Application of FGF4 (Fibroblast Growth Factor 4) as drug target in treatment of enameloblastoma

Abstract

The invention provides an application of FGF4 (fibroblast growth factor 4) as a drug target in treatment of enameloblastoma, relates to the technical field of biological medicines, finds a potential effect of the FGF4 in the enameloblastoma for the first time, proves an inhibition effect of the FGF4 on tumor growth, proves that the FGF4 can be used as a treatment target of the enameloblastoma, and proves that the FGF4 gene is knocked down in an enameloblastoma cell line, so that the treatment effect on the enameloblastoma is obviously improved. Cell proliferation, cell migration, cell invasion and cell colony formation can be inhibited; in an animal body, the FGF4 gene is knocked down to inhibit the growth of the enameloblastoma, which shows that the FGF4 has the effect of regulating and controlling the growth of the enameloblastoma, and the FGF4 inhibitor can inhibit the proliferation, migration, invasion and cell colony formation of an enameloblastoma cell line and inhibit the growth of the enameloblastoma. A new treatment target is provided for prevention and / or treatment of the glamoblastoma, and the application has a wide clinical application value.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of FGF4 as a drug target in the treatment of ameloblastoma. Background Technology

[0002] Ameloblastoma is a highly aggressive benign tumor of the oral and maxillofacial region with an extremely high recurrence rate. It is formed by the abnormal proliferation and development of Serres epithelium, which is not fully degenerated during embryonic development. The currently accepted cause of the disease is a mutation in the BRAF600V gene.

[0003] FGF4, fibroblast growth factor 4, is a protein that plays a crucial role in embryonic development, cell proliferation, and differentiation. It functions in the FGF signaling pathway by binding to FGFR (receptors). Its main receptors are FGFR1, FGFR2, FGFR3, and FGFR4. After binding to these receptors, FGF4 can activate various downstream signaling pathways, including MARK, thereby exerting its effects. Research on FGF4 in cancer has included studies in lung cancer, esophageal squamous cell carcinoma, breast cancer, and hepatocellular carcinoma. Current research focuses more on embryonic development, regenerative medicine, and diabetes. Studies on the liver suggest that FGF4 protects the liver from non-alcoholic fatty liver disease by activating the AMP-activated protein kinase-caspase 6 signaling axis. In ameloblastoma, research on FGF is limited, primarily focusing on FGF1 and FGF2. The role of FGF4 in ameloblastoma remains unclear.

[0004] Lentivirals, as effective gene vectors, have been widely used in the field of cancer treatment. Through lentiviral vectors, specific therapeutic genes (such as tumor suppressor genes and immunomodulatory factors) can be delivered to tumor cells or immune system cells, thereby achieving targeted therapy or delaying tumor progression. However, several limitations remain in practical applications. First, the targeting of treatment is poor; existing lentiviral therapies cannot completely target tumor cells, potentially affecting normal cells as well, thus increasing side effects. Second, treatment efficacy is often unstable; the effectiveness of lentiviral vectors varies significantly across different tumor types, and due to the heterogeneity and drug resistance of tumor cells, the efficacy may be greatly reduced. Third, as exogenous gene vectors, lentiviruses may trigger rejection responses from the immune system, affecting treatment efficacy and causing additional side effects. Finally, the integration of lentiviral genes into host cells may pose potential safety risks, such as the risk of gene mutation or carcinogenesis, especially with long-term or repeated use.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] One of the objectives of this invention is to provide the application of the FGF4 gene, FGF4 protein, or FGF4 inhibitor in the preparation of products for the prevention and / or treatment of ameloblastoma, in order to solve the technical problem of the lack of a target for the treatment of ameloblastoma in the prior art.

[0007] The second objective of this invention is to provide a drug.

[0008] A third objective of this invention is to provide the use of the FGF4 gene, FGF4 protein, or FGF4 inhibitor in screening candidate drugs for the prevention and / or treatment of ameloblastoma.

[0009] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: In a first aspect, the present invention provides the use of the FGF4 gene, FGF4 protein, or FGF4 inhibitor in the preparation of products for the prevention and / or treatment of ameloblastoma.

[0010] Furthermore, the treatment of ameloblastoma includes inhibiting ameloblastoma growth.

[0011] Furthermore, the inhibition of ameloblastoma growth includes inhibiting the proliferation of ameloblastoma cell lines, inhibiting the migration of ameloblastoma cell lines, inhibiting the invasion of ameloblastoma cell lines, and inhibiting the formation of ameloblastoma cell line colonies.

[0012] Furthermore, the FGF4 inhibitor includes substances that inhibit FGF4 gene expression, silence or knock out the FGF4 gene, and / or substances that reduce FGF4 protein content and / or activity.

[0013] Furthermore, the substance includes at least one of nucleic acid molecules, carbohydrates, lipids, small molecule compounds, antibodies, peptides, proteins, gene editing vectors, lentiviruses, or adeno-associated viruses.

[0014] Furthermore, the nucleic acid molecule includes shRNA, and the shRNA includes any one of B1 to B3: B1. The shRNA targets and interferes with the FGF4 gene; B2. The target sequence of the shRNA is shown in SEQ ID NO.1; B3. The sense and antisense strands of the interference sequence of the shRNA are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0015] Furthermore, the product includes an FGF4 inhibitor; the product includes reagents and / or drugs.

[0016] In a second aspect, the present invention provides a drug comprising the above-mentioned FGF4 inhibitor, wherein the drug has the use of at least one of inhibiting ameloblastoma growth, inhibiting ameloblastoma cell line proliferation, inhibiting ameloblastoma cell line migration, inhibiting ameloblastoma cell line invasion, or inhibiting ameloblastoma cell line colony formation.

[0017] Thirdly, the present invention provides the use of the FGF4 gene, FGF4 protein, or FGF4 inhibitor in screening candidate drugs for the prevention and / or treatment of ameloblastoma.

[0018] Furthermore, the screening method includes screening drugs or reagents targeting FGF4, and selecting drugs or reagents that can reduce FGF4 gene expression levels or reduce FGF4 protein content or activity as candidate drugs for the prevention and / or treatment of ameloblastoma.

[0019] This invention provides the application of the FGF4 gene, FGF4 protein, or FGF4 inhibitor in the preparation of products for the prevention and / or treatment of ameloblastoma. It is the first discovery of the potential role of FGF4 in ameloblastoma, demonstrating its inhibitory effect on tumor growth. FGF4 can serve as a therapeutic target for ameloblastoma. Experiments have shown that knocking down the FGF4 gene in ameloblastoma cell lines inhibits cell proliferation, migration, invasion, and colony formation. In vivo, knocking down the FGF4 gene inhibits ameloblastoma growth, indicating that FGF4 plays a regulatory role in ameloblastoma growth. FGF4 inhibitors can inhibit the proliferation, viability, migration, invasion, and colony formation of ameloblastoma cell lines, thus inhibiting ameloblastoma growth. This provides a new therapeutic target for the prevention and / or treatment of ameloblastoma and has broad clinical application value. Attached Figure Description

[0020] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0021] Figure 1 This is a lentiviral vector map provided in Embodiment 2 of the present invention; Figure 2 The results of viability detection of ameloblastoma cell lines inhibiting FGF4 provided in Example 2 of this invention; Figure 3 This refers to the observation results of ameloblastoma cell line migration inhibited by FGF4 provided in Example 2 of the present invention; Figure 4The migration count results of ameloblastoma cell lines inhibiting FGF4 provided in Example 2 of this invention; Figure 5 This refers to the observation results of the invasion of ameloblastoma cell lines that inhibit FGF4 provided in Example 2 of the present invention; Figure 6 The results of the invasion count of ameloblastoma cell lines that inhibit FGF4 provided in Example 2 of the present invention; Figure 7 The results of the effect of inhibiting FGF4 on the colony formation of ameloblastoma cell lines provided in Example 2 of the present invention are shown, where A is the observation result and B is the counting result; Figure 8 The results show the statistical results of tumor size formation in animals by the ameloblastoma cell line that inhibits FGF4 provided in Example 2 of the present invention. Detailed Implementation

[0022] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms shall be clear; however, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definitions. In this application, unless otherwise stated, the use of "or" means "and / or". Furthermore, the use of the term "comprising" and other forms is non-limiting.

[0023] Generally, the nomenclature and techniques used in cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization, together with those described herein, are those well-known and commonly used in the art. Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well-known in the art and described in various general and more specific references, which are cited and discussed throughout this specification. Enzymatic reactions and purification techniques are carried out according to the manufacturer's instructions, as commonly practiced in the art, or as described herein. The nomenclature, laboratory procedures, and techniques used in analytical chemistry, synthetic organic chemistry, and medical and medicinal chemistry, together with those described herein, are those well-known and commonly used in the art.

[0024] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] This invention is the first to discover the potential role of FGF4 in ameloblastoma, demonstrating its inhibitory effect on tumor growth. FGF4 can serve as a therapeutic target for ameloblastoma. Experiments have shown that knocking down the FGF4 gene in ameloblastoma cell lines can inhibit cell proliferation, cell migration, cell invasion, and cell colony formation. In vivo, knocking down the FGF4 gene can inhibit the growth of ameloblastoma, indicating that FGF4 has a regulatory effect on ameloblastoma growth. FGF4 inhibitors can inhibit the proliferation, viability, migration, invasion, and cell colony formation of ameloblastoma cell lines, thereby inhibiting ameloblastoma growth.

[0026] This invention provides, in one aspect, the use of the FGF4 gene, FGF4 protein, or FGF4 inhibitor in the preparation of products for the prevention and / or treatment of ameloblastoma.

[0027] This provides a new therapeutic target for the prevention and / or treatment of ameloblastoma, and has broad clinical application value.

[0028] In some specific embodiments, the treatment of ameloblastoma includes inhibiting ameloblastoma growth. In some specific embodiments, inhibiting ameloblastoma growth includes inhibiting ameloblastoma cell line proliferation, inhibiting ameloblastoma cell line migration, inhibiting ameloblastoma cell line invasion, and inhibiting ameloblastoma cell line colony formation.

[0029] In some specific embodiments, the FGF4 inhibitor includes substances that inhibit FGF4 gene expression, silence or knock out the FGF4 gene, and / or substances that reduce FGF4 protein content and / or activity.

[0030] In some specific embodiments, the substance includes at least one of nucleic acid molecules, carbohydrates, lipids, small molecule compounds, antibodies, peptides, proteins, gene editing vectors, lentiviruses, or adeno-associated viruses.

[0031] Specifically, the inhibition of FGF4 gene expression can be achieved through gene mutation, gene silencing, gene knockout, gene editing, or gene knockdown techniques well known to those skilled in the art. For example, RNA interference (RNAi) technology can specifically knock out or shut down the expression of a specific gene; gene editing tools can include CRISPR / Cas9 technology, zinc finger nucleases (ZFNs), or transcription activator-like effector nucleases (TALENs), but are not limited to these. Gene knockdown techniques, which inactivate or silence FGF4 gene expression at the post-transcriptional or translational level, are well known to those skilled in the art. These gene knockdown techniques include, but are not limited to, RNA interference, Morpholino interference, antisense nucleic acids, ribozymes, or dominant-negative repressive mutations. Using shRNA or siRNA expressed by viruses (such as lentiviruses or adeno-associated viruses) to suppress gene expression and achieve gene silencing is well known to those skilled in the art.

[0032] In some specific embodiments, the nucleic acid molecule may include shRNA, microRNA, siRNA, and / or antisense oligonucleotides.

[0033] In some specific embodiments, the shRNA includes any one of B1 to B3: B1. The shRNA targets and interferes with the FGF4 gene; B2. The target sequence of the shRNA is shown in SEQ ID NO.1; B3. The sense and antisense strands of the interference sequence of the shRNA are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0034] In some specific embodiments, the FGF4 inhibitor may also be an antibody, which may be an antibody against the FGF4 protein or a functional fragment thereof.

[0035] In some specific embodiments, the FGF4 inhibitor may also be a lentivirus or adeno-associated virus, wherein the lentivirus or adeno-associated virus may be a recombinant lentivirus or recombinant adeno-associated virus expressing shRNA for knocking down the FGF4 gene.

[0036] In some specific embodiments, the product includes an FGF4 inhibitor; the product includes reagents and / or drugs.

[0037] According to another aspect of the present invention, a medicament is also provided, comprising the above-described FGF4 inhibitor, the medicament having the use of at least one of inhibiting ameloblastoma growth, inhibiting ameloblastoma cell line proliferation, inhibiting ameloblastoma cell line migration, inhibiting ameloblastoma cell line invasion, or inhibiting ameloblastoma cell line colony formation.

[0038] According to another aspect of the invention, the use of the FGF4 gene, FGF4 protein, or FGF4 inhibitor in screening candidate drugs for the prevention and / or treatment of ameloblastoma is also provided.

[0039] Specifically, the screening method includes screening drugs or reagents targeting FGF4, and selecting drugs or reagents that can reduce FGF4 gene expression levels or reduce FGF4 protein content or activity as candidate drugs for the prevention and / or treatment of ameloblastoma.

[0040] The present invention will be further illustrated by the following examples. Unless otherwise specified, the materials in the examples are prepared according to existing methods or purchased directly from the market.

[0041] The FGF4 gene information is referenced from the human FGF4 gene in the NCBI Gene database, numbered 2249.

[0042] Example: Effect of FGF4 inhibitors on ameloblastoma growth FGF4 inhibitors can be substances that inhibit FGF4 gene expression, silence or knock out FGF4, or substances that inhibit or reduce FGF4 protein content and / or activity. In this embodiment, lentivirus-mediated shRNA is used to knock down the FGF4 gene in ameloblastoma cell lines to inhibit FGF4 gene expression.

[0043] I. Construction of Lentiviral Vectors The target sequence of the shRNA used to suppress FGF4 gene expression is: GCCGGTTCTTCGTGGCCATGA (SEQ ID NO.1). The interfering sequence of shRNA and the encoding DNA sequence of the sense strand are: CCGGGCCGGTTCTTCGTGGCCATGACTCGAGTCATGGCCACGAAGAACCGGCTTTTTG (SEQ ID NO.2). The encoding DNA sequence of the interfering antisense strand of the shRNA is: AATTCCAAAAAGCCGGTTCTTCGTGGCCATGACTCGAGTCATGGCCACGAAGAACCGGC (SEQ ID NO.3).

[0044] The target sequence of the shRNA from the FGF4 gene was constructed into the lentiviral cloning vector GV493 (derived from Jikai Gene). The vector map is shown below. Figure 1 As shown, the element sequence is: hU6-MCS-CBh-gcGFP-IRES-puromycin, with cloning sites at AgeI and EcoRI, constructed by the Gecco gene.

[0045] The constructed lentiviral vector, along with two helper plasmids, psPAX2 and pMD2.G, was co-transfected into 293T cells using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific). Infectious lentivirus was collected 72 h after transfection. Cell debris was removed by rapid centrifugation, followed by filtration through a 0.45 μm cellulose acetate membrane to obtain recombinant lentivirus expressing shRNA interfering with the FGF4 gene. Viral titer was determined by flow cytometry of the proportion of GFP-positive 293T cells. The viral infection titer was 1.20E+09 TU / mL of culture medium, and the cells were stored at -80°C for later use.

[0046] II. Cell Experiments The ameloblastoma cell line (hTERT+-AM cells) was transfected with the recombinant lentivirus expressing shRNA interfering with the FGF4 gene obtained in step one to obtain a stable ameloblastoma cell line that inhibits the FGF4 gene, designated as the FGF4-inhibited group. Meanwhile, the ameloblastoma cell line not transfected with the recombinant lentivirus served as the control group.

[0047] 1. Cell viability Cell proliferation was assessed at specified time intervals using the Cell Counting Kit-8 (CCK-8) (Dojin Chemical Research Institute, Japan), following the manufacturer’s instructions.

[0048] Cell viability was assessed using the CCK-8 assay. hTERT+-AM cells from the FGF4-inhibited group and the control group were seeded into 96-well plates. After treatment, 10 µl of CCK-8 solution (10% of the total culture medium volume) was added to each well, and the plates were incubated at 37°C. Absorbance was measured at 450 nm using a multimodal microplate reader (Silicon Valley, USA) on days 1, 3, and 5.

[0049] The results are as follows Figure 2 As shown, compared with Control, the ameloblastoma cell line (FGF4) with suppressed FGF4 gene has significantly reduced proliferation capacity.

[0050] 2. Transfer Experiment Migration assay: hTERT+-AM cell suspensions (5×10⁻⁶ cells / mL) from the FGF4-inhibited group and the control group were respectively used. 4 Cells (cells / well) were prepared in 200 μL of FBS-free DMEM / F12 medium and added to a transwell chamber (Corning, China). 500 μL of DMEM / F12 containing 1% FBS was added to the lower chamber.

[0051] Experimental results are as follows Figure 3 and Figure 4 As shown, compared with the control group, the migration of ameloblastoma cell lines with inhibited FGF4 gene was significantly lower than that of the control group, indicating that inhibiting FGF4 gene reduces the migration ability of ameloblastoma cell lines.

[0052] 3. Invasion Experiment In the invasion assay, transwell chambers were pre-coated with a mixture of 5% Mogengel Matrix (Mogengel Bio, China) and DMEM / F12 and incubated at 37°C for 1 hour to allow them to solidify. Cells were then added following the same procedure as in the migration assay. After 48 hours of incubation, the transwell chambers were removed and stained with 0.1% crystal violet. Images of the stained cells on the lower surface were captured, and cells in five randomly selected fields of view were quantified under a microscope.

[0053] To assess the invasive potential of hTERT+-AM cells, an invasion assay was performed using 24-well plates with 8 μm well inserts. hTERT+-AM cells were starved in serum-free DMEM for one day. Cells were then loaded at 5 × 10⁶ cells / well. 5 Cells were resuspended in serum-free DMEM at a concentration of [cells / ml]. 100 μL of 1.6 mg / mL matrix gel was coated onto each well. 100 μL of cell suspension was added to the upper chamber, followed by 500 μL of DMEM and 10% FBS to the lower chamber. After 16 hours, cells were fixed with paraformaldehyde for 15 minutes and stained with 0.4% crystal violet for 20 minutes at room temperature. After washing with PBS, cells were removed from the upper surface of the inserts with cotton swabs. The remaining cells were air-dried, photographed, and counted under a microscope.

[0054] Experimental results are as follows Figure 5 and Figure 6 As shown, compared with the control group, the invasiveness of ameloblastoma cell lines with FGF4 inhibition was reduced, indicating that FGF4 inhibition can reduce the invasive ability of ameloblastoma cell lines.

[0055] 4. Colony Formation Experiment In colony formation assays, cells were seeded at a density of 500 cells per well into 6-well plates containing DMEM / F12 (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA). These cells were then cultured for 14 days in a humidified environment at 37°C and 5% CO2. Colonies were fixed with 4% paraformaldehyde and stained with crystal violet; visible colonies were then counted.

[0056] To assess colony formation, hTERT+-AM cells were seeded at a density of 2000 cells per well in 6-well plates and cultured in DMEM supplemented with 10% fetal bovine serum (FBS) for 10 to 14 days. After incubation, colonies were fixed with 4% paraformaldehyde for 15 minutes and then stained with 0.4% crystal violet for 15 minutes. After thorough washing with phosphate-buffered saline (PBS) and air-drying, cell colonies were counted and photographed using a microscope.

[0057] Experimental results are as follows Figure 7 As shown, compared with the control group, the number of colonies formed in ameloblastoma cell lines with FGF4 inhibition was reduced.

[0058] III. Animal Experiments: 1. Subcutaneous tumor formation in nude mice Select ameloblastoma cell lines in good condition, logarithmic growth control group and FGF4-inhibited group respectively, discard the supernatant, add 2 mL of 1×PBS solution, gently shake and wash, and discard the liquid.

[0059] Add 1 mL of 0.25% trypsin cell digestion solution to a culture dish, let stand for 10 seconds, then discard the trypsin. Continue digestion with the remaining trypsin at room temperature for 1-3 minutes. When the cells become rounded, add 1 mL of culture medium containing 10% fetal bovine serum to stop the digestion. Carefully disperse the cells and collect the cell suspension in a 15 mL plastic centrifuge tube. Centrifuge at 1000 rpm for 3 minutes and discard the supernatant. Wash the cells once with PBS, then resuspend the cells in serum-free basal medium. Take 10 μL of the cell suspension for cell counting.

[0060] The cell suspension and Mogengel Matrix (Mogengel Bio, China) were mixed at a 1:1 ratio at 4°C. Nude mice were held and restrained with the left hand, and a subcutaneous injection was administered into the right back of the mouse. During inoculation, the needle was inserted approximately 1 cm deep subcutaneously to minimize leakage of the cell suspension from the injection site. The inoculation volume was 100–200 μL. The nude mice were returned to their cages for continued rearing. Tumor volume was measured periodically as needed, and data were recorded and plotted. The tumor volume was monitored until it exceeded 2000 mmHg. 3 The nude mice were euthanized by cervical dislocation, the tumors were removed, and photographs were taken.

[0061] Experimental results are as follows Figure 8 As shown, the tumors in the FGF4-inhibited group (Treated) were significantly smaller than those in the control group (Control), indicating that inhibiting FGF4 can suppress ameloblastoma growth.

[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of any one of A1 to A3 in the preparation of products for the prevention and / or treatment of ameloblastoma; A1 and FGF4 genes; A2 and FGF4 proteins; A3 and FGF4 inhibitors.

2. The application according to claim 1, characterized in that, The treatment of ameloblastoma includes inhibiting the growth of ameloblastoma.

3. The application according to claim 2, characterized in that, The inhibition of ameloblastoma growth includes inhibiting the proliferation of ameloblastoma cell lines, inhibiting the migration of ameloblastoma cell lines, inhibiting the invasion of ameloblastoma cell lines, and inhibiting the formation of ameloblastoma cell line colonies.

4. The application according to any one of claims 1 to 3, characterized in that, The FGF4 inhibitors include substances that inhibit FGF4 gene expression, silence or knock out the FGF4 gene, and / or substances that reduce FGF4 protein content and / or activity.

5. The application according to claim 4, characterized in that, The substance includes at least one of nucleic acid molecules, carbohydrates, lipids, small molecule compounds, antibodies, peptides, proteins, gene editing vectors, lentiviruses, or adeno-associated viruses.

6. The application according to claim 5, characterized in that, The nucleic acid molecule includes shRNA, and the shRNA includes any one of B1 to B3: B1. The shRNA targets and interferes with the FGF4 gene; B2. The target sequence of the shRNA is shown in SEQ ID NO.1; B3. The sense and antisense strands of the interference sequence of the shRNA are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

7. The application according to claim 1, characterized in that, The product includes an FGF4 inhibitor; The products include reagents and / or drugs.

8. A drug, characterized in that, The drug includes the FGF4 inhibitor according to any one of claims 1 to 7, wherein the drug has the use of at least one of inhibiting ameloblastoma growth, inhibiting ameloblastoma cell line proliferation, inhibiting ameloblastoma cell line migration, inhibiting ameloblastoma cell line invasion, or inhibiting ameloblastoma cell line colony formation.

9. The application of any one of A1~A3 in screening candidate drugs for the prevention and / or treatment of ameloblastoma: A1 and FGF4 genes; A2 and FGF4 proteins; A3 and FGF4 inhibitors.

10. The application according to claim 9, characterized in that, The screening method includes screening drugs or reagents targeting FGF4, and selecting drugs or reagents that can reduce FGF4 gene expression levels or reduce FGF4 protein content or activity as candidate drugs for the prevention and / or treatment of ameloblastoma.

Images