A non-destructive detection method for grouper nervous necrosis virus based on correlation between water body virus load and fish tissue virus load

By concentrating the virus in water and combining it with a water-fish viral load model, the invasiveness of detecting grouper nerve necrosis virus has been solved, enabling non-destructive and low-cost early warning and dynamic monitoring, applicable to grouper and other aquaculture species.

CN122168732APending Publication Date: 2026-06-09HAINAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HAINAN UNIV
Filing Date
2026-02-06
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing methods for detecting grouper nerve necrosis virus rely on live animal sampling, which is traumatic, costly, and cannot be used for high-frequency monitoring, thus failing to achieve early warning and dynamic monitoring.

Method used

By optimizing the concentration conditions of neuronecrosis virus in aquaculture water, FeCl3 flocculation and polyethersulfone membrane filtration were used to concentrate the virus from water samples. Combined with a water-fish virus load correlation model, the infection status of fish was indirectly assessed, and a non-destructive detection method was established.

Benefits of technology

It achieves non-destructive, low-cost, and high-frequency virus monitoring, and can capture infection signals in the early stages of virus infection, provide early warning and reduce aquaculture costs. It is suitable for early warning and dynamic monitoring of grouper and other aquaculture species.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a kind of based on water body virus load and fish body tissue virus load correlation grouper nervous necrosis virus nondestructive testing method.The method is through optimizing the concentration condition of virus in aquaculture water, realize the efficient concentration and quantification of water body virus load, then combine water-water aquaculture animal virus load correlation model, indirectly and nondestructively assess the virus infection state of aquaculture animal.The application detects water environment instead of detecting animals itself, realizes nondestructive, dynamic, early warning monitoring of the health status of aquaculture animal population, with the advantages of low cost, simple operation, frequent implementation, etc., and has important application value in aquatic disease prevention and control, good seed selection and biological safety management.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of aquaculture disease detection technology, specifically relating to a non-destructive detection method for grouper nerve necrosis virus based on the correlation between viral load in water and viral load in fish tissue. Background Technology

[0002] As a marine aquaculture fish of high economic value in China and even globally, the healthy development of the grouper industry has long been seriously threatened by various diseases. Among them, viral nerve necrosis (VNN) caused by Nervous Necrosis Virus (NNV) is one of the most serious diseases, especially in the fry and juvenile stages of grouper, with extremely high morbidity and mortality rates, which can reach 100%, causing huge economic losses to aquaculture farmers.

[0003] Currently, detection techniques for neuronecrosis virus (NSV) are mainly divided into traditional methods and modern molecular biology techniques. Traditional methods, such as histopathological observation, require dissecting fish to prepare pathological sections, which is cumbersome and time-consuming. Modern molecular biology techniques, especially real-time quantitative PCR (RT-qPCR), although possessing extremely high sensitivity and specificity and capable of accurately quantifying viral load, still require obtaining tissue samples from fish, such as brain tissue or eyeballs of fry, or gonadal tissue of parent fish.

[0004] However, all existing mainstream detection methods, regardless of their technical principles, face a common and insurmountable drawback—destructive testing. The sampling process inevitably causes irreversible mechanical damage to the individual animals being tested, ranging from stress, reduced immunity, and secondary infections to direct death. For valuable broodstock (such as those used for SPF, i.e., specific pathogen-free parent fish), destructive testing is unacceptable. For large-scale fry or commercial fish farming, random sampling not only suffers from insufficient representativeness but also significantly increases farming costs and mortality rates with frequent sampling. Therefore, farmers often only confirm an outbreak when obvious clinical symptoms are observed or large-scale mortality occurs, by which time the optimal window for prevention and control has been missed, resulting in irreparable losses. Therefore, the market and industry urgently need a new, non-invasive, and non-destructive virus monitoring technology that can perform health assessments of the entire farmed population at low cost and high frequency, enabling early disease detection and risk warning, thereby guiding farmers to take timely and precise prevention and control measures.

[0005] Studies have shown that many aquatic pathogens (including viruses) are released into the surrounding aquatic environment after infecting a host through excrement, secretions, or the decomposition of dead individuals. This means that aquaculture water may contain "nucleic acid molecules" that reflect the health status of farmed animal populations. However, effectively capturing these trace viral signals from the complex aquatic environment and accurately correlating them with the infection levels of host animals has remained a technical challenge that has yet to be effectively solved in this field. Summary of the Invention

[0006] This invention aims to address the technical problems of existing fish virus detection methods, particularly those for detecting grouper nerve necrosis virus, which rely on live animal sampling, causing trauma, high costs, and preventing high-frequency monitoring. To solve this problem and overcome the shortcomings of existing technologies, this invention leverages the fact that nerve necrosis virus can spread horizontally between fish in water. By optimizing the concentration conditions of nerve necrosis virus in aquaculture water, it achieves efficient concentration and quantification of viral load in the water. Combined with a water-fish viral load correlation model, it indirectly and non-destructively assesses the nerve necrosis virus infection status in fish, thereby solving the problems of invasive sampling, high detection costs, and the inability to achieve early warning and dynamic monitoring in existing detection technologies.

[0007] This invention first protects a method for detecting the viral load of a target virus in a water sample, which may include the following steps:

[0008] (1) Add FeCl3 to the water sample to be tested for flocculation, and then filter the flocculated water sample with a polyethersulfone membrane and collect the concentrate on the filter membrane, i.e. virus concentrate; (2) After completing step (1), release the viral nucleic acid from the viral concentrate to obtain the recovered sample; (3) Detect the target viral load in the recovered sample, and then obtain the target viral load in the water sample to be tested.

[0009] In the above method, in step (1), the concentration of FeCl3 as a flocculant is 0.8-1.2 mg / L (such as 0.8-1.0 mg / L, 1.0-1.2 mg / L, 0.8 mg / L, 1.0 mg / L or 1.2 mg / L).

[0010] In the above method, in step (1), the flocculation conditions are 280-320 rpm (e.g., 280-300 rpm, 300-320 rpm, 280 rpm, 300 rpm or 320 rpm) and stirring for 0.5-1.5 h (e.g., 0.5-1.0 h, 1.0-1.5 h, 0.5 h, 1.0 h or 1.5 h).

[0011] In the above method, in step (1), the pore size of the polyethersulfone membrane can specifically be 0.80 μm.

[0012] In the above method, step (2) can be used to release viral nucleic acid from the viral concentrate by adding lysis buffer and / or steel balls to the viral concentrate, followed by grinding and crushing.

[0013] The lysis buffer can be an RNA lysis buffer.

[0014] The grinding and crushing can be performed using a high-throughput tissue grinder.

[0015] The above method may also include a step of identifying the target virus, which can be performed after step (2) and before step (3). The step of identifying the target virus may be as follows: using the cDNA of the recovered sample as a template, PCR amplification is performed using primer pairs for amplifying the target virus-specific sequence to obtain PCR amplification products; then the following determination is made: if the PCR amplification products contain the target virus-specific sequence, then the water sample to be tested contains the target virus; otherwise, the water sample to be tested does not contain the target virus. If the water sample to be tested contains the target virus, then the quantitative step of step (3) is performed.

[0016] In the above method, step (3), the step of detecting the target viral load in the recovered sample, can be performed as follows: (a1) Insert the target virus-specific DNA fragment into the vector to obtain the recombinant vector; (a2) Real-time quantitative PCR was performed using dilutions of recombinant vectors at different concentrations as templates to obtain CT values; (a3) Plot a standard curve with the copy number or log number of the target virus in the recombinant vector as the x-axis and the CT value as the y-axis; (a4) Use the cDNA of the recovered sample as a template to perform real-time quantitative PCR and obtain the CT value; substitute the CT value into the standard curve plotted in step (a3) ​​to obtain the target viral load in the recovered sample.

[0017] In any of the methods described above, the water sample to be tested can be an aquaculture water sample. Further, the aquaculture water sample can be water from adult fish farming, fish fry rearing, or water from other aquaculture species. Further, the other aquaculture species can be shrimp or shellfish.

[0018] In any of the methods described above, the target virus may be a virus that can be horizontally transmitted between aquaculture animals in the aquaculture water. The virus that can be horizontally transmitted between aquaculture animals in the aquaculture water may be a nerve necrosis virus. Further, the nerve necrosis virus may be a red-spotted grouper nerve necrosis virus.

[0019] In any of the methods described above, when the target virus is red-spotted grouper neuronecrosis virus, the recombinant vector can be a recombinant plasmid obtained by cloning the second-round PCR amplification product with the nucleotide sequence shown in SEQ ID No. 1 into the pMD19-T vector. When performing real-time fluorescence quantification, the primers used can be primer RNA2 FOR: 5'-CAACTGACARCGAHCACAC-3' and primer RNA2 REV: 5'-CCCACCAYTTGGCVAC-3', and the probe can be a TaqMan probe: 5'-6FAM-TYCARGCRACTCGTGGTGCVG-BHQ1-3'. The standard curve can be y = -2.5191x + 39.942, R0 2 =0.9902.

[0020] The application of any of the methods described above in monitoring the viral infection status of aquatic animals also falls within the scope of protection of this invention.

[0021] In the above applications, the virus can be a virus that can spread horizontally among aquatic animals in the aquaculture water. Further, the virus that can spread horizontally among aquatic animals in the aquaculture water can be a nerve necrosis virus. Further, the nerve necrosis virus can be a red-spotted grouper nerve necrosis virus.

[0022] In the above applications, the aquaculture animals can be fish, shrimp, or shellfish. Furthermore, the fish can be grouper or red grouper.

[0023] This invention also protects a method for non-destructively monitoring the infection status of a target virus in aquaculture animals, which may include the following steps: S1. Take a sample of the aquaculture water where the aquatic animals are located, and then use any of the methods described above to detect the target virus load in the aquaculture water. S2. Input the target virus load in the aquaculture water into the trained artificial intelligence model to obtain the target virus load in the tissues of aquaculture animals as the output value, and monitor the target virus infection status of aquaculture animals based on the output value. The artificial intelligence model was obtained through multiple linear regression analysis of the weight, length, viral load in tissues of aquatic animals infected with the target virus, and viral load in aquaculture water. The viral load in aquaculture water was the dependent variable, and the weight, length, and viral load in tissues of aquatic animals infected with the target virus were the independent variables.

[0024] In the above method, inputting the target viral load in the aquaculture water into the trained artificial intelligence model can specifically mean inputting the target viral load in the aquaculture water, the weight and length of the aquaculture animals into the trained artificial intelligence model.

[0025] In the above method, the target viral load in the tissues of aquaculture animals can specifically be the target viral load in the brain and eye tissues of aquaculture animals.

[0026] In the above method, the aquatic animals can be fish, shrimp, or shellfish. Furthermore, the fish can be grouper or red grouper.

[0027] In the above method, further, the target virus can be a virus that can be horizontally transmitted between aquaculture animals in the aquaculture water. Further, the virus that can be horizontally transmitted between aquaculture animals in the aquaculture water can be a nerve necrosis virus. Further, the nerve necrosis virus can be the nerve necrosis virus of the red-spotted grouper.

[0028] In the above method, the aquaculture water body can further be water for adult fish rearing, water for fish fry raising, or water for other aquaculture species. Further, other aquaculture species can be shrimp or shellfish.

[0029] The methods or applications described above are for non-disease diagnosis and treatment. Because monitoring can be performed frequently and at low cost, these methods or applications can be used for early warning in aquaculture, detecting infection signals through minute changes in viral load in the water at the initial stage of viral infection, before aquatic animals show clinical symptoms.

[0030] This invention also protects a data processing device for non-destructive monitoring of the target virus infection status of aquaculture animals. The data processing device for non-destructive monitoring of the target virus infection status of aquaculture animals may include a memory, a processor, and a computer program stored in the memory. The processor executes the computer program to perform the following steps: P1, Data Reception: Receiving the target virus load in the aquaculture water where the aquaculture animals are located, obtaining sample data; P2, Data Processing: Inputting the sample data into a trained artificial intelligence model, obtaining the target virus load in the tissues of the aquaculture animals as the output value, and monitoring the target virus infection status of the aquaculture animals based on the output value; the artificial intelligence model is obtained through multiple linear regression analysis using the weight, length, target virus load in the tissues of the aquaculture animals infected with the target virus, and the target virus load in the aquaculture water; wherein the target virus load in the aquaculture water is the dependent variable, and the weight, length, and target virus load in the tissues of the aquaculture animals infected with the target virus are the independent variables.

[0031] In the aforementioned data processing device, the phrase "receiving the target viral load in the aquaculture water where the aquaculture animals are located and obtaining sample data" can specifically refer to receiving the target viral load in the aquaculture water where the aquaculture animals are located, the weight and length of the aquaculture animals, and obtaining sample data.

[0032] In the aforementioned data processing device, the target viral load in the aquaculture animal tissue can specifically be the target viral load in the brain and eye tissues of the aquaculture animal.

[0033] In the aforementioned data processing device, the aquatic animals can be fish, shrimp, or shellfish. Furthermore, the fish can be grouper or red grouper.

[0034] Furthermore, in the aforementioned data processing device, the target virus is a virus that can be horizontally transmitted between aquaculture animals in the aquaculture water. Furthermore, the virus that can be horizontally transmitted between aquaculture animals in the aquaculture water can be a nerve necrosis virus. Furthermore, the nerve necrosis virus can be a red-spotted grouper nerve necrosis virus.

[0035] In the aforementioned data processing device, the aquaculture water body can further be water for adult fish rearing, water for fish fry raising, or water for other aquaculture species. Further, other aquaculture species may be shrimp or shellfish.

[0036] In a specific embodiment, the data processing device is a computer device.

[0037] This application also provides a computer-readable storage medium.

[0038] The computer-readable storage medium provided in this application stores a computer program thereon, which, when executed by a processor, implements the steps of the method.

[0039] In some implementations, the computer-readable storage medium is "non-transitory" or "non-temporary".

[0040] This application also provides a computer program (product).

[0041] The computer program (product) provided in this application includes a computer program that, when executed by a processor, implements the steps of the method.

[0042] The computer program products mentioned above can be software products that primarily implement their solutions through computer programs.

[0043] The computer-readable storage medium refers to a carrier for storing data, which may be magnetic tape, disk, floppy disk, optical disk, magneto-optical disk, ROM, PROM, VCD, DVD, hard disk, flash memory, USB flash drive, CF card, SD card, MMC card, SM card, Memory Stick, or xD card, etc.

[0044] Those skilled in the art will understand that the steps of the present invention described above can be implemented using general-purpose computing devices. They can be centralized on a single computing device or distributed across a network of multiple computing devices. Optionally, they can be implemented using computer-executable program code, thereby storing them in a storage device for execution by a computing device. In some cases, the steps can be performed in a different order than described here, or they can be fabricated as separate integrated circuit modules, or multiple steps can be fabricated as a single integrated circuit module. Thus, the present invention is not limited to any particular combination of hardware and software.

[0045] The general-purpose computing device mentioned here typically includes a processor and a memory. The memory is used to store instructions, which, when executed by the processor, cause the computing device to perform "the steps of the present invention".

[0046] The aforementioned artificial intelligence model can specifically be the original modeling data accumulated through artificial infection experiments, which showed a large number of viral copy numbers in aquaculture water and fish tissue, and based on this data, a multiple linear regression model capable of quantitatively characterizing the correlation between viral load in water and fish was constructed. =40996.057+400.102X1+0.002X2+0.01X3+1777.580X4; where Let X1 be the copy number of RGNNV virus in the aquaculture water, X2 be the copy number of RGNNV virus in the fish eye tissue, X3 be the copy number of RGNNV virus in the fish brain tissue, and X4 be the fish body length. Therefore, by simply detecting the copy number of RGNNV virus in the aquaculture water and substituting it into this model, the copy number of RGNNV virus in fish body tissues (especially brain and eye tissues) can be indirectly estimated.

[0047] The present invention has the following advantages: (1) Non-destructive detection; the method provided by the present invention only requires the collection of aquaculture water in the entire detection process, completely avoiding any contact and harm to the aquaculture animals themselves, fundamentally solving the trauma problem of traditional detection methods; (2) Early warning; since monitoring can be carried out at high frequency and low cost, the present invention can capture infection signals through the slight changes in viral load in the water at the early stage of viral infection, before the aquaculture animals show clinical symptoms, greatly advancing the warning time point and winning valuable time for taking effective prevention and control measures; (3) Population representativeness; detecting aquaculture water samples is equivalent to conducting a "comprehensive sampling" of the virus in the entire aquaculture environment. The results of this invention can better reflect the average infection status of the entire aquaculture animal population, overcoming the representativeness bias problem of traditional small-batch sampling; (4) Low cost and easy operation; Compared with dissecting and sampling a large number of aquaculture animals, collecting water samples is simpler and faster, greatly reducing manpower and material costs, making routine monitoring possible both economically and operationally; (5) Wide application; The experimental principle of this invention is universal and is not only applicable to the detection of grouper nerve necrosis virus, but by replacing the detection target and adjusting the correlation model, its theory and process can be extended to the monitoring of other aquaculture species (such as shrimp and shellfish) and other viral or bacterial pathogens. Therefore, this invention abandons the traditional method of sampling that requires damaging the fish body, and innovatively assesses the infection status of fish indirectly by detecting the viral load in the aquaculture environment. Furthermore, this invention clarifies the optimal technical combination for concentrating RGNNV virus in aquaculture water—using FeCl3 as a flocculant in conjunction with a 0.8 μm polyethersulfone membrane for virus recovery, and establishes a corresponding enrichment and concentration process. This process is effective for RGNNV virus titers of 1 × 10⁻⁶. 3 -1×10 4 TCID 50 The virus recovery rate of spiked water samples was 58.98±4.56% at a concentration of 20.1 copies / mL, with a limit of detection of 20.1 copies / mL. This invention also established and validated a quantitative mathematical model relating the viral load of neuronecrosis virus in grouper tissues (especially brain tissue) to the viral load in aquaculture water, enabling quantitative prediction from environmental data to the state of organisms within the organism.

[0048] This invention achieves non-destructive, dynamic, and early warning monitoring of the health status of farmed animal populations by detecting the aquatic environment instead of the animals themselves. It has advantages such as low cost, simple operation, and frequent implementation, and has significant application value in aquatic disease control, breeding, and biosecurity management. The method provided by this invention has important application prospects. Attached Figure Description

[0049] Figure 1A standard curve is plotted using the copy number of neuronecrosis virus in the recombinant plasmid and its CT value.

[0050] Figure 2 This is a flowchart of a method for detecting viral load in water samples.

[0051] Figure 3 The viral copy number in fish tissues and aquaculture water in different groups (intraperitoneal injection method); H is the high concentration group, L is the low concentration group, and PBS is the control group; for P <0.05, for P <0.001.

[0052] Figure 4 The viral copy numbers in fish brain tissue, fish eye tissue, and culture water of different groups were measured using the immersion method. MN represents the fish brain and eye tissue of the medium concentration group, LN represents the fish brain and eye tissue of the low concentration group, PBS-N represents the fish brain and eye tissue of the control group, MW represents the culture water of the medium concentration group, LW represents the culture water of the low concentration group, and PBS-W represents the culture water of the control group. for P <0.01, for P <0.001.

[0053] Figure 5 The results show a comparison between the predicted and actual copy numbers of RGNNV in aquaculture water. Detailed Implementation

[0054] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0055] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0056] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0057] The preparation of artificial seawater in the following examples can be referred to the literature (Kester, DR, Duedall, IW, Connors, DN, & Pytkowicz, RM (1967). Preparation of Artificial Seawater. Limnology and Oceanography, 12(1), 176–179.), specifically as follows: 42.38g of sodium chloride, 7.1g of sodium sulfate, 1.2g of potassium chloride, 0.348g of sodium bicarbonate, 19.184g of magnesium chloride hexahydrate and 2.688g of calcium chloride were fully dissolved in 2000mL of ultrapure water. Then, 1mL of artificial seawater stock solution I and 1mL of artificial seawater stock solution II were added. After thorough mixing, the mixture was filtered using a 0.22μm microporous membrane. The filtered solution was then autoclaved at 121℃ for 20min to obtain artificial seawater. Artificial seawater mother liquor I: Dissolve 8.63g potassium bromide, 2.30g boric acid and 0.28g sodium fluoride in 100mL ultrapure water and store at 4℃.

[0058] Artificial seawater mother liquor II: Dissolve 2.18g of strontium chloride hexahydrate in 100mL of ultrapure water and store at 4℃.

[0059] Example 1: Establishment of a method for detecting viral load in aquaculture water This embodiment optimizes the concentration conditions of RGNNV in aquaculture water by comparing different flocculants, filter membrane types and pore sizes, and whether or not metal ion chelating agents are added. It obtains the optimal conditions for efficient and stable concentration of the virus from aquaculture water, and then establishes a method for detecting viral load in aquaculture water, providing technical support for the subsequent non-destructive detection of RGNNV.

[0060] I. Main Experimental Reagents and Consumables AlCl3 flocculant: Weigh 7.23g of aluminum chloride hexahydrate and dissolve it completely in 100mL of deionized water. Then filter it through a 0.22μm filter membrane to obtain an AlCl3 stock solution with a concentration of 0.3M. The AlCl3 stock solution is the AlCl3 flocculant.

[0061] FeCl3 flocculant: Weigh 4.83g of ferric chloride hexahydrate and dissolve it in 100mL of deionized water. Then filter it through a 0.22μm filter membrane to obtain a FeCl3 stock solution with a concentration of 1.0mg / L. The FeCl3 stock solution is the FeCl3 flocculant.

[0062] Medium-concentration spiked water: Take 500 μL of RGNNV virus solution (RGNNV virus titer is 1×10⁻⁶). 6 -1×10 7 TCID 50The RGNNV virus titer was diluted with 500 mL of artificial seawater to obtain medium-concentration spiked water; the RGNNV virus titer in the medium-concentration spiked water was 1 × 10⁻⁶. 3 -1×10 4 TCID 50 / mL.

[0063] Low-concentration spiking water: Take 5 mL of medium-concentration spiking water and dilute it with 500 mL of artificial seawater to obtain low-concentration spiking water; the RGNNV virus titer in the low-concentration spiking water is 1×10⁻⁶. 1 -1×10 2 TCID 50 / mL.

[0064] The filter membranes include polyethersulfone (PES) membranes and mixed cellulose ester (MCE) membranes. Both the mixed cellulose ester membrane and the PES membrane have a diameter of 47 mm and pore sizes of 0.22 μm, 0.45 μm, and 0.80 μm, respectively.

[0065] The red-spotted grouper nervous necrosis virus (RGNNV) was kindly provided by Professor Qin Qiwei of South China Agricultural University and is specifically described in the following literature: Wang Q, Liu Y, Zhang M, Yang M, Liang J, Zuo X, Wang S, Jia X, Zhao H, Jiang H, Lin Q, Qin Q. Slc43a2+ T cell metastasis from spleen to brain in RGNNV infected teleost. Sci China Life Sci. 2024 Apr;67(4):733-744. doi: 10.1007 / s11427-023-2473-x. The name of the red-spotted grouper nervous necrosis virus in the literature is RGNNV.

[0066] II. Experimental Methods 1. Flocculation and sedimentation RGNNV Add 50 μL of FeCl3 flocculant or 5 mL of AlCl3 flocculant to medium- or low-concentration spiked water, and stir magnetically at 300 rpm for 1 h to obtain concentrated virus water samples treated with different flocculants. Each group was set up with 3 replicates.

[0067] 2. Membrane filtration and sample preservation The virus-concentrated water sample obtained in step 1 was filtered using different types (MCE or PES) and pore sizes (0.22 μm, 0.45 μm or 0.80 μm). The virus concentrate on the filter membrane was collected and placed in an RNase-free centrifuge tube, flash-frozen in liquid nitrogen, and stored at -80°C.

[0068] 3. Mechanical grinding releases RGNNV Add RNA lysis buffer and 3 RNase-free steel beads to the virus concentrate obtained in step 2. For some samples, 0.2g of EDTA-2Na (metal ion chelating agent) also needs to be added. Then, the samples are broken up by a high-throughput tissue homogenizer (to release RGNNV nucleic acid) to obtain the recovered samples.

[0069] 4. Preparation of standard curves (1) Extract total RNA from RGNNV use Total RNA was extracted from RGNNV using a total RNA extraction kit. After extraction, the purity and concentration were measured using an ultra-micro spectrophotometer, and the RNA was stored at -80℃.

[0070] (2) cDNA synthesis Take the total RNA of RGNNV extracted in step (1), and use... II. Reverse transcription was performed using the 1st Strand cDNA Synthesis Kit (reaction program: incubation at 50℃ for 15 min, heating at 85℃ for 2 min) to obtain RGNNV cDNA, which was then stored at -20℃.

[0071] (3) PCR amplification of the capsid protein gene fragment of RGNNV Using the RGNNV cDNA obtained in step (2) as a template, the first round of PCR amplification was performed using primer pair consisting of primer NNV1: 5'-ACACTGGAGTTTGAAATTCA-3' and primer NNV2: 5'-GTCTTGTTGAAGTTGTCCCA-3', and the first round of PCR amplification product of about 610 bp was recovered.

[0072] Using the first-round PCR amplification product as a template, a second-round PCR amplification was performed using primer pairs consisting of NNV3: 5'-ATTGTGCCCCGCAAACAC-3' and NNV4: 5'-GACACGTTGACCACATCAGT-3', and approximately 255 bp of the second-round PCR amplification product was recovered.

[0073] The reaction program was as follows: pre-denaturation at 94℃ for 2 min; (94℃ for 30 s, 57℃ for 30 s, 72℃ for 45 s) for 35 cycles; extension at 72℃ for 10 min.

[0074] The nucleotide sequence of the second-round PCR amplification product is: AATGTGCCCCGCAAACACGGGCGGCGGTTACGTTGCTGGCTTCCTGCCTGATCCAACTGACAACGACCACACCTTCGACGCGCTTCAAGCAACTCGTGGTGCAGTCGTTGCCAAATGGTG GGAAAGCAGAACAGTCCGACCCCAGTACACCCGCACGCTCCTCTGGACCTCGTCGGGAAAGGAGCAGCGTCTCACGTCACCTGGTCGGCTGATACTCCTGTGTGTTGGCAACAACACTGATGTGGTCAACGTGTC (SEQ IDNo.1).

[0075] (4) Construction of recombinant plasmids and real-time quantitative PCR The second-round PCR product obtained in step (3) was cloned into the pMD19-T vector, positive clones were screened and recombinant plasmids were extracted. The recombinant plasmids were serially diluted to obtain dilutions of recombinant plasmids at different concentrations.

[0076] Using dilutions of recombinant plasmids at different concentrations as templates, The Universal U+ Probe MasterMix V2 kit was used for real-time quantitative PCR to obtain CT values. The primers used for real-time quantitative PCR were primer RNA2 FOR: 5'-CAACTGACARCGAHCACAC-3' and primer RNA2 REV: 5'-CCCACCAYTTGGCVAC-3', and the probe was a TaqMan probe: 5'-6FAM-TYCARGCRACTCGTGGTGCVG-BHQ1-3'.

[0077] The reaction program was: 37℃ for 2 min; 95℃ for 5 min; (95℃ for 10 s, 60℃ for 30 s) for 35 cycles.

[0078] The reaction system consisted of 20 μL of 10 μL 2×AceQ Universal U+ Probe Master Mix V2, 0.4 μL primer RNA2 FOR, 0.4 μL primer RNA2 REV, 0.2 μL TaqMan probe, 2 μL template, and 7 μL ddH2O.

[0079] A standard curve was plotted with the logarithm of the RGNNV copy number in the recombinant plasmid as the x-axis and the corresponding CT value as the y-axis.

[0080] 5. Obtaining the copy number of RGNNV in medium-concentration spiked water, low-concentration spiked water, and recovered samples. (1) Extract total RNA from the sample use The total RNA extraction kit extracts total RNA from samples (medium-concentration spiked water, low-concentration spiked water, or recovered samples). After extraction, the purity and concentration are detected by an ultra-micro spectrophotometer and stored at -80℃.

[0081] (2) cDNA synthesis Take the total RNA from the sample extracted in step (1), and use... II. Reverse transcription was performed using the 1st Strand cDNA Synthesis Kit to obtain the cDNA of the sample, which was then stored at -20°C.

[0082] (3) RT-qPCR Using the sample's cDNA as a template, The Universal U+ Probe Master Mix V2 kit was used for real-time quantitative PCR to obtain CT values. The primers used for real-time quantitative PCR were primer RNA2 FOR: 5'-CAACTGACARCGAHCACAC-3' and primer RNA2 REV: 5'-CCCACCAYTTGGCVAC-3', and the probe was a TaqMan probe: 5'-6FAM-TYCARGCRACTCGTGGTGCVG-BHQ1-3'.

[0083] (4) Detection of RGNNV copy number in the sample Substitute the CT value obtained in step (3) into the standard curve obtained in step 4 (as the y value in the equation) to obtain the RGNNV load in the sample (corresponding to the x value in the equation), that is, the RGNNV copy number in the sample.

[0084] 6. Data Statistics Two-way ANOVA was performed using GraphPad Prism software. p <0.05 indicates a statistically significant difference; the recovery rate is calculated using the following formula: Recovery rate (%) = (Number of RGNNV copies in recovered sample / Number of RGNNV copies in medium- or low-concentration spiked water) × 100% III. Experimental Results 1. The standard curve plotted with RGNNV copy number (x-axis) and CT value (y-axis) in the recombinant plasmid is shown below. Figure 1 Specifically, y = -2.5191x + 39.942, R 2 =0.9902.

[0085] 2. Optimal Concentrated Combination Scheme The recovery rates of eight combinations of medium- and low-concentration spiked water are compared in Table 1. The results show that the optimal concentration combination is FeCl3 flocculant + 0.80 μm PES + no EDTA-2Na added. Under this combination, the RGNNV recovery rate for medium-concentration spiked water reaches 58.98 ± 4.56%, and the RGNNV recovery rate for low-concentration spiked water reaches 6.49 ± 2.51%.

[0086] Table 1. RGNNV recovery rate (%) for different combination schemes

[0087] 3. Minimum detection limit Based on the standard curve y = -2.5191x + 39.942, R 2 =0.9902, and the calculated limit of detection for RGNNV in aquaculture water is 20.1 copies / mL.

[0088] 4. Based on the above results, a method for detecting viral load in water samples was finally established. The detailed flowchart is shown below. Figure 2 The specific steps of this method are as follows: (1) Sample collection Collect water samples, each with a volume of 500 mL, and place them in a sterile water collection bottle.

[0089] (2) Flocculation treatment A 1.0 mg / L FeCl3 aqueous solution was added to the water sample as a flocculant, and the sample was stirred at 300 rpm for 1 h using a constant temperature magnetic stirrer to promote the formation of flocs from virus particles and hydroxide.

[0090] (3) Membrane filtration The flocculated water sample was filtered using a polyethersulfone (PES) membrane with a diameter of 47 mm and a pore size of 0.80 μm. The virus concentrate on the filter membrane was collected, flash-frozen in liquid nitrogen, and stored at -80 °C for later use.

[0091] Virus concentrate is a concentration of viruses from water.

[0092] (4) Virus release The virus concentrate was placed in an RNase-free centrifuge tube, RNA lysis buffer was added, and three RNase-free steel balls were added. The mixture was then broken up using a high-throughput tissue homogenizer (to release viral nucleic acid) to obtain the recovered sample.

[0093] (5) RNA extraction use Total RNA was extracted and recovered from the samples using a total RNA extraction kit. The purity and concentration were then measured using an ultra-micro spectrophotometer and stored at -80°C.

[0094] (6) cDNA synthesis Take the total RNA from the recovered sample extracted in step (1), and use... II. Reverse transcription was performed using the 1st Strand cDNASynthesis Kit to obtain the cDNA from the recovered sample, which was then stored at -20°C.

[0095] (7) Qualitative detection Using the recovered cDNA as a template, PCR amplification was performed using primer pairs for amplifying the target viral sequence, yielding PCR amplification products. If the PCR amplification products contain the target viral sequence, the water sample contains the target virus; otherwise, the water sample does not contain the target virus.

[0096] (8) RT-qPCR quantitative detection Using the cDNA from the recovered sample as a template, The Universal U+ Probe Master Mix V2 kit was used for real-time quantitative PCR to obtain CT values.

[0097] A target virus-specific DNA fragment was inserted into a cloning vector to obtain a recombinant vector. Then, using different concentrations of diluted recombinant vector as templates, AceQ was employed. ® The Universal U+ Probe Master Mix V2 kit was used for real-time quantitative PCR to obtain the corresponding CT values.

[0098] Primers and probes used in real-time quantitative PCR are designed and synthesized based on the genome of the virus species being detected.

[0099] (9) Plot the standard curve of the target virus A standard curve is plotted with the logarithm of the viral copy number in the recombinant vector in step (8) as the x-axis and the corresponding CT value as the y-axis.

[0100] (10) Detection of viral load in water bodies Substitute the CT value of the recovered sample obtained in step (8) into the standard curve obtained in step (9) to obtain the viral load in the water (corresponding to the x value in the equation); then divide the viral load by the volume of the water sample to obtain the copy number of the virus in the water sample (copy number / mL), which is the viral load in the water sample.

[0101] In the above method, the virus can be a nerve necrosis virus. Specifically, the nerve necrosis virus can be the nerve necrosis virus of the red-spotted grouper.

[0102] When the virus is red-spotted grouper nerve necrosis virus, the primers used for real-time quantitative PCR are primer RNA2 FOR: 5'-CAACTGACARCGAHCACAC-3' and primer RNA2 REV: 5'-CCCACCAYTTGGCVAC-3', and the probe is the TaqMan probe: 5'-6FAM-TYCARGCRACTCGTGGTGCVG-BHQ1-3'.

[0103] In the above method, the water sample can be an aquaculture water sample. Specifically, the aquaculture water sample can be water used for adult fish farming, water used for raising fish fry, or water used for other aquaculture species (such as shrimp and shellfish).

[0104] Example 2: Construction and Validation of a Correlation Model between Grouper Tissue and Nerve Necrosis Virus Load in Aquaculture Water This embodiment is based on the positive correlation between the viral load of nerve necrosis virus in grouper tissue and aquaculture water. Matching data is obtained through artificial infection, a multiple linear regression model is constructed, and the applicability of the model is evaluated in a factory aquaculture environment. Ultimately, the goal of non-destructive detection is achieved by detecting the viral load in aquaculture water to indirectly monitor the infection status of fish.

[0105] I. Main Experimental Reagents and Consumables FeCl3 flocculant: Weigh 4.83g of ferric chloride hexahydrate and dissolve it in 100mL of deionized water. Then filter it through a 0.22μm filter membrane to obtain a FeCl3 stock solution with a concentration of 1.0mg / L. The FeCl3 stock solution is the FeCl3 flocculant.

[0106] 1×PBS buffer: Weigh 8g sodium chloride, 0.2g sodium dihydrogen phosphate, 1.44g disodium hydrogen phosphate, and 0.2g potassium chloride, add deionized water to dissolve completely and bring the volume to 1000mL.

[0107] Pearl Giant Grouper. Adults: 9-10 cm in length, approximately 25 g in weight. Fry: 4-5 cm in length, approximately 0.6 g in weight.

[0108] Eastern Star Grouper. Adult: Approximately 13 cm in length. Fry: Approximately 4 cm in length.

[0109] II. Experimental Methods 1. Grouper farming and management Breeding setup: 240 adult pearl grouper and 200 fry were raised in batches in 9 107 L tanks and temporarily kept in filtered seawater for more than two weeks.

[0110] Aquaculture conditions: The water temperature is kept constant at 28-30℃. Feed suitable feed at 8:00 and 17:00 every day. Change 1 / 2 of the water every three days. Clean the bottom sediment daily. Regularly test the nitrite and ammonia nitrogen content to ensure water quality stability. Use a 180 W aerator pump for continuous oxygenation throughout the process.

[0111] 2. Artificial infection (1) Intraperitoneal injection method (for adult fish) Grouping: Adult pearl grouper were randomly divided into a high-concentration group, a low-concentration group, and a control group, with 5 fish in each group and 3 replicates per group.

[0112] High-concentration RGNNV virus solution: RGNNV virus titer is 1×10 6 -1×10 7 TCID 50 / mL.

[0113] Low-concentration RGNNV virus solution was obtained by diluting high-concentration RGNNV virus solution with seawater. The RGNNV virus titer of the low-concentration RGNNV virus solution was 1×10⁻⁶. 1 -1×10 2 TCID 50 / mL.

[0114] Infection and Sampling: Each fish in the high-concentration group was injected intraperitoneally with 0.1 mL of high-concentration RGNNV virus solution, each fish in the low-concentration group was injected intraperitoneally with 0.1 mL of low-concentration RGNNV virus solution, and each fish in the control group was injected with 0.1 mL of 1×PBS buffer. After injection, one surviving fish was randomly selected from each group each day for dissection and observation of phenotypes and clinical symptoms of the brain, liver, kidneys, heart, and spleen. Brain tissue and eye tissue were also obtained, weighed, flash-frozen in liquid nitrogen, and then RNA lysis buffer was added. The samples were then ground using a high-throughput tissue homogenizer to obtain ground samples.

[0115] (2) Soaking method (for adult fish and fry) Grouping: Pearl grouper fry were randomly divided into a medium-concentration group, a low-concentration group, and a control group, with 20 fish in each group and 3 replicates per group. Adult pearl grouper were also randomly divided into a medium-concentration group, a low-concentration group, and a control group, with 20 fish in each group and 3 replicates per group.

[0116] A medium-concentration RGNNV virus solution was obtained by diluting a high-concentration RGNNV virus solution with seawater. The RGNNV virus titer of the medium-concentration RGNNV virus solution was 1×10⁻⁶. 3 -1×10 4 TCID 50 / mL.

[0117] Low-concentration RGNNV virus solution was obtained by diluting a medium-concentration RGNNV virus solution with seawater. The RGNNV virus titer of the low-concentration RGNNV virus solution was 1×10⁻⁶. 1 -1×10 2 TCID 50 / mL.

[0118] Infection and Sampling: The medium concentration group was soaked in a medium concentration RGNNV virus solution for 2 hours, the low concentration group was soaked in a low concentration RGNNV virus solution for 2 hours, and the control group was soaked in 1×PBS buffer for 2 hours. After soaking, the fish were rinsed with seawater. Samples were taken every 12 hours for the first 3 days of the experiment, and then every 24 hours thereafter. Two live fish were randomly selected from each group each time. The brain, liver, kidney, heart, spleen and other phenotypes and clinical symptoms were observed. Brain tissue and eye tissue were also obtained. After weighing, the samples were flash-frozen in liquid nitrogen and then RNA lysis buffer was added. The samples were then ground using a high-throughput tissue homogenizer to obtain ground samples.

[0119] 3. Nucleic acid extraction and detection (1) RNA extraction use Total RNA was extracted from the ground sample obtained in step 2 using the total RNA extraction kit. The purity and concentration were then measured using a micro spectrophotometer, and the sample was stored at -80°C. The total RNA from the ground sample is the total RNA from fish tissue, specifically fish brain and fish eye tissue.

[0120] Following the method in steps 3 of Example 1 (4(1)-(4)), the water sample was replaced with aquaculture water, while all other steps remained unchanged, resulting in a recovered sample. Then, the following was used... Total RNA was extracted and recovered from the samples using a total RNA extraction kit. The purity and concentration were then measured using an ultra-micro spectrophotometer and stored at -80°C.

[0121] (2) cDNA synthesis Total RNA was extracted from fish tissue in step (1) and used... II. Reverse transcription was performed using the 1st Strand cDNA Synthesis Kit to obtain cDNA from fish tissue, which was then stored at -20°C.

[0122] Take the total RNA from the recovered sample extracted in step (1), and use... II. Reverse transcription was performed using the 1st Strand cDNASynthesis Kit to obtain the cDNA from the recovered sample, which was then stored at -20°C.

[0123] (3) RT-qPCR Using cDNA from recovered samples or cDNA from fish tissue as templates, Real-time quantitative PCR was performed using the Universal U+ ProbeMaster Mix V2 kit to obtain CT values. The primers used for real-time quantitative PCR were primer RNA2 FOR: 5'-CAACTGACARCGAHCACAC-3' and primer RNA2 REV: 5'-CCCACCAYTTGGCVAC-3', and the probe was a TaqMan probe: 5'-6FAM-TYCARGCRACTCGTGGTGCVG-BHQ1-3'. Three replicates were set up for each sample.

[0124] The reaction program was: 37℃ for 2 min; 95℃ for 5 min; (95℃ for 10 s, 60℃ for 30 s) for 35 cycles.

[0125] The reaction system consisted of 20 μL of 10 μL 2×AceQ Universal U+ Probe Master Mix V2, 0.4 μL primer RNA2 FOR, 0.4 μL primer RNA2 REV, 0.2 μL TaqMan probe, 2 μL template, and 7 μL ddH2O.

[0126] (4) Viral load detection Substituting the CT value obtained in step (3) into the standard curve obtained in step 3 of Example 1, the copy number of RGNNV virus in the aquaculture water, the copy number of RGNNV virus in the fish brain tissue, and the copy number of RGNNV virus in the fish eye tissue were calculated.

[0127] 4. Establishment of correlation model Variable setting: based on the copy number of RGNNV virus in the aquaculture water ( A multiple linear regression model was constructed with fish body tissue weight (X1), fish eye tissue copy number of RGNNV virus (X2), fish brain tissue copy number of RGNNV virus (X3), and fish body length (X4) as the dependent variable.

[0128] Model analysis: SPSS software was used for data processing. R² was used to evaluate the goodness of fit, F test was used to verify the overall significance of the model, T test was used to analyze the significance of the effects of independent variables, and VIF value was used to diagnose multicollinearity (VIF < 5 indicates no significant multicollinearity).

[0129] 5. Validation of the factory farming system model (1) Collection of aquaculture water samples Adult pearl grouper and red grouper and their culture water / seedling water were collected from a fish farm in Qionghai, Hainan (500mL / bottle for adult fish culture water and 500mL / bottle for fry seedling water).

[0130] (2) Concentration of aquaculture water samples and detection of RGNNV copy number Following the method in step 3 of Example 1, the water sample was replaced with an aquaculture water sample, while all other steps remained unchanged. The copy number of RGNNV in the aquaculture water (copy number / mL) was obtained, which is the actual value of RGNNV in the aquaculture water.

[0131] (3) Detection of RGNNV virus copy number in fish brain tissue and fish eye tissue Using cDNA from fish brain tissue or fish eye tissue as a template, Real-time quantitative PCR was performed using the Universal U+ ProbeMaster Mix V2 kit to obtain CT values. The primers used for real-time quantitative PCR were primer RNA2 FOR: 5'-CAACTGACARCGAHCACAC-3' and primer RNA2 REV: 5'-CCCACCAYTTGGCVAC-3', and the probe was a TaqMan probe: 5'-6FAM-TYCARGCRACTCGTGGTGCVG-BHQ1-3'. Three replicates were set up for each sample.

[0132] Then, the CT values ​​were substituted into the standard curve obtained in step 3 of Example 1, and the copy number of RGNNV virus in fish brain tissue and fish eye tissue was calculated.

[0133] (4) Model accuracy assessment Substitute the copy number of RGNNV virus in fish brain tissue and fish eye tissue obtained in step (3), as well as the weight of fish body tissue and the length of fish body, into the multiple linear regression model established in step 4 to obtain the copy number of RGNNV in the aquaculture water, i.e., the predicted value.

[0134] The accuracy of the model was then evaluated using the error rate (error rate = (predicted copy number of RGNNV in aquaculture water - actual copy number of RGNNV in aquaculture water) / actual copy number of RGNNV in aquaculture water × 100%).

[0135] III. Experimental Results 1. Histological and pathological examination Groupers infected with RGNNV exhibit typical clinical symptoms: discoloration or blackening of body color, cloudy / protruding eyes, abdominal swelling, and gill congestion. Behavioral symptoms include frantic swimming and swirling swimming. Some fish show anorexia and excrete white feces. Autopsy revealed that as the infection concentration increased, the brain tissue became red, swollen, and congested (compared to a milky white, well-defined structure in the control group), the liver became yellowish-brown and enlarged, and white spots appeared on the kidneys (suspected local necrosis). The degree of pathological damage to each organ was positively correlated with the RGNNV infection concentration.

[0136] 2. RGNNV horizontal propagation RT-qPCR assay showed (see) Figure 3 , P <0.05 indicates a significant difference). The highest viral copy number was observed in the high-concentration group, and the viral load in the aquaculture water was positively correlated with the viral load in the fish tissues, increasing with increasing infection dose. This suggests that RGNNV can be transmitted horizontally through water (infected fish release the virus through secretions / excrement). However, intraperitoneal injection resulted in the death of all fish in the high-concentration group within 3 days and the low-concentration group within 6 days, indicating stress-induced interference. Subsequent experiments used an immersion method.

[0137] 3. Correlation between virus load in fish tissues and aquaculture water Partial results of viral load in fish tissues are shown below. Figure 4 The results showed that the viral copy number in the fish brain and eye tissues of the medium concentration group was significantly higher than that in the low concentration group and the control group, and the viral copy number decreased as the immersion concentration decreased.

[0138] Results of viral load in aquaculture water are shown below Figure 4 The results showed that the viral copy number in the medium-concentration aquaculture water was significantly higher than that in the low-concentration group and the control group, and increased with increasing immersion concentration. Furthermore, the viral load in the aquaculture water was significantly positively correlated with the viral load in the fish tissues.

[0139] 4. Construction of the correlation model Using fish brain tissue, fish eye tissue obtained by immersion method, and the copy number of nerve necrosis virus in the culture water as modeling data, the model equation was obtained through multiple linear regression analysis. =40996.057+400.102X1+0.002X2+0.01X3+1777.580X4; where X1 represents the copy number of RGNNV virus in the aquaculture water, X2 represents the copy number of RGNNV virus in the fish eye tissue, X3 represents the copy number of RGNNV virus in the fish brain tissue, and X4 represents the fish body length.

[0140] Model evaluation: R² = 0.190, adjusted R² = 0.172; F = 10.213. p<0.05, the model is significant overall; only X3 (virus copy number in fish brain tissue) is significant. p <0.001 (significant effect), X1, X2, X4 p <0.05 (no significant effect); VIF of all independent variables <5, no significant multicollinearity.

[0141] Therefore, the above model uses the copy number of RGNNV virus in aquaculture water ( The model is constructed with RGNNV virus copy number (X3) in fish brain tissue as the dependent variable, and fish body tissue weight (X1), fish eye tissue RGNNV virus copy number (X2), and fish body length (X4) as related independent variables. Therefore, by simply detecting the RGNNV virus copy number in the aquaculture water and substituting it into this model, the RGNNV virus copy number in fish body tissue (especially fish brain and fish eye tissue) can be indirectly estimated.

[0142] 5. Model accuracy evaluation (modify according to the previous steps) The test results of 12 groups of aquaculture water samples are shown below. Figure 5 (The horizontal axis represents the sample name in the aquaculture water, and the vertical axis represents the copy number of RGNNV. OW represents the actual copy number of RGNNV in the aquaculture water, and SW represents the predicted copy number of RGNNV in the aquaculture water.) The results show that there is no significant difference between the predicted and actual copy numbers of RGNNV in the aquaculture water, resulting in a very low error rate. Therefore, the model established in this application has good reliability and applicability, and can monitor the degree of viral infection in fish tissues by detecting the viral load in the aquaculture water.

[0143] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for detecting the viral load of a target virus in a water sample, comprising the following steps: (1) Add FeCl3 to the water sample to be tested for flocculation, and then filter the flocculated water sample with a polyethersulfone membrane and collect the concentrate on the filter membrane, i.e. virus concentrate; (2) After completing step (1), release the viral nucleic acid from the viral concentrate to obtain the recovered sample; (3) Detect the target viral load in the recovered sample, and then obtain the target viral load in the water sample to be tested.

2. The method according to claim 1, characterized in that: In step (1), the concentration of FeCl3 as a flocculant is 0.8-1.2 mg / L; the flocculation conditions are stirring at 280-320 rpm for 0.5-1.5 h; and the pore size of the polyethersulfone membrane is 0.80 μm.

3. The method according to claim 1, characterized in that: In step (2), the method for releasing viral nucleic acid from the viral concentrate is to add lysis buffer and / or steel balls to the viral concentrate, followed by grinding and crushing.

4. The method according to claim 1, characterized in that: In step (3), the steps for detecting the target viral load in the recovered sample are as follows: (a1) Insert the target virus-specific DNA fragment into the vector to obtain the recombinant vector; (a2) Real-time quantitative PCR was performed using dilutions of recombinant vectors at different concentrations as templates to obtain CT values; (a3) Plot a standard curve with the copy number or log number of the target virus in the recombinant vector as the x-axis and the CT value as the y-axis; (a4) Use the cDNA of the recovered sample as a template to perform real-time quantitative PCR and obtain the CT value; substitute the CT value into the standard curve plotted in step (a3) ​​to obtain the target viral load in the recovered sample.

5. The method according to claim 1, characterized in that: The water sample to be tested is an aquaculture water sample; the target virus is a virus that can be horizontally transmitted between aquaculture animals in aquaculture water. Furthermore, the virus that can be horizontally transmitted between aquatic animals in the aquaculture water is a nerve necrosis virus; Furthermore, the nerve necrosis virus is the nerve necrosis virus of the red-spotted grouper; Furthermore, the aquaculture water sample is water used for adult fish farming, water used for raising fish fry, or water used for other aquaculture species; Furthermore, other farmed species include shrimp or shellfish.

6. The application of the method according to any one of claims 1 to 5 in monitoring the viral infection status of aquaculture animals; Furthermore, the virus is one that can be horizontally transmitted between aquaculture animals in the aquaculture water. Furthermore, the virus that can be horizontally transmitted between aquatic animals in the aquaculture water is a nerve necrosis virus; Furthermore, the nerve necrosis virus is the nerve necrosis virus of the red-spotted grouper; Furthermore, the aquatic animals being farmed are fish, shrimp, or shellfish; Furthermore, the fish in question is either a grouper or a red grouper.

7. A method for non-destructively monitoring the infection status of a target virus in farmed aquatic animals, comprising the following steps: S1. Take a sample of the aquaculture water where the aquatic animals are located, and then use the method described in any one of claims 1 to 5 to detect the target virus load in the aquaculture water. S2. Input the target virus load in the aquaculture water into the trained artificial intelligence model to obtain the target virus load in the tissues of aquaculture animals as the output value, and monitor the target virus infection status of aquaculture animals based on the output value. The artificial intelligence model was obtained through multiple linear regression analysis of the weight, length, viral load in tissues of aquatic animals infected with the target virus, and viral load in aquaculture water. The viral load in aquaculture water was the dependent variable, and the weight, length, and viral load in tissues of aquatic animals infected with the target virus were the independent variables. Furthermore, the aquatic animals being farmed are fish, shrimp, or shellfish; Furthermore, the fish in question is either a grouper or a red grouper; Furthermore, the target virus is a virus that can be horizontally transmitted between aquaculture animals in the aquaculture water. Furthermore, the virus that can be horizontally transmitted between aquatic animals in the aquaculture water is a nerve necrosis virus; Furthermore, the nerve necrosis virus is the nerve necrosis virus of the red-spotted grouper; Furthermore, the aquaculture water body is water for adult fish farming, water for raising fish fry, or water for other aquaculture species; Furthermore, other farmed species include shrimp or shellfish.

8. A data processing device for non-destructive monitoring of the infection status of a target virus in aquaculture animals, comprising a memory, a processor, and a computer program stored in the memory, wherein, The processor executes the computer program to perform the following steps: P1. Data reception: Receive the target virus load in the aquaculture water where the aquaculture animals are located to obtain sample data; P2. Data processing: The sample data is input into the trained artificial intelligence model to obtain the target virus load in the tissues of aquatic animals as the output value, and the target virus infection status of aquatic animals is monitored based on the output value. The artificial intelligence model was obtained through multiple linear regression analysis of the weight, length, viral load in tissues of aquatic animals infected with the target virus, and viral load in aquaculture water. The viral load in aquaculture water was the dependent variable, and the weight, length, and viral load in tissues of aquatic animals infected with the target virus were the independent variables. Furthermore, the aquatic animals being farmed are fish, shrimp, or shellfish; Furthermore, the fish in question is either a grouper or a red grouper; Furthermore, the target virus is a virus that can be horizontally transmitted between aquaculture animals in the aquaculture water. Furthermore, the virus that can be horizontally transmitted between aquatic animals in the aquaculture water is a nerve necrosis virus; Furthermore, the nerve necrosis virus is the nerve necrosis virus of the red-spotted grouper; Furthermore, the aquaculture water body is water for adult fish farming, water for raising fish fry, or water for other aquaculture species; Furthermore, other farmed species include shrimp or shellfish.

9. A computer-readable storage medium having a computer program stored thereon, which, when executed by a processor, implements the steps of the method of claim 7.

10. A computer program product comprising a computer program that, when executed by a processor, implements the steps of the method of claim 7.