Application of SNP molecular marker located on pig chromosome 2 and related to nipple number heterosis

By detecting pigs with the SNP molecular marker rs334177868 on chromosome 2 and having the genotype GG, the problem of improving the number of pig nipples was solved, sow reproductive performance and piglet survival rate were improved, and rapid breeding progress was achieved.

CN122012722APending Publication Date: 2026-05-12SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512053731.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the number of teats in pigs, which affects the reproductive performance of sows and the survival rate of piglets. Furthermore, hybrid vigor has not been fully utilized in pig breeding.

Method used

The SNP molecular marker rs334177868 located on chromosome 2 of pigs was provided. By selecting pigs with the genotype GG, the hybrid vigor of teat number was significantly improved, and the reproductive capacity of sows was rapidly improved.

Benefits of technology

By detecting and selecting GG-type pigs with SNP molecular markers, the reproductive capacity of sows can be significantly improved, the number of weaned piglets can be increased, the generation interval of genetic progress can be shortened, and the efficiency of pig breeding can be enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012722A_ABST
    Figure CN122012722A_ABST
Patent Text Reader

Abstract

The invention discloses application of an SNP (Single Nucleotide Polymorphism) molecular marker located on a pig chromosome 2 and related to nipple number heterosis, the locus of the SNP molecular marker is rs334177868 and corresponds to Agt at 405366bp on a chromosome 2 of an international pig reference genome version 11.1; the genotype of the SNP molecular marker is AA, AG or GG. The SNP molecular marker provided by the invention can be applied to crossbreeding of pigs so as to improve the nipple number heterosis of offspring pigs and realize genetic improvement of the pigs. According to the present invention, by detecting the single nucleotide polymorphism and / or the genotype of the SNP molecular marker, the identification of the pig nipple number character heterosis can be achieved, and by breeding the pig with the genotype of the SNP molecular marker GG, the breeding process of the pig can be accelerated, and the reproductive capacity of the sow can be improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic breeding technology and relates to the application of SNP molecular markers located on chromosome 2 of pigs that are associated with heterosis in nipple number. Background Technology

[0002] The number of teats in pigs is a crucial economic trait affecting sow reproductive performance and piglet survival rate. The number of teats determines a sow's ability to suckle piglets, a fundamental factor in ensuring healthy piglet development and improving pig production efficiency. While significant progress has been made in breeding piglets for litter size in recent years, genetic improvement of the teat number trait has lagged behind. When the number of effective teats is less than the number of live piglets, some piglets may not receive enough sow's milk in time, leading to stunted growth or even death. This not only reduces piglet survival rate but also increases breeding costs and management difficulty. Therefore, increasing the total teat number (TTN) in sows has become an important goal for improving pig reproductive performance.

[0003] Heterosis refers to the phenomenon where the offspring of crosses between different breeds or strains exhibit superior traits in growth, reproduction, and disease resistance compared to their parents. It is widespread in both plants and animals. Crossbreeding can significantly improve individual production performance, and heterosis-effect loci have been successfully identified in crossbred crops such as rice and corn. The utilization of heterosis is also of great significance to the development of animal husbandry. In developed countries with advanced animal husbandry, over 80% of eggs, chicken, pork, and mutton are produced from crossbred commercial pigs. In pig farming, commercial pigs bred using the "three-way crossbreeding" model based on Duroc, Landrace, and Large White breeds possess excellent characteristics such as rapid growth, high feed conversion ratio, and high lean meat percentage, making them suitable for modern intensive and large-scale farming systems. Summary of the Invention

[0004] The purpose of this invention is to provide an application of a SNP molecular marker located on chromosome 2 of pigs that is significantly associated with heterosis in the number of pig nipples.

[0005] According to one aspect of the present invention, a SNP molecular marker associated with heterosis in the number of teats is provided on chromosome 2 of a pig, the site being rs334177868, corresponding to the A>G mutation at 405366 bp on chromosome 2 of the International Pig Reference Genome 11.1, and the genotype of the SNP molecular marker being AA, AG or GG.

[0006] The SNP molecular markers provided by this invention are significantly correlated with heterosis in the nipple number trait in pigs and can be used to regulate heterosis in this trait. Specifically, pigs with the SNP molecular marker genotype GG exhibit significantly greater heterosis over their parents than pigs with genotypes AA or AG. The SNP molecular marker genotype GG is the dominant genotype for heterosis in pig nipple number. By detecting the single nucleotide polymorphisms and / or genotypes of the SNP molecular markers of this invention, heterosis in the nipple number trait in pigs can be identified. In pig crossbreeding, selecting pigs with the SNP molecular marker genotype GG can accelerate the breeding process and improve the reproductive capacity of sows.

[0007] According to a second aspect of the invention, an application is provided for detecting the SNP molecular marker rs334177868 located on chromosome 2 of pigs and associated with heterosis in nipple number, the application comprising at least one of the following (1) to (4): (1) Identify heterosis in pigs based on the number of teats; (2) Prepare products for identifying heterosis in pigs based on the number of teats; (3) Pig genetic improvement, based on the selection of pigs with the SNP molecular marker genotype GG to improve the heterosis of pigs in terms of the number of teats; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of SNP molecular markers to assist in the genetic improvement of pigs.

[0008] In some embodiments, products for detecting SNP molecular markers located on porcine chromosome 2 that are associated with heterosis in nipple number may include at least one of the following: reagents, kits, chips, and devices for detecting SNP molecular markers located on porcine chromosome 2 that are associated with heterosis in nipple number.

[0009] In some embodiments, the reagents for detecting SNP molecular markers on chromosome 2 of pigs that are associated with heterosis in nipple number may include at least one of the following: primers or probes for detecting SNP molecular markers on chromosome 2 of pigs that are associated with heterosis in nipple number.

[0010] In some implementations, the pigs are three-way crossbred pigs.

[0011] In some embodiments, the primers used to detect SNP molecular markers associated with heterosis in nipple number located on pig chromosome 2 include an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. This primer can specifically amplify a fragment containing the single nucleotide polymorphism at position 91 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and can be used to detect whether the single nucleotide at position 91 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 405366 bp on chromosome 2 of the International Swine Reference Genome Version 11.1, is A or G.

[0012] In some embodiments, the kit for detecting SNP molecular markers located on porcine chromosome 2 that are associated with heterosis in nipple number may include primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, as well as dNTPs, DNA polymerase, and Mg 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0013] According to a third aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular marker rs334177868 located on chromosome 2 of pigs and associated with heterosis in the number of nipples; (2) Select individuals with the SNP molecular marker genotype GG and eliminate individuals with the genotypes AA and AG, thereby increasing the number of teats in offspring pigs.

[0014] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.

[0015] In some implementations, in step (1), the breeding pig is a three-way crossbred pig.

[0016] In some implementations, step (1), determining the genotype of the SNP molecular marker located on chromosome 2 of pigs that is associated with heterosis in nipple number, includes the following steps: Whole-genome DNA was extracted from breeding pigs and amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplified products were sequenced, and the genotypes of SNP molecular markers related to nipple number heterosis located on chromosome 2 of pigs were determined based on the sequencing results.

[0017] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention verifies the effect of the SNP molecular marker rs334177868, which is located on the nucleotide sequence of chromosome 2 of pigs and is related to heterosis of the nipple number trait in pigs, on heterosis of the nipple number trait in pigs. This is helpful to establish a molecular marker-assisted selection breeding technology for rapid improvement of the nipple number trait in pigs, improve the production efficiency of breeding sows, and increase the number of weaned piglets.

[0018] (2) This invention provides a method for genetic improvement of pigs based on SNP molecular markers located on chromosome 2 of pigs that are associated with heterosis in the number of teats. By selecting the dominant alleles of this SNP molecular marker, genetic progress can be accelerated and the generation interval can be shortened. By selecting all AA or AG individuals with this SNP molecular marker to become GG individuals, heterosis in the number of teats in offspring pigs can be effectively improved, thereby significantly improving the reproductive capacity of sows and increasing the number of weaned piglets. Attached Figure Description

[0019] Figure 1 This is a genome-wide association study (GWAS) plot showing the over-parental dominance of the nipple number trait on chromosome 2 in three-way crossbred pigs; where: the horizontal axis represents the chromosome number of the pig; and the vertical axis represents -log. P value. Detailed Implementation

[0020] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0021] Example 1: Identification and Validation of SNP Molecular Markers Related to Heterosis in Pig Teat Number (1) Experimental pig herd This invention used a total of 939 three-way crossbred pigs. The experimental pig population consisted of 939 three-way crossbred pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd., along with 74 Duroc grandparent pigs and 366 two-way crossbred pigs identified through pedigree. The Duroc pigs were the core group of the breeding pig division, and their pedigree records were detailed. The pigs had free access to feed and water, and the feeding methods and rearing conditions remained consistent throughout the process, following conventional methods.

[0022] (2) Phenotypic measurement Over-parental heterosis refers to the degree to which a hybrid's value of a particular trait surpasses that of the best parent of the same trait. The calculation formula is as follows:

[0023] F1 refers to the phenotypic value (total number of teats) of three-way crossbred pigs, P D Phenotypic values ​​(total number of teats) of Duroc pig parents, P E This refers to the phenotypic value (total number of teats) of a two-way crossbred pig.

[0024] (3) Extraction of porcine genomic DNA Ear tissue samples from each collected three-way crossbred pig were used to extract whole-genome DNA using the standard phenol-chloroform method. The DNA quality and concentration were determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.

[0025] (4) Genotyping of pig whole genome variation DNA samples were subjected to next-generation sequencing by Beijing Novogene Technology Co., Ltd., and the sequencing results were in FASTQ format.

[0026] First, GATK v4.0.2.1 software was used to generate a dict file based on the pig reference genome (Sscrofa11.1). Second, BWA-MEM-0.7.12 software was used to correlate FASTQ data reads onto the pig reference genome. Third, SAMtools v1.9 software was used to generate a bam file. Fourth, Sentieon software (version 202010) was used for variant detection, during which "--algo LocusCollector", "--algo Realigner", "--algoQualCal", "--algo Haplotyper", and "algo GVCFtyper" were used to ultimately generate the VCF file for the three-way crossbred pig. Finally, the "VariantFiltration" function of GATK v4.0.2.1 software was used to filter SNPs, with the default parameters being: "QD<2.0, FS>60.0, SOR>3.0, MQ<40.0, MQRankSum<12.5, ReadPosRankSum<-8.0". For INDEL filtering, the parameters were: "QD<2.0, QUAL<50.0, FS>100.0, and ReadPosRankSum<-20.0". Finally, PLINK v1.9 was used to perform quality control on the obtained genotype data, removing variant sites with a detection rate <90%, a mimor allelic frequency (MAF) <5%, and excluding variant sites located at unknown locations and on sex chromosomes. The remaining variant sites and 939 samples were used for subsequent data analysis.

[0027] (5) Genome-wide association analysis (GWAS) Because kinship and population stratification effects can cause false positives, a kinship matrix needs to be constructed using GCTA software before association analysis. Principal component analysis is then performed using GCTA software, with the first three principal components used as covariates to correct for population structure. Finally, GWAS analysis is performed using a mixed linear model in GCTA software. This invention references the human genome significance threshold, setting the genomic significance and chromosomal significance thresholds to 5.00E-08 and 1.00E-06, respectively.

[0028] GWAS analysis results are as follows Figure 1 As shown.

[0029] from Figure 1 It can be seen that in three-way crossbred pigs, there is a SNP locus on chromosome 2 that significantly affects heterosis in terms of nipple number, and the most strongly associated SNP is 2_405366_A_G ( P = 2.73×10-8 This refers to nucleotide 91 in SEQ NO.1, which corresponds to the A>G mutation at 405366 bp on chromosome 2 in International Pig Reference Genome Version 11.1.

[0030] (6) Analyze the association between different genotypes and the superiority phenotype of nipple number in three-way crossbred pigs to verify the influence of SNP loci on heterosis of nipple number in pigs. The results are shown in Table 1.

[0031] As shown in Table 1, the SNP molecular marker 2_405366_A_G of this invention is highly significantly correlated with the number of nipples in a super-affinity relationship. P The value <0.01 indicates that this molecular marker significantly affects the heterosis of nipple number in pigs. By assisted selection at this SNP site in pigs, the heterosis of nipple number in this population can be improved, thereby accelerating the breeding process of sow fertility.

[0032] Furthermore, Table 1 also shows that the number of nipples in the GG type is significantly higher than that in the AA and AG types. P A value <0.01 indicates that GG is the dominant genotype for teat number heterosis. Teat number, as an important indicator of boar genetic improvement, significantly affects sow reproductive performance and piglet survival rate. Therefore, by gradually culling AA and AG type boars and retaining GG type boars during the breeding process, sow reproductive capacity and the number of weaned piglets can be significantly improved.

[0033] Table 1 Correlation analysis between SNP molecular markers and traits

[0034] (7) Effect analysis This invention provides an SNP molecular marker 2_405366_A_G that can significantly improve heterosis in pigs by increasing the number of teats. By using this SNP molecular marker for marker-assisted selection, pigs with genotypes AA and AG in the population can be gradually culled, which can significantly improve the productivity of breeding sows and increase the number of weaned piglets.

[0035] Example 2: Methods for genetic improvement of pigs The nucleotide sequence of the target fragment containing the SNP site that is significantly associated with heterosis in the number of nipples in three-way crossbred pigs is shown in SEQ ID NO:1, and the primer pairs for its PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0036] SEQ ID NO:1 ATCAAGGCCACTGGAACGGAGGCAGGGGGAGCGTCTGAGGGCTCGGCCAGGGGGCCGGGCCTGGGGGCCTCCTGGGCTCCACTGCCTGCC R CCAGGACTTCAGCCACCTGTTCCCGCTCATCCCAGAGCCCAGGCCCCGTGTCAGGCAGGTGGGACAAGGAGCCGAGTTT The R marked in the sequence is the mutation site, which is A or G, indicating an allele mutation; the bolded beginning and end of the sequence indicate the primer binding position.

[0037] Upstream primer-F: 5'-ATCAAGGCCACTGGAAC-3' (SEQ ID NO:2); Downstream primer primer-R: 5'-AAACTCGGCTCCTTGTC-3' (SEQ ID NO:3).

[0038] The genetic improvement methods for pigs include the following steps: S1. Determine the genotypes of SNP molecular markers related to heterosis in pigs based on teat number. (1) Take ear tissue from pigs or tail tissue from piglets, extract the whole genome DNA of pigs using the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.

[0039] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0040] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.

[0041] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and the gene fragments were sequenced in both forward and reverse reactions. Based on the sequencing results, it was determined whether the single nucleotide at position 91 from the 5' end in the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 405366 bp on chromosome 2 of the International Swine Reference Genome Version 11.1, was A or G, thus determining the genotype of the SNP molecular marker rs334177868 of the pig to be tested. S2. Select pigs with the SNP molecular marker genotype GG as parents for breeding.

[0042] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. The application of products for detecting SNP molecular markers located on porcine chromosome 2 that are associated with heterosis in nipple number, characterized in that, The SNP molecular marker site is rs334177868, and the application includes at least one of the following items (1) to (4): (1) Identify heterosis in pigs based on the number of teats; (2) Prepare products for identifying heterosis in pigs based on the number of teats; (3) Pig genetic improvement, based on breeding pigs with the SNP molecular marker genotype GG to improve the heterosis of pigs in terms of the number of teats; (4) Prepare a product for assisting in the genetic improvement of pigs, wherein the product is based on the identification of the genotype of the SNP molecular marker to assist in the genetic improvement of pigs.

2. The application according to claim 1, characterized in that, The product for detecting SNP molecular markers located on pig chromosome 2 that are associated with heterosis in nipple number includes at least one of the following: reagents, kits, chips, and devices for detecting the SNP molecular markers.

3. The application according to claim 2, characterized in that, The reagents used to detect the SNP molecular marker include at least one of the following: primers or probes for detecting the SNP molecular marker.

4. The application according to claim 3, characterized in that, The primers used to detect the SNP molecular marker include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

5. The application according to any one of claims 1 to 4, characterized in that, The pigs in question are three-way crossbred pigs.

6. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the SNP molecular markers located on chromosome 2 of pigs that are associated with heterosis in the number of nipples; (2) Select individuals with the SNP molecular marker genotype GG; The site of the SNP molecular marker is rs334177868.

7. The method for genetic improvement of pigs according to claim 6, characterized in that, In step (1), the method for determining the genotype of the SNP molecular marker located on chromosome 2 of pigs that is associated with heterosis in nipple number includes the following steps: Whole-genome DNA was extracted from pigs and amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplified products were sequenced, and the genotypes of SNP molecular markers related to nipple number heterosis located on chromosome 2 of pigs were determined based on the sequencing results.

8. The method for genetic improvement of pigs according to claim 6 or 7, characterized in that, The pigs in question are three-way crossbred pigs.