Construction method of humanized sirpalpha immunodeficient mouse and application thereof in human immune reconstruction
By replacing the endogenous Sirpα gene with the human Sirpα gene in BALB/c mice, humanized Sirpα immunodeficient mice were constructed. This solved the problems of low chimerism rate and high GVHD in BRG mice during human cell transplantation, achieving efficient human cell implantation and stable expression, and enhancing the application potential for immune reconstitution and drug development.
Patent Information
- Application Number
- CN202610308974.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-13
- Publication Date
- 2026-06-19
AI Technical Summary
The existing immunodeficient BRG mice have problems such as low human cell chimerism rate and high incidence of GVHD in human cell transplantation, which limits their application in long-term experimental studies.
Using CRISPR/Cas9 gene editing technology, the Rag2 and IL2rg genes were knocked out in BALB/c mice, and the endogenous Sirpα gene in the mice was replaced with the full-length cDNA of the human Sirpα gene to construct humanized Sirpα immunodeficient mice. By specifically designing sgRNA and dsDNA templates, efficient targeted replacement and stable expression of human Sirpα protein were ensured.
It significantly improved the implantation efficiency and survival stability of human cells in mice, reduced the incidence of GVHD, enhanced the application value of humanized mice in immune reconstitution and drug development, with a human T cell chimerism rate of ≥25%, a GVHD incidence of ≤10%, and extended the experimental window period.
Smart Images

Figure CN122235233A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of medical experimental model construction technology, specifically relating to a humanized... Sirpα Methods for constructing immunodeficient mice and their application in human immune reconstitution. Background Technology
[0002] The development and application of immunodeficient mice represents a significant technological breakthrough in modern biomedicine, providing crucial experimental tools for research in oncology and immunology. The advent of the congenital athymic nude mouse marked the first application of an immunodeficient animal model, opening a new direction for immunodeficient mouse research. Subsequently, the successful breeding of severely combined immunodeficient (SCID) mice with dual T and B lymphocyte deletions further promoted the large-scale application of immunodeficient animal models in biomedical research. With the development of genetic engineering technology, researchers will... prkdc scid and IL2rg By combining gene mutations, mouse strains with a higher degree of immunodeficiency, including the combined absence of T, B, and NK cells and the presence of NSG and NOG cells, were successfully constructed. These immunodeficient mice can support human CD34. + The efficient implantation of hematopoietic stem cells and PBMCs provides a core carrier for the construction of mouse models for human immune system reconstruction, which has greatly promoted the development of research on humanized mice.
[0003] The applicant initially used BALB / c mice as a base and employed CRISPR / Cas9 gene editing technology to knock out... Rag2 Genes and IL2rg Genes were successfully used to obtain BRG immunodeficient mice with combined loss of T, B, and NK cells. Rag2 - / - IL2rg - / -BRG immunodeficient mice (Zhao Y, Liu P, Xin Z, Shi C, Bai Y, Sun X, Zhao Y, Wang X, Liu L, Zhao X, Chen Z, Zhang H. Biological characteristics of severe combined immunodeficient mice produced by CRISPR / Cas9-mediated rag2 and IL2rgmutation. Front Genet 2019, 10: 401.) have shown good application value in tumor xenotransplantation and human immune system reconstruction studies. However, similar to NSG and NOG immunodeficient mice, they are prone to graft-host disease (GVHD) after transplantation into PBMCs, which significantly shortens the experimental window and limits their application in long-term experimental studies.
[0004] Sirpα (CD172a) is a key "don't eat me" signaling receptor expressed on the surface of myeloid macrophages and dendritic cells. It inhibits macrophage phagocytosis by binding to its ligand CD47 on the target cell surface. It is worth noting that... Sirpα Binding to CD47 exhibits strict species specificity and is murine in origin. Sirpα It has extremely low affinity for human CD47. Based on these characteristics, when human CD34... + When hematopoietic stem cells or PBMCs are transplanted into immunodeficient mice, mouse macrophages cannot effectively recognize the CD47 signal on the surface of human cells, thus identifying the human cells as abnormal targets and engulfing and clearing them in large quantities. This process severely reduces the implantation efficiency and reconstructive effect of human cells in mice. Summary of the Invention
[0005] In order to overcome the shortcomings of the prior art, the purpose of this invention is to provide a humanized... Sirpα The method for constructing immunodeficient mice and their application in human immune reconstitution aims to solve the technical problems of low human cell chimerism and high incidence of GVHD in existing immunodeficient BRG mice during human cell transplantation.
[0006] To achieve the above objectives, the present invention employs the following technical solution: The first aspect of the present invention discloses a humanized Sirpα Methods for constructing immunodeficient mice, with Rag2 and IL2rgBALB / c mice with double gene knockout and impaired T, B, and NK lymphocyte immune function were used as the background strain. Through CRISPR / Cas9 gene editing technology, the endogenous... Sirpα Gene replacement to human Sirpα The full-length cDNA sequence of the gene was obtained and humanized. Sirpα Immunodeficient mice.
[0007] Preferably, the background strain of mice is derived from the BALB / c background. Rag2 - / - IL2rg - / - BRG immunodeficient mice.
[0008] Preferably, the human source Sirpα The GenBank accession number for the gene sequence is NM_001040023.1, or it may be a homologous functional sequence.
[0009] Preferably, the target site of the CRISPR / Cas9 gene editing technology is endogenous in mice. Sirpα The sequence between the start codon and the stop codon in the coding region of a gene.
[0010] Preferably, it includes the following steps: 1) In mice Sirpα sgRNA sequences targeting the 30 bp upstream and 30 bp downstream regions of the gene start codon ATG were designed. 2) dsDNA was designed and synthesized as a knock-in template based on the principle of homologous recombination. The knock-in template sequence includes a 5' homologous arm and a human... Sirpα Full-length CDS, WPRE elements, Poly A regulatory region, and 3' homologous arms of the gene; 3) Microinject the mixture of Cas9 mRNA, sgRNA obtained in step 1), and dsDNA obtained in step 2) into... Rag2 - / - IL2rg - / - From fertilized eggs of BRG immunodeficient mice, offspring mice were continuously mated after transplantation until homozygous mice were obtained, thus achieving humanization. Sirpα Immunodeficient mice.
[0011] More preferably, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.1, and the nucleotide sequence of the dsDNA is shown in SEQ ID NO.6.
[0012] Preferably, in step 3), the sgRNA is an oligonucleotide synthesized according to the sgRNA sequence and obtained by in vitro transcription.
[0013] Preferably, in step 3), the mass ratio of Cas9 mRNA, sgRNA, and dsDNA is 2:1:1.
[0014] A second aspect of the present invention discloses the humanized material obtained by the above-described construction method. Sirpα Immunodeficient mice.
[0015] Preferably, the humanization Sirpα Immunodeficient mice simultaneously meet the following characteristics: 1) Rag2 and IL2rg Double gene knockout leads to impaired T, B, and NK cell immune function. 2) Capable of stably expressing human sources Sirpα Gene.
[0016] A third aspect of this invention discloses the above-described construction method and humanization. Sirpα Application of immunodeficient mice in human immune reconstitution.
[0017] Preferably, the human immune reconstitution is for the development of immune-related drugs, evaluation of the efficacy of tumor immunotherapy, or construction of autoimmune disease models.
[0018] Preferably, the human immune cell reconstitution involves the use of human PBMCs or human CD34. + Hematopoietic stem cells were transplanted into the mice to achieve the implantation and proliferation of human immune cells.
[0019] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a humanized Sirpα Methods for constructing immunodeficient mice: 1) Selecting mice closely related to the occurrence of GVHD Sirpα Genes, through CRISPR / Cas9 technology, in human... Sirpα Replace mouse endogenous CDS gene sequence Sirpα Genes can more completely simulate Sirpα 1) Reaction with CD47; 2) Rag2 originating in the BALB / c background. - / - IL2rg - / - In BRG immunodeficient mice SirpαFull-length gene editing can solve Rag2 - / - IL2rg - / - BRG immunodeficient mice have low human immune reconstitution efficiency and are prone to GVHD; 3) Targeting humans and mice Sirpα Due to genetic characteristics, sgRNA and dsDNA were specially designed. The sgRNA can guide Cas9 mRNA to bind to... Sirpα The ATG region of the gene has high target specificity and can effectively reduce the risk of off-target effects; dsDNA template carriers Sirpα The full-length CDS and 3' regulatory sequence of the gene ensure its human-like expression in mice. Sirpα The protein possesses its native conformation and function; 4) The construction method is simple to operate and highly reproducible. This method can effectively improve the implantation efficiency and survival stability of human cells, significantly reduce the incidence of GVHD, and solve the problems of low human cell chimerism and high GVHD incidence in existing immunodeficient BRG mice in human cell transplantation. It enhances the application value of immunodeficient mice in human immune cell reconstruction, drug development, and other fields, and is of great significance for overcoming the technical bottleneck of existing BRG and other immunodeficient mice in the application of human immune system reconstruction. The humanized cells obtained by this method Sirpα Immunodeficient mice, compared with conventional immunodeficient mice, have the following advantages: (1) Immunodeficient characteristics: maintaining Rag2 - / - IL2rg - / - Background T, B and NK lymphocyte immune dysfunction provides a low immune rejection environment for xenogeneic cell transplantation; (2) humanization Sirpα Expression: mouse endogenous Sirpα Genes were sourced from humans Sirpα Full-length CDS replacement of the gene allows for stable expression of human-derived genes in mice. Sirp α Protein, solved the "mouse" problem Sirpα The species-specific problem of "low affinity for human CD47"; (3) Advantages of human cell transplantation: After transplantation of human PBMCs, human T cells can be efficiently reconstructed in mice, with a human T cell chimerism rate ≥25%, and the incidence of GVHD within 60 days after transplantation ≤10%, significantly prolonging the experimental window period. This humanized Sirpα Immunodeficient mice can be widely used for: (1) human immune cell reconstitution: through transplantation of human PBMCs or human CD34 +(1) Hematopoietic stem cells, to realize the implantation and proliferation of human immune cells in mice; (2) Biomedical research: including the development of immune-related drugs, evaluation of the effects of tumor immunotherapy, construction of autoimmune disease models, etc., to provide experimental carriers that are closer to the human immune environment for related research. Attached Figure Description
[0020] Figure 1 Humans and mice of the present invention Sirpα Amino acid sequence alignment diagram; Figure 2 This is a schematic diagram illustrating the construction of the sgRNA and template required for gene knock-in in this invention; Figure 3 This is a gel electrophoresis image of gene knock-in positive mice detected by PCR according to the present invention; wherein, M, Marker; 1, BRG immunodeficient mouse; 2, humanized hSirpα Immunodeficient mice; Figure 4 This is the Sanger sequencing map of the gene knock-in positive mouse of this invention; Figure 5 This is a diagram showing the Western blotting results of human Sirpα protein in this invention; from left to right, it represents two parallel experiments in BRG immunodeficient mice and humanized mice. hSirpα Two parallel experiments were conducted on immunodeficient mice. Figure 6 CD3 of the present invention + T cells and B220 + B cell flow cytometry results; the left side is the control group, and the right side is the knock-in group. Figure 7 CD3 of the present invention + T cells and Nkp46 + Flow cytometry results of NK cells; left side is control, right side is knock-in. Figure 8 This is a flow cytometry result of CD11b+F4 / 80+CD172a+ cells according to the present invention; wherein, the upper row is the control and the lower row is the knock-in. Figure 9 The present invention relates to CD45 in mice transplanted with human PBMCs. + CD3 + CD4 + CD3 + CD8 + Figure 1 shows the results of T cell flow cytometry detection and quantitative analysis; where A represents human CD45 in mouse peripheral blood. + T cell chimerism ratio, B is human CD3 + CD4 + and CD3 + CD8+ The chimerism rate of T cells, C represents the quantitative analysis result; Figure 10 This is a diagram showing the appearance of mice after transplantation of human PBMCs according to the present invention. Figure 11 HE staining results of liver, lung and spleen in mice after transplantation of human PBMCs according to the present invention; Figure 12 This is a survival curve of mice after transplantation of human PBMCs according to the present invention. Detailed Implementation
[0021] To enable those skilled in the art to understand the features and effects of the present invention, the following description and definitions are only general descriptions of the terms and expressions mentioned in the specification. Unless otherwise specified, all technical and scientific terms used herein have the ordinary meaning understood by those skilled in the art regarding the present invention, and in case of conflict, the definitions in this specification shall prevail.
[0022] The theories or mechanisms described and disclosed herein, whether right or wrong, should not in any way limit the scope of the invention, that is, the contents of the invention can be implemented without being limited by any particular theory or mechanism.
[0023] In this document, all features defined by numerical ranges or percentage ranges, such as numerical values, quantities, contents, and concentrations, are for the sake of brevity and convenience only. Accordingly, descriptions of numerical ranges or percentage ranges should be considered as covering and specifically disclosing all possible sub-ranges and individual numerical values (including integers and fractions) within those ranges.
[0024] In this article, unless otherwise specified, “contains,” “includes,” “containing,” “has,” or similar terms cover the meanings of “composed of” and “mainly composed of,” for example, “A contains a” covers the meanings of “A contains a and others” and “A contains only a.”
[0025] For the sake of brevity, not all possible combinations of the technical features in each implementation scheme or embodiment are described herein. Therefore, as long as there is no contradiction in the combination of these technical features, the technical features in each implementation scheme or embodiment can be combined arbitrarily, and all possible combinations should be considered within the scope of this specification.
[0026] The text uses Rag2 - / - IL2rg - / - BRG immunodeficient mice are used as a basis for... Rag2 and IL2rgBALB / c mice with double gene knockout and impaired T, B, and NK lymphocyte immune function were constructed according to the method reported by Zhao Y, Liu P, Xin Z, Shi C, Bai Y, Sun X, Zhao Y, Wang X, Liu L, Zhao X, Chen Z, Zhang H. Biological characteristics of severe combined immunodeficient mice produced by CRISPR / cas9-mediated rag2 and IL2rg mutation. Front Genet 2019, 10: 401.
[0027] This invention provides a humanized Sirpα Methods for constructing immunodeficient mice, with Rag2 and IL2rg Using BALB / c mice with double gene knockout and impaired T, B, and NK lymphocyte immune function as the background strain, endogenous mouse gene editing was achieved through CRISPR / Cas9 gene editing technology. Sirpα The complete humanization of genes involves the following steps: 1. sgRNA design and preparation: in mice Sirpα Targeting sgRNAs were designed near the gene start codon ATG, and the corresponding oligonucleotides were synthesized and then transcribed in vitro to obtain sgRNAs that could be used for microinjection. 2. Construction of dsDNA homologous recombination template: Based on the principle of homologous recombination, a template containing a 5' homologous arm (5'HA) and human DNA was synthesized. Sirpα The full-length CDS (GenBank accession number NM_001040023.1 or its homologous functional sequence), WPRE (Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element) element, PolyA regulatory region and dsDNA homologous recombination template of the 3' homologous arm (3'HA); 3. Microinjection and homozygous selection: A mixture of Cas9 mRNA, the above-mentioned sgRNA, and dsDNA homologous recombination template was microinjected into... Rag2 - / - IL2rg - / - The fertilized eggs of BRG immunodeficient mice were then transferred to recipient mice to obtain F0 generation knock-in mice; positive F0 generation mice and Rag2 - / - IL2rg - / - BRG immunodeficient mice were mated to obtain F1 generation mice; after interbreeding of F1 generation mice, homozygous humanized mice were selected. Sirpα Immunodeficient mice.
[0028] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading this description, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined in this application.
[0029] The following examples use instruments and equipment conventional in the art. Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. All raw materials used in the following examples are conventional commercially available products with specifications in the art, unless otherwise stated.
[0030] I. sgRNA Sequence Design and Synthesis 1. sgRNA sequence design Based on human and mouse data published in the GenBank database Sirpα Gene sequence characteristics were analyzed, and an in situ substitution strategy was employed to introduce endogenous genes from mice. Sirpα The coding sequence (CDS) of the gene was replaced with a human one. Sirpα The CDS sequence of the gene. Based on mice. [[ID=8,6]]Sirpα Gene sequence characteristics were determined by uploading 30 bp sequences upstream and downstream of the start codon ATG to the CRISPOR and CHOPCHOP websites for analysis of potential sgRNA sequences that could be used for gene knockout. Based on the analysis results, 20 bp sequences with high scores on both websites and GC content between 40% and 70% were selected as candidate sgRNAs and synthesized. The nucleotide sequences of the sgRNAs are shown in SEQ ID NO.1 in Table 1.
[0031] Table 1 Nucleotide sequence list Name Sequence (5'-3') Serial number sgRNA gccgggccggcgggctccat SEQ ID NO.1 T7 promoter TAATACGACTCACTATA SEQ ID NO.2 RNA scaffold GTTTTAGAGCTAGAAATAGC SEQ ID NO.3 sgRNA-F <![CDATA[ TAATACGACTCACTATA gggccgggccggcgggctccatGTTTTAGAGCTAGAAATAGC]]> SEQ ID NO.4 sgRNA-R AGCACCGACTCGGTGCCACT SEQ ID NO.5 dsDNA CCTACACACACGCTATTTTTGTACCATCACTCTCTCCTTCCTCTCCCCCTTCCCCCTGCATTTACTTCCTGCTTTTGCTATACCTCGGGGCCAGCTAGGAAAGATTTGGGCCCCTAGGACTCACGCCCACCCGGAGGCCGACCTTCGGCTTTGGGACACACAAGCAGGGCCTCTCGGGGAGGGGCAGAAAGCAAACCTCCCCGCCCCCTCCACTCTCCACCCTTGCAAGCTCCCCTGCCGCGGGCAGCCTCTTGCCCACTGGAGTCTAAGGACTGGCCGGGTGAGAGGCCGAGACCAGGGGGCGATCGGCCGCCACTTCCCCAGTCCACCTTAAGAGGACCAAGTAGCCAGCCCGCCGCGCCGACCTCAGAAAAACAAGTTTGCGCAAAGTGGTGCGCGGCCAGCCTCTGGGCAGAGGGAGCGGTGCTTCCACCGCCTGGCAGCCCTGCGCGCGGCGGCGCAGGTCCGAGCGGCTGGCGGGGACCCGCACGGGCAGAGCGGGCTCGCGCAGAGCCGAGGCGGGCGGCGCAGCTCGCGGGGCGCACTGGGGCGCGGGCGGGAAGGTGCGGGCGCGAGGAGGGGGCGCTCGGCCGGGCCGCCCTCGCGCTGGCCTCGCGACGGCTCCGCACAGCCCGCACTCGCTCTGCGAGCTGTCCCCGCTCGCGCTTGCTCTCCGATCTCCGTCCCCGCTCCCTCTCCCTCTTCCTCTCCCCCTCTTTCCTTCTCCCTCGCTATCCGCTCCCCCGCCCCCGTGCCTCTGGCTCTGCGCCTGGCTCCCTCGGGTCCGCTCCCCTTTCCCGCCGGCCTGGCCCGGCGTCACGCTCCCGGAGTCTCCCCGCTCGGCGGCGTCTCATTGTGGGAGGGGGTCAGATCACCCCGCCGGGCGGTGGCGCTGGGGGGCAGCGGAGGGGGAGGGGCCTTAGTCGTTCGCCCGCGCCGCCCGCCCGCCTGCCGAGCGCGCTCACCGCCGCTCTCCCTCCTTGCTCTGCAGCCGCGGCCC SEQ ID NO.6 atggagcccgccggcccggcccccggccgcctcgggccgctgctctgcctgctgctcgccgcgtcctgcgcctggtcaggagtggcgggtgaggaggagctgcaggtgattcagcctgacaagtccgtgttggttgcagctggagagacagccactctgcgctgcactgcgacctctctgatccctgtggggcccatccagtggttcagaggagctggaccaggccgggaattaatctacaatcaaaaagaaggccacttcccccgggtaacaactgtttcagacctcacaaagagaaacaacatggacttttccatccgcatcggtaacatcaccccagcagatgccggcacctactactgtgtgaagttccggaaagggagccccgatgacgtggagtttaagtctggagcaggcactgagctgtctgtgcgcgccaaaccctctgcccccgtggtatcgggccctgcggcgagggccacacctcagcacacagtgagcttcacctgcgagtcccacggcttctcacccagagacatcaccctgaaatggttcaaaaatgggaatgagctctcagacttccagaccaacgtggaccccgtaggagagagcgtgtcctacagcatccacagcacagccaaggtggtgctgacccgcgaggacgttcactctcaagtcatctgcgaggtggcccacgtcaccttgcagggggaccctcttcgtgggactgccaacttgtctgagaccatccgagttccacccaccttggaggttactcaacagcccgtgagggcagagaaccaggtgaatgtcacctgccaggtgaggaagttctacccccagagactacagctgacctggttggagaatggaaacgtgtcccggacagaaacggcctcaaccgttacagagaacaaggatggtacctacaactggatgagctggctcctggtgaatgtatctgcccacagggatgatgtgaagctcacctgccaggtggagcatgacgggcagccagcggtcagcaaaagccatgacctgaaggtctcagcccacccgaaggagcagggctcaaataccgccgctgagaacactggatctaatgaacggaacatctatattgtggtgggtgtggtgtgcaccttgctggtggccctactgatggcggccctctacctcgtccgaatcagacagaagaaagcccagggctccacttcttctacaaggttgcatgagcccgagaagaatgccagagaaataacacaggacacaaatgatatcacatatgcagacctgaacctgcccaaggggaagaagcctgctccccaggctgcggagcccaacaaccacacggagtatgccagcattcagaccagcccgcagcccgcgtcggaggacaccctcacctatgctgacctggacatggtccacctcaaccggacccccaagcagccggcccccaagcctgagccgtccttctcagagtacgccagcgtccaggtcccgaggaagtga <![CDATA[ cgtacgtaaaagcttatcgataatcaacctctggattacaaaatttgtgaaagat tgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaat gcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaa tcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtgg tgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtca gctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgcc gcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtgg tgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggat tctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttcct tcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcaga cgagtcggatctccctttgggccgcctccccgcatccgggcggccgcttcgagcagac atgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaat gctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaa taaacaagtt ]]> ATGGGGCTGTGGTCTGTACTAGGCCCCATCCCCACAAGTTTTCTTGTCCTACATGGAGTGGCCATGACGAGGACATCCAGCCAGCCAATCCTGTCCCCAGAAGGCCAGGTGGCACGGGTCCTAGGACCAGGGGTAAGGGTGGCCTTTGTCTTCCCTCCGTGGCTCTTCAACACCTCTTGGGCACCCACGTCCCCTTCTTCCGGAGGCTGGGTGTTGCAGAACCAGAGGGCGAACTGGAGAAAGCTGCCTGGAATCCAAGAAGTGTTGTGCCTCGGCCCATCACTCGTGGGTCTGGATCCTGGTCTTGGCAACCCCAGGTTGCGTCCTTGATGTTCCAGAGCTTGGTCTTCTGTGTGGAGAAGAGCTCACCATCTCTACCCAACTTGAGCTTTGGGACCAGACTCCCTTTAGATCAAACCGCCCCATCTGTGGAAGAACTACACCAGAAGTCAGCAAGTTTTCAGCCAACAGTGCTGGCCTCCCCACCTCCCAGGCTGACTAGCCCTGGGGAGAAGGAACCCTCTCCTCCTAGACCAGCAGAGACTCCCTGGGCATGTTCAGTGTGGCCCCACCTCCCTTCCAGTCCCAGCTTGCTTCCTCCAGCTAGCACTAACTCAGCAGCATCGCTCTGTGGACGCCTGTAAATTATTGAGAAATGTGAACTGTGCAGTCTTAAAGCTAAGGTGTTAGAAAATTTGATTTATGCTGTTTAGTTGTTGTTGGGTTTCTTTTCTTTTTAATTTCTTTTTCTTTTTTGATTTTTTTTCTTTCCCTTAAAACAACAGCAGCAGCATCTTGGCTCTTTGTCATGTGTTGAATGGTTGGGTCTTGTGAAGTCTGAGGTCTAACAGTTTATTGTCCTGGAAGGATTTTCTTACAGCAGAAACAGATTTTTTTCAAATTCCCAGAATCCTGAGGACCAAGAAGGATCCCTCAGCTGCTACTTCCAGCACCCAGCGTCACTGGGACGAACCAGGCCCTGTTCTTACAAGGCCACATG PCR upstream primer GGGAGGGGCCTTAGTCGT SEQ ID NO.7 PCR downstream primers CCAGCTCCTCTGAACCACTG SEQ ID NO.8 Note: In the sgRNA-F sequence, the underlined part represents the T7 promoter sequence, lowercase letters represent the sgRNA sequence, and uppercase letters represent the scaffold sequence; in the dsDNA sequence, uppercase letters represent 5'HA and 3'HA; lowercase letters represent human. Sirpα Gene CDS; Underline: Spacer sequence; Bold underline: WPRE sequence; Curved underline: SV40 PolyA.
[0032] 2. sgRNA synthesis During synthesis, a T7 promoter (nucleotide sequence shown in SEQ ID NO.2 in Table 1, 17 bp) was introduced into the sgRNA 5' end, and an RNA scaffold (nucleotide sequence shown in SEQ ID NO.3 in Table 1, 20 bp) sequence was introduced into the 3' end. Simultaneously, based on codon preference, two Gs were added before the sgRNA to improve transcription efficiency. This primer was then synthesized by Beijing Qingke Biotechnology Co., Ltd. and used as the upstream primer for sgRNA PCR amplification (sgRNA-F, nucleotide sequence shown in SEQ ID NO.4 in Table 1, 59 bp). In addition, based on the characteristics of the pX330 plasmid, a downstream primer for PCR amplification (sgRNA-R, nucleotide sequence shown in SEQ ID NO.5 in Table 1, 20 bp) was designed and synthesized.
[0033] II. In vitro transcription of sgRNA 1. PCR amplification and purification of sgRNA sequences Using pX330 plasmid (Addgene, #42230) as a template, PCR amplification was performed using sgRNA-F and sgRNA-R as upstream and downstream primers, respectively. The PCR reaction system is shown in Table 2, and the PCR reaction program is shown in Table 3. Table 2 PCR reaction system reagents Volume (μL) pX330 1 2×Taq MIX 20 sgRNA-F 2 sgRNA-R 2 <![CDATA[ddH2O]]> 25 Table 3 PCR reaction procedure
[0034] The PCR products were purified using the Tiangen DNA purification kit. After the adsorption column was equilibrated, the PCR products were added to the adsorption column, and the column was eluted twice with washing buffer. The purified DNA was collected from the adsorption column and quantified.
[0035] 2. In vitro transcription of sgRNA In vitro transcription of sgRNA was performed using the TranscriptAid T7 High Yield Transcription Kit (purchased from Thermo Fisher Scientific) following the instructions. The specific steps are as follows: Table 4 Reaction System
[0036] Prepare the reaction system according to Table 4. After mixing the components, incubate at 37°C for 2 h, and collect the sgRNA in vitro transcription product; use MEGAclear... TMPurification was performed according to the kit (purchased from Thermo Fisher Scientific) and its instructions: 20 μL of the transcript was added to 100 μL of Elution Solution, 350 μL of Binding Solution, and 250 μL of ethanol, mixed well, and slowly transferred to an elution column. The column was centrifuged at 12,000 rpm for 30 s, and the centrifuged liquid was discarded. Elution was performed twice with 500 μL of Wash Solution, followed by elution with 20 μL of preheated (95°C) Wash Solution. The eluent was collected, and quantification using NanoDrop yielded purified sgRNA. 1% agarose gel electrophoresis confirmed the sgRNA size to be approximately 120 bp, consistent with expectations. Quantitative analysis showed that sgRNA OD... 260 / OD 280 >1.8、OD 260 / OD 230 >2.3, with a content of 1.2 μg / μL, store at -80℃ until use.
[0037] III. dsDNA Design and Synthesis Humans and mice Sirpα The CDS lengths of the genes are 1515 bp and 1530 bp, respectively, encoding proteins of 505 and 510 amino acids. Blast alignment results showed 139 site differences in the protein sequences, with a sequence homology of only 70%. Figure 1 To overcome the impact of species differences on immune function research, dsDNA was designed as a knock-in template to replace mice in situ. Sirpα The gene, dsDNA, is 4276 bp in total length and contains a 5' HA and human-derived DNA sequence. Sirpα Gene CDS (GenBank accession number NM_001040023.1 or its homologous functional sequence), WPRE element, Poly A regulatory region and 3'HA dsDNA knock-in template (sequence characteristics see [link to template]). Figure 2 Both upstream and downstream HA sequences were designed to be 1000 bp, with the 5' HA sequence referencing mice. Sirpα The upstream endogenous genomic sequence of gene ATG, and the 3'HA referencing the downstream endogenous genomic sequence of gene ATG; in the recombinant fragment, human... Sirpα The gene is fused downstream with a WPRE element and an SV40 PolyA sequence (nucleotide sequence shown as SEQ ID NO. 6 in Table 1). This design can achieve humanization through homologous recombination. Sirpα In situ gene substitution simultaneously achieves stable expression of human genes and mouse endogenous genes. Sirpα Gene transcription and translation are silenced. After sequence design, dsDNA was synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0038] IV. Intrauterine Injection and Transfer of Fertilized Eggs 1. Obtaining fertilized eggs from BRG mice Select sexually mature females Rag2 - / - IL2rg - / - BRG immunodeficient mice were intraperitoneally injected with 5 units of pregnant mare serum gonadotropin (PMSG), followed by an intraperitoneal injection of 5 units of human chorionic gonadotropin (HCG) 48 hours later. Immediately afterward, they were bred with sexually mature males. Rag2 - / - IL2rg - / - BRG immunodeficient mice were caged together, and the mice with thrombi were sacrificed the next day. The fertilized oocytes of the mice were collected from the ampulla of the oviduct under a stereomicroscope.
[0039] 2. Microinjection 100 ng of Cas9 mRNA (purchased from Thermo Fisher Scientific), 50 ng of the sgRNA obtained in step two, and 50 ng of the dsDNA synthesized in step three were mixed thoroughly to obtain a Cas9 / sgRNA / dsDNA mixture. This Cas9 / sgRNA / dsDNA mixture was then injected into the Eppendorf NK2 microinjector. Rag2 - / - IL2rg - / - The cytoplasm of fertilized oocytes from BRG immunodeficient mice was injected, and the injected fertilized oocytes were cultured at 37°C and 5% CO2 for 24 h until they reached the 2-cell stage.
[0040] 3. Embryo transfer The 2-cell embryos obtained in step 2 were transplanted into pseudopregnant ICR recipient mice. After the embryos developed and were born, F0 generation mice were obtained for genotyping.
[0041] V. Humanized Mice Sirpα Genotyping and strain development of immunodeficient mice 1. Extraction of F0 mouse genomic DNA Genomic DNA was extracted from the F0 generation mice obtained in step 3 using a blood / tissue / cell genomic DNA extraction kit (purchased from Tiangen Biotech Co., Ltd.), with BRG immunodeficient mice used as a control. The specific method is as follows: 1) Cut off the tail tissue of F0 generation mice that are 7 days old, add 200 μL of GA solution and 20 μL of Proteinase K to the sample, and incubate at 56°C overnight until the tissue is lysed and digested; 2) Add 200 μL of GB solution to the lysis buffer, invert and mix well, and place at 70°C until the solution is clear; add 200 μL of anhydrous ethanol and shake to mix well; pour the mixture into the adsorption column, centrifuge at 12000 rpm for 30 s, and discard the waste liquid. 3) Add 500 μL GD to the adsorption column, centrifuge at 12000 rpm for 30 s, and discard the waste liquid; add 600 μL PW, centrifuge at 12000 rpm for 30 s, and elute twice consecutively. 4) Add 50 μL of TE elution buffer to the adsorption membrane of the adsorption column, let stand for 5 min, centrifuge at 12000 rpm for 30 s, and collect genomic DNA for identification.
[0042] 2. F0 mouse genome identification Use 2 Taq MIX (purchased from Takara) was used to amplify the corresponding gene fragment for sequencing analysis. The specific method is as follows: The primers required for PCR were synthesized by Beijing Qingke Biotechnology Co., Ltd. The nucleotide sequences of the upstream PCR primer are shown in SEQ ID NO.7 in Table 1, and the nucleotide sequences of the downstream PCR primer are shown in SEQ ID NO.8 in Table 1. The PCR reaction system is shown in Table 5, and the PCR reaction procedure is shown in Table 6. Table 5 Identification PCR Reaction System reagents Volume (μL) Genomic DNA 2 2×Taq MIX 20 upstream primer 2 Downstream primer 2 <![CDATA[ddH2O]]> 24 Table 6 Identification PCR Reaction Procedure
[0043] The PCR products were identified by 1% agarose gel electrophoresis. Figure 3 The genotypes of the F0 mice were analyzed using Sanger sequencing by Beijing Qingke Biotechnology Co., Ltd. Sequencing results showed that in the F0 mice... Sirpα Accurate insertion of the ATG gene after the codon into human Sirpα Gene CDS region ( Figure 4 Preliminary results indicate that the F0 mouse is humanized. hSirpα Immunodeficient mice (BRG-h) Sirp α Successfully constructed.
[0044] 3. Humanization hSirpα Breeding of Immunodeficient Homozygous Mice Positive F0 generation mice and Rag2 - / - IL2rg - / -BRG immunodeficient mice were mated to obtain F1 generation mice. Positive F1 generation mice were interbred and screened to obtain homozygous humanized mice. Sirpα Immunodeficient mice.
[0045] VI. Humanized Mice Sirpα Detection of protein expression Knock-in mice (humanized) hSirpα Immunodeficient mice (obtained by steps one through four) and control mice ( Rag - / - IL2rg - / - Spleens were harvested from BRG immunodeficient mice after dissection and homogenized thoroughly in RIPA lysis buffer. The homogenate was centrifuged at 12000 g for 15 min, and the supernatant was collected for protein quantification using the BCA method. 20 μg of protein sample was mixed with 5× SDS loading buffer, boiled at 100℃ for 10 min, and then loaded onto a 10% SDS-PAGE gel for electrophoresis. After electrophoresis, the protein was transferred to a PVDF membrane using a wet transfer method. The PVDF membrane was blocked with 5% skim milk at room temperature for 1 h. After elution, anti-human Sirpα antibody and secondary antibody were added, and protein expression was detected by ECL chemiluminescence. The results showed that human Sirpα protein expression was detectable in the spleens of knock-in mice, while almost no expression was observed in control mice. Figure 5 Based on the above results, humanization hSirpα Genes were not only precisely inserted into mice Sirpα Following the ATG codon, and with transcription and translation proceeding normally, it indicates humanization. hSirpα An immunodeficient mouse model has been successfully constructed.
[0046] VII. Flow cytometry detection of mouse peripheral blood T, B and NK cells Single-cell suspensions prepared from peripheral blood or bone marrow of EDTA-anticoagulated mice (knock-in mice or control mice) were lysed with pre-chilled erythrocyte lysis buffer. After cell elution, murine CD3-PE, B220-APC, and Nkp46-PerCP antibodies were added for staining at room temperature in the dark for 20 min. After washing and fixation, the cells were analyzed. The results showed that CD3-PE in the peripheral blood of knock-in mice was significantly higher than that in mice. + B220 + ( Figure 6 ) and Nkp46 + ( Figure 7 The number of cells was not significantly different from that of control mice, both remaining at extremely low levels, indicating a severe immunodeficiency state.
[0047] 8. Flow cytometry detection of human cells in myeloid cells Sirpα expression Single-cell suspensions prepared from peripheral blood or bone marrow of EDTA-anticoagulated mice (knock-in mice or control mice) were lysed with pre-chilled erythrocyte lysis buffer. After cell elution, murine CD11b-FITC, F4 / 80-PerCP, and CD172a-PE antibodies were added for staining at room temperature in the dark for 20 min. After washing and fixation, the cells were analyzed. The results of bone marrow myeloid cell detection showed significant differences; human CD172a cells were more abundant in the control mice. + The percentage of cells was extremely low, while knock-in mice were enriched with large amounts of human CD172a. + cell( Figure 8 The above results indicate that, compared with control mice, the knock-in mice exhibit a more widespread and severe immunodeficiency phenotype, with the deficiency extending not only to the lymphocyte lineage but also to the myeloid cell population.
[0048] IX. Human peripheral blood mononuclear cell (PBMC) transplantation 1 10 6 PBMCs were intravenously inoculated into control mice and knock-in mice, respectively. Three weeks later, peripheral blood was collected from the mice, and after erythropoiesis, human CD45-FITC, CD3-PerCP, CD4-APC, and CD8-PE antibodies were added and incubated at room temperature in the dark for 20 min. After elution, flow cytometry was used to detect the chimerism of human T cells in the mice. The results showed that human CD45-FITC antibodies were present in the peripheral blood of knock-in mice. + The chimerism rate of T cells was significantly higher in mice than in control mice. Figure 9 (A); Meanwhile, human CD3 was detectable in both types of mice. + CD4 + and CD3 + CD8 + T cells ( Figure 9 (B), quantitative analysis of human CD45 + The chimerism rate is much higher than the accepted standard of 25% ( Figure 9 The results (C) indicate that knock-in mice perform better in supporting human T cell regeneration and are a more ideal humanized model.
[0049] 10. GVHD Analysis After Human Immune Reconstitution After transplantation of PBMCs into mice (knock-in mice or control mice), their fur, foraging, and activity were observed every 2-3 days. After the observation period, the mice were sacrificed, and their spleen, lungs, liver, and other tissues were immediately fixed in 4% paraformaldehyde. The fixed tissue blocks were dehydrated in a gradient of ethanol, cleared with xylene, and then embedded in paraffin. The paraffin blocks were sliced into 4-5 μm thick sections using a microtome and attached to glass slides. For staining, the sections were first dewaxed to water, then the cell nuclei were stained with hematoxylin, and after blue staining, the cytoplasm was stained with eosin. After staining, the sections were dehydrated with ethanol, cleared with xylene, and finally mounted with neutral resin and observed under a light microscope. The results showed that some successfully reconstituted control mice exhibited obvious GVHD symptoms, specifically piloerection, lethargy, reduced activity, and significant weight loss. Some control mice also showed conjunctivitis. Figure 10 Pathological examination showed that the spleen, lungs, kidneys, and other organs of these control mice exhibited significant inflammatory infiltration and necrosis. Figure 11 Five weeks after inoculation, some control mice died due to severe GVHD. Knock-in mice, however, did not exhibit the aforementioned GVHD-related phenotypes, showed normal activity levels, and survived well. Figure 12 Compared with the control group, humanization after PBMC transplantation was achieved. Sirpα The incidence of GVHD in immunodeficient mice was ≤10%. These results indicate that in immunodeficient mice... Sirpα Humanization of genes can effectively reduce the risk of GVHD after human PBMC transplantation.
[0050] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of this invention.
Claims
1. A kind of humanization Sirpα A method for constructing immunodeficient mice, characterized in that, In Rag2 and IL2rg BALB / c mice with double gene knockout and T, B and NK lymphocyte immune dysfunction as background strains, the endogenous Sirpα genes of the background strain mice are replaced by the full-length cDNA sequence of human Sirpα genes by CRISPR / Cas9 gene editing technology, and humanized Sirpα immunodeficient mice are obtained.
2. A humanization method according to claim 1 Sirpα A method for constructing immunodeficient mice, characterized in that, The background strain mice are of BALB / c background Rag2 - / - IL2rg - / - BRG immunodeficient mice.
3. A humanization method according to claim 1 Sirpα A method for constructing immunodeficient mice, characterized in that, The human origin Sirpα GenBank Accession No. NM_001040023.1, or a functionally homologous sequence thereof.
4. A humanization method according to claim 1 Sirpα A method for constructing immunodeficient mice, characterized in that, The targeting site of the CRISPR / Cas9 gene editing technology is the sequence between the start codon and the stop codon of the coding region of the mouse endogenous Sirpα gene.
5. A humanized antibody according to claim 1, wherein the amino acid sequence of the light chain variable region is SEQ ID NO:
2. Sirpα A method for constructing an immunodeficient mouse, characterized by, Includes the following steps: 1) In mice Sirpα The sgRNA sequence targeting the 30 bp region upstream and downstream of the ATG start codon of the gene was designed, respectively; 2) design and synthesize dsDNA as knock-in template according to the principle of homologous recombination, the sequence of the knock-in template comprises 5' homologous arm, human Sirpα gene full-length CDS, WPRE element, Poly A regulatory region and 3' homologous arm; 3) Microinject the mixture of Cas9 mRNA, sgRNA obtained in step 1), and dsDNA obtained in step 2) into... Rag2 - / - IL2rg - / - From fertilized eggs of BRG immunodeficient mice, offspring mice were continuously mated after transplantation until homozygous mice were obtained, thus achieving humanization. Sirpα Immunodeficient mice.
6. A humanization method according to claim 5 Sirpα A method for constructing immunodeficient mice, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO.1, and the nucleotide sequence of the dsDNA is shown in SEQ ID NO.
6.
7. A humanization method according to claim 5 Sirpα A method for constructing immunodeficient mice, characterized in that, In step 3), the mass ratio of Cas9 mRNA, sgRNA, and dsDNA is 2:1:
1.
8. The humanized form obtained by the construction method according to any one of claims 1 to 7 Sirpα Immunodeficient mice.
9. The humanization according to claim 8 Sirpα Immunodeficient mice, characterized by, The humanization Sirpα Immunodeficient mice simultaneously meet the following characteristics: 1) Rag2 and IL2rg Double gene knockout leads to impaired T, B, and NK cell immune function. 2) Capable of stably expressing human sources Sirpα Gene.
10. The construction method according to any one of claims 1 to 7, or the humanization according to claim 8 or 9. Sirpα Application of immunodeficient mice in human immune reconstitution.