A protein for generating methyl anthranilate, an aroma component of tea leaves, and a gene and application thereof

By cloning the CsAAMT gene of tea trees and expressing its protein in Escherichia coli and tea leaves, methyl anthranilate was catalyzed to produce it, solving the problem of aroma component formation in tea trees and improving the stability and persistence of tea aroma.

CN122256285APending Publication Date: 2026-06-23TEA RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610182487.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-09
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

The lack of research on the key methyltransferase (AAMT) for the synthesis of methyl anthranilate in tea plants in the current technology makes it difficult to control the formation of methyl anthranilate, an aroma component of tea plants, and affects the stability and persistence of tea aroma.

Method used

By discovering and cloning the CsAAMT gene in tea plants, expressing the protein it encodes, purifying the recombinant protein in E. coli, catalyzing the formation of methyl anthranilate from S-adenosylmethionine and anthranilic acid, and transiently overexpressing the gene in tea leaves to enhance the release of tea aroma components.

Benefits of technology

This study achieves the efficient generation of methyl anthranilate in tea, improves the stability and persistence of the 'grape aroma' of tea, and provides a convenient and easy-to-operate method for producing this aroma component.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256285A_ABST
    Figure CN122256285A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological gene engineering, and particularly relates to a protein for generating methyl o-aminobenzoate, a gene thereof and application. S A protein for generating methyl o-aminobenzoate from adenosylmethionine and o-aminobenzoate, wherein the amino acid sequence of the protein is shown as SEQ ID NO. 2. The experiment of the application proves that methyl o-aminobenzoate methyltransferase CsAAMT is found in a new tea variety 'Zhongchaxiangning', the gene corresponding to the protein is expressed in Escherichia coli, and the purified recombinant protein has the activity of catalyzing S o-aminobenzoate from adenosylmethionine and o-aminobenzoate, and further, the tea leaves without the aroma component can release methyl o-aminobenzoate by transiently overexpressing the gene in tea leaves.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a protein that generates methyl anthranilate, a component of tea aroma, its gene, and its applications. Background Technology

[0002] Tea varieties with natural aroma characteristics provide a reliable foundation for producing green tea with stable and lasting aroma, making them particularly suitable for large-scale industrial production. After 12 years of single-plant identification and 4 years of sensory evaluation, we have cultivated a new tea variety, 'Zhongcha Xiangning'. The most prominent characteristic of this variety is its outstanding "grape" aroma. Figure 1 Through sensory comparison, GC-MS volatile component analysis, and aroma recombination experiments on 'Zhongcha Xiangning' tea, grape juice, grape-flavored beverages (jelly and milk tea), and fresh grapes, it was found that methyl anthranilate, a key volatile substance producing the "fox-like" aroma characteristic in grape-flavored beverages, is also a core aroma component of 'Zhongcha Xiangning' green tea. Sensory evaluation and aroma component addition experiments confirmed that methyl anthranilate is a key component of the unique "grape aroma" of 'Zhongcha Xiangning'. Previous studies have shown that plant-derived methyl anthranilate is produced using methyltransferases, such as in grapes and corn. Currently, no reports have been found regarding the key methyltransferase (AAMT) for the synthesis of methyl anthranilate in tea plants. Given that methyl anthranilate is a key component of the unique "grape aroma" of 'Zhongcha Xiangning', therefore, tea plants... CsAAMT The discovery of genes is of great significance for studying the formation of aroma components in tea trees and for breeding highly aromatic tea varieties. Summary of the Invention

[0003] To address the problems existing in the prior art, the purpose of this invention is to design and provide a protein that generates methyl anthranilate, a component of tea aroma, along with its gene and applications.

[0004] The present invention is specifically implemented using the following technical solutions: The first aspect of the present invention provides a catalyst S -Adenosylmethionine and anthranilic acid form a protein of methyl anthranilate, the amino acid sequence of which is shown in SEQ ID NO.2.

[0005] A second aspect of the present invention provides a gene for the protein, the nucleotide sequence of which is shown in SEQ ID NO. 1.

[0006] A third aspect of the present invention provides a recombinant vector containing the coding gene as described above.

[0007] The fourth aspect of the present invention provides the protein as described above in catalysis S - Application in the formation of anthranilic acid from S-adenosylmethionine and anthranilic acid.

[0008] The fifth aspect of this invention provides the role of the encoding gene in the synthesis of methyl anthranilate, an aroma component of tea.

[0009] The sixth aspect of the present invention provides a catalyst S A method for forming methyl anthranilate from S-adenosylmethionine and anthranilic acid includes the following steps: S.1. The coding gene was introduced into Escherichia coli, as shown in SEQ ID NO.1, and recombinant protein was obtained by inducing expression.

[0010] S.2. After desalting the recombinant protein, it is combined with... S Methyl anthranilate was obtained by catalysis of a mixture of S-adenosylmethionine and anthranilic acid solution.

[0011] S.3. Transient overexpression of the recombinant protein in tea leaves to synthesize methyl anthranilate.

[0012] Furthermore, the catalytic reaction conditions in step S.2 are as follows: [The text abruptly ends here, so the translation stops as well.] S A mixture of S-adenosylmethionine and anthranilic acid was added, along with Tris-HCl, NaCl, imidazole, β-mercaptoethanol, and glycerol. The pH of the reaction solution was 7.0-7.2, and the reaction temperature was 35-39 °C.

[0013] The optimal temperature described in this invention is 37 °C.

[0014] Furthermore, take 25 μM S A mixture of S-adenosylmethionine, 50 mM o-aminobenzoic acid, 50 mM Tris-HCl, 500 mM NaCl, 250 mM imidazole, 10 mM β-mercaptoethanol, and 10% glycerol was prepared, wherein the pH of the Tris-HCl was 7-8 and the pH of the imidazole was 7.5-8.5.

[0015] The optimal pH of Tris-HCl described in this invention is 7.5, and the pH of imidazole is 8.

[0016] Furthermore, the conditions for transient overexpression of protein CsAAMT in step S.3 are as follows: CsAAMT The condition for transient overexpression in tea leaf pieces is based on CsAAMT Specific primers, the nucleotide sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4, were used to analyze the expression time spectrum of protein CsAAMT in tea leaves by qRT-PCR, and methyl anthranilate was collected and analyzed by HS-SPME tandem GC-MS.

[0017] The present invention has the following beneficial effects: (1) Experiments of this invention have demonstrated that methyl anthranilate methyltransferase CsAAMT was found in the new tea variety 'Zhongcha Xiangning'. The gene corresponding to this protein was expressed in Escherichia coli, and the purified recombinant protein exhibited catalytic activity. S The activity of S-adenosylmethionine and anthranilic acid to generate methyl anthranilate was further demonstrated by transient overexpression of this gene in tea leaves, which could release methyl anthranilate from tea leaves lacking this aroma component.

[0018] (2) The protein CsAAMT catalysis provided by this invention S The method for forming methyl anthranilate from S-adenosylmethionine and anthranilic acid is convenient and easy to operate, which is conducive to its widespread use in production. Attached Figure Description

[0019] Figure 1 The gas chromatography-tandem mass spectrometry (GC-MS) spectrum of aroma components of 'Zhongcha Xiangning' is as follows: 1: citral; 2: n-Decanol; 3: indole; 4: tridecane; 5: methyl anthranilate; 6: hexanoic acid leaf ester; 7: cis-jasmone; 8: tetradecane.

[0020] Figure 2 for CsAAMT The gene sequence.

[0021] Figure 3 For different organizations CsAAMT Relative quantification results of gene qPCR.

[0022] Figure 4 This is the elution diagram for the target protein Line2.

[0023] Figure 5 Chromatograms of S-adenosylmethionine and anthranilic acid products catalyzed by recombinant CsAAMT protein; A: Chromatogram of products generated from anthranilic acid and S-adenosylmethionine catalyzed by CsAAMT; B: Chromatogram of products generated from anthranilic acid and S-adenosylmethionine with the addition of anthranilic acid methyl ester and S-adenosylmethionine in the empty vector.

[0024] Figure 6 for CsAAMT Transient overexpression detection and analysis in tea leaf petals; A: CsAAMT Transient overexpression changes in tea leaf petals; B: CsAAMT Analysis of changes in the content of methyl anthranilate in tea leaves after transient overexpression. Detailed Implementation

[0025] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.

[0026] Example 1: Collection and Analysis of Aroma Components of 'Zhongcha Xiangning' A sample of 'Zhongcha Xiangning' tea, consisting of one bud and two leaves, was collected, freeze-dried in liquid nitrogen, and ground into tea powder. 1.5 g of the tea powder was placed in a 20 mL headspace vial, an aqueous solution was added, the vial was capped, and the vial was placed in a 75 ℃ water bath with a solid-phase microextraction (SPME) head inserted for adsorption for 45 minutes. The SPME head was then inserted into the gas chromatography-tandem mass spectrometry (GC-MS) inlet to analyze the tea aroma components. The GC parameters used were as follows: inlet temperature = 250 ℃; carrier gas flow rate = 1.2 mL / min; column oven temperature program: 40 ℃ for 5 minutes, increased to 250 ℃ at 5 ℃ / min, held for 3 minutes, then increased to 280 ℃ at 10 ℃ / min, held for 3 minutes; ion acquisition scan range m / z = 40-440; ionization voltage... v =70 eV. The mass-to-nucleus ratio and retention time of the o-amino standard and the compound in the sample were compared using the NIST 14.0 database to identify the target compound. Methyl anthranilate was prepared into concentration gradients of 10 ppm, 50 ppm, 100 ppm, and 500 ppm to plot a standard curve. The absolute content of methyl anthranilate in the sample was calculated using the standard curve. Figure 1 ).

[0027] Example 2: Gene Cloning Using one bud and two leaves of 'Zhongcha Xiangning' tea as material, total RNA was extracted using a kit method; according to CsAAMT Primers were designed based on the mRNA sequence of the coding sequence, and the full length of the gene was obtained by reverse transcription PCR and sequenced for verification. CsAAMT The primers used for gene cloning included CsAAMT_R1, with nucleotide sequences SEQ ID NO. 5 and 6, respectively. CsAAMT_F1 (SEQ ID NO.5): 5′-ATGGTGGTCCAAAATGTTCTTCACATGA-3′; CsAAMT_R1 (SEQ ID NO.6): 5′-TTACTTCTTCGACAATGAAACGACGATA -3′; 'Chinese Tea Fragrance' CsAAMT The gene sequence is shown in SEQ ID NO.1, and the protein sequence obtained by its translation is shown in SEQ ID NO.2 (as shown in SEQ ID NO.2). Figure 2 ).

[0028] Example 3: Real-time fluorescence quantitative analysis Quantitative real-time PCR was performed using an ABI 7500 real-time PCR system (Applied Biosystems) labeled with SYBR Green dye. The internal control gene was selected from tea plants. GAPDH Gene (GE651107). The primer sequences used are SEQ ID NO.7-10: CsAAMT _F (SEQ ID NO. 7): 5'-TACAGCAAGTTGAAGGAAGA-3'.

[0029] CsAAMT _R (SEQ ID NO. 8): 5'-CCAATGGAGACTAGAAGAGG-3'.

[0030] GAPDH -F (SEQ ID NO. 9): 5'-TTGGCATCGTTGAGGGTCT-3'.

[0031] GAPDH-R (SEQ ID NO. 10): 5'-CAGTGGGAACACGGAAAGC-3'.

[0032] The reaction system consisted of 20 mL of LATaq, 4 mL of PCR buffer, 1.6 mL of dNTPs (2.5 mM), 0.5 mL of primers (10 M), 1 mL of cDNA (40 ng), and 11.4 mL of ddH2O. The reaction conditions were: 94 ℃ for 3 min; 95 ℃ for 30 s; 59 ℃ for 30 s; 72 ℃ for 1 min; 35 cycles; 72 ℃ for 10 min; and the program was stopped at 4 ℃. Each sample was tested in triplicate. Figure 3 As shown, 'Zhongcha Xiangning' CsAAMT The gene is highly expressed in one bud and two leaves, but its expression level is low in mature leaves, petioles, and other tissues, indicating that... CsAAMT The gene is specifically expressed in the tender shoots of 'Zhongcha Xiangning' tea, but not in mature leaves.

[0033] Example 4: Recombinant Expression and Purification of CsAAMT Protein 'Chinese Tea Fragrance' CsAAMT The coding frame of the full-length cDNA was cloned into the prokaryotic expression vector pET32a containing the T7 promoter. Specific steps included: designing specific primers: the forward primer nucleotide sequence was SEQ ID NO.3 (5'-gacaaggccatggctgatatc(EcoR V)ATGGTGGTCCAAAATGTTCTTCACGGGATCC); the reverse primer nucleotide sequence was SEQ ID NO.4 (5'-ttgtcgacggagctcgaattc(EcoR I)TTACTTCTTCGACAATGAAACGACG); expression vector construction: PCR amplification... CsAAMT After extraction and purification using phenol, phenol / chloroform (1:1), and chloroform / isoamyl alcohol (24:1), the gene was double-digested with EcoR V and EcoR I, and a fragment of approximately 1200 bp was separated and recovered by low-melting-point gel electrophoresis. The recovered fragment was then ligated into the prokaryotic expression vector pET32a, which had undergone the same double-digestion, thereby enabling the gene to express its genetic material. CsAAMT The gene was directionally cloned into the prokaryotic expression vector pET32a, and the recombinant plasmid containing the insert fragment was named... CsAAMT -pET32a will recombinant plasmid CsAAMT -pET32a conversion to E In *E. coli* BL21, engineered bacteria were constructed; IPTG was used to induce expression of the target protein and desalting: single colonies of the engineered bacteria verified by DNA sequencing were picked and inoculated into 5 mL of LB medium containing ampicillin (50 μg / mL), and cultured overnight at 37 ℃ with shaking. 50 μL of the inoculum was then inoculated into 50 mL of LB medium containing ampicillin (50 μg / mL), and cultured at 37 ℃ with shaking until OD (dose eluent) was reached. 600 =0.6-0.8, add IPTG to a final concentration of 0.05 mmol / L, and induce expression at 18 ℃ for 12-18 h. Collect bacterial cells by centrifugation at 5000 r / min for 15 min at low temperature. Use cell lysis buffer (50 mM Tris-HCl [pH 7.5], containing 5 mM sodium ascorbate, 0.5 mM benzyl sulfonyl fluoride, 5 mM dithiothreitol, 10% [ v / v [Glycerol] was used to remove residual culture medium and suspended bacterial cells from the cells. The cells were sonicated on ice and the supernatant was obtained by centrifugation at 12000 r / min. The supernatant was then prepared using 10 mL of reaction buffer (50 mM Tris-HCl [pH 7.5], 100 mM KCl, 5 mM β-mercaptoethanol, 10% [ v / vAfter the buffer solution has completely drained from the desalting column, add 3 mL of the cell lysis supernatant to the desalting column, discarding the first 3 mL. When no more liquid flows out of the desalting column, add 3 mL of analysis buffer to elute and obtain the target protein Line2. Figure 4 .

[0034] Example 5: Verification of the activity of methyl anthranilate formation Add 100 μL of crude protein solution to 90 μL of reaction buffer, and add 25 µM of substrate ( S The mixture was prepared with S-adenosylmethionine (-adenosylmethionine, anthranilic acid), thoroughly mixed, and incubated in a water bath at 37 °C for 1 h. After the reaction was complete, the chromatographic vial was rapidly frozen in ice for 5 min. An SPME (solid-phase microextraction) adsorption column was then inserted into the vial, and adsorption was performed for 30 min. The catalytic products were analyzed using GC-MS. Enzymatic analysis of the catalytic products showed that CsAAMT can... S The methyl group on S-adenosylmethionine is transferred to the carboxyl group of anthranilic acid to form methyl anthranilate. Figure 5 ). Methyl anthranilate produced by CsAAMT catalysis is the methyl anthranilate in the aroma of one bud and two leaves of 'Zhongcha Xiangning' tea. Figure 5 A and Figure 5 B).

[0035] Example 6: CsAAMT Catalysis S Method for forming methyl anthranilate from S-adenosylmethionine and anthranilic acid S.1. The encoding gene was introduced into E. coli and induced to express the recombinant protein CsAAMT; S.2. After desalting recombinant protein CsAAMT, it is combined with... S - A mixture of S-adenosylmethionine and anthranilic acid solution was used as a catalyst to yield methyl anthranilate. The catalytic reaction conditions for CsAAMT were 25 μM. S - Adenosylmethionine and 50 mM o-aminobenzoic acid, 50 mM Tris-HCl (pH 7.5), 500 mM NaCl, 250 mM imidazole (pH 8.0), 10 mM β-mercaptoethanol, 10% (v / v) glycerol, the reaction solution pH is: pH=7.0-7.2, the reaction temperature is 37 ℃.

[0036] S.3. CsAAMT The condition for transient overexpression in tea leaf pieces is based on... CsAAMT Specific primers were analyzed by qRT-PCR. CsAAMT The expression time spectrum of methyl anthranilate in tea leaves was obtained, and methyl anthranilate was collected and analyzed by HS-SPME tandem GC-MS.

[0037] CsAAMT Overexpression analysis: CsAAMT Homologous recombination via double enzyme digestion was performed and the enzyme digestion sites are as follows: CsAAMT_C1300_XbaI_F (SEQ ID NO.11): atcgactctagaATGGTGGTCCAAAATGTTCTTCA; CsAAMT_C1300_XbaI_R (SEQ ID NO. 12): gtccattctagaTTACTTCTTCGACAATGAAACGACG.

[0038] CsAAMT was transiently overexpressed in tea leaves according to the following procedure: ① Take 2 μL CsAAMT Add the _C1300 plasmid to 200 μL of competent Agrobacterium (GV31001 strain), incubate on ice for 30 min, freeze in liquid nitrogen for 5 min, incubate in water at 37 ℃ for 5 min, and then incubate on ice for 2 min. ② Add 800 μL of YEB medium (LB without antibiotics), and incubate at 28 ℃, 200 rpm, and in the dark for 4-5 hours; ③ Spread 200 μL of bacterial suspension onto LB agar plates (centrifuge, pipette-spread) (containing rifampicin resistant (C1305-Kan)). + +Rif + ), 28 ℃, incubate in the dark for >36 h; ④ Pick single-clone plaques and add them to LB medium containing kanamycin and rifampin resistance (LB+Kan) + + Rif + Incubate 1 mL of the bacterial culture at 28 °C overnight. After PCR identification of the bacterial culture, take 100 μL of the bacterial culture and incubate it in 25 mL of a solution containing the double antibody (Kan). + and Rif + LB medium, 200 rpm, 28 ℃, incubated until OD. 600 = Around 1.0-1.2; ⑤ Centrifuge the bacterial solution at 28 ℃ and 4000 rpm for 10 min, and collect the bacterial precipitate.

[0039] ⑥ Adjust the Agrobacterium culture to OD using the inoculation solution. 600 =0.6, stand at room temperature for 2-3 h. Infection solution components: 10 mM MgCl2; 10 mM 2-morpholine ethanesulfonic acid; 150 µM acetylsyl syringone; Silwet-L-77 100 μL / L; pH=5.6.

[0040] ⑦ After 8 hours of treatment, the treated tea leaves were collected. Total RNA was extracted from the tea leaves using an RNA extraction kit and reverse transcribed into cDNA. The cDNA was then analyzed by qRT-PCR. CsAAMT The expression level in tea leaves was analyzed, and time periods with high expression levels were selected. Figure 6 A).

[0041] ⑧Collect CsAAMT Overexpressing tea leaves was ground into powder in liquid nitrogen. 1.5g of the tea powder was added to a headspace vial, and 5mL of aqueous solution was added. Solid-phase microextraction was used to adsorb tea aroma components. GC-MS was used to analyze the changes in methyl anthranilate content in the overexpressing tea leaves. Figure 6 B).

Claims

1. A catalyst S A protein that reacts S-adenosylmethionine and anthranilic acid to form methyl anthranilate, characterized in that... The amino acid sequence of the protein is shown in SEQ ID NO.

2.

2. A gene encoding the protein of claim 1 CsAAMT Its characteristics are, The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. A recombinant vector containing the gene encoding as described in claim 2.

4. The protein as described in claim 1 in catalysis S - Application in the formation of anthranilic acid from S-adenosylmethionine and anthranilic acid.

5. The role of the encoding gene as described in claim 2 in regulating the synthesis of methyl anthranilate, an aroma component of tea.

6. A catalyst S A method for forming methyl anthranilate from S-adenosylmethionine and anthranilic acid, characterized in that... Includes the following steps: S.

1. The coding gene was introduced into Escherichia coli, as shown in SEQ ID NO.1, and recombinant protein was obtained by inducing expression; S.

2. After desalting the recombinant protein, it is combined with... S methyl anthranilate was obtained by catalysis of a mixture of S-adenosylmethionine and anthranilic acid solution. S.

3. Transient overexpression of the recombinant protein in tea leaves to synthesize methyl anthranilate.

7. The method as described in claim 6, characterized in that, The catalytic reaction conditions in step S.2 are as follows: [The text abruptly ends here, so the translation stops as S A mixture of S-adenosylmethionine and anthranilic acid was added, along with Tris-HCl, NaCl, imidazole, β-mercaptoethanol, and glycerol. The pH of the reaction solution was 7.0-7.2, and the reaction temperature was 35-39 °C.

8. The method as described in claim 7, characterized in that, Take 25 μM S A mixture of S-adenosylmethionine, 50 Mm-o-aminobenzoic acid, 50 mM Tris-HCl, 500 mM NaCl, 250 mM imidazole, 10 mM β-mercaptoethanol, and 10% glycerol was prepared, wherein the pH of the Tris-HCl was 7-8 and the pH of the imidazole was 7.5-8.

5.

9. The method as described in claim 6, characterized in that, The conditions for transient overexpression of protein CsAAMT in step S.3 are as follows: CsAAMT The condition for transient overexpression in tea leaf pieces is based on CsAAMT Specific primers, the nucleotide sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4, were used to analyze the expression time spectrum of protein CsAAMT in tea leaves by qRT-PCR, and methyl anthranilate was collected and analyzed by HS-SPME tandem GC-MS.