Construction and application of RNase III deletion type bacillus thuringiensis

By constructing an RNaseIII-deficient Bacillus thuringiensis engineered strain DBΔrnc, and utilizing the CRISPR-Cas9 gene editing system and dsRNA expression vector, the problem of dsRNA degradation was solved, achieving highly efficient RNAi effects and synergistic insecticidal effects with Bt strains, thus improving pest control efficacy.

CN122038433APending Publication Date: 2026-05-15INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610274315.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-08
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing Bacillus thuringiensis (Bt) products suffer from the problem of dsRNA degradation during delivery of double-stranded RNA (dsRNA), resulting in poor RNA interference (RNAi) effects. Furthermore, traditional Bt preparations face challenges such as pest resistance and reduced control efficacy, and there is a lack of efficient CRISPR-Cas9 gene editing systems.

Method used

An RNaseIII-deficient Bacillus thuringiensis engineered strain DBΔrnc was constructed. The rnc gene was knocked out using a CRISPR-Cas9 gene editing system. Combined with a bidirectional promoter and hairpin structure dsRNA expression vector, stable expression and oral delivery of dsRNA were achieved. This was then used in conjunction with the Bt strain HD1 to form a synergistic insecticidal strategy.

Benefits of technology

It significantly improved the transcription level and delivery efficiency of dsRNA, enhanced the RNAi effect on the target pest fall armyworm, and synergistically enhanced the insecticidal effect with Bt strain HD1, thereby improving the overall control effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to construction and application of RNase III deletion type bacillus thuringiensis (RNase III). The bacterial strain is obtained by taking a bacillus thuringiensis engineering bacterial strain DB delta 189 as an initial bacterial strain and knocking out an rnc gene by adopting a gene editing method. The strain realizes oral delivery of dsRNA and effective silencing of a target gene; meanwhile, the insecticidal effect of the Bt strain HD1 can be obviously enhanced. According to the invention, a new action mechanism is introduced while the traditional insecticidal advantages of Bt are reserved, so that the insecticidal effect of the Bt strain is improved, and the application prospect of Bt in comprehensive pest control is expanded.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology and microbial genetic engineering, specifically relating to an RNaseIII-deficient mutant Bacillus thuringiensis and its application in double-stranded RNA expression and RNAi synergistic insecticidal activity. Background Technology

[0002] Lepidoptera are among the most serious agricultural pests worldwide, posing a significant threat to food security and cash crop production for a long time. Traditional pest control methods mainly rely on chemical pesticides, but their long-term and widespread use has led to the rapid evolution of pesticide resistance in pests, increased environmental pollution, and adverse effects on non-target organisms. Therefore, developing innovative pest control strategies that are both environmentally friendly and biosafe has become an urgent need for sustainable agricultural development.

[0003] Among numerous microbial control resources, Bacillus thuringiensis (Bt) is currently the most mature, widely used, and commercially viable biopesticide. Bt can produce a variety of insecticidal proteins with high host specificity, exhibiting significant toxicity to target pests while showing low toxicity to vertebrates and beneficial arthropods, thus demonstrating high safety. Based on these advantages, Bt formulations have been widely used in agricultural pest control. .

[0004] However, with the continued and large-scale use of Bt preparations, the sensitivity of some important lepidopteran pests to Bt toxins has gradually decreased, posing a challenge to their control effectiveness. This situation indicates the need to expand the insecticidal function of Bt, upgrading it from a single-toxin insecticide to a multifunctional, compound control system, thereby further improving the overall control effect and the sustainability of its application.

[0005] RNA interference (RNAi) technology has been recognized as an important new strategy for precision pest control in recent years due to its high sequence specificity and low non-target effect. However, compared with Coleoptera, Lepidoptera are generally less sensitive to double-stranded RNA (dsRNA). Previous studies have shown that this low sensitivity may be related to factors such as insufficient dsRNA uptake efficiency by cells, rapid degradation by intestinal nucleases, and limited systemic propagation of silencing signals (LI X, FU L, LU Y, et al., A targeted RNAi-of-RNAi strategy to overcome nuclease-mediated RNAi suppression and enhance RNAiefficacy in lepidopteran pest, Cydia pomonella. J Agric Food Chem 73:28788–28801,2025). Therefore, in lepidopteran larvae, RNAi often only produces sublethal effects, such as developmental delay or reduced physiological adaptability, and is unlikely to achieve rapid lethality (SHUKLA JN, KALSI M, SETHI A, et al., Reduced stability and intracellular transport of dsRNA contribute to poor RNAiresponse in lepidopteran insects. RNA Biol 13:656-669, 2016). This indicates that the effectiveness of RNAi technology in lepidopteran pests largely depends on the improvement of dsRNA delivery efficiency and in vivo stability.

[0006] To overcome the problem of naked dsRNA being easily degraded in vivo, various bacterial-mediated dsRNA delivery systems have been developed in recent years. Engineered bacteria (such as *Escherichia coli* and *Bacillus subtilis*) can synthesize dsRNA intracellularly and deliver it to insects orally, thereby protecting dsRNA from rapid degradation to some extent and achieving sustained exposure (RIET J, COSTA-FILHO J, DALL'AGNO L, et al., *Bacillus subtilis* expressing double-strand RNAs induces RNA interference and increases survival of WSSV-challenged *Litopenaeus vannamei*. *Aquaculture* 541:736834, 2021). Furthermore, bacterial delivery is less expensive and simpler to operate compared to methods such as microinjection. However, these engineered bacteria typically lack natural insecticidal activity, resulting in limited control efficacy when used as independent pest control agents.

[0007] As an insect pathogen with natural insecticidal activity, *Bt* has the potential to serve as a dsRNA delivery chassis strain, combining RNAi-mediated gene silencing with a toxin-based insecticidal mechanism to achieve synergistic control. Previous studies have shown that combining dsRNA with Bt treatment can increase the sensitivity of pests to Bt toxins, suggesting a functional synergistic effect between RNAi and Bt toxins. This integrated strategy provides a new approach to improving prevention and control efficiency and extending the effectiveness of control measures.

[0008] However, achieving efficient and stable dsRNA expression in Bt bacteria remains a significant technical challenge. Within bacterial cells, dsRNA is highly susceptible to degradation by endogenous ribonucleases, particularly RNase III, an enzyme encoded by the rnc gene that participates in the processing and degradation of double-stranded RNA. In *Escherichia coli* or *Bacillus subtilis*, constructing RNase III-deficient strains can significantly increase intracellular dsRNA expression levels and enhance RNAi delivery efficiency. However, no RNase III-deficient Bt strains specifically designed for dsRNA expression have been reported, which has become a key technical bottleneck in constructing RNAi delivery platforms based on Bt.

[0009] The Bt strain LM-DB was obtained by high-temperature mutation of the wild-type strain LM1212. The LM1212 strain contained both spore-forming cells and crystal-producing cells, while the LM-DB strain, after high-temperature mutation, only contained crystal-producing cells and did not undergo cell lysis (ZHANG R, LUO Y, GANG L, et al., Key amino acid residues enhance the ability of CpcR to activate cry gene expression in Bacillus thuringiensis. Res Microbiol 174:104051, 2023). Chinese patent "Bacillus thuringiensis engineered strain DBΔ189 and its application" (application number: 2025117738904) discloses a Bt strain DBΔ189, a novel engineered strain obtained from the Bt LM-DB strain through systematic engineering modification. This strain, by knocking out the main endogenous insecticidal gene, yielded an engineered strain that does not produce crystals or produces low-crystal production and is non-lytic.

[0010] Therefore, establishing an efficient CRISPR-Cas9 gene editing platform suitable for LM-DB or its derivative strains, constructing RNaseIII-deficient Bt engineered strains, improving the stable expression level of dsRNA, and achieving synergistic effects between dsRNA and Bt strains are key technical problems that urgently need to be solved in this field. Summary of the Invention

[0011] This invention provides an RNaseIII-deficient engineered Bacillus thuringiensis strain. This strain was obtained by knocking out the rnc gene using gene editing, starting with the engineered Bacillus thuringiensis strain DBΔ189. This strain achieves oral delivery of dsRNA and effective silencing of the target gene; it also significantly enhances the insecticidal effect of the Bt strain HD1.

[0012] This invention also provides a CRISPR-Cas9 gene editing system suitable for Bacillus thuringiensis DB strain. This invention constructs a CRISPR-Cas9 gene editing system suitable for DB strains. Based on this system, an RNase III deletion mutant engineered strain, DB∆rnc, was constructed in the DB∆189 strain. This strain can stably express dsCHI and can be orally delivered to the target pest, the fall armyworm (Spodoptera frugiperda), effectively inducing the silencing of the target gene SfCHI. Simultaneously, this engineered strain can be used in combination with the Bt strain HD1 to achieve synergistic control and enhance insecticidal effects.

[0013] Establishment of CRISPR-Cas9 gene editing system in Bt strain LM-DB

[0014] To address the lack of a suitable CRISPR-Cas9 gene editing system for existing Bacillus thuringiensis DB strains, this invention constructs a CRISPR-Cas9 gene editing system suitable for Bacillus thuringiensis. This system works by manipulating the P-value in the edit plasmid... van and P man The promoter was replaced to enable the Cas9 protein and sgRNA to be stably expressed in the target Bacillus thuringiensis strain, thereby establishing a gene-targeted editing platform that can operate effectively in DB strains, providing a technical basis for the subsequent construction of functional gene knockout and double-stranded RNA expression engineered strains.

[0015] The editing system includes:

[0016] The modified shuttle vector pCas9 can replicate in Escherichia coli and Bacillus thuringiensis.

[0017] The promoter P8 drives sgRNA expression;

[0018] The inducible promoter P that drives Cas9 protein expression xyl ;

[0019] Specifically, this invention is based on the CRISPR-Cas9 editing system of Bacillus subtilis, by replacing the P on the editing plasmid. vanThe promoter is the strong promoter P8, which has been demonstrated in previous studies. man The promoter is replaced with a xylose-induced P xyl Promoter. The CRISPR-Cas9 system was further adapted to the LM-DB strain, a Bt strain derived from LM1212, which possesses unique differentiation characteristics. The DB strain is a stable mutant obtained through high-temperature mutagenesis, retaining only the crystalloid cell type and exhibiting a non-lytic phenotype, making it suitable as a heterologous expression chassis strain. Based on the genetic background characteristics of the DB strain, this invention modifies the sgRNA expression promoter from P... van By replacing the P8 promoter, a CRISPR-Cas9 editing system suitable for the DB background was constructed. Using this system, the cry32-like gene driven by the P9 promoter was successfully knocked out, obtaining the mutant strain DB9. This established a stable gene editing platform suitable for non-spore-forming Bt strains and yielded the cry32-like gene strain DB∆9.

[0020] Knockout of the RNase III encoding gene rnc in Bt engineered strain DB∆189

[0021] To construct a Bt chassis strain capable of stably expressing double-stranded RNA, this invention achieved the knockout of the rnc gene in Bacillus thuringiensis using the aforementioned CRISPR-Cas9 editing system.

[0022] The knockout method includes:

[0023] Screening for PAM sequences of the target gene rnc;

[0024] Construct a repair template containing upstream and downstream homologous repair arms;

[0025] Deletion of the target gene is achieved through homologous recombination;

[0026] This resulted in the engineered strain DB∆rnc with the target gene missing.

[0027] Specifically, based on the aforementioned editing system, this invention uses the rnc gene as the target gene. By screening PAM sequences, constructing specific sgRNA expression sequences, and creating a repair template containing 700 bp homologous arms upstream and downstream of the target gene, the knockout of the target gene was achieved. The rnc gene is located on the strain genome. An RNase III-deficient strain, DB∆rnc, was obtained through gene editing.

[0028] Expression of double-stranded RNA

[0029] To detect the dsRNA expression capacity of the DB∆rnc chassis strain, a target sequence for dsRNA was designed using endochitinase (SfCHI) from the fall armyworm. This invention constructs a double-stranded RNA expression vector system suitable for Bacillus thuringiensis, comprising:

[0030] The bidirectional promoter-driven dsCHI expression vector pHT315-dsCHI;

[0031] A single promoter-driven hairpin-structured hpdsCHI expression vector pHT315-hpdsCHI;

[0032] The hairpin structure hpdsGFP expression vector pHT315-hpdsGFP was used as a control.

[0033] The expression vector is capable of expressing the target double-stranded RNA in Bacillus thuringiensis.

[0034] This invention further establishes a method for detecting double-stranded RNA expression, and analyzes the transcriptional level of target double-stranded RNA in engineered strains using RT-PCR and RT-qPCR.

[0035] Specifically, based on the RNaseIII-deficient strain DBΔrnc, this invention designs two dsRNA expression strategies: bidirectional P cry35 Promoter-directed expression of double-stranded RNA (dsCHI); P cry35 The promoter directs the expression of double-stranded RNA with a hairpin structure (hpdsCHI). The expression vectors pHT315-dsCHI and pHT315-hpdsCHI were transformed into the chassis strain DB∆rnc via electroporation, obtaining expression strains DB∆rnc(dsCHI) and DB∆rnc(hpdsCHI), respectively. Experimental results showed that the stability and accumulation level of dsRNA transcripts were significantly improved in the DB∆rnc background, and the hpdsCHI construction method accumulated a higher amount of double-stranded RNA. The DB∆rnc strain is an engineered chassis strain suitable for dsRNA expression and can be used to construct various dsRNA expression vectors and achieve stable expression.

[0036] RNAi efficacy detection of DB∆rnc(hpdsCHI) strain

[0037] To verify the RNAi effect of the DB∆rnc(hpdsCHI) strain on the target pest fall armyworm, this invention establishes a method for determining RNA interference efficiency. This involves orally feeding an engineered strain expressing dsCHI to fall armyworm larvae and detecting changes in the transcriptional levels of target genes. This includes:

[0038] The engineered strain expressing hpdsCHI was given to the second-instar fall armyworm via oral feeding;

[0039] Changes in the transcriptional level of the SfCHI gene in larvae were detected by RT-qPCR.

[0040] Specifically, to verify the RNAi effect of the constructed strain DBΔrnc(hpdsCHI) in RNA interference, second-instar larvae of the fall armyworm were fed with strain DBΔrnc(hpdsCHI) expressing double-stranded RNA targeting SfCHI, with a DBΔrnc strain expressing hpdsGFP serving as a control. The relative expression levels of the target gene were measured. Results showed that, compared to the control group, the transcription level of the target gene SfCHI was significantly reduced in larvae fed with the hpdsCHI-expressing strain from day 1 to day 5. However, no significant difference in larval mortality was observed between the two treatment groups during the feeding phase. Therefore, the observation period was extended, and significant phenotypic differences were observed in subsequent developmental stages. Larvae fed with DBΔrnc(hpdsCHI) exhibited a higher proportion of pupal developmental abnormalities, including abnormal pupal morphology, during the pupal stage, while larvae in the control group developed normally. These abnormalities mainly occurred during the pupal stage, not the larval stage. The above results indicate that the Bt strain DB∆rnc(hpdsCHI) expressing hpdsCHI constructed in this invention can effectively deliver dsRNA and induce target gene silencing via oral administration, thereby producing a developmental defect phenotype at a critical stage of insect development.

[0041] Synergistic insecticidal effect of DB∆rnc(hpdsCHI) strain and Bt strain HD1 strain

[0042] To verify whether the DB∆rnc(hpdsCHI) strain can synergize with existing insecticidal strains, this invention establishes a method for determining the synergistic insecticidal activity of co-treatment of the dsCHI-expressing strain and the Bacillus thuringiensis HD1 strain. The theoretical additive mortality rate is calculated using the Bliss independence model, and the degree of synergistic effect is quantified using the co-toxicity coefficient. This includes:

[0043] The engineered strain expressing hpdsCHI was combined with the Bt insecticidal strain HD1 to treat fall armyworm.

[0044] The theoretical additive mortality rate was calculated using the Bliss independence model;

[0045] Synergistic effects are quantified through co-toxicity coefficients.

[0046] Specifically, to evaluate whether the DB∆rnc(hpdsCHI) strain could enhance the insecticidal activity of the Bt strain HD1, second-instar and newly hatched fall armyworm larvae were treated with the combined treatment, and mortality rates were measured. In both larval stages, the lethality of the combined treatment with HD1 and DB∆rnc(hpdsCHI) was significantly better than that of either the single treatment or the control, indicating a significant functional enhancement effect between the DB∆rnc(hpdsCHI) and HD1 strains. These results demonstrate that oral delivery of Bt strains expressing dsCHI can significantly increase the larval sensitivity to Bt strain HD1, thereby enhancing the overall insecticidal effect.

[0047] Through the above technical solution, the present invention achieves the following:

[0048] Establish a feasible CRISPR-Cas9 editing system in DB strain;

[0049] Achieve knockout of cry32-like and rnc genes;

[0050] Construct an engineered chassis strain DB∆rnc suitable for double-stranded RNA expression;

[0051] Construct expression vectors for dsCHI and hairpin-structured hpdsCHI;

[0052] Establish an evaluation system for RNA interference and synergistic insecticidal activity.

[0053] The novel Bacillus engineered strain DB∆rnc provided by this invention has the following characteristics: (1) a stable RNaseIII-deficient engineered chassis strain has been established; (2) it is conducive to the accumulation of double-stranded RNA; (3) it achieves oral delivery of dsRNA and effective silencing of target genes; and (4) it significantly enhances the insecticidal effect of Bt strain HD1. This strain can be used as a dsRNA expression platform, complementing the insecticidal strategy of traditional Bt strains, which helps to improve the overall control effect and enrich the application path of Bt in RNAi-Bt synergistic control.

[0054] Beneficial effects

[0055] Compared with the prior art, the present invention has the following beneficial effects:

[0056] 1. A high-efficiency CRISPR-Cas9 gene editing system suitable for Bt strain DB was established.

[0057] 2. An RNaseIII-deficient Bt engineered chassis strain was constructed and dsRNA transcription levels were significantly enhanced.

[0058] 3. It achieved Bt-mediated oral delivery of dsRNA and efficient silencing of target genes.

[0059] 4. Significantly enhances the insecticidal effect of Bt strain HD1, forming a synergistic control strategy.

[0060] While retaining the traditional insecticidal advantages of Bt, this invention introduces a new mechanism of action, which helps to improve the insecticidal effect of Bt strains and expand the application prospects of Bt in integrated pest management. Attached Figure Description

[0061] Figure 1 Construction of DB9 mutant

[0062] Figure (A) shows a schematic diagram of the CRISPR-Cas9 vector pCas9 used for editing in the DB strain. The P8 promoter is used to guide sgRNA transcription, P... xyl (A) Cas9 expression was induced; the repair template represents the template used for homologous recombination. (B) Electrophoresis diagram of PCR identification of cry32-like gene deletion mutants; each lane represents an independent transformant; M represents the DNA marker; DB, the originating strain; DB9, the cry32-like gene deletion mutant. (C) DB9 sequencing results. (D) SDS-PAGE electrophoresis results of the DB9 mutant. The arrow points to the Cry3-like protein band.

[0063] Figure 2 Construction of the DB∆rnc mutant

[0064] Figure (A) shows the electrophoresis diagram of PCR identification of the rnc gene deletion mutant strain, where DB∆189 is the starting strain and DB∆rnc is the rnc deletion mutant strain; (B) shows the sequencing results of DB∆rnc; (C) shows the optical microscope observation of DB∆189 and DB∆rnc strains in SSM medium. 20 Cell morphology during the period; (D) Growth results of DB∆189 and DB∆rnc strains in SSM medium.

[0065] Figure 3 Expression and detection of :dsCHI in different chassis strains

[0066] The figure shows (A) the expression vector of dsCHI, a schematic diagram of the dsCHI expression vector with bidirectional promoter expression (top), and a schematic diagram of the hpdsCHI expression vector with hairpin structure (bottom); (B) RT-PCR method to identify the expression of dsCHI in different chassis strains with the two construction methods; (C) RT-qPCR method to compare the transcriptional levels of dsCHI in different chassis strains with the two construction methods.

[0067] Figure 4 RNAi efficiency detection of DB∆rnc(hpdsCHI) strain

[0068] Figure (A) shows the target gene silencing efficiency of second-instar fall armyworm larvae fed with DB∆rnc(hpdsCHI) strain on days 1, 3, and 5, with the control group consisting of larvae fed with DB∆rnc(hpdsGFP); (B) shows the target gene transcription level of second-instar fall armyworm larvae fed with DB∆rnc(hpdsCHI) strain 7 days after feeding, with the control group consisting of larvae fed with DB∆rnc(hpdsGFP); (C) shows the phenotypic results of abnormal pupation in second-instar fall armyworm larvae fed with DB∆rnc(hpdsCHI) strain 15 days after feeding.

[0069] Figure 5 Insecticidal activity analysis of DB∆rnc(hpdsCHI) strain

[0070] Figure (A) shows the mortality rate of second-instar fall armyworm larvae fed with DB∆rnc(hpdsCHI) strain for 7 days, with the control group consisting of larvae fed with DB∆rnc(hpdsGFP) strain; (B) shows the abnormal pupation results of second-instar fall armyworm larvae fed with DB∆rnc(hpdsCHI) strain for 15 days.

[0071] Figure 6 Synergistic insecticidal effect of DB∆rnc(hpdsCHI) strain and HD1 strain

[0072] Figure (A) shows the mortality rate of second-instar fall armyworm larvae after 7 days of feeding with DB∆rnc(hpdsCHI), HD1, DB∆rnc(hpdsGFP), DB∆rnc(hpdsCHI) and HD1, and DB∆rnc(hpdsGFP) and HD1 strains, respectively; (B) shows the mortality rate of newly hatched fall armyworm larvae after 7 days of feeding with DB∆rnc(hpdsCHI), HD1, DB∆rnc(hpdsGFP), DB∆rnc(hpdsCHI) and HD1, and DB∆rnc(hpdsGFP) and HD1 strains, respectively. Detailed Implementation

[0073] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0074] All the biological materials used below are stored in the applicant's laboratory and can be publicly distributed.

[0075] 1. Strains, plasmids, and culture conditions

[0076] *E. coli* TG1 was used for routine molecular cloning operations; *E. coli* ET was used to prepare demethylated plasmid DNA for transformation with *Bacillus thuringiensis*. The engineered *Bacillus thuringiensis* strain DB was derived from strain LM1212 and obtained through high-temperature mutagenesis screening. This strain retained only the crystal-forming cell type and exhibited a non-lytic phenotype. In the DB strain background, the cry-related gene was knocked out via homologous recombination to obtain the crystal protein-deficient strain DB∆189 (Chinese Patent "Engineering *Bacillus thuringiensis* strain DB∆189 and its application" (Application No.: 2025117738904)). *E. coli* was cultured in LB medium, and *Bacillus thuringiensis* was cultured in LB or SSM medium. The culture temperature was 30°C or 37°C, and the shaking speed was 200 rpm. The pCas9 plasmid was an *E. coli*-*Bacillus* shuttle vector containing the pUC replicon for *E. coli* replication and the pE194ts replicon for temperature-sensitive *Bacillus* replication.

[0077] Table 1. Strains and plasmids used in this study

[0078]

[0079] 2. DNA manipulation and transformation

[0080] Plasmid DNA was extracted from *E. coli* using an alkaline lysis method with an Omega column-based plasmid miniprep kit (Omega Bio-Tek, Georgia, USA). DNA fragments were amplified using 2 × Phanta Flash Master Mix or 2 × RapidTaq Master Mix (Nanjing Novizan Biotechnology Co., Ltd., Nanjing, China). Primers used for PCR were synthesized by Beijing Qingke Biotechnology Co., Ltd. (see Table 2). DNA fragments were recovered using an Omega column-based purification kit (Omega Bio-Tek, Georgia, USA). Homologous recombination was performed using the ClonExpress Ultra One Step Cloning Kit V3 (Nanjing Novizan Biotechnology Co., Ltd., Nanjing, China). Restriction endonucleases and T4 ligases were purchased from Takara (Takara Bio Inc., Dalian, China). The constructed vectors were validated by PCR and then identified by sequencing by Beijing Qingke Biotechnology Co., Ltd.

[0081] Table 2. Specific primers used in this study

[0082] Primer Name Primer Sequence Restriction Site <![CDATA[pCas9-P8-cry32-R]]> CGTATGTCCGTATACAACTCGATCATTCTCCCTCCCATAT pCas9-cry32-F CATTCGATAAGCGAAGGTACATAAGGCCTTTCTAGATTAA sgRNA-cry32-F GAGTTGTATACGGACATACGGTTTTAGAGCTAGAAATAGC sgRNA-cry32-R GAAAAGACCTGCGGTAGTATCGTTGGCCGTCGACCCTATA HA-cry32-F1 TATAGGGTCGACGGCCAACGATACTACCGCAGGTCTTTTC HA-cry32-R1 TCCGTGAGGAAGCTGAGTAGTAATAATCCTCCCTCGTAAA HA-cry32-F2 TTTACGAGGGAGGATTATTACTACTCAGCTTCCTCACGGA HA-cry32-R2 TTAATCTAGAAAGGCCTTATGTACCTTCGCTTATCGAATG cry32-uF GTGTGAACGTGTGACATAAAACT cry32-dR TGCAAATCTCGCAAGAGATGGG <![CDATA[pCas9-P8-rnc-R]]> ATACTGCATCTCCAAGAAATGATCATTCTCCCTCCCATAT pCas9-rnc-F ATGAGTCTGTAGATTCCCTGATAAGGCCTTTCTAGATTAA sgRNA-rnc-F ATTTCTTGGAGATGCAGTATGTTTTAGAGCTAGAAATAGC sgRNA-rnc-R ATAACTGTATCCCATTCTTCCGTTGGCCGTCGACCCTATA HA-rnc-F1 TATAGGGTCGACGGCCAACGGAAGAATGGGATACAGTTAT HA-rnc-R1 GGGATTCCTTATAGTTGTTCACGGTACGGCATAGGTCCCT HA-rnc-F2 AGGGACCTATGCCGTACCGTGAACAACTATAAGGAATCCC HA-rnc-R2 TTAATCTAGAAAGGCCTTATCAGGGAATCTACAGACTCAT rnc-uF TAGGTTCGGATGCAATTGCAGTGAGAG rnc-dR AGCTCACGCTGTCCTTCTAACTTTTCT <![CDATA[P8-F]]> TCCTTTTTGCGTGTGATGCGGCTTAAAAAACTTGGTAAAAAAA <![CDATA[P8-R]]> GCTATTTCTAGCTCTAAAACGATCATTCTCCCTCCCATATTCTT <![CDATA[8999-P8-F]]> TTTTTTTACCAAGTTTTTTAAGCCGCATCACACGCAAAAAGGAAAT 8999-R AAGAATATGGGAGGGAGAATGATCGTTTTAGAGCTAGAAATAGCAA <![CDATA[P xyl -F]]> TCTCATTTGGATTATTAAAAATGTCACTATTGCTTCAGAAAT <![CDATA[P xyl -R]]> CTAACTTAAGAATAAGATCTGTGATTTCCCCCTTAAAAATA gRNA-F ATTTTTAAGGGGGAAATCACAGATCTTATTCTTAAGTTAGG Cas9-R TTCTGAAGCAATAGTGACATTTTTAATAATCCAAATGAGATA <![CDATA[pHT315-P 35 -F1]]> <![CDATA[GCTATGACCATGATTACGCC AAGCTT TTTCAAATCGTTTAGCTTTT]]> HindIII <![CDATA[pHT315-P 35 -CHI-R1]]> GACGAGGAAGAGGAACCGATCAAACAGTTCCCCTTTCGGA [[ID= ​ ​ <![CDATA[GGGGATCCTCTAGAGTCGAC ​ TCGTCTCCACAAAGGCCTTT]]> ​ <![CDATA[P 35 -CHI-F2]]> <![CDATA[GACGA ​ CAAACAGTTCCCCTTTCGGA]]> ​ <![CDATA[P 35 -CHI-R2]]> <![CDATA[CCCGG ​ TTTCAAATCGTTTAGCTTTT]]> ​ ​ <![CDATA[GACGA ​ GGAGCTTAATCAGAGGGTTC]]> ​ <![CDATA[CCAGT ​ GAGCTCGGTACCCGGGGATC]]> <![CDATA[pHT315-P 35 -GFP-R1]]> ​ ​ ​ ​ <![CDATA[GGGGATCCTCTAGAGTCGAC ​ CAAACTCAAGAAGGACCATG]]> ​ ​ <![CDATA[GTTTG ​ TGTAATCCCAGCAGCTGTTA]]> ​ ​ <![CDATA[CCCGG ​ ATGAGTAAGGAGAAGAACT]]> ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​

[0083] The underlined part in the note indicates the enzyme cleavage site.

[0084] 3. Construction of mutant strains

[0085] To construct a CRISPR-Cas9 editing system suitable for Bt strain DB, this invention builds upon the CRISPR-Cas9 editing system of Bacillus subtilis by modifying the P-type editing plasmid pJOE8999. van The promoter was replaced with the P8 promoter, which has been shown to have strong transcriptional activity in the DB strain in previous studies. Specifically, using the genome of the DB∆189 strain as a template, the P8 promoter fragment was amplified using primers P8-F and P8-R. Using plasmid pJOE8999 as a template, the plasmid was amplified using primers 8999-P8-F and 8999-R to obtain the linearized vector pJOE8999. The P8 promoter fragment and the linearized vector pJOE8999 were then fused using homologous recombinase to obtain the recombinant vector pJOE8999-P8. man The promoter is replaced with a xylose-induced P xyl The promoter, specifically, is plasmid P xyl -18Z was used as a template, and primer P was used. xyl -F and P xyl -R amplification P xyl Using the promoter fragment pJOE8999-P8 as a template, the linearized vector pJOE8999-P8 was obtained by amplification with primers gRNA-F and Cas9-R. The P promoter fragment was then used to generate the linearized vector pJOE8999-P8. xyl The promoter fragment and the linearized vector pJOE8999-P8 were fused to obtain the recombinant vector pCas9.

[0086] The endogenous plasmid pLM113 of strain DB contains a gene encoding a Cry32-like protein (WP_118991958.1), transcribed by promoter P9. To verify whether the pCas9 plasmid works in strain DB, the cry32-like gene was knocked out using the pCas9 plasmid. First, the nucleotide sequence of the cry32-like gene (3780 bp) to be knocked out was submitted to the online tool CHOPCHOP to screen for suitable PAM sequences. A PAM sequence (Protospacer Adjacent Motif) is a 23-nt specific nucleotide sequence that is essential for Cas9 to recognize and cleave the target gene. The PAM sequence screened for the cry32-like gene was: 5'-GAGTTGTATACGGACATACGAGG-3'. The sequence with the AGG nucleotide removed from the 3' end is called the N20 sequence. Subsequently, the selected N20 sequence was designed into the 5' end of primer sgRNA-cry32-F. Using pCas9 plasmid as a template, the gRNA sequence was amplified by PCR using primers sgRNA-cry32-F and sgRNA-cry32-R to finally obtain the sgRNA sequence carrying the N20 sequence. Then, 700 bp fragments upstream and downstream of the cry32-like gene coding region were used as homologous repair arms. Using DB strain as a template, the upstream homologous arm 5HA was amplified by PCR using primers HA-cry32-F1 and HA-cry32-R1. Similarly, the downstream homologous arm 3HA was amplified by PCR using primers HA-cry32-F2 and HA-cry32-R2. Finally, using the two homologous arms as templates, the two homologous arms were fused by overlap extension PCR using primers HA-cry32-F1 and HA-cry32-R2 to obtain the homologous recombination repair template HA. Subsequently, using primers sgRNA-cry32-F and HA-cry32-R2, the sgRNA fragment was fused with the assembled homologous repair template via overlap PCR to obtain the sgRNA-HA fragment. Using the pCas9 plasmid as a template, a linearized pCas9 vector was obtained by PCR amplification using primers pCas9-cry32-F and pCas9-P8-cry32-R. The sgRNA-HA fragment was then constructed into the linearized pCas9 vector using homologous recombinase to obtain the recombinant plasmid pCas9-Δcry32-like. The recombinant plasmid was first demethylated in *E. coli* ET, and then 1 µg of the plasmid was introduced into *DB* strain via electroporation.Positive transformants were identified and screened by PCR using primers sgRNA-cry32-F and HA-cry32-R2. These transformants were then cultured in 5 mL LB tubes for 12 h, followed by 1% transfer to 100 mL LB medium with 100 µL kanamycin (100 mg / mL) added. The culture was incubated at 30°C and 220 rpm for 18 h. Then, 100 µL of 2 M xylose was added to induce Cas9 protein expression, and the culture was continued for another 12 h. Finally, 1 mL of the bacterial culture was serially diluted to 10⁻⁶. -5 The samples were evenly spread on LB agar plates containing kanamycin and xylose and incubated at 30°C for 12 hours. Then, using single clones as templates, PCR identification was performed on the clones using primers cry32-uF and cry32-dR. For successfully edited single clones, the PCR products were used for subsequent sequencing to confirm the knockout of the target gene. Further functional validation experiments were then conducted based on the function of the target gene to ensure its deletion.

[0087] To construct a suitable chassis strain for double-stranded RNA expression, the rnc gene encoding RNase III in the crystal-free, non-lytic strain DBΔ189 was knocked out using the CRISPR-Cas9 editing system already established in the DB strain. The rnc gene is located in the genome of the DBΔ189 strain and encodes a 738 bp sequence (AXY10918.1). First, the nucleotide sequence of the rnc gene to be knocked out was submitted to the online tool CHOPCHOP to screen for suitable PAM sequences. The PAM sequence screened for the rnc gene was: 5'-ATTTCTTGGAGATGCAGTATTGG-3'. The N20 sequence, obtained by removing the TGG nucleotides at the 3' end, was designed into the 5' end of primer sgRNA-rnc-F. Using the pCas9 plasmid as a template, the gRNA sequence was amplified by PCR using primers sgRNA-rnc-F and sgRNA-rnc-R to finally obtain the sgRNA sequence carrying the N20 sequence. Subsequently, 700 bp fragments upstream and downstream of the rnc gene coding region were used as homologous repair arms. Using DB strain as a template, the upstream homologous arm 5HA was obtained by PCR amplification using primers HA-rnc-F1 and HA-rnc-R1. Similarly, the downstream homologous arm 3HA was obtained by PCR amplification using primers HA-rnc-F2 and HA-rnc-R2. Then, using the two homologous arms as templates, the two homologous arms were fused by overlap extension PCR using primers HA-rnc-F1 and HA-rnc-R2 to obtain the homologous recombination repair template HA fragment. Subsequently, using primers sgRNA-rnc-F and HA-rnc-R2, the sgRNA fragment was fused with the assembled homologous repair template HA fragment via overlap PCR to obtain the sgRNA-HA fragment. Using the pCas9 plasmid as a template, a linearized pCas9 vector was obtained by PCR amplification using primers pCas9-rnc-F and pCas9-P8-rnc-R. The sgRNA-HA fragment was then constructed into the linearized pCas9 vector using homologous recombinase to obtain the recombinant plasmid pCas9-Δrnc. The recombinant plasmid was first demethylated in *E. coli* ET, and then 1 µg of the plasmid was introduced into *DB* strain via electroporation. Positive transformants were identified and screened by PCR using primers sgRNA-rnc-F and HA-rnc-R2. These transformants were then cultured in 5 mL LB tubes for 12 h, followed by 1% transfer to 100 mL LB medium with 100 µL kanamycin (100 mg / mL) added. The culture was incubated at 30°C and 220 rpm for 18 h. Then, 100 µL of 2 M xylose was added to induce Cas9 protein expression, and the culture was continued for another 12 h. Finally, 1 mL of the bacterial culture was serially diluted to 10⁻⁶. -5The samples were evenly spread on LB agar plates containing kanamycin and xylose and incubated at 30°C for 12 hours. Then, using single clones as templates, PCR identification was performed on the clones using primers rnc-uF and rnc-dR. For successfully edited single clones, the PCR products were used for subsequent sequencing to confirm the knockout of the target gene. Further functional validation experiments were then conducted based on the function of the target gene to ensure its deletion.

[0088] 4. Construction of the dsCHI expression vector

[0089] A 670 bp region on the CDS sequence of the fall armyworm endochitinase (SfCHI) gene (LOC118278006), which has been reported to induce RNA interference, was selected as a fragment of double-stranded RNA. This fragment was then used in the bidirectional promoter P... 35 In the construction of the promoter-guided dsCHI expression vector, the genome of strain DB∆189 was used as a template, and primer pHT315-P was employed. 35 -F1 and pHT315-P 35 -CHI-R1 was amplified by PCR to obtain a 202bp P-value. 35 The promoter fragment was then used as a template by fall armyworm cDNA, and a 670bp SfCHI fragment was obtained by PCR amplification using primers SfCHI-F1 and SfCHI-R. Finally, the fragment was amplified using primer pHT315-P. 35 -F1 and SfCHI-R bind the SfCHI fragment to P via overlap PCR. 35 Promoter fusion was performed, and the intermediate vector dpHT315-P35-CHI was constructed between the HindIII and PstI sites of the pHT315 vector using homologous recombinase. Subsequently, primer P... 35 -CHI-F2 and P 35 -CHI-R2 was amplified by PCR of the second 202bp P segment. 35 The promoter fragment was then used to insert a reverse P gene between the PstI and BamHI sites using T4 DNA ligase. 35 The promoter was used to obtain the dual-promoter-guided dsCHI expression vector pHT315-dsCHI. In a single P 35In the construction of the promoter-guided hairpin-structured dsCHI expression vector, fall armyworm cDNA was used as a template, and PCR amplification was performed using primers SfCHI-F2 and SfCHI-R2 to obtain a 690 bp SfCHI fragment. Compared with the first SfCHI fragment, this fragment had an additional 20 bp sequence added at the 3′ end to construct the neck loop region of the hairpin structure. Then, this 690 bp fragment was ligated to the PstI and BamHI sites of the intermediate vector pHT315-P35-CHI using T4 DNA ligase to obtain the hairpin-structured double-stranded RNA expression vector pHT315-hpdsCHI. The construction method of the pHT315-hpdsGFP vector was the same as described above, and the primers used are shown in Table 2. One µg of each of the obtained recombinant plasmids pHT315-dsCHI and pHT315-hpdsCHI was then transformed into the chassis strains DB∆189 and DB∆rnc, respectively, via electroporation. This yielded recombinant strains DB189(dsCHI), DB189(hpdsCHI), DB∆rnc(dsCHI), and DB∆rnc(hpdsCHI). One µg of the obtained recombinant plasmid pHT315-hpdsGFP was then transformed into the chassis strain DB∆rnc via electroporation, yielding the recombinant strain DB∆rnc(hpdsGF).

[0090] 5. RNA extraction and RT-PCR or RT-qPCR analysis

[0091] Bt strains were cultured in SSM medium until T 20The phase, Tn, represents n hours after the end of the logarithmic growth phase in SSM medium. Collect 1 mL of bacterial culture by centrifugation and mechanically disrupt the cells with vigorous shaking. Extract total RNA according to the TransZol Up Plus RNA Kit (TransGen, Beijing, China). Determine RNA concentration using a NanoDrop 2000 microspectrophotometer (Thermo Fisher Scientific, USA) and assess RNA integrity by 1% agarose gel electrophoresis. Take 1 μg of total RNA and reverse transcribe it using the HiScript III one-strand cDNA synthesis kit (including gDNA removal step) (Nanjing Novizan Biotechnology Co., Ltd., Nanjing, China). Using 1 μL of cDNA as a template, dsCHI expression was detected by RT-PCR using primers Bt-CHI-F and Bt-CHI-R. The cDNA, diluted 100-fold, was used as a template, and the transcription levels of dsCHI under different chassis strains and construction methods were compared by RT-qPCR using primers Bt-CHI-F and Bt-CHI-R. Primers Bt-rpsU-F and Bt-rpsU-R were used as internal reference primers for the rpsU gene, which served as an internal reference gene for RT-qPCR detection in Bt. Real-time quantitative PCR was performed using SYBR Green Pro Taq HS Premix qPCR reagent on an Applied Biosystems 7500 real-time fluorescence quantitative PCR instrument (Thermo Fisher Scientific, USA). The experimental procedures were performed according to the reagent instructions.

[0092] Total RNA extraction and RT-qPCR procedures for fall armyworm were the same as described above. Oligo(dT)20VN primers were added during cDNA synthesis. Using fall armyworm cDNA as a template, primers SfCHI-qF and SfCHI-qR were used to detect the expression of the SfCHI gene in fall armyworms fed with DB∆rnc(hpdsCHI) bacteria for 1, 3, 5, and 7 days via RT-qPCR. Primers Sfactin-qF and Sfactin-qR were used as internal reference primers for the detection of the actin gene, which served as an internal reference gene for RT-qPCR detection in fall armyworms. The relative expression levels of target genes were all calculated using 2^(- ... -ΔΔCt Method calculation.

[0093] 6. RNA interference efficiency determination and phenotypic statistics

[0094] DB∆rnc strains expressing hpdsCHI or hpdsGFP are now cultured in 100 mL SSM medium to T. 20After centrifugation at 6000 rpm for 10 min, 100 mL of culture medium was enriched, and the bacterial cells were resuspended in 50 mL of sterile water. Then, 3 mL of the test bacterial solution was thoroughly mixed with 15 g of artificial feed and dispensed into 24-well plates, with one second-instar larva placed in each well. The hpdsGFP-expressing strain served as the control group, and sterile water as the negative control. Larvae were reared under a light-dark cycle of 14:10 h, a temperature of 26 ± 1°C, and a relative humidity of 75% ± 10%. Samples were collected on days 1, 3, 5, and 7 after feeding. Each biological replicate consisted of 3 larvae, with 3 independent replicates per treatment, for a total of 72 larvae per treatment. RT-qPCR was used to analyze the transcriptional levels of target genes in the treatment and control groups. Phenotypic analysis was performed on second-instar fall armyworm larvae 15 days after feeding with the DB∆rnc (hpdsCHI) strain.

[0095] 7. Assay of synergistic insecticidal activity between hpdsCHI expression strain and Bt strain HD1

[0096] DB∆rnc strains expressing hpdsCHI or hpdsGFP are now cultured in 100 mL SSM medium to T. 20 Afterwards, 100 mL of culture medium was enriched by centrifugation at 6000 rpm for 10 min, and the bacterial cells were resuspended in 100 mL of sterile water. The artificial feed was heated and dispensed into 24-well plates. After cooling and solidification, 1 μg of HD1 lyophilized powder and 200 μL of the test bacterial solution were evenly coated on the surface of the feed. After drying, one newly hatched larva was inoculated into each well. Each treatment group had 3 24-well plates, with a total of 72 larvae. For second-instar larvae, 3 mL of bacterial solution, 6 mg of HD1 lyophilized powder, and 15 g of artificial feed were thoroughly mixed and dispensed into 24-well plates, with one larva per well. The dsGFP-expressing strain and sterile water served as controls. Larval mortality was recorded after 7 days of feeding. The HD1 strain was cultured in SSM medium for 24 hours and then lyophilized at low temperature for 12 hours. The resulting lyophilized powder was stored at -40°C for later use.

[0097] 8. Statistical Analysis

[0098] Statistical analysis was performed using Prism 10 software. The relative expression levels of the CHI gene were analyzed using Student's t-test (*P < 0.05, **P < 0.01, ***P < 0.001). Larval mortality data were analyzed using one-way ANOVA, followed by Tukey's multiple comparison test (**P < 0.01, ***P < 0.001, ****P < 0.0001).

[0099] All bioassays were performed in triplicate, with each treatment containing 24 larvae (total sample size n = 72 per treatment). Mortality data from each replicate were pooled for synergistic effect analysis. The theoretical additive mortality rate for the combined treatments was calculated using the Bliss independence model.

[0100] Where M A and M B These represent the mortality rates of each individual treatment group.

[0101] The degree of synergistic effect was quantitatively assessed using the co-toxicity factor (CTF):

[0102]

[0103] result

[0104] 1. Establishment of a CRISPR-Cas9 genome editing system in Bt strain LM-DB

[0105] To establish a CRISPR-Cas9 genome editing system suitable for Bacillus thuringiensis (Bt), the plasmid backbone derived from the Bacillus subtilis vector pJOE8999 was functionally modified to obtain the recombinant editing vector pCas9. This vector contains a Cas9 coding sequence, an sgRNA expression cassette, a kanamycin resistance selection marker, and a repair template sequence for homologous recombination (see [link to documentation]). ​ (A). Given that the promoters in the original vector were unsuitable for the expression requirements of the Bt strain, the promoters guiding sgRNA transcription and Cas9 protein expression were systematically replaced and optimized. Promoter P8 was used to guide sgRNA transcription, and promoter P... xyl Used to regulate Cas9 protein expression (see...) ​ (See section A). The optimized editing system was applied to the non-cellular Bt strain DB. After transforming the recombinant plasmid into LM-DB via electroporation, positive transformants were selected to knock out the cry32-like gene in the DB strain. PCR identification and single-clone sequencing analysis confirmed the successful deletion of the cry32-like gene. SDS-PAGE electrophoresis analysis also showed the absence of the Cry32-like protein band in the edited strain DB9 (see section A). ​ (BD), further confirming the loss of function of the target gene.

[0106] In summary, the CRISPR-Cas9 genome editing system established in this invention can achieve precise and efficient gene editing in non-cellular Bt strains, exhibiting good stability and versatility, and can serve as a technical basis for subsequent genetic modification and functional optimization of Bt strains.

[0107] Construction of 2 DBΔrnc strain

[0108] This study successfully knocked out the rnc gene in DB∆189, a crystal protein-deficient strain derived from the DB strain, which was constructed previously. The DB∆189 strain retained only the crystal-producing cell type, exhibiting a non-lytic phenotype. The knockout of the rnc gene was confirmed by PCR and sequencing (see [link to study].) ​ (See AB). Growth characteristics and morphological comparisons were performed between DB∆189 and its rnc deletion mutant DBΔrnc. Results showed no significant differences in growth curves and cell morphology between the two (see AB). ​ The results (CD) indicate that under the culture conditions described, the absence of RNase III did not have a significant impact on the growth viability and basic physiological state of the strain.

[0109] In summary, the results indicate that the constructed DBΔrnc strain has a clear genetic background, stable phenotype, and non-lytic characteristics, and can be used as an engineered Bt chassis strain suitable for research on stable expression and delivery of dsRNA.

[0110] 3 Expression and detection of double-stranded RNA in Bt

[0111] To compare the dsRNA expression performance of different chassis strains, the fall armyworm endochitinase (SfCHI) gene was selected as the RNA interference target. Two dsRNA expression strategies were constructed and evaluated: a bidirectional dual-promoter P... 35 Guided double-stranded RNA expression vector (pHT315-dsCHI) and single promoter P 35 Guided double-stranded RNA expression vector with hairpin structure (pHT315-hpdsCHI) (see) ​ (A). RT-PCR analysis showed that dsCHI transcripts were detectable in both expression constructs in both strain backgrounds (see [link]). ​ (See section B). RT-qPCR quantitative analysis showed that the abundance of dsCHI transcripts in the RNaseIII-deficient strain DBΔrnc was significantly higher than that in the starting strain DB∆189; under both expression strategies, the dsRNA level in DBΔrnc was significantly increased, and in the DBΔrnc background, the transcription level of dsRNA with hairpin structures was significantly higher than that of dual promoters (see section B). ​ (C)

[0112] The above results indicate that RNaseIII deficiency significantly enhances the accumulation of dsRNA in Bt cells, while the construction of the hairpin structure further increases the dsRNA production in the RNaseIII-deficient chassis.

[0113] 4. RNAi efficiency detection and insecticidal activity assay of DB∆rnc(hpdsCHI) strain

[0114] To evaluate the RNA interference efficiency of dsCHI delivered by the DB∆rnc strain in the target pest, fall armyworm, second-instar fall armyworm larvae were orally fed with the DB∆rnc(hpdsCHI) strain, with the DB∆rnc(hpdsGFP) strain serving as a control. Transcription of the target gene was analyzed; compared to the control group, the transcription level of the target gene SfCHI was significantly reduced in DB∆rnc(hpdsCHI)-treated larvae from day 1 to day 5 (see [link to study]. ​ (A), partial recovery occurred on the 7th day (see ​ (B). There was no significant difference in larval mortality among the different treatment groups during the feeding period (see [reference]). ​ (A). However, after extending the observation period, significant developmental abnormalities were observed. Larvae fed DBΔrnc(hpdsCHI) exhibited pupal abnormalities in 20% of cases, including pupal morphological deformities, while the control group showed normal development (see [reference needed]). ​ (B). The combined results indicate that hpdsCHI expressed by Bt can be effectively delivered to larvae orally, inducing target gene silencing and causing developmental defects during the pupal stage.

[0115] Synergistic insecticidal effect of DB∆rnc(hpdsCHI) strain and HD1 strain

[0116] To assess whether Bt-expressed dsRNA could enhance the insecticidal activity of Bt strain HD1, synergistic insecticidal mortality was determined in second-instar and newly hatched fall armyworm larvae. In second-instar larvae, the mortality rate of DBΔrnc(hpdsCHI) alone was 20%, higher than the control DBΔrnc(hpdsGFP) (7%), but significantly lower than that of the toxin-producing strain HD1 (40%). The mortality rate of HD1 combined with DBΔrnc(hpdsGFP) was 46%, showing only a slight additive effect. In contrast, the mortality rate of HD1 combined with DBΔrnc(hpdsCHI) significantly increased to 81%, significantly higher than either treatment alone (see [link to relevant documentation]). ​ (A). A similar trend was observed in newly hatched larvae. The mortality rate was 16% for DBΔrnc(hpdsCHI) alone, 4% for the control, and 50% for HD1. The mortality rate was 54% for HD1 combined with DBΔrnc(hpdsGFP), while the mortality rate was significantly increased to 92% for HD1 combined with DBΔrnc(hpdsCHI) (see [link to article]). ​ (B). In both larval developmental stages, the combined treatment of HD1 and DBΔrnc(hpdsCHI) was significantly superior to both the single treatment and the control combination, demonstrating a significant synergistic insecticidal effect.

[0117] The above results indicate that oral delivery of Bt strains expressing dsCHI can significantly increase the susceptibility of larvae to Bt strain HD1, thereby significantly enhancing its overall insecticidal effect.

Claims

1. A Bacillus thuringiensis CRISPR-Cas9 system gene editing vector, using the Bacillus subtilis CRISPR-Cas9 system gene editing vector pJOE8999 as the backbone, with the promoter P8 replacing P. van The promoter drives sgRNA expression, P xyl Promoter replacement P man The promoter drives the Cas9 protein.

2. The Bacillus thuringiensis CRISPR-Cas9 system gene editing vector according to claim 1, wherein the Bacillus thuringiensis strain is the DB strain.

3. An RNaseIII-deleted Bacillus thuringiensis strain, DB∆rnc, was obtained by knocking out the rnc gene from Bacillus thuringiensis DB∆189 as the starting strain.

4. The method for constructing the RNase III-deficient Bacillus thuringiensis strain DB∆rnc according to claim 3, comprising the following steps: (1) Screening for suitable PAM sequences for the knocked-out rnc gene encoding RNase III enzyme. The PAM sequence is: 5'-ATTTCTTGGAGATGCAGTATTGG-3'; (2) Using the Bacillus thuringiensis CRISPR-Cas9 system gene editing vector plasmid as described in claim 1 as a template, the gRNA sequence carrying the N20 sequence is finally obtained by PCR amplification of the gRNA sequence using primers sgRNA-rnc-F and sgRNA-rnc-R. sgRNA-rnc-F:ATTTCTTGGAGATGCAGTATGTTTTAGAGCTAGAAATAGC; gRNA-rnc-R: ATGAGTCTGTAGATTCCCTGATAAGGCCTTTCTAGATTAA; (3) The upstream and downstream fragments of 700 bp in the coding region of the rnc gene were used as homologous repair arms. Using DB∆189 strain as a template, the upstream homologous arm 5HA was obtained by PCR amplification using primers HA-rnc-F1 and HA-rnc-R1; the downstream homologous arm 3HA was obtained by PCR amplification using primers HA-rnc-F2 and HA-rnc-R2; then, using the two homologous arms as templates, the two upstream and downstream homologous arms were fused by overlapping extension PCR using primers HA-rnc-F1 and HA-rnc-R2 to obtain the homologous recombination repair template HA. HA-rnc-F1: TATAGGGTCGACGGCCAACGGAAGAATGGGATACAGTTAT, HA-rnc-R1: GGGATTCCTTATAGTTGTTCACGGTACGGCATAGGTCCCT, HA-rnc-F2: AGGGACCTATGCCGTACCGTGAACAACTATAAGGAATCCC, HA-rnc-R2: TTAATCTAGAAAGGCCTTATCAGGGAATCTACAGACTCAT; (4) Using primers sgRNA-rnc-F and HA-rnc-R2, the sgRNA fragment is fused with the assembled homologous repair template HA by overlapping PCR to obtain the sgRNA-HA fragment. Using the Bacillus thuringiensis CRISPR-Cas9 system gene editing vector plasmid described in claim 1 as a template, the linearized pCas9 vector is obtained by PCR amplification using primers pCas9-rnc-F and pCas9-P8-rnc-R. The sgRNA-HA fragment is then constructed into the linearized pCas9 vector by homologous recombinase to obtain the recombinant plasmid pCas9-Δrnc. pCas9-rnc-F:ATGAGTCTGTAGATTCCCTGATAAGGCCTTTCTAGATTAA; pCas9-P8-rnc-R: ATACTGCATCTCCAAGAAATGATCATTCTCCCTCCCATAT; (5) The recombinant plasmid pCas9-Δrnc was demethylated in Escherichia coli ET and then introduced into strain DB∆189 by electroporation to obtain strain DB∆rnc.

5. The application of the RNaseIII-deficient Bacillus thuringiensis strain DB∆rnc as a dsRNA delivery chassis strain according to claim 3, wherein specific dsRNA is designed using genes that can interfere with the growth or survival of pests as RNA interference targets, and introduced into the RNaseIII-deficient Bacillus thuringiensis strain to obtain a dsRNA delivery chassis strain.

6. The application of claim 5 further includes delivering the dsRNA delivery chassis strain orally to the target pest, thereby killing the pest.

7. The application according to claim 6, wherein the specific dsRNA is a dsRNA with a hairpin structure.

8. The application of claim 7, wherein, when taken orally, the dsRNA delivers the chassis strain in combination with the pest-killing Bt strain.

9. The application according to claim 8, wherein the gene is the endochitinase (SfCHI) gene of the fall armyworm, the pest is the fall armyworm (Spodoptera frugiperda), and the Bt strain with pest-killing properties is HD1.

10. A combined insecticide comprising a Bacillus thuringiensis strain DB∆rnc of claim 3 with a specific dsRNA containing genes that interfere with the growth or survival of pests and a Bt strain that kills pests. The gene in question is the endochitinase (SfCHI) gene of the fall armyworm, the pest is the fall armyworm, and the Bt strain that kills the pest is HD1.