Application of dicentrine in preparation of medicine for treating kanamycin drug-resistant bacterium infection
The combined use of purslane and kanamycin has solved the treatment problem of kanamycin-resistant bacteria, achieving effective inhibition and treatment of infections caused by drug-resistant bacteria. In particular, it has a synergistic effect on EanT-1 enzyme-mediated drug-resistant strains, showing significant clinical therapeutic effects.
Patent Information
- Application Number
- CN202610229039.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-26
- Publication Date
- 2026-04-10
AI Technical Summary
Current technology lacks an effective strategy to restore the antibacterial activity of kanamycin against bacteria expressing EanT-1 aminoglycoside nucleotide transferases, leading to serious drug resistance problems, especially in infections such as sepsis, pneumonia, urinary tract infections, and skin and soft tissue infections where there are no effective treatment options.
The combination of pendansine and kanamycin enhances the antibacterial effect of kanamycin by competitively binding to the active sites of drug-resistant enzymes and occupying key aspartic acid residues to disrupt the catalytic environment.
The combined use of purslane and kanamycin significantly reduces the minimum inhibitory concentration of drug-resistant strains and effectively treats serious infections caused by kanamycin-resistant bacteria, such as sepsis, pneumonia, and urinary tract infections, demonstrating significant potential for clinical application.
Smart Images

Figure CN121818641A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of pharmaceutical technology, and in particular to the application of purslane in the preparation of drugs for treating kanamycin-resistant bacterial infections. Background Technology
[0002] Aminoglycoside antibiotics (such as kanamycin, gentamicin, and amikacin) are an important class of broad-spectrum antibacterial drugs. They exert their bactericidal effect by binding to the 30S ribosomal subunit of bacteria, interfering with protein synthesis. However, with their widespread clinical use, bacterial resistance to these drugs has spread rapidly, becoming a major challenge in anti-infective therapy. Aminoglycoside nucleotransferases (ANTs) can covalently link AMP groups to specific hydroxyl groups of antibiotic molecules via an ATP-dependent mechanism, thereby inactivating the antibiotic and preventing it from binding to ribosomes. In recent years, novel ANTs such as EanT-1 have been observed in environmental and clinical isolates (such as Microbes). Small bacterium It was found in sp.) that can efficiently mediate high-level resistance to drugs such as kanamycin, and its encoding gene eanT-1 It can spread to common pathogens such as Escherichia coli through horizontal plasmid transfer, significantly increasing the risk of drug resistance transmission.
[0003] Although studies have attempted to develop AMEs inhibitors (such as metal chelators and nucleoside analogs), most suffer from high toxicity, poor selectivity, or insufficient in vivo stability, and no drug resistance reversal agents are yet available for clinical use. Natural products, due to their structural diversity and biocompatibility, are considered an important source for discovering novel antibiotic potentiators. Dihydrosanguinarine is an isoquinoline alkaloid found in *Bleeding Heart* (*Bleeding Heart*). Dicentra spectacular In plants such as [list of plants], it has been previously reported to have anti-inflammatory, analgesic and antitumor activities, but so far there has been no research or application of it in reversing kanamycin resistance.
[0004] Currently, there is an urgent need to develop a safe and effective strategy to restore the antibacterial activity of kanamycin against ANT-resistant bacteria. Summary of the Invention
[0005] The first aspect of the present invention provides the use of purslane in the preparation of medicaments for treating kanamycin-resistant bacterial infections.
[0006] Specifically, the molecular structure of the purslane is shown in formula (I).
[0007]
[0008] Formula (I) Specifically, the kanamycin-resistant bacteria are strains that express EanT-1 aminoglycoside nucleotransferase.
[0009] More specifically, the strains include, but are not limited to, any one or more of the following: Microbacterium, drug-resistant Escherichia coli, and / or Enterobacter cloacae that produce EanT-1 enzyme and / or carry the EanT-1 gene as SEQ ID NO.1.
[0010] SEQ ID NO.1: .
[0011] Specifically, the aminokanamycin-resistant bacterial infections include, but are not limited to, at least one of the following: sepsis, pneumonia, urinary tract infection, skin and soft tissue infection, or abdominal infection caused by drug-resistant bacteria.
[0012] A second aspect of the present invention provides a pharmaceutical composition for treating kanamycin-resistant bacterial infections, the active ingredients of the pharmaceutical composition comprising paeonol and kanamycin.
[0013] Specifically, the mass ratio of the purslane to kanamycin is 0.01-30:1.
[0014] Specifically, the pharmaceutical composition further comprises pharmaceutically acceptable excipients.
[0015] More specifically, the excipients include any one or more of the following: binders, fillers, disintegrants, lubricants, preservatives, antioxidants, flavoring agents, fragrances, solubilizers, emulsifiers, solubilizers, or osmotic pressure regulators.
[0016] Specifically, the dosage forms of the pharmaceutical composition include, but are not limited to: liquid solutions, lyophilized powders, tablets, capsules, granules, sprays, implants, gels, creams, ointments, or suppositories.
[0017] Specifically, the pharmaceutical composition further includes pharmaceutical excipients.
[0018] Specifically, the administration methods of the pharmaceutical composition include injection, implantation, external application, spraying, inhalation, or combinations thereof.
[0019] More specifically, the injection administration methods include, but are not limited to: intraocular injection, intravenous injection, intramuscular injection, subcutaneous injection, intrathecal injection, intra-articular injection, or intratumoral injection.
[0020] A third aspect of the present invention provides a method for treating kanamycin-resistant bacterial infections, the method comprising administering to a subject a therapeutically effective amount of purslane and kanamycin or any of the above-mentioned drug combinations.
[0021] Specifically, the mass ratio of the purslane to kanamycin is 0.01-30:1.
[0022] Specifically, the kanamycin-resistant bacterial infections include, but are not limited to, at least one of the following: sepsis, pneumonia, urinary tract infection, skin and soft tissue infection, or abdominal infection caused by drug-resistant bacteria.
[0023] The term "subject" includes living organisms (e.g., mammals) that can elicit an immune response. Examples of subjects include humans, primates, cattle, horses, goats, sheep, dogs, cats, mice, rats, rabbits, guinea pigs, pigs, and their transgenic species.
[0024] The terms “treat” or “treatment” or “ameliorate” refer to the medical management of a subject’s disease, condition, or undesirable condition. Treatment or preventative benefits include improved clinical outcomes; reduction or alleviation of symptoms associated with the disease, condition, or undesirable condition; reduced symptom occurrence; improved quality of life; longer disease-free status; reduction in the severity of the disease, condition, or undesirable condition; stabilization of the disease state; delay in disease progression; remission; survival; prolonged survival; or any combination thereof.
[0025] The term "therapeutic effective dose" refers to a pharmaceutically considered effective dosage, that is, an amount of active drug sufficient to significantly improve the condition without causing serious side effects. Dosage depends on many factors, such as the nature and severity of the disease to be prevented or treated, the sex, age, weight, personality, and individual response of the patient or animal, the route of administration, frequency of administration, and therapeutic purpose; therefore, the dosage of this invention can vary widely.
[0026] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a synergist for kanamycin—pembrolizine. When used in combination with kanamycin, pembrolizine can effectively kill kanamycin-resistant bacteria. Pembrolizine exerts its synergistic effect through mechanisms such as competitively binding to the active sites of drug-resistant enzymes and occupying key aspartic acid residues to disrupt the catalytic environment. It is expected to be applied in the clinical treatment of severe bacterial infections and has important clinical significance and social benefits. Attached Figure Description
[0027] Figure 1 This is the binding site for paeonol and the aminoglycoside nucleotide transferase EanT-1. Detailed Implementation The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0028] Example 1: Antibacterial effect of kanamycin and purslane in combination against aminoglycoside-resistant bacteria. In this embodiment, aminoglycoside-resistant strains Small bacterium sp. PL221A and transfection eanT-1The *E. coli* strain *EcEanT* containing the gene was isolated and preserved in the laboratory. Kanamycin (CAS: 59-01-8, purity ≥98%) was purchased from Sigma-Aldrich, and gentianin (CAS: 485-49-4, purity ≥96%) was purchased from Shanghai Maclean Biochemical Technology Co., Ltd. Kanamycin was prepared into a 32 mg / mL stock solution with sterile water, filtered through a 0.22 μm filter membrane, and aliquoted into sterile centrifuge tubes, stored at -80℃. Genianin was prepared into a 1 mg / mL stock solution with DMSO, filtered through a 0.22 μm filter membrane, and aliquoted into sterile centrifuge tubes, stored at -80℃.
[0029] transfection eanT-1 Construction of the EcEanT gene in *E. coli*: The promoter sequence fragment (Pamp) of the ampicillin resistance gene in the pMD-18T vector was amplified by PCR using primers Pamp-F3 and Pamp-R3. Then, using primers EanT-1-F and EanT-1-R, the gene was amplified from strain PL221A by PCR. eanT -1 Complete gene fragment. Using the above fragment as a template, PCR amplification was performed using Pamp-F3 and EanT-1-R primers to obtain the fusion fragment. The fusion fragment was digested with Xba I and Kpn I and ligated into the linearized pMD18-T vector to obtain the pMD-EanT plasmid. The pMD-EanT plasmid was transformed into E. coli DH5α to obtain the EcEanT strain. E. coli DH5α and DT carrying the pMD18-T vector were used as blank controls. The primer sequences are as follows.
[0030] Pamp-F3 (SEQ ID NO.2): CCATGGGGTACCGACGAAAGGGCCTCGTGATAC.
[0031] Pamp-R3 (SEQ ID NO.3): GCCCAGATCGGTATCGGTCATACTCTTCCTTTTTCAATATTATTGAAGC.
[0032] EanT-1 (SEQ ID NO.4): GCTTCAATAATATTGAAAAAGGAAGAGTATGTATATGACCAATGAGCAAGTGCTC.
[0033] EanT-1-R (SEQ ID NO.2): TCTAGATTAATCGTTTGAACACCAAAGC.
[0034] Following CLSI guidelines, the minimum inhibitory concentrations (MICs) of kanamycin and purslane against kanamycin-resistant bacteria PL221A and EcEanT were determined using the microbroth dilution method. The results are shown in Table 1. The MIC for kanamycin against PL221A was >128 mg / L, and the MIC for EcEanT was 128 mg / L. The addition of 10 mg / L purslane significantly reduced the MICs of both strains against kanamycin (PL221A MIC decreased to 4 mg / L, and EcEanT MIC decreased to <2 mg / L), indicating that the combined use of kanamycin and purslane has a synergistic inhibitory effect against aminoglycoside-resistant bacteria.
[0035] Table 1. MICs (mg / L) of kanamycin-resistant bacteria
[0036] Example 2: Efficacy of combined kanamycin and purslane in the treatment of sepsis in mice Injected via tail vein Small bacterium A mouse sepsis model was established using sp. PL221A. The treatment groups received twice-daily injections of kanamycin (25 mg / kg), pentamidine (25 mg / kg), or kanamycin + pentamidine (10 mg / kg + 15 mg / kg), while the control group received an equal volume of physiological saline. Peripheral blood was collected at 24, 48, and 72 hours for bacterial culture, identification, and counting. The total white blood cell count was also measured to observe the anti-infective effect of the combined application of kanamycin and pentamidine. The results are shown in Table 2. In the kanamycin and pentamidine combined treatment group, bacterial infection in the blood was cleared by 72 hours, with no bacteria detected in the peripheral blood and the total white blood cell count within the normal range. However, the groups treated with kanamycin alone or without treatment still exhibited sepsis symptoms at 72 hours, with a large number of bacteria detected in the blood, and a few mice died.
[0037] Steps for constructing a mouse sepsis model: Cultivate and collect Microbacterium sp. PL221A strain, washed with sterile physiological saline and adjusted to 10 10 CFU / mL. Healthy C57BL / 6 mice, weighing 220–300 g, were selected and injected with the prepared bacterial solution via tail vein injection. The injection dose was 0.5 mL per mouse. After injection, the mice's survival rate, weight change, body temperature, and activity level were closely monitored. Obvious symptoms, such as lethargy, loss of appetite, and abnormal body temperature, appeared within several hours to 48 hours. Table 2. Blood bacterial load and peripheral blood leukocyte count of mice in each group at 72 hours.
[0038] Example 3: Paeoniaeline inhibits the drug resistance function of kanamycin resistance genes. The inventors confirmed through previous research (Wang J, Yu M, Zhang M, et al. Bicuculline reversal of aminoglycoside O-nucleotidyltransferase EanT-1-mediated kanamycin resistance. BMC Microbiol. Published online February 3, 2026.) that... Small bacterium The drug resistance gene associated with kanamycin resistance in sp. PL221A is: eanT-1 It encodes aminoglycoside nucleotidyltransferases (ANTs), named EanT-1. The above-mentioned PL221A strain was amplified by PCR. eanT-1 The gene was ligated into the expression vector pET-15b and transformed into... E. coli EanT-1 was induced to express by BL21 (DE3) strain at 20℃ with 0.5 mM IPTG, and then purified by Ni-NTA affinity chromatography. Enzyme activity was measured using the EnzChek Pyrophosphate Assay kit. The enzyme activity results are shown in Table 3. The EanT-1 enzyme activity parameter kcat decreased from 7.81±1.3 s⁻¹ to <0.05 s⁻¹, indicating that purslane can inhibit the degradation of aminoglycoside antibiotics by the kanamycin resistance protein EanT-1. Molecular docking analysis was performed to investigate the molecular mechanism by which purslane inhibits the aminoglycoside nucleotransferase EanT-1, and the results are shown below. Figure 1 As shown, among the amino acids that bind to the catalytic active site of EanT-1 enzyme, several amino acid residues overlap with the kanamycin binding site (N26, D43, D98, V44, T45, and D114). By competing with natamycin for binding to some key amino acids in the catalytic active site of the enzyme, it inhibits enzyme activity and thus prevents kanamycin adenylation.
[0039] Table 3. Inhibition of EanT-1 enzyme activity by purslane
[0040] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Application of purslane in the preparation of drugs for treating kanamycin-resistant bacterial infections.
2. The application according to claim 1, characterized in that, The kanamycin-resistant bacteria are strains that express EanT-1 aminoglycoside nucleoside transferase.
3. The application according to claim 2, characterized in that, The strains include microbacteria that produce EanT-1 enzyme and / or carry the EanT-1 gene, drug-resistant Escherichia coli, and / or Enterobacter cloacae.
4. The application according to claim 1, characterized in that, The kanamycin-resistant bacterial infections include at least one of the following: sepsis, pneumonia, urinary tract infection, skin and soft tissue infection, or abdominal infection caused by drug-resistant bacteria.
5. A pharmaceutical composition for treating kanamycin-resistant bacterial infections, characterized in that, The active ingredients of the pharmaceutical composition include purslane and kanamycin.
6. The pharmaceutical composition according to claim 5, characterized in that, The mass ratio of purslane to kanamycin is 0.01-30:
1.
7. The pharmaceutical composition according to any one of claims 5-6, characterized in that, The pharmaceutical composition also contains pharmaceutically acceptable excipients.
8. The pharmaceutical composition according to claim 7, characterized in that, The excipients include any one or more of the following: binders, fillers, disintegrants, lubricants, preservatives, antioxidants, flavoring agents, fragrances, solubilizers, emulsifiers, solubilizers, or osmotic pressure regulators.
9. The pharmaceutical composition according to any one of claims 5-6, characterized in that, The dosage forms of the pharmaceutical composition include: liquid solutions, lyophilized powders, tablets, capsules, granules, sprays, implants, gels, creams, ointments, or suppositories.
10. The pharmaceutical composition according to any one of claims 5-6, characterized in that, The drug composition can be administered by injection, implantation, external application, spraying, inhalation, or a combination thereof.