Plasmid tool for simulating Kras random evolution and application

Abstract

The invention provides a plasmid tool for simulating Kras random evolution and application thereof, and the plasmid tool comprises at least two guide RNA expression cassettes driven by a first promoter, which respectively target a Pten gene and a Trp53 gene; the pilot editing guide RNA expression box is driven by a second promoter, targets the 12th codon of the Kras gene, and comprises a repair template sequence for editing the codon into G12D; the fusion protein expression cassette is driven by a third promoter and comprises SpCas9 protein and MMLV reverse transcriptase; and at least one eukaryotic selection marker gene expression cassette. The invention also discloses a method for constructing a simulated Kras random evolution model by adopting the plasmid tool, and application of the plasmid tool in screening targeted drugs aiming at KRAS mutation tumors. The plasmid tool provided by the invention can realize cell multi-gene locus editing, construct a Kras locus random evolution model and simulate a Kras random evolution process in ovarian cancer.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and more specifically, to a plasmid tool for simulating Kras random evolution and its uses. Background Technology

[0002] Clinical and molecular epidemiological studies have shown that KRAS is one of the most common driver oncogenes in various malignant tumors, particularly enriched in ovarian cancer subtypes such as mucinous, low-grade serous, and endometrioid. KRAS mutations often occur at codon 12, forming persistently activated RAS proteins that drive cell proliferation and malignant transformation. Large-scale ovarian cancer cohort studies have found that the KRAS mutation spectrum is dominated by G12D and G12V alleles, and clinical samples often exhibit a complex pattern of multiple KRAS alleles coexisting, frequently accompanied by synergistic gene alterations such as PTEN deletion and TP53 mutation. Current therapeutic approaches targeting the KRAS pathway mainly consist of small-molecule inhibitors targeting downstream RAF / MEK / FAK, but these have only shown efficacy in a subset of ovarian cancer patients. Therefore, there is an urgent need to establish an in vivo model platform that can mimic KRAS mutations in an immune-healthy context.

[0003] Existing preclinical models of KRAS-mutant ovarian cancer mainly include: First, patient-derived xenograft (PDX) models, which involve transplanting surgically resected tumor samples from KRAS-mutant patients into immunodeficient mice. These models have long establishment cycles, limited success rates, and, due to the lack of a complete immune system in the host, cannot accurately reflect the tumor microenvironment. Second, models using Kras... LSL-G12D United Pten flox / flox Or Trp53 flox / flox Genetically engineered mouse models (GEMMs) are used. While this method can induce tumor formation in an immune-healthy host, its construction and maintenance costs are high, the breeding cycle is long, which is not conducive to large-scale screening and rapid iteration. Furthermore, it lacks highly specific molecular markers for specific ovarian cancer subtypes, limiting the model's targeting capabilities. Therefore, existing platforms struggle to systematically and flexibly reconstruct the real clinical lineage of "multiple KRAS mutation types + common synergistic gene alterations" in immune-healthy hosts.

[0004] In terms of gene manipulation techniques, the traditional CRISPR / Cas9 system generates DNA double-strand breaks (DSBs) at target sites, primarily relying on non-homologous end joining (NHEJ) for repair, introducing base insertions / deletions that lead to gene inactivation. While this method is highly efficient at constructing knockout models, it has a low rate of accurately obtaining specific amino acid substitutions or small fragment insertions / deletions, and double-strand breaks easily lead to genomic instability issues such as large fragment deletions and chromosomal rearrangements. Prime editing (PE), by fusing the Cas9 nickase with reverse transcriptase and using pegRNA containing the editing template, achieves high-precision base substitutions and small fragment editing without double-strand breaks or exogenous donor DNA, significantly reducing the risks associated with DSBs. However, existing prime editing systems typically introduce only a single pre-defined mutation at a time. To stack multiple gene sites or combinations of multiple KRAS mutation sites in the same cell, multiple pegRNAs or vectors need to be constructed and delivered, making the operation complex, inefficient, and difficult to integrate with in vivo selection pressures for evolutionary screening.

[0005] In summary, on the one hand, the heterogeneity and complex allelic mutation profile of KRAS-mutant ovarian cancer in clinical practice urgently need to be realistically reconstructed in immunocompetent in vivo models; on the other hand, existing CRISPR / Cas9 and lead editing technologies each have their limitations: the former is more efficient but mainly produces destructive indels, while the latter is more precise but usually only achieves single-target mutations. Neither can achieve the parallel generation and in vivo evolutionary screening of multiple precisely defined allelic mutations at the same gene locus and within the same host. Therefore, there is an urgent need for a novel genetic engineering tool and operating system that can combine the advantages of double-strand cut template repair and lead editing, maintaining high editing efficiency while enabling multi-type editing of KRAS and other genes at the same cell and the same locus. Furthermore, it should be able to construct multi-allelic mutation libraries in immunocompetent animals to simulate tumor natural evolution and differences in drug response. This type of technology is expected to provide a more advanced, universal, and scalable platform for mechanistic research and targeted therapy strategy development in KRAS-mutant ovarian cancer. Summary of the Invention

[0006] To address the aforementioned technical problems, the present invention aims to provide a plasmid tool for simulating Kras random evolution and its applications. Addressing the issue that existing KrasG12D single-mutation models struggle to reproduce the entire evolutionary process due to the spatiotemporal heterogeneity and clonal progression characteristics of Kras-driven tumors, the present invention develops the multifunctional plasmid Multi-gRNAs-SpCas9-MMLV. This plasmid enables multi-gene site editing in cells and constructs a Kras site random evolution model. By simulating the Kras random evolution process in ovarian cancer, and combining single-cell full-length transcriptomics and single-cell transcriptomics, the mutational characteristics of randomly evolved KrasG12D cells were identified, providing a new tool for studying the mutational generation and key mechanisms of gain-of-function gene sites.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] In a first aspect, the present invention provides a plasmid tool for simulating Kras random evolution, comprising the following operable functional elements: (a) At least two guide RNA expression cassettes driven by a first promoter, targeting the Pten gene and the Trp53 gene, respectively; (b) At least one leader editing guide RNA expression cassette driven by a second promoter, the leader editing guide RNA targeting codon 12 of the Kras gene and containing a repair template sequence for editing the codon to G12D; (c) A fusion protein expression cassette driven by a third promoter, the fusion protein comprising a SpCas9 protein with nicking enzyme activity and an MMLV reverse transcriptase; (d) At least one eukaryotic selection marker gene expression cassette; After transfecting cells with the plasmid tool, the Pten and Trp53 genes can be knocked out simultaneously, and G12D precise mutations and random insertion / deletion mutations can be generated in parallel at codon 12 of the Kras gene, thereby constructing a genetically heterogeneous cell population.

[0009] As some specific embodiments of the present invention, the nucleotide sequence of the lead editing guide RNA includes the sequence shown in SEQ ID NO:5, or a variant sequence that has at least 90% identity with it and retains the targeted editing function.

[0010] As some specific embodiments of the present invention, the first promoter is the human U6 promoter, the second promoter is the mouse U6 promoter, and the third promoter is the CAG promoter.

[0011] As some specific embodiments of the present invention, the guide RNA sequence targeting the Pten gene is shown in SEQ ID NO.4; the guide RNA sequence targeting the Trp53 gene is shown in SEQ ID NO.3.

[0012] As some specific embodiments of the present invention, the eukaryotic selection marker gene includes a fluorescent protein encoding gene and / or an resistance gene; The fluorescent protein encoding gene includes the ZsGreen fluorescent protein gene; The resistance gene includes a puromycin resistance gene.

[0013] As some specific embodiments of the present invention, the plasmid tool also includes an OriP element and an EBNA1 gene coding element for adjoint replication in mammalian cells.

[0014] As some specific embodiments of the present invention, the plasmid tool is a Multi-gRNAs-Spcas9-MMLV expression plasmid, the construction method of which includes: using epiCRISPR plasmid to obtain the OriP element and EBNA1 coding sequence by PCR amplification, and inserting the following elements into the vector sequentially by Gibson assembly: two gRNAs targeting the Pten gene and the Trp53 gene respectively, one pegRNA targeting Kras, CAG promoter, SpCas9 nuclease coding sequence, MMLV reverse transcriptase coding sequence, ZsGreen fluorescent gene, and puromycin resistance gene.

[0015] As some specific embodiments of the present invention, the nucleotide sequence of the Multi-gRNAs-Spcas9-MMLV expression plasmid consists of SEQ ID NO.1 and SEQ ID NO.2.

[0016] In a second aspect, the present invention provides a method for constructing a simulated Kras stochastic evolution model using plasmid tools as described in any of the preceding claims, comprising the following steps: S1. Transfect the plasmid into target tumor cells and select edited heterogeneous cell populations. S2. The heterogeneous cell population is transplanted into an immune-healthy animal to form an initial tumor; S3. The initial tumor tissue is continuously passaged in situ to obtain a series of passaged tumors; In the series of passaged tumors, the proportion of cells carrying the Kras G12D mutation increased significantly with increasing passage number.

[0017] As some specific embodiments of the present invention, the proportion of cells carrying the Kras G12D mutation is determined by the following steps: Amplicon sequencing targeting the 12th codon region of the Kras gene was performed on the initial tumor and passaged tumor cells of different generations to quantitatively analyze the dynamic changes in the frequency of the G12D mutant allele. And / or, perform single-cell transcriptome sequencing on the tissues of the initial tumor and at least one generation of passaged tumors, identify a characteristic cell subpopulation stably associated with the Kras G12D mutation through computational analysis, and quantify the dynamic changes in the proportion of this subpopulation in the sample.

[0018] Thirdly, the present invention provides the use of a plasmid tool simulating random evolution of Kras as described in any of the preceding claims in screening targeted drugs against KRAS-mutant tumors.

[0019] Compared with the prior art, the present invention has the following beneficial effects: (1) To address the problem that existing single mutation models (such as KrasG12D) cannot reproduce the entire evolutionary process of Kras-driven tumors due to their spatiotemporal heterogeneity and clonal progression characteristics, this invention developed a multifunctional plasmid, Multi-gRNAs-SpCas9-MMLV. In addition to editing the Pten and Trp53 genes and generating G12D mutations at the pegRNA cleavage and repair sites of the Kras gene, it also generates other indel events near the Kras G12 site, achieving multi-gene site editing in cells. Furthermore, when this plasmid is transfected into cells and passaged, the proportion of KrasG12D in the cells gradually increases with passage, thereby obtaining a stochastic evolutionary model of gain-of-function gene sites (such as Kras). This model can simulate the stochastic evolutionary process of Kras in ovarian cancer, providing a new tool for studying the mutation generation and key mechanisms of gain-of-function gene sites.

[0020] (2) This invention innovatively uses single-cell full-length transcriptomics and single-cell transcriptomics technology to clearly depict the cellular characteristics of cells carrying the KrasG12D mutation during the random evolution of Kras through algorithms, and further provides new support for the study of mutation generation and key mechanisms of gain-of-function gene sites.

[0021] (3) This invention combines the advantages of double-strand cleavage template repair and leader editing, achieving multi-type editing of KRAS and other genes on the same cell and at the same site while maintaining high editing efficiency. It also enables the construction of multi-allelic mutation libraries in immunocompetent animals, providing novel genetic engineering tools and operating systems for simulating tumor natural evolution and drug response differences. This is expected to provide a more advanced, universal, and scalable platform for mechanistic research and targeted therapy strategy development in KRAS-mutant ovarian cancer. Attached Figure Description

[0022] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 This is a schematic diagram of the Multi-gRNAs-SpCas9-MMLV vector constructed in Example 1; Figure 2 This is a plasmid map of the Multi-gRNAs-SpCas9-MMLV constructed in Example 1; Figure 3 The image shows the transfection efficiency results after the expression plasmid was transfected into ID8 cells in Example 1. The left image is a light micrograph of the cells, and the right image is a fluorescence image of the cells. Figure 4 This is a diagram showing the alignment results of the target sequences of the Pten, Trp53, and Kras genes with the wild-type sequences in the DNA of PPK cells after transfection in Example 1. Figure 5 This is a schematic diagram illustrating the establishment of a tumor model in mice in Example 1, wherein... Figure 5 Image A shows the morphology of a mouse one week after subcutaneous inoculation with PPK cells; Figure 5 Image B shows the morphology of ascites and abdominal girth in mice after PPK4 cells were inoculated into the ovarian capsule and cultured for one month. Figure 5 C represents bloody ascites fluid extracted from the peritoneal cavity of a mouse; Figure 6 The image shows the results of amplicon sequencing of the Kras site in each generation of PPK cells in Example 1. A represents the amplicon sequencing alignment results from PPK1 to PPK6, and B represents the change in the proportion of KrasG12D in PPK cells. Figure 7 This is a diagram showing the UMAP unsupervised clustering and grouping annotation of sequencing data in Example 2, where A shows different samples and B shows different cell types; Figure 8 This is a graph showing the results of an optimization transport analysis between the expression profiles of each PPK6 cluster and the full-length Kras G12D+ cell population in Example 2. In this graph, A shows the KrasG12D cells in the full-length transcriptome of a single cell. Figure 8 Image B shows the cell subset of PPK6 in the single-cell transcriptome, and image C shows the Wasserstein distance between them. Figure 9This is a diagram showing the results of mapping the features of PPK6 cell subset_4 back to the single-cell transcriptome in Example 2. The left diagram is the overall single-cell subset diagram, showing the clustering of cells from different sample sources, including ID8-WT, PPK1, and PPK6; the middle diagram is the single-cell subset diagram, showing that the features of different subsets in the PPK6 population were mapped to the total population, resulting in 7 subsets; the right diagram is the cell count diagram, showing the proportion of cell populations with the features of subset_4 in ID8-WT, PPK1, and PPK6. Figure 10 The images show the results of fluorescence staining analysis using UNG and WT1 antibodies in Example 2. The left image shows the expression level of Ung in PPK6 single-cell sequencing, indicating that Ung is mainly expressed in subset_4 cells. The middle image is an immunofluorescence image showing the expression of DAPI (nucleus, blue), WT1 (ovarian cancer cell marker, green), and UNG (subset_4 characteristic gene, red) in ID8-WT and PPK1 cells. The right image is an immunofluorescence image showing the expression of DAPI (nucleus, blue), WT1 (ovarian cancer cell marker, green), and UNG (subset_4 characteristic gene, red) in PPK6 cells. Detailed Implementation

[0023] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.

[0024] Example 1: Construction of a Kras stochastic evolution model based on ovarian cancer (1) Cell source and culture The mouse ovarian cancer cell line ID8 was cultured in DMEM medium containing 10% FBS (fetal bovine serum) and 100 U / mL penicillin-streptomycin at 37°C and 5% CO2.

[0025] (2) Vector construction methods and gene editing methods A. Carrier Construction The MMLV reverse transcriptase coding sequence was obtained by PCR amplification using the pCMV-PEmax plasmid (addgene:174820); the OriP element and EBNA1 coding sequence were obtained by PCR amplification using the epiCRISPR plasmid (addgene #135960). The following elements were then inserted into the vector sequentially using the Gibson assembly method: expression elements for two gRNAs and one pegRNA, the CAG promoter, the SpCas9 nuclease coding sequence, the MMLV reverse transcriptase coding sequence, the ZsGreen fluorescent gene, and the Puromycin resistance gene. Among these: The two gRNAs are regulated by the human U6 promoter and target the Pten and Trp53 genes, respectively. One pegRNA is regulated by the mouse U6 promoter and targets the Kras gene. This pegRNA contains both a Kras-targeting sequence and a repair sequence (for MMLV-mediated repair). It can edit the Kras G12 site using Kras G12D as a repair template.

[0026] A schematic diagram of the constructed carrier is shown below. Figure 1 As shown, the plasmid map is as follows Figure 2 As shown.

[0027] in, The sequences of gRNA / pegRNA are shown below: Trp53 gRNA (5'-3'): ATAAGCCTGAAAATGTCTCC (SEQ ID NO.3); Pten gRNA (5'-3'): CATACCTCTGCAGTTAAATT (SEQ ID NO.4); Kras pegRNA (5'-3'): AAACTTGTGGTGGTTGGAGCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcGCCTACGCCAtCAGCTCCAACCACCACAA (SEQ ID NO. 5).

[0028] The constructed Multi-gRNAs-Spcas9-MMLV expression plasmid uses the ori element as the replication initiation site and includes, in sequence, gRNA sequences targeting the Pten and Trp53 genes controlled by the dual-human U6 promoter, pegRNA sequences targeting the Kras gene controlled by the mouse U6 promoter, the CAG promoter, the SpCas9 nuclease coding sequence, the MMLV reverse transcriptase coding sequence, the ZsGreen fluorescent gene, and the Puromycin resistance gene.

[0029] The constructed Multi-gRNAs-Spcas9-MMLV expression plasmid consists of SEQ ID NO.1 (1-9719 bp) and SEQ ID NO.2 (9720-18648 bp), totaling 18648 bp. Among them, 14-253bp is the U6 promoter, 264-283bp is the Pten gRNA, 401-641bp is the U6 promoter, 652-671bp is the Trp53 gRNA, 823-1137bp is the mouse U6 promoter, 1139-1263bp is the KrasG12D pegRNA, 1544-3269bp is the CAG promoter, 3360-7463bp is the Cas9, 7758-9719bp is the MMLV, 9840-10532bp is the ZsGreen, 10674-11270bp is the PuroR, 12130-13920bp is the oriP, 14222-16147bp is the EBNA1, and 17804-18392bp is the ori.

[0030] B. Gene editing methods The constructed Multi-gRNAs-Spcas9-MMLV expression plasmid was transfected into ID8 cells using the cell transfection reagent EZ Trans (Life-iLab). Twenty-four hours after transfection, ZsGreen fluorescence signal was observed under a microscope to confirm transfection efficiency. Figure 3 The left image shows a light micrograph of the cells, and the right image shows a fluorescence image of the cells, indicating that the cells express green fluorescent protein, suggesting successful plasmid transfection. Successfully transfected cells (named PPK cells) were then selected by adding 5 µg / ml Puromycin (YEASEN) for 7 days to obtain PPK cells with Pten and Trp53 gene knockout and Kras gene editing.

[0031] DNA was extracted from transfected PPK cells, and the target sequences of the Pten, Trp53, and Kras genes were amplified by PCR. The PCR products were then subjected to Sanger sequencing and compared with wild-type sequences. The results are as follows: Figure 4 As shown: after the gRNA cleavage sites of the Pten and Trp53 genes, peak overlap, signal attenuation, and base misalignment were observed, indicating that insertion / deletion (indel) events occurred at the target sites of these two genes. At the same time, G12D editing signals (GGT→GAT) were detected at the pegRNA cleavage and repair sites of the Kras gene, indicating that pegRNA editing was successful. The presence of indel events at this site also indicates that PPK cells contain both KrasG12D mutant cells and cells carrying other mutation types near the Kras G12 site.

[0032] C. Establishment of an in vivo stochastic evolution model of KrasG12D Model building and propagation process: a) Subcutaneous inoculation and passage: Take 3 × 10 6 One PPK cell was subcutaneously inoculated into the dorsal side of 6-8 week old C57BL / 6 mice. After about one week of culture, tumors formed (e.g., ...). Figure 5 (In mice, PPK cells were inoculated to form tumors subcutaneously). b) Preparation of single-cell suspension: The tumor tissue was taken and digested with DMEM digestion solution containing collagenase, hyaluronidase and dispersant enzyme (STEMCELL) to obtain a single-cell suspension. c) In vitro culture and expansion: Single cell suspensions were seeded into culture dishes and cultured in DMEM medium containing 10% fetal bovine serum (FBS) and 100 U / mL penicillin-streptomycin at 37°C and 5% CO2 to obtain P1 generation cells (PPK1). d) Circulating subcutaneous passage: Repeat steps a)-c) above a) a total of 4 times to obtain P4 generation cells (PPK4). e) Oral inoculation and passage: Take 1×10 6 One PPK4 cell was inoculated into the ovarian capsule of immunocompetent 6-8 week old C57BL / 6 mice. Within one month of culture, tumors, metastases, and ascites formed. Figure 5 Figures B and C show the ascites formed after PPK4 cell inoculation. Figure B shows bloody ascites and a significant increase in the abdominal girth of the mouse; Figure C shows the bloody ascites aspirated from the abdominal cavity. f) In situ tumor cell culture: The tumor formed in situ was digested and cultured in vitro according to the methods in steps b) and c) to obtain P5 generation cells (PPK5). g) Cyclic in situ passage: Repeat steps e)-f) above once to obtain P6 generation cells (PPK6).

[0033] (3) Model validation Amplicon sequencing was performed on the Kras sites of each generation of PPK cells. Figure 6 ). Figure 6 A represents the amplicon sequencing alignment results for PPK1 to PPK6 (DNA shows base alignment results; AA shows amino acid alignment results). Sorted from most to least number of amplicon detections, GGT→GAT (amino acid: G→D) gradually appears earlier, indicating that the proportion of KrasG12D is gradually increasing. Figure 6 The changes in the proportion of KrasG12D in PPK cells, as shown in Figure B, further confirm that its proportion gradually increases with passage.

[0034] Example 2: Characterization of KrasG12D cells by combining full-length single-cell transcriptome and single-cell transcriptome (1) Single-cell sequencing / single-cell full-length transcriptome sequencing Sequencing samples and data sources: Subcutaneous tumors formed from PPK1 generation cells were selected for single-cell transcriptome sequencing, and orthotopic tumors formed from PPK6 generation cells were selected for both single-cell transcriptome sequencing and single-cell full-length transcriptome sequencing.

[0035] A. Single-cell sequencing was performed using the Novcyto single-cell system (3' single-cell transcriptome sequencing): First, single-cell suspensions were randomly distributed into more than 100,000 microwells using a limiting dilution method. Oligonucleotide barcode beads were then added until saturated, ensuring each bead paired with a cell in each well. After cell lysis in the microwells, mRNA hybridized with the barcodes on the beads to capture oligonucleotides. The beads were collected into single tubes for reverse transcription and ExoI digestion. During cDNA synthesis, a unique molecular identifier (UMI) and a cell barcode (for traceability) were added to the 5' end of the cDNA (corresponding to the 3' end of the mRNA transcript). A library was constructed using the NovelCyto single-cell whole transcriptome amplification (WTA) pipeline, including random primer extension, amplification PCR, and WTA library indexing PCR. The library was quantified using an Agilent high-sensitivity DNA microarray (Bioanalyzer 4200) and a Thermo Fisher Qubit high-sensitivity DNA detector. Finally, 150bp paired-end sequencing was performed using a BGI DNBSEQ-T7 sequencer.

[0036] B. Single-cell full-length transcriptome sequencing: Single-cell RNA-Seq libraries were prepared according to the manufacturer's instructions using the SeekOne® Single-Cell Transcriptomics Kit (SeekGene, catalog number K00801). Brief steps: An appropriate amount of cells was mixed with reverse transcription reagent and added to the sample wells of the SeekOne® DD Chip S3. Barcode hydrogel beads (BHBs) and partitioning oil were added to the corresponding wells of the chip, and then the reverse transcription reagent containing cells and BHBs were encapsulated into emulsion droplets using the SeekOne® digital droplet system. After transferring the droplets to PCR tubes, annealing was performed for 15 cycles (from 8°C to 42°C) followed by heat inactivation at 85°C for 5 minutes to obtain barcoded cDNA. The cDNA was purified from the fragmented droplets, and most of the ribosomes and mitochondrial cDNA were removed by two PCR cycles. Purification was then performed using AMPure magnetic beads. One-quarter of the cDNA volume was fragmented, end-repaired, A-tailed, and ligated with sequencing adapters. The indexed PCR-amplified DNA contained polyA or non-polyA RNA fragments, cell barcodes, and unique molecular identifiers. After purification with AMPure magnetic beads, the index library was quantified by qPCR (KAPABiosystems KK4824) and then sequenced on an Illumina NovaSeq 6000 (PE150) or DNBSEQ-T7 platform (PE150). Primer sequences and low-quality bases of the original reads were trimmed and basic information was collected using Fastp (v0.20.1).

[0037] (2) Processing and analysis of single-cell transcriptome and full-length transcriptome sequencing data Sequencing data were analyzed using the standard Seruat (v5) workflow. Single-cell sequencing data of ID8 cells forming orthotopic tumors (accession: GSE183368) from a public database were included as a control (ID8-WT) for comparative analysis; three samples were used: ID8-WT, PPK1, and PPK6. After data quality control and Harmony algorithm removal to eliminate batch effects between different data sets, UMAP unsupervised clustering and cluster annotation were performed. Figure 7 A: Displays different samples; Figure 7 (B: Showing different cell types). Epi / Fib represents tumor cells, which exhibit epithelial cell and epithelial-mesenchymal transition characteristics.

[0038] To identify the transcriptional prototype of KrasG12D, Optiman transport analysis was performed between the expression profiles of each PPK6 cluster and the full-length KrasG12D+ cell population. The Wasserstein distance between the two was calculated using the transport R package. A lower Wasserstein distance value indicated higher similarity, and based on this, Subset_4 of PPK6 was determined to be the closest prototype to KrasG12D. Results are as follows: Figure 8 As shown, Figure 8 Cell A shows the KrasG12D cells in the full-length transcriptome of a single cell. Figure 8 Image B shows the cell subsets of PPK6 (including Subset_1 to Subset_7) in the single-cell transcriptome. Figure 8 The middle C represents the Wasserstein distance between the two, with Subset_4 having the lowest value. Mapping the features of Subset_4 back to the single-cell transcriptome revealed that the proportion of cells possessing the KrasG12D feature continuously increased in ID8-WT, PPK1, and PPK6, consistent with the previous experimental results. Figure 9 As shown, the left figure is an unsupervised clustering diagram of the overall single-cell subpopulation, indicating the situation of the three cell groups ID8-WT, PPK1, and PPK6. The distribution of PPK1 and PPK6 is similar, while the distribution of ID8-WT is far off, indicating that the transcriptome characteristics of the cells have shifted after gene editing; the middle figure shows... Figure 8 The seven subsets in the middle plot are mapped to all cells, with cells matching the subset_4 feature represented in green. The right figure is a cell count chart, showing the percentage of cells matching the subset_4 feature in each sample, as shown in the middle plot. It reveals that the proportion of subset_4 gradually increases with the evolution from ID8-WT to PPK1 and PPK6. Figure 6 The increased proportion of G12D cells shown in Figure B follows the same trend.

[0039] (3) Description and verification of transcriptome features of KrasG12D cells Analysis of differentially expressed genes in Subset4 revealed that Ung is a characteristic molecule of Subset4. Fluorescence staining analysis using UNG antibodies (Proteintech: 67490-1-Ig) and WT1 antibodies (Abcam: ab180840) showed that the proportion of UNG cells was consistent with amplicon sequencing and single-cell sequencing results, and was significantly higher in PPK6 than in ID8-WT and PPK1. Figure 10As shown, the left image shows the expression level of Ung in single-cell transcriptome sequencing of PPK6 cells, indicating that Ung is mainly expressed in subset_4 cells; the middle image is an immunofluorescence image showing the expression of DAPI (nucleus, blue), WT1 (ovarian cancer cell marker, green), and UNG (subset_4 characteristic gene, red) in ID8-WT and PPK1; the right image is an immunofluorescence image showing the expression of DAPI (nucleus, blue), WT1 (ovarian cancer cell marker, green), and UNG (subset_4 characteristic gene, red) in PPK6 cells, showing that UNG expression in PPK6 cells is significantly stronger than that in ID8-WT and PPK1, verifying that UNG is a characteristic molecule of subset_4.

[0040] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A plasmid tool for simulating Kras random evolution, characterized in that, Includes the following operable and connectable functional elements: (a) At least two guide RNA expression cassettes driven by a first promoter, targeting the Pten gene and the Trp53 gene, respectively; (b) At least one leader editing guide RNA expression cassette driven by a second promoter, the leader editing guide RNA targeting codon 12 of the Kras gene and containing a repair template sequence for editing the codon to G12D; (c) A fusion protein expression cassette driven by a third promoter, the fusion protein comprising a SpCas9 protein with nicking enzyme activity and an MMLV reverse transcriptase; (d) At least one eukaryotic selection marker gene expression cassette; After transfecting cells with the plasmid tool, the Pten and Trp53 genes can be knocked out simultaneously, and G12D precise mutations and random insertion / deletion mutations can be generated in parallel at codon 12 of the Kras gene, thereby constructing a genetically heterogeneous cell population.

2. The plasmid tool according to claim 1, characterized in that, The nucleotide sequence of the lead editing guide RNA comprises the sequence shown in SEQ ID NO:5, or a variant sequence that has at least 90% identity with it and retains the targeted editing function.

3. The plasmid tool according to claim 1, characterized in that, The first promoter is the human U6 promoter, the second promoter is the mouse U6 promoter, and the third promoter is the CAG promoter.

4. The plasmid tool according to claim 1, characterized in that, The guide RNA sequence targeting the Pten gene is shown in SEQ ID NO.4; the guide RNA sequence targeting the Trp53 gene is shown in SEQ ID NO.

3.

5. The plasmid tool according to claim 1, characterized in that, The eukaryotic selection marker genes include fluorescent protein-encoding genes and / or resistance genes; The fluorescent protein encoding gene includes the ZsGreen fluorescent protein gene; The resistance gene includes a puromycin resistance gene.

6. The plasmid tool according to claim 1, characterized in that, The plasmid tool also includes an OriP element and an EBNA1 gene encoding element for attach-type replication in mammalian cells.

7. The plasmid tool according to any one of claims 1-6, characterized in that, The plasmid tool is a Multi-gRNAs-Spcas9-MMLV expression plasmid, which is constructed by using epiCRISPR plasmid to amplify the OriP element and EBNA1 coding sequence by PCR, and inserting the following elements into the vector sequentially by Gibson assembly: two gRNAs targeting the Pten gene and the Trp53 gene respectively, one pegRNA targeting Kras, CAG promoter, SpCas9 nuclease coding sequence, MMLV reverse transcriptase coding sequence, ZsGreen fluorescent gene, and puromycin resistance gene.

8. The plasmid tool according to claim 7, characterized in that, The nucleotide sequence of the Multi-gRNAs-Spcas9-MMLV expression plasmid consists of SEQ ID NO.1 and SEQ ID NO.

2.

9. A method for constructing a simulated Kras stochastic evolution model using plasmid tools as described in any one of claims 1-8, characterized in that, Includes the following steps: S1. Transfect the plasmid into target tumor cells and select edited heterogeneous cell populations. S2. The heterogeneous cell population is transplanted into an immune-healthy animal to form an initial tumor; S3. The initial tumor tissue is continuously passaged in situ to obtain a series of passaged tumors; In the series of passaged tumors, the proportion of cells carrying the Kras G12D mutation increased significantly with increasing passage number.

10. Use of a plasmid tool simulating random evolution of Kras as described in any one of claims 1-8 in screening targeted drugs for KRAS-mutant tumors.

Images