Gene CsDELLA4 for regulating and controlling parthenocarpy of cucumber and application of gene CsDELLA4
By knocking out the CsDELLA4 gene in cucumber using CRISPR/Cas9 technology, the problem of insufficient utilization of the parthenocarpy regulation gene in cucumber was solved, significantly improving the parthenocarpy rate of cucumber and promoting the development of new high-yield cucumber varieties.
Patent Information
- Application Number
- CN202610318820.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-16
- Publication Date
- 2026-05-01
AI Technical Summary
The lack of exploration and utilization of regulatory genes related to parthenocarpy in cucumbers in existing technologies has limited the improvement of cucumber yield and fruit edibility.
By identifying and using CRISPR/Cas9 technology to knock out the cucumber CsDELLA4 gene and negatively regulate its function, the parthenocarpy ability of cucumber can be improved.
It significantly improved the parthenocarpy rate of cucumbers, promoted the development of new high-yield cucumber varieties, and has good prospects for agricultural application.
Smart Images

Figure CN121950847A_ABST
Abstract
Description
A gene CsDELLA4 that regulates parthenocarpy in cucumber and its application Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a gene CsDELLA4 that regulates parthenocarpy in cucumbers and its applications. Background Technology
[0002] Cucumber (Cucumis sativus L.) is a widely cultivated and important vegetable globally, renowned for its refreshing taste, high water content, and rich nutrients. It is not only a common raw and processed food in our daily diet but also highly valued in the health and beauty industry due to its antioxidant and mineral content. In agricultural production, cucumbers are often used as a crop in rotation, helping to improve soil structure and biodiversity. As a multifunctional crop, cucumbers play an important role in food, health, and sustainable agriculture. Parthenocarpy refers to the phenomenon of forming seedless fruits without pollination and fertilization; this trait can effectively increase cucumber yield and fruit edibility. Currently, the discovery and utilization of genes regulating parthenocarpy in cucumbers are still insufficient. Therefore, this invention aims to identify key genes regulating parthenocarpy in cucumbers using molecular biology techniques, elucidate their mechanisms of action, and establish breeding methods to improve the parthenocarpy rate of germplasm resources, providing technical support for the genetic improvement and efficient production of cucumbers. Summary of the Invention
[0003] Objective of the Invention: To address the shortcomings of existing technologies, this invention provides a gene, CsDELLA4, to enhance the parthenocarpy ability of cucumbers. This invention identifies a novel parthenocarpy regulatory gene, CsDELLA4, whose edited mutants exhibit enhanced parthenocarpy ability. The CsDELLA4 gene of this invention can be used to guide the breeding and improvement of cucumber germplasm resources with strong parthenocarpy, providing technical support for the breeding of cucumber varieties with strong parthenocarpy.
[0004] The present invention also provides the application of the aforementioned gene CsDELLA4, which regulates parthenocarpy in cucumber.
[0005] Technical solution: In order to achieve the above objectives, the present invention provides a gene CsDELLA4 for regulating parthenocarpy in cucumber, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0006] The primer pair used to amplify the CsDELLA4 gene is as follows:
[0007] DELLA4-F: 5'-ATCTATTTTTAAACCCTTCC-3';
[0008] DELLA4-R: 5'-CTTTTATCAAAGTGTTTGGA-3'.
[0009] The CDS gene that regulates the parthenocarpy gene CsDELLA4 in cucumber, as described in this invention, has the CDS gene sequence shown in SEQ ID NO. 2.
[0010] The primer pair used to amplify the CDS gene of the CsDELLA4 gene is as follows:
[0011] DELLA4-F-1: 5'- ATGAAGAGGGAGCATCACCATC -3';
[0012] DELLA4-R-1: 5'-CTTAGCGACCACCGGGTTG-3'.
[0013] The gene knockout vector CRISPR-CsDELLA4, which regulates the parthenocarpy gene CsDELLA4 in cucumber, is described in this invention.
[0014] The gene knockout vector CRISPR-CsDELLA4 is constructed by designing the target gene sequences sgRNA1 and sgRNA2 of CsDELLA4.
[0015] sgRNA1: 5'-TGATGGTGGAGGATTCCGCCGG -3';
[0016] sgRNA2: 5'-ACTAGCAGCCGGATTTTCGAGG-3'.
[0017] Using pCBC-DT1T2(Cm) as a template, the dual targets were amplified, and the resulting double-stranded sgRNA1 / 2 was ligated into the pkSE402 vector. After transformation, the plasmid was extracted, and the gene knockout vector CRISPR-CsDELLA4 was finally obtained.
[0018] The present invention contains a host bacterium for the gene knockout vector, wherein the host bacterium is Agrobacterium as the starting strain.
[0019] The application of the gene CsDELLA4, which improves the parthenocarpy ability of cucumber, or the CDS gene, or the gene knockout vector, or the host bacterium described in this invention, in regulating parthenocarpy in cucumber.
[0020] Among them, editing the cucumber CsDELLA4 gene with CRISPR / Cas9 can improve the parthenocarpy ability of cucumber through negative regulation.
[0021] The application of the gene CsDELLA4, which improves the parthenocarpy ability of cucumber, or the CDS gene, or the gene knockout vector, or the host bacterium described in this invention, in the cultivation of cucumber germplasm with strong parthenocarpy.
[0022] This invention utilizes gene editing technology to knock out the CsDELLA4 gene. Compared to the wild type, the gene-edited mutant exhibits an increased parthenocarpy rate, indicating that the CsDELLA4 gene plays a negative regulatory role in the parthenocarpy process of cucumber. Therefore, this invention provides a new gene resource for improving the parthenocarpy trait of cucumber, which is beneficial for promoting the development of high-yield cucumber varieties and has good prospects for agricultural application.
[0023] This invention uses the cucumber cultivar "XTMC" as material and constructs a dual-target CRISPR / Cas9 technology to obtain stable CRISPR-CsDELLA4 gene-edited material. The parthenocarpy rate of the CRISPR-CsDELLA4 transgenic material and the control material (WT) were statistically analyzed, and plant phenotypic changes were observed. The results showed that the parthenocarpy rate after knocking out the CsDELLA4 gene was significantly higher than that of the control. This invention explores the application of CsDELLA4 in the formation of parthenocarpy in cucumber through gene editing technology, providing a new gene resource for the molecular genetic improvement of strong parthenocarpy in cucumber. This invention provides the CsDELLA4 gene for enhancing parthenocarpy in cucumber, which has important application value in studying the ability to regulate parthenocarpy in cucumber.
[0024] Beneficial effects: Compared with the prior art, the present invention has the following advantages:
[0025] This invention identified a novel gene, CsDELLA4, that enhances parthenocarpy in cucumbers. The invention utilizes gene editing technology to knock out the CsDELLA4 gene in cucumbers. Compared to wild-type varieties, the mutant bred through gene editing exhibited a significantly higher parthenocarpy rate. This indicates that the CsDELLA4 gene plays a negative regulatory role in the parthenocarpy process of cucumbers.
[0026] Therefore, this invention provides new gene resources for improving the parthenocarpy trait of cucumber, which is conducive to promoting the development of new high-yield cucumber varieties and has good prospects for agricultural application. Attached Figure Description
[0027] Figure 1 shows the phenotype of transgenic plants after the cucumber CsDELLA4 gene was knocked out using CRISPR / Cas9 technology. (a) Schematic diagram of the CRISPR / Cas9-CsDELLA4 target site and the obtained mutant DNA sequence; (b) Phenotypic observation of gene-edited plants (Csdella4-1, Csdella4-2) and control plants.
[0028] Figure 2 shows the change in parthenocarpy rate of transgenic plants after the CsDELLA4 gene in cucumber was knocked out using CRISPR / Cas9 technology. Detailed Implementation
[0029] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0030] This invention uses the cultivated cucumber variety “ZK” for related experiments. This variety comes from the germplasm resource bank of the Cucumber Genetics and Breeding and Molecular Science Innovation Team of the College of Horticulture and Landscape Architecture, Yangzhou University, and was provided by Yangzhou University (Cytokinin and auxinmodulate cucumber parthenocarpy fruit development. Scientia Horticulturae, 2021, 282, 110026.).
[0031] The cucumber was transformed using the material “XTMC” (The CsHEC1-CsOVATE module contributes to fruitneck length variation via modulating auxin biosynthesis in cucumber. PNAS, 2022, 119(39): e2209717119). This variety was provided by the germplasm resource bank of the Cucurbit Vegetable Genetics and Molecular Biology Innovation Team of the College of Horticulture and Landscape Architecture, Yangzhou University.
[0032] Example 1
[0033] The cloning method for the CsDELLA4 gene includes the following steps:
[0034] (1) Cucumber tissue cDNA synthesis: RNA was extracted from cucumber “ZK” fruit tissue and reverse transcribed to obtain first-strand cDNA;
[0035] (2) PCR amplification of the CsDELLA4 gene and its CDS sequence:
[0036] Primers were designed (CsDELLA4-F: 5'-ATCTATTTTTAAACCCTTCC -3'; CsDELLA4-R: 5'-CTTTTATCAAAGTGTTTGGA -3'), and cucumber tissue DNA was used as a template for PCR amplification. The PCR amplification products were recovered, purified, and sequenced.
[0037] Primers were designed (CsDELLA4-F-1: 5'- ATGAAGAGGGAGCATCACCATC -3'; CsDELLA4-R-1: 5'- CTTAGCGACCACCGGGTTG -3'), and cucumber tissue cDNA was used as a template for PCR amplification. The PCR amplification products were recovered, purified, and sequenced.
[0038] The nucleotide sequence encoding the cucumber CsDELLA4 gene of this invention is shown in SEQ ID NO.1, and the CDS coding region sequence is shown in SEQ ID NO.2.
[0039] Example 2
[0040] (1) CRISPR / Cas9 vector was constructed using the cucumber CsDELLA4 gene.
[0041] Construction of CsDELLA4 gene knockout vector: Two target gene primer sequences for CsDELLA4, sgRNA1 and sgRNA2, were designed. The designed target gene sequences are as follows:
[0042] sgRNA1: 5'-TGATGGTGGAGGATTCCGCCGG -3';
[0043] sgRNA2: 5'-ACTAGCAGCCGGATTTTCGAGG-3'.
[0044] Using pCBC-DT1T2(Cm) as a template, dual-target products were obtained by PCR amplification using PrimerSTAR high-fidelity enzyme. The reaction volume was 50 μL, containing 10 μL of 5× PrimeSTAR Buffer, 4 μL of dNTP Mixture, 1 μL each of sgRNA1 and sgRNA2 primers, 32.5 μL of ddH2O, 1 μL of pCBC-DT1T2(Cm) plasmid, and 0.5 μL of PrimerSTAR high-fidelity enzyme. The reaction program was 95℃ for 5 min; 95℃ for 15 sec, 55℃ for 15 sec, 72℃ for 15 sec, 35 cycles; 72℃ for 5 min.
[0045] The amplified dual-target product sgRNA1 / 2 was ligated into the pkSE402 vector. The reaction volume was 15 μL, containing 1.2 μL of pkSE402 vector, 2 μL of dual-target product, 1 μL of Bsal, 1 μL of T4 Liguse, 1.5 μL of 10×NEB T4 Buffer, and 8.3 μL of ddH2O. The reaction program was 37℃ for 5 min; 16℃ for 5 min, 60℃ for 5 min, and 12℃ for incubation. 10 μL of the ligation product was added to 50 μL of competent E. coli cells, mixed thoroughly, and then frozen on ice for 30 min. After heat shock at 42℃ for 30 sec, the mixture was placed on ice for 2 min, and 700 μL of LB liquid medium was added. The mixture was then incubated at 37℃ for 1 h using a shaker. 100 μL of the bacterial cells were spread onto Kan+LB solid medium and incubated at 37℃ for 12–16 h. Single colonies were selected for positive testing and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Correct single clones were selected for propagation. Plasmids were extracted using the FastPure® Plasmid Mini Kit to obtain the gene knockout vector CRISPR-CsDELLA4. The plasmid was transformed into Agrobacterium competent cells EHA105. The competent cells were thawed on ice. 50 μL of competent cells and 2 μL of plasmid were mixed and incubated sequentially on ice for 5 min, in liquid nitrogen for 5 min, at 37°C for 5 min, and on ice for 5 min. 700 μL of LB liquid medium was added, mixed, and incubated in a shaker at 28°C for 2-3 h. 100 μL of bacterial cells were spread on Kan+Rif LB solid medium and incubated in a constant temperature incubator at 28°C for 2-3 days. Single clones were selected for testing and preservation to obtain Agrobacterium carrying the CRISPR-CsDELLA4 gene for subsequent transgenic applications.
[0046] (2) Obtaining CRISPR-CsDELLA4 transgenic plants and positive detection
[0047] Transgenic plants were obtained using Agrobacterium-mediated genetic transformation. The recipient material was “XTMC”. The basic method was as follows: “XTMC” seeds were soaked in distilled water in a 55°C water bath for 30 min, the seed coat was removed, and the seeds were rinsed 3-4 times with sterile water. They were then soaked in 75% alcohol for 30 sec, soaked in 2% sodium hypochlorite solution for 10 min, and rinsed 4-5 times with sterile ddH2O. The seeds were then sown on SGM medium, wrapped in aluminum foil, and placed in a 28°C incubator for 36 h. Agrobacterium carrying the CRISPR-CsDELLA4 gene was cultured in LB solid medium containing Kan and Rif antibiotics for 12 h. The bacterial cells were added to 40 mL of IM liquid medium, mixed well, and the OD was measured.600 , making OD 600 =0.2, placed in a 28℃ constant temperature incubator; remove the buds, cut off 1 / 3 of the seed and divide it in half, soak in IM liquid medium, after the seeds are treated, transfer them together to IM liquid medium containing bacterial solution, sonicate for 20 seconds with a KQ5200DE type CNC ultrasonic cleaner, vacuum penetrate for 90 seconds (twice in total), finally place the explants on IM solid medium with tweezers, wrap with aluminum foil and place in a 25℃ constant temperature incubator for 3 days; transfer the explants to SRM medium and culture in a 26℃ light 16 h / dark 8 h environment for 2-3 weeks; observe under a fluorescence microscope and select explants with green fluorescence, cut off the putative transformant about 1 cm in length, place the remaining part in RM medium to induce rooting, transfer the rooted tissue culture seedlings to the substrate for acclimatization culture, and finally transfer them to the greenhouse for cultivation.
[0048] CRISPR-CsDELLA4 transgenic positive plants were screened by PCR, and the gene editing type of the knockout plants was further determined by sequencing.
[0049] Design specific primers near the CsDELLA4 target gene sequence to detect the gene knockout fragment sequence:
[0050] CRISPR-CsDELLA4-F: 5'- TCCATGGCTGTCGTCCTAA -3';
[0051] CRISPR-CsDELLA4-R: 5'-TTCCGTTCTCCTGCGAATCG-3'.
[0052] Using CRISPR-CsDELLA4 transgenic plant leaf DNA as a template, PCR amplification and sequencing were performed using PrimerSTAR high-fidelity enzyme to obtain the editing sites. The reaction system was 50 μL, containing 10 μL of 5× PrimeSTAR Buffer, 4 μL of dNTP Mixture, 1 μL of CRISPR-CsDELLA4-F primer, 1 μL of CRISPR-CsDELLA4-R primer, 32.5 μL of ddH2O, 1 μL of DNA template, and 0.5 μL of PrimerSTAR high-fidelity enzyme. The reaction program was 95℃ for 5 min; 95℃ for 15 sec, 55℃ for 15 sec, 72℃ for 15 sec, 35 cycles; 72℃ for 5 min. The results, as shown in Figure 1(a), revealed two types of editing. Sequencing analysis showed that the transgenic plants Csdella4-1 and Csdella4-2 had deletions of 61 bp and 76 bp, respectively.
[0053] Example 3
[0054] CRISPR-CsDELLA4 transgenic cucumber plant genotypic observation and expression level detection
[0055] Phenotypic observation of CRISPR-CsDELLA4 transgenic cucumber plants
[0056] To confirm the ability of the CsDELLA4 gene to regulate parthenocarpy in cucumber, female flowers of control wild-type plants (XTMC) and CRISPR-CsDELLA4 transgenic plants (Csdella4-1 and Csdella4-2) were subjected to flower-clamping treatment one day before flowering. After one week of continuous flower clamping, the parthenocarpy rate was calculated and phenotypic observations were performed. As shown in Figures 1(b) and 2, the parthenocarpy rates of CRISPR-CsDELLA4 transgenic plants were 74.81% and 65.41%, respectively, significantly higher than the 44.16% of the control plants. The parthenocarpy capacity of the two edited transgenic plants was significantly higher than that of the control plants.
Claims
1. A gene CsDELLA4 that enhances the parthenocarpy ability of cucumber, characterized in that, The nucleotide sequence of the gene CsDELLA4 is shown in SEQ ID NO.
1.
2. The gene CsDELLA4 for improving the parthenocarpy ability of cucumber according to claim 1, characterized in that, The preferred primers for amplifying the gene CsDELLA4 are: DELLA4-F: 5'- ATCTATTTTTAAACCCTTCC-3'; DELLA4-R: 5'- CTTTTATCAAAGTGTTTGGA-3'.
3. A gene CsDELLA4 that enhances the parthenocarpy ability of cucumber, characterized in that, The CDS gene sequence of the gene CsDELLA4 is shown in SEQ ID NO.
2.
4. The CDS gene regulating cucumber parthenocarpy gene CsDELLA4 according to claim 3, characterized in that, The preferred primers for amplifying the CDS gene of the CsDELLA4 gene are: DELLA4-F-1: 5'-ATGAAGAGGGAGCATCACCATC-3'; DELLA4-R-1: 5'-CTTAGCGACCACCGGGTTG-3'.
5. A gene knockout vector CRISPR-CsDELLA4 based on the gene CsDELLA4, which enhances the parthenocarpy of cucumber as described in claim 1.
6. The gene knockout vector CRISPR-CsDELLA4 according to claim 5, characterized in that, The gene knockout vector CRISPR-CsDELLA4 was constructed by designing the target gene sequences sgRNA1 and sgRNA2 for CsDELLA4; sgRNA1: 5'- TGATGGTGGAGGATTCCGCCGG -3'; sgRNA2: 5'-ACTAGCAGCCGGATTTTCGAGG -3'; using pCBC-DT1T2(Cm) as a template to amplify the dual targets, ligating the resulting double-stranded sgRNA1 / 2 into the vector, transforming, extracting the plasmid, and finally obtaining the gene knockout vector CRISPR-CsDELLA4.
7. A host bacterium containing the gene knockout vector of claim 5, characterized in that, The host bacterium is Agrobacterium as the starting strain.
8. The application of the gene CsDELLA4 as described in claim 1 for improving parthenocarpy in cucumber, or the CDS gene as described in claim 2, or the gene knockout vector as described in claim 5, or the host bacterium as described in claim 7, in regulating parthenocarpy in cucumber.
9. The application according to claim 8, characterized in that, Editing the cucumber CsDELLA4 gene using CRISPR / Cas9 can improve the parthenocarpic ability of cucumbers through negative regulation.
10. The application of the gene CsDELLA4 for improving parthenocarpy in cucumber as described in claim 1, or the CDS gene as described in claim 2, or the gene knockout vector as described in claim 5, or the host bacterium as described in claim 7, in the cultivation of highly parthenocarpy cucumber germplasm.