, the pRED-Cas9 plasmid was removed by culturing at 42°C, resulting in the recombinant *E. coli* strain AST4 that produces astaxanthin.

[0062] It should be noted that (1) in this embodiment, AST2 constructed in Example 1 was used as the starting strain to construct a recombinant Escherichia coli strain that synthesizes astaxanthin. Therefore, the recombinant strain AST4 can achieve efficient conversion of the synthetic pathway of lycopene → β-carotene → astaxanthin, thereby increasing the yield of astaxanthin. (2) It is reasonable for those skilled in the art to speculate that, using Escherichia coli capable of producing carotene as the starting strain, the recombinant Escherichia coli strain constructed by the method described in this embodiment will necessarily be able to achieve efficient conversion of the synthetic pathway of β-carotene → astaxanthin.

[0063] Example 3: Production of astaxanthin by fermentation using the recombinant Escherichia coli strain AST4 constructed in Example 2.

[0064] The recombinant Escherichia coli strain AST4 obtained in Example 2 was inoculated into seed culture medium for seed culture; then, the seed culture was transferred into fermentation medium at an inoculation rate of 20%. Details are as follows:

[0065] 1.5L Seed Tank Process Control

[0066] a. Set the temperature to 30℃, pH to 7.0, fan speed to 500 rpm, and airflow to 0.3 m³ / h. 3 / h, with the temperature controlled at 30℃ throughout the process, the tank pressure at 0.05~0.08MPa, and the culture cycle at 10h;

[0067] b. Transplantation standard: OD 600 :12-15.

[0068] c. The seed culture medium consisted of 20 g / L glycerol, 5 g / L yeast extract, 2 g / L KH2PO4, 1 g / L magnesium sulfate, 20 mg / L FeSO4·7H2O, and 20 mg / L MnSO4·H2O.

[0069] 2.5L fermenter fermentation process control

[0070] a. Set the temperature to 30℃, pH to 7.0, initial rotation speed to 300 rpm, and airflow to 0.3 m³ / h. 3 / h, with the temperature controlled at 30℃ throughout the process and the tank pressure at 0.05~0.08MPa;

[0071] b. Residual sugar control: The residual amount is controlled within 0-1 g / L by adding glycerol;

[0072] c.DO control: At 0h, the air volume is 0.3m³. 3 / h, 300rpm, tank pressure 0.05MPa;

[0073] d. When DO drops below 30%, adjust the aeration rate and stirring speed to control the dissolved oxygen level at 30% until fermentation ends;

[0074] e. The fermentation medium consists of 20 g / L glucose, 2 g / L potassium dihydrogen phosphate, 3 g / L yeast powder, 1 g / L betaine, 1 g / L magnesium sulfate, 10 mg / L FeSO4·7H2O, 10 mg / L MnSO4·H2O, 8 g / L corn steep liquor powder, and 10 mg / L vitamin B1.

[0075] 3. Methods for determining astaxanthin:

[0076] a. Sample preparation: Take 1 mL of fermentation broth after 60 h of fermentation, centrifuge at 12000 rpm for 10 min, remove the supernatant and collect the bacterial cells; resuspend the bacterial cells in 1 mL of acetone and incubate at 55℃ in the dark for 15 min. Centrifuge at 12000g for 10 min to obtain the supernatant containing astaxanthin, and filter it through a 0.22 μm pore size filter membrane;

[0077] b. Analytical Methods: High-performance liquid chromatography (HPLC) was performed using a Thermo Fisher Ultimate 3000 system equipped with a C18 reversed-phase column (250 mm × 4.6 mm, 5 μm particles) and a UV detector. 20 μL of sample was loaded, and the eluted carotenoids were detected by spectral analysis at 476 nm. The mobile phases were A (methanol / acetonitrile / dichloromethane = 21:21:8) and B (methanol / water = 1:9), with a flow rate of 0.8 mL / min. −1 The column temperature was 30℃. The solvent gradient was 80%~100% A, 20%~0% B (0~18 min), 100% A~0% B (18~38 min), 100%~80% A, 0%~20% B (38~50 min).

[0078] The product was analyzed by high performance liquid chromatography, and the results are detailed in [link to relevant documentation]. Figure 4 .like Figure 4As shown, the chromatographic peak with a retention time of 12.6 min is astaxanthin, indicating that astaxanthin was detected in the fermentation broth of the recombinant E. coli strain AST4, and that astaxanthin is the most important carotenoid product. Combined with... Figure 2 It can be seen that the astaxanthin content in the fermentation broth increases with the extension of time, and tends to stabilize at 60 hours, with the highest yield being 1.54 g / L.

[0079] In summary, this application's embodiments construct a recombinant *E. coli* strain AST4 by overexpressing the encoding genes for lycopene cyclase *crtY*, β-carotene hydroxylase *crtZ*, and β-carotene ketylase *crtW* in a basic strain. Using this recombinant *E. coli* for fermentation to produce astaxanthin, the astaxanthin yield and conversion rate are significantly improved. Using glycerol as a substrate, fermentation in a 5L fermenter for 60 hours yields 1.54 g / L of astaxanthin (compared to 1.18 g / L in the prior art), solving the technical problem of low astaxanthin yield in existing microbial fermentation production. This lays the foundation for the industrial production of astaxanthin and possesses broad application prospects and significant market value. Furthermore, this application provides a plasmid-free recombinant *E. coli* strain and its construction method, eliminating the safety hazards and increased costs associated with adding antibiotics during fermentation.

[0080] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An enzyme system for increasing astaxanthin production, characterized in that: It includes β-carotene hydroxylase crtZ and β-carotene ketolase crtW; wherein the β-carotene hydroxylase crtZ has the amino acid sequence shown in SEQ ID NO: 2, and the β-carotene ketolase crtW has the amino acid sequence shown in SEQ ID NO:

3.

2. The enzyme system for increasing astaxanthin production according to claim 1, characterized in that: It also includes lycopene cyclase crtY, which has the amino acid sequence shown in SEQ ID NO:

1.

3. The isolated recombinant nucleic acid encoding the enzyme system of claim 1 or 2.

4. A transforming microorganism, characterized in that: Includes the recombinant nucleic acid as described in claim 3.

5. The transforming microorganism according to claim 4, characterized in that: The microorganism is a strain that produces β-carotene or lycopene.

6. The transforming microorganism according to claim 4 or 5, characterized in that: The microorganism in question is recombinant Escherichia coli.

7. The transforming microorganism according to claim 6, characterized in that: The gene encoding the lycopene cyclase crtY is shown in SEQ ID NO:4, the gene encoding the β-carotene hydroxylase crtZ is shown in SEQ ID NO:5, and the gene encoding the β-carotene ketylase crtW is shown in SEQ ID NO:

6.

8. The application of the microorganisms described in any one of claims 4-7 in the fermentation production of astaxanthin.

9. A method for producing astaxanthin by microbial fermentation, characterized in that: Includes the following steps: (1) The microorganisms described in any one of claims 5-7 are inoculated into a seed culture medium and cultured to obtain a seed solution; (2) The seed liquid is inoculated into a fermentation medium for aerobic fermentation to obtain fermentation liquid; (3) The fermentation liquid is centrifuged to collect the cells, and the product astaxanthin is obtained by cell disruption, extraction and purification.

10. The method for producing astaxanthin by microbial fermentation according to claim 9, characterized in that: The fermentation medium uses glucose, glycerol, and other carbon sources that Escherichia coli can grow well as fermentation substrates.

Citation Information

Patent Citations

  • Astaxanthin synthetase of sphingomonas, encoding gene of astaxanthin synthetase and method for genetic manipulation of sphingomonas

    CN104232595A

  • Engineering strain capable of producing high-content zeaxanthine or astaxanthin and application thereof

    CN106801028A

  • Beta-carotene hydroxylase for sphingomonas, encoding gene thereof and application of beta-carotene hydroxylase in producing astaxanthin

    CN107142250A

  • Recombinant pichia pastoris for producing astaxanthin as well as construction method and application of recombinant pichia pastoris

    CN118146970A

  • Transformant having carotenoid productivity and method for producing carotenoid

    JP2006075097A