Application of OsFabF gene in resistance to rice stripe virus

By using the CRISPR/Cas9 system to target and edit the rice OsFabF gene, mutants were prepared, solving the problem of low resistance to rice stripe virus in rice breeding and cultivating a transgenic rice variety with high virus resistance.

CN122104747APending Publication Date: 2026-05-29NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610154633.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-12-18
Filing Date
2026-02-03
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies are inefficient and have safety controversies in breeding rice for resistance to rice stripe virus. Traditional methods are time-consuming, and gene editing technology has not been applied to the OsFabF gene.

Method used

The OsFabF gene in rice was targeted and edited using the CRISPR/Cas9 gene editing system. By knocking out or introducing nucleotide mutations, OsFabF mutants were prepared, and transgenic rice resistant to rice stripe virus was bred.

Benefits of technology

It significantly improved the resistance of rice to rice stripe virus, reduced the harm of viral infection, and bred transgenic rice varieties with enhanced resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104747A_ABST
    Figure CN122104747A_ABST
Patent Text Reader

Abstract

The application of OsFabF gene in resistance to rice stripe virus, the application relates to the technical field of rice disease resistance breeding. The application uses a CRISPR / Cas9 gene editing system to design sgRNA targeting a specific functional region of an endogenous OsFabF gene in rice, to precisely edit the region, thereby obtaining a mutant with a functionally deficient OsFabF. The editing preferably results in a frame shift mutation or a premature stop codon, to obtain a truncated OsFabF protein mutant. Experiments show that the rice mutant plant obtained in this way exhibits significantly enhanced resistance to RSV infection, reduced virus accumulation and reduced disease symptoms. The application provides an effective gene target and breeding material for cultivating new rice varieties resistant to rice stripe virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the application of a rice gene FabF in resistance to rice stripe virus, belonging to the field of rice disease resistance breeding technology. Background Technology

[0002] Rice (Oryza sativa L.) is one of the world's most important food crops, providing staple food for more than half of the global population. Currently, it is grown in over 100 countries worldwide, but its cultivation is mainly concentrated in Asia. Rice is also one of the most important food crops in my country, therefore, controlling rice diseases and pests is crucial for ensuring my country's food production.

[0003] The rice stripe virus outbreak in rice-growing areas of China and Japan is caused by rice stripevirus (RSV), which is transmitted by the planthopper (Laodelphax striatellus) in rice paddies and among weeds in the field.

[0004] Rice stripe virus (RSV) can infect a variety of food crops, including rice, wheat (Triticum aestivum), and maize (Zea mays). In the laboratory, it can also infect two model plants, Arabidopsis thaliana and Nicotiana benthamiana. RSV inoculation causes stunting and chlorosis, with severe stunting and inflorescence distortion in later stages. RSV can also be used to inoculate Nicotiana benthamiana through mechanical friction with crude extracts from infected leaves, causing yellow spots on inoculated leaves and yellowing of leaf veins on systemic leaves. In the mid-to-late stages, leaf curling and deformity occur, leading to plant stunting.

[0005] To improve crop resistance to viruses, crop plants can be optimized through breeding. However, traditional breeding methods are time-consuming and inefficient; while transgenic technology is highly efficient, its application is currently limited due to significant safety controversies.

[0006] The emergence of genome editing technology has overcome the limitations of previous methods. In particular, the simplicity and low cost of CRISPR / Cas9 technology make targeted editing at the whole genome level possible, enabling efficient editing of specific sites. Regulating specific plant defense mechanisms through genome editing is currently one of the most effective measures to improve plant disease resistance.

[0007] If rice varieties resistant to viruses can be obtained through genetic engineering, rice viral diseases can be controlled, reducing economic losses. Currently, there are no reports on the application of the rice OsFabF gene in rice resistance to rice stripe virus.

[0008] In view of this, the present invention is proposed. Summary of the Invention

[0009] Technical problem solved: This invention provides a rice gene OsFabF and its application. By using gene editing technology, the rice OsFabF gene is knocked out, which improves the rice's antiviral ability and can significantly reduce the damage to plants after infection by viruses, especially rice stripe virus.

[0010] Technical solution: A mutant of the rice OsFabF gene, the mutant having a nucleotide sequence as shown in SEQ ID NO.1, and containing a mutation of at least one nucleotide in the region shown in SEQ ID NO.3 of the sequence.

[0011] The above-mentioned mutations result in frameshift mutations or the generation of premature stop codons in the open reading frame of the OsFabF gene, and the mutations include at least one of nucleotide deletion, insertion or substitution.

[0012] A mutant of the OsFabF protein encoded by the above-mentioned gene mutant.

[0013] The above-mentioned protein mutant is a truncated protein, whose amino acid sequence terminates prematurely at amino acid position 124 or 125 corresponding to the sequence shown in SEQ ID NO.2.

[0014] The mutant described above is missing at least one nucleotide between positions 306 and 328 of the sequence shown in SEQ ID NO.1, and / or missing at least one nucleotide between positions 357 and 379.

[0015] The mutant described above has the deletion of nucleotides at positions 323 and 363 of the sequence shown in SEQ ID NO.1 and the addition of an amino acid.

[0016] A rice plant cell or plant tissue containing the above-mentioned OsFabF gene mutant or the above-mentioned OsFabF protein mutant.

[0017] A method for preparing rice plants with enhanced resistance to rice stripe virus (RSV) includes the following steps: using a CRISPR / Cas9 gene editing system, targeting and editing the OsFabF gene region of rice plant cells with a target sequence as shown in SEQ ID NO.3 using sgRNA, thereby obtaining edited cells; and culturing and regenerating the edited cells into complete rice plants.

[0018] The primers used to construct the CRISPR / Cas9 system described above contain sequences as shown in SEQ ID NO.7 and SEQ ID NO.8.

[0019] The use of the above-mentioned OsFabF gene mutant or the above-mentioned OsFabF protein mutant in the breeding of rice varieties resistant to rice stripe virus (RSV).

[0020] Beneficial effects: 1. This invention uses OsFabF gene editing to genetically improve crops and cultivate transgenic rice resistant to rice stripe virus, significantly improving the ability to resist the virus; 2. Further experiments using planthoppers to transmit rice stripe virus to wild-type and OsFabF-KO rice plants showed that knocking out OsFabF increased the resistance of rice plants to rice stripe virus. Attached Figure Description

[0021] Figure 1 The Benedictine smoke, after being silenced by NbFabF, exhibits some resistance to RSV.

[0022] Figure 2 The phenotype of the OsFabF-KO knockout strain after RSV infection.

[0023] Figure 3 The results show the RSV virus content of the OsFabF-KO knockout strain after RSV infection.

[0024] Figure 4 The results of gene detection in the OsFabF-KO knockout strain after RSV infection.

[0025] Meaning of the symbols in the image:

[0026] Nip: A virus-carrying Nipponbare rice strain.

[0027] OsFabF-KO: Nipponbare rice line with the OsFabF gene knocked out. Detailed Implementation

[0028] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The embodiments are only used to explain the present invention and are not intended to limit the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0029] This invention first silences the gene in *Nicotiana benthamiana*, and then shows that OsFabF can significantly inhibit RSV infection in *Agrobacterium*-infiltrated infectious clones (see details). Figure 1Therefore, this invention constructed rice knockout lines of this gene and observed the disease resistance phenotype of the transgenic rice lines. It was found that OsFabF knockout exhibited a significant disease resistance phenotype, namely, it could significantly inhibit RSV expression. Finally, a new target gene, OsFabF, for the control of rice stripe virus was screened. In summary, this invention provides the application of the OsFabF gene and its mutants in the genetic improvement breeding of rice disease resistance, and has great application prospects.

[0030] More specifically, this invention uses the CRISPR / Cas9 gene editing system to target and edit the OsFabF gene.

[0031] First, an OsFabF knockout vector was constructed, and callus tissue induced by mature embryos of rice Nipponbare was transformed using rice callus transfection technology. After obtaining T0 generation transgenic rice seeds, they were further propagated to obtain T1 generation seeds. DNA was extracted from the young leaves of T1 generation single plants, and the sgRNA target site was amplified using target-specific primers and sequenced to obtain stable homozygous mutant transgenic plants.

[0032] Experimental results showed that the OsFabF knockout mutant inoculated with RSV exhibited significantly lower symptoms and virus expression levels compared to the control Nip plant. This demonstrates that OsFabF mutant transgenic rice significantly enhances rice's resistance to RSV infection, possessing significant application value in the field of transgenic technology. In conclusion, this invention provides practical guidance for cultivating transgenic plants resistant to rice stripe virus and holds important application prospects in the field of plant disease control.

[0033] The specific technical solution is as follows: the rice gene OsFabF, whose nucleotide sequence is shown in SEQ ID NO.1, and whose encoded protein amino acid sequence is shown in SEQ ID NO.2.

[0034] The present invention provides an OsFabF gene mutant, which is generated by a mutation in the region shown in SEQ ID NO.3 of the sequence shown in SEQ ID NO.1.

[0035] The types of "mutations" include: the addition, deletion, and substitution of nucleotides.

[0036] Furthermore, the gene mutant is missing bases 306-328 and any one or more of bases 357-379 in the sequence shown in SEQ ID NO.1.

[0037] This invention utilizes CRISPR / Cas9 gene editing technology to introduce mutations in the SEQ ID NO.3 region of the OsFabF gene, preparing various OsFabF gene mutants. Among them, the OsFabF gene mutant corresponding to SEQ ID NO.4 was prepared by inserting a T into the nucleotides at positions 323 and 363 of the OsFabF gene (SEQ ID NO.1), and it was confirmed that the mutant can enhance the resistance of rice to rice stripe virus.

[0038] Furthermore, this invention provides an OsFabF protein mutant, characterized in that the protein mutant refers to an OsFabF protein whose editing was prematurely terminated. In other words, the FabF protein of this invention is indirectly generated by CRISPR / Cas9 gene editing technology.

[0039] "Premature termination" refers to a deletion, addition, or substitution of a base at a specific site within the open reading frame of the OsFabF gene, prematurely forming a stop codon and thus preventing the production of the complete OsFabF protein. The mutation site of the OsFabF gene determines the amino acid sequence and activity of the encoded protein. Specifically, the protein mutant terminating at amino acid 125 corresponds to the OsFabF gene mutant lacking nucleotides 365-368 (SEQ ID NO. 5); the protein mutant terminating at amino acid 124 corresponds to the OsFabF gene mutant with a base inserted after nucleotide 364 (SEQ ID NO. 6).

[0040] In this invention, the biological material refers to the OsFabF knockout mutation (OsFabF-KO) from Nipponbare. More specifically, the OsFabF-KO includes OsFabF-KO#1, OsFabF-KO#2, and OsFabF-KO#3, wherein OsFabF-KO#1 corresponds to a protein mutant with an amino acid frameshift, which is an OsFabF gene mutant with the deletion of nucleotides at positions 323 and 363 and the insertion of a T; OsFabF-KO#2 corresponds to a protein mutant terminated at amino acid position 125, which is an OsFabF gene mutant with the deletion of nucleotides at positions 365-368; and OsFabF-KO#3 corresponds to a protein mutant terminated at amino acid position 124, which is an OsFabF gene mutant with a base inserted after nucleotide position 364.

[0041] Furthermore, the present invention provides the application of biomaterials containing the above-mentioned OsFabF gene or the above-mentioned OsFabF gene mutant or the above-mentioned OsFabF protein mutant in rice disease resistance breeding.

[0042] Example 1: Experimental Method

[0043] 1. Artificial inoculation with RSV

[0044] Rice materials (such as Nip and OsFabF-KO transgenic lines) were soaked and germinated for 2-3 days. After the radicle broke through the seed coat, the radicle tip was vertically inserted into a standard glass culture dish with a volume of 1 L using the directional sowing method. About 30 seeds were placed in each beaker, and 3 biological replicates were set up. The culture was carried out at 30℃ under 16 h light / 8 h dark conditions.

[0045] The artificial transmission process of RSV mainly consists of three steps: identification of RSV toxin source, acquisition of the toxin by the vector insect, and transmission of the toxin by the vector insect.

[0046] First, rice plants carrying RSV were collected from the field, and total RNA was extracted. RT-qPCR experiments were performed using RSV (CP) virus-specific primers to detect the mRNA level of the virus in the diseased plants. The tested infected plants were pretreated before transplanting.

[0047] After the virus feeding is completed, the virus transmission stage begins with the vector insects. At the initial stage of the vector insects entering the cycle, the cultivation process for the virus recipient plant must be initiated simultaneously.

[0048] Finally, virus inoculation experiments were conducted using healthy gray planthoppers carrying RSV at the 3-4 instar stage.

[0049] 2. Construction of the rice YL-Hu-OsFabF vector

[0050] The YL-Hu-OsFabF vector is a CRISPR / Cas9 gene editing vector.

[0051] The construction scheme is as follows: Primers were designed on the CRISPR-GE website based on the OsFabF gene sequence shown in SEQ ID NO.1 to clone the sgRNA fragment from rice. The target sequence was: CAGCCTGAAAGGAGAACTGTTGAAAAGAAACCTGATGTTAAACAAAGAAGGGTGGTTATCACTGGCATGGGTGTAGTAACACCGTTGGGCCATGATCCTGATGTGTTTTACAACAACCTTCTGGATGGTGTTAGTGGAATAAGCGAGATAGAAAGGTTCGACTGCTCCACGTTTCCGACGGTAATACAGATGGTTTTCTTCCTGTCATGGATATGGGG (SEQ ID NO.3). The PCR primer sequences were: YL-Hu-OsFabF-F:CAGTGGTCTCATGGCGGCCGTGGCGGTGCC (SEQ ID NO.7); YL-Hu-OsFabF-R:CAGTGGTCTCTCACTTGAAGGGTGCAAACA (SEQ ID NO.8).

[0052] After PCR product recovery and purification, the target sequence was ligated to the U3 promoter and gRNA scaffold using the pYLsgRNA-OsU3 vector as a template. The two PCR products were then mixed and used as a template to ligate the U3 promoter, target sequence, and gRNA scaffold together using overlap PCR to form an sgRNA expression cassette. The PCR reaction program was: pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 90 s, and complete extension at 72℃ for 10 min, followed by storage at 4℃. After PCR product recovery and purification, the sgRNA expression cassette and pYLCRISPR / Cas9Pubi-H plasmid were digested with BsaI at 37℃ for 3-5 hours. After purification of the digested products, the fragments and vector were ligated with T4 ligase and incubated overnight at 4℃. The ligation product was then added to DH5α competent cells for transformation. Positive clones were selected and sent for assay. The constructed vector was used for subsequent Agrobacterium transformation.

[0053] 3. Obtaining OsFabF gene knockout materials

[0054] The successfully constructed OsFabF knockout vector was transferred into the GV3101 Agrobacterium strain by electroporation. Rifampicin and kanamycin were used to screen for positive Agrobacterium strains containing the knockout vector. (1) Place GV3101 competent cells on ice until completely thawed; add 2 μL of plasmid to the competent cells, gently tap the tube wall to mix, and let stand on ice for 1 min; (2) Transfer the competent cells containing the plasmid to a pre-treated electroporation cup; (3) Place the electroporation cup in the electroporator, set the instrument to the "Agr" program, and perform electroporation; (5) After electroporation, add 800 μL of antibiotic-free LB, mix by pipetting, transfer to a new 1.5 mL EP tube, and incubate at 28℃ and 220 rpm for 3 h; (6) Take 100 μL of culture medium onto solid LB medium containing the vector resistance, spread evenly with a spreader, seal with sealing film, and incubate upside down at 28℃ for 48 h.

[0055] Positive transgenic callus was obtained by dark culturing callus containing a knockout vector on selection medium containing 50 mg / L hygromycin. The positive callus was differentiated, rooted, and transplanted to obtain T0 generation plants. T1 generation plants were obtained through routine molecular detection and rice cultivation methods.

[0056] 4. Resistance detection of OsFabF gene knockout material after RSV inoculation

[0057] (1) Observe the phenotype of the RSV knockout material (see details) Figure 2 ):

[0058] Observations on rice knockout materials inoculated with RSV showed that the OsFabF knockout mutant inoculated with RSV exhibited significantly milder symptoms than the control Nip plants.

[0059] (2) Detection of viral load by Western blot (see details) Figure 3 ):

[0060] First, OsFabF-KO rice lines carrying RSV were collected, and inoculated leaf proteins were extracted. The protein expression level was then detected using an RSV CP-specific antibody.

[0061] The RSV expression level in OsFabF knockout mutants was significantly lower than that in control Nip plants. This indicates that OsFabF mutant transgenic rice significantly enhances rice resistance to RSV infection.

[0062] (3) The editing status of OsFabF was detected by PCR sequencing (see details). Figure 4 ):

[0063] The product containing the knockout site in the rice genome was amplified using CRISPR-F / R primers, ligated into the pMD19-T vector, transformed into *E. coli*, and positive clones were screened. Sequencing was then used to confirm the editing status of the knockout site. The CRISPR-F primer sequence was: CAGCCTGAAAGGAGAACTG (SEQ ID NO. 9), and the CRISPR-R primer sequence was: CCCCATATCCATGACAGGAAG (SEQ ID NO. 10). Analysis of the gene and amino acid sequences was performed using SnapGene software. Since the knockout site is located in the functional region of the gene, the CRISPR / Cas9 system can efficiently alter the gene's function by editing this site.

[0064] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A mutant of the rice OsFabF gene, characterized in that, The mutant has a nucleotide sequence as shown in SEQ ID NO.1, and contains a mutation of at least one nucleotide in the region shown in SEQ ID NO.3 of the sequence.

2. The mutant according to claim 1, characterized in that, The mutation results in a frameshift mutation or the generation of an early stop codon in the open reading frame of the OsFabF gene, and the mutation includes at least one of nucleotide deletion, insertion, or substitution.

3. A mutant of the OsFabF protein encoded by the gene mutant of claim 1.

4. The protein mutant according to claim 3, characterized in that, The protein mutant is a truncated protein whose amino acid sequence terminates prematurely at amino acid position 124 or 125 corresponding to the sequence shown in SEQ ID NO.

2.

5. The gene mutant according to claim 1, characterized in that, The mutant is missing at least one nucleotide between positions 306 and 328 of the sequence shown in SEQ ID NO.1, and / or missing at least one nucleotide between positions 357 and 379.

6. The gene mutant according to claim 5, characterized in that, The mutant is missing nucleotides 323 and 363 of the sequence shown in SEQ ID NO.

1.

7. A rice plant cell or plant tissue containing the OsFabF gene mutant of any one of claims 1, 2, 5 or 6, or the OsFabF protein mutant of any one of claims 3 or 4.

8. A method for preparing rice plants with enhanced resistance to rice stripe virus (RSV), characterized in that, Includes the following steps: Using the CRISPR / Cas9 gene editing system, the OsFabF gene region of rice plant cells was targeted and edited with sgRNA as shown in SEQ ID NO.3 to obtain edited cells; and the edited cells were cultured and regenerated into complete rice plants.

9. The method according to claim 8, characterized in that, The primers used to construct the CRISPR / Cas9 system contain sequences as shown in SEQ ID NO.7 and SEQ ID NO.

8.

10. Use of the OsFabF gene mutant of any one of claims 1, 2, 5 or 6, or the OsFabF protein mutant of any one of claims 3 or 4, in the breeding of rice varieties resistant to rice stripe virus (RSV).