A SNP marker related to chicken age at first egg and its application

By applying the G/A polymorphic SNP marker at the 3298230 bp position on chromosome 27 of chickens in white-feathered broilers, the problem of difficulty in quickly assessing the age of first egg production in existing technologies has been solved, enabling early selection of superior individuals and improving reproductive efficiency and economic benefits.

CN122104939APending Publication Date: 2026-05-29FUJIAN SHENGZE BIOLOGICAL TECH DEV CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
FUJIAN SHENGZE BIOLOGICAL TECH DEV CO LTD
Filing Date
2026-03-13
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately assess the age at first laying trait in broiler flocks, resulting in low reproductive efficiency and difficulty in early selection of superior individuals.

Method used

A G/A polymorphic SNP marker located at 3298230 bp on chromosome 27 of chicken, along with its detection primer pairs and kit, was developed for early screening of individuals with precocious potential, and genotypic analysis was used to shorten the age at first egg production.

Benefits of technology

This technology enables precise screening of chicken flocks before sexual maturity, significantly shortens the age at which chickens begin laying eggs, and improves the reproductive efficiency and economic benefits of broiler chickens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104939A_ABST
    Figure CN122104939A_ABST
Patent Text Reader

Abstract

The application discloses a SNP marker related to a chicken age of first egg laying character and application thereof, and belongs to the technical field of molecular genetics and gene breeding. The SNP marker is located at the position of 3298230 bp of chicken chromosome 27, the reference genome version is GRCg7b, has G / A polymorphism, and the individual with the AA genotype at the position has the early age of first egg laying character compared with other genotypes. The SNP marker can be applied to the breeding of excellent breeding hens, can significantly shorten the age of first egg laying of a population, and has great economic application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics and gene breeding technology, specifically involving a SNP marker related to the age of chickens at the start of laying and its application. Background Technology

[0002] The broiler industry is a core pillar of the global broiler production system. Its high-efficiency production depends not only on growth rate but also profoundly on reproductive efficiency. Optimization of reproductive traits, particularly age at first laying (ASM)—the age at which a hen lays its first viable egg—is a key factor influencing the length of the laying cycle, peak laying rate, and overall production efficiency. Shortening the ASM means entering peak laying earlier, extending the effective laying period, and thus significantly increasing the total egg production and economic benefits throughout the laying cycle. In-depth analysis of the genetic regulatory mechanisms of ASM, especially identifying key SNP sites affecting the initiation of sexual maturity, reproductive axis development, and hormone levels, is crucial for accelerating the genetic improvement of broiler reproductive performance.

[0003] Currently, accurate determination of ASM (Age-Solving Performance) in broiler chickens mainly relies on continuous observation and recording of flock egg production performance. This method is time-consuming (requiring waiting for the chickens to naturally begin laying eggs), suffers from significant data collection lag, and is easily affected by environmental factors (such as lighting regimes and nutritional levels) and individual differences within the flock, resulting in large phenotypic data variability and making it difficult to achieve accurate and efficient assessment of large-scale flocks. These limitations severely restrict the efficiency of ASM-based early selection.

[0004] Therefore, developing high-throughput genomic selection technology based on ASM-related SNP molecular markers to enable breeder chickens to accurately screen individuals with early maturation potential based on genotype before sexual maturity is a key strategy to break through existing bottlenecks, optimize the reproductive efficiency of broiler chickens, shorten generation intervals, and ultimately improve the overall benefits of the industry, and has profound breeding application value. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide an SNP marker related to the age at first laying of chickens and its application.

[0006] The technical solution of this invention is as follows: This invention first provides a SNP marker associated with the age at first egg production in chickens. The SNP marker is located at 3298230 bp on chromosome 27 of chicken, with a reference genome version of GRCg7b, and exhibits G / A polymorphism. Individuals with the AA genotype selected at this location have an earlier age at first egg production than those with other genotypes.

[0007] The present invention also provides the application of the SNP marker in the assisted breeding of chickens with the age at first laying trait.

[0008] Secondly, the present invention provides a primer pair for detecting the SNP marker, the nucleotide sequences of which are shown in SEQ ID No. 1 and SEQ ID No. 2.

[0009] And a kit for detecting the SNP marker, comprising the primer pair.

[0010] Subsequently, the present invention provides the application of the primer pair or the kit described herein in the assisted breeding of chickens with the trait of laying age.

[0011] Furthermore, the chicken includes broiler chickens.

[0012] Finally, the present invention provides a method for using the aforementioned SNP markers to assist in the breeding of chickens with a shortened age at first laying, comprising the following steps: (1) Extract genomic DNA from the chickens to be tested; (2) Using the genome obtained in step (1) as a template, amplification was performed using primers as shown in SEQ ID No. 1 and SEQ ID No. 2, and finally the size of the product fragments was detected by agarose gel electrophoresis; (3) Sequencing the amplified fragments to obtain the genotypes of the SNP sites, and selecting individuals with the AA genotype at the 3298230th nucleotide site on chromosome 27 of chickens as superior breed chickens.

[0013] Compared with the prior art, the present invention has the following beneficial effects: The SNP markers of this invention can be applied to the selection of superior breeding chickens. In this population, by preferentially selecting individuals with the AA allele, the age at which the chickens begin laying can be significantly shortened, which has great economic application value. Attached Figure Description

[0014] Figure 1 shows the results of a genome-wide association study (GWAS), illustrating the association between each genetic variant and the trait. The horizontal axis represents chromosomes (Chr), and the vertical axis represents the negative logarithm (p-value) of the association strength between each genetic variant and the trait. 10 The p-value (p) is used to measure the correlation between the variance point and the trait under study. The smaller the p-value, the stronger the correlation; the larger the negative logarithm p-value.

[0015] Figure 2 shows the distribution of observed P-values ​​versus the distribution of expected P-values ​​under the null hypothesis. If the observed P-value distribution is the same as the expected distribution, it indicates no statistically significant association. The X-axis shows the expected -log 10 (p) value, the Y-axis shows the observed -log 10 (p) value.

[0016] Figure 3 shows the phenotypic distribution of age at labor for samples with three different genotypes (G / G, G / A, and A / A) in Example 1. The horizontal axis represents the three genotypes, and the vertical axis represents the phenotypic distribution of age at labor. The solid black line in the middle of the box represents the median, and the points in the diamond shape within the box represent the mean of each group.

[0017] Figure 4 This is a phenotypic distribution of age at labor for samples with three different genotypes: G / G, G / A, and A / A, as shown in Example 3. Detailed Implementation

[0018] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were all purchased from commercial channels.

[0019] Example 1: Genome-wide association analysis of age at labor phenotype 1. Test materials Blood or tissue was collected from the broiler flock, ensuring the samples were uncontaminated and labeled with a number. The age at which each hen laid its first egg was determined and recorded.

[0020] 2. Test Methods 2.1 Phenotypic determination The age at first egg phenotype was determined, and the age at which each hen laid its first egg was recorded.

[0021] 2.2 Chicken whole-genome SNP genotyping method based on low-depth resequencing technology The sequencing data was aligned to a reference genome (GRCg7b version) using the FPGA-accelerated GTX-one computing platform and BWA alignment software. BaseVar was used for variant detection to identify polymorphic SNPs and their population frequencies from low-depth population data, with a filter condition of DP > 1.5 IQR. Finally, parameter-free imputation was performed using STITCH, resulting in 10,984,458 SNPs.

[0022] 2.3 Genome-wide association analysis Genome-wide association analysis was performed on the age-to-laying phenotypes of 9879 chickens using a GCTA mixed linear model.

[0023] 2.4 SNP loci significantly associated with age at labor The detection of significant loci at the genomic level was performed based on the condition that FDR < 0.05.

[0024] 3. Results and Analysis This invention used 9879 broiler chickens as subjects and obtained 10,984,458 SNPs using low-depth resequencing technology. GWAS analysis was performed on the age at first laying trait of chickens, identifying a SNP locus significantly associated with this trait. This SNP locus is located at 3298230 bp on chromosome 27. The alleles at this locus are G and A, with three genotypes: G / G, G / A, and A / A. This SNP locus is located downstream of the GIP gene, with a p-value of 7.32661e-08. The allele substitution effect of the mutant locus A relative to the reference locus G was -1.05035 days. The mean age at first laying for the G / G genotype samples was 185.40 ± 8.8 days, for the G / A genotype samples it was 184.32 ± 9.4 days, and for the A / A genotype samples it was 183.14 ± 10.3 days. Figure 1 , Figure 2 , Figure 3 ).

[0025] Example 2 Detection of SNP molecular markers 1. Design and synthesize amplification primers based on the upstream and downstream sequences of the SNP site: F: GCTGTTCCCTTCCTTTTGA (SEQ ID No. 1) R: TGTTTGCTGGCAAACTCCTC (SEQ ID No. 2) 2. Blood tissue was collected from broiler chickens, and DNA was extracted using the total DNA extraction kit from Beijing Tiangen Biotech Co., Ltd. The extracted DNA was then measured using a NanoDrop 2000 spectrophotometer to determine its OD value. 260 / OD 280 and OD 260 / OD 230 The ratio determines the concentration and purity of DNA, and the integrity of DNA is detected by agarose gel electrophoresis.

[0026] 3. Using the broiler genome as a template, amplification was performed using primers shown in SEQ ID No. 1 and SEQ ID No. 2. The reaction system was as follows: 95℃, pre-mutation for 3 min; 95℃, mutation for 15 s, 60℃, annealing for 15 s, 72℃, extension for 15 s, 30 cycles; 72℃, complete extension for 5 min. Finally, agarose gel electrophoresis was used to detect the product fragment size, and the accurately amplified fragment was recovered.

[0027] 4. Sequencing the amplified fragments to obtain the genotypes of the SNP sites.

[0028] Example 3: Validation of SNP molecular markers The genomes of 2126 white-feathered broiler chickens with records of their age at first laying were amplified. The primers, conditions, and system used for amplification were the same as in Example 2. After sequencing the amplified fragments, the genotypes of the SNP loci were obtained.

[0029] The results are as follows Figure 4 As shown, there were 141 samples with the G / G genotype at this locus, with an average age at first laying of 187.04±6.0 days; 758 samples with the G / A genotype, with an average age at first laying of 186.65±6.2 days; and 1227 samples with the A / A genotype, with an average age at first laying of 185.48±6.2 days. The age at first laying of the AA genotype was earlier than that of the AG and GG genotypes, proving that mutations at this locus can advance the age at first laying in chickens. In breeding, chickens with the dominant AA allele can be preferentially selected, as they will begin laying earlier.

Claims

1. A SNP marker associated with the age at first laying trait in chickens, characterized in that: The SNP marker is located at 3298230 bp on chicken chromosome 27, with a reference genome version of GRCg7b. It exhibits G / A polymorphism, and individuals with the AA genotype at this location have an earlier age of egg onset than those with other genotypes.

2. The application of the SNP marker as described in claim 1 in the assisted breeding of chickens with the trait of laying age.

3. A primer pair for detecting the SNP marker as described in claim 1, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID No. 1 and SEQ ID No.

2.

4. A kit for detecting the SNP marker as described in claim 1, characterized in that: Includes the primer pair as described in claim 3.

5. The application of the primer pair as described in claim 3 or the kit as described in claim 4 in the assisted breeding of chickens with the trait of laying age.

6. The application according to claim 5, characterized in that: The chickens mentioned include broiler chickens.

7. A method for shortening the age at first laying of chickens using SNP marker-assisted breeding as described in claim 1, characterized in that: Includes the following steps: (1) Extract genomic DNA from the chickens to be tested; (2) Using the genome obtained in step (1) as a template, amplification was performed using primers as shown in SEQ ID No. 1 and SEQ ID No. 2, and finally the size of the product fragments was detected by agarose gel electrophoresis; (3) Sequencing the amplified fragments to obtain the genotypes of the SNP sites, and selecting individuals with the AA genotype at the 3298230th nucleotide site on chromosome 27 of chickens as superior breed chickens.