A molecular marker related to pig body size traits and carcass traits on pig chromosome 4 and application thereof
By mining pleiotropic molecular markers associated with body size and carcass traits on pig chromosome 4, and combining them with whole-genome resequencing and GWAS analysis, the problem of low efficiency in pig breeding in existing technologies has been solved, achieving efficient genetic improvement and enhanced economic benefits.
Patent Information
- Application Number
- CN202610722643.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-25
- Publication Date
- 2026-06-23
AI Technical Summary
Existing technologies are insufficient for effectively identifying and utilizing pleiotropic molecular markers, making it difficult to efficiently achieve genetic improvement of pig body size and carcass traits, thus affecting pig breeding efficiency and economic benefits.
By mining pleiotropic molecular markers associated with body size and carcass traits on pig chromosome 4, genotyping was performed using SNP markers, and whole-genome resequencing and GWAS analysis were combined to develop detection products and methods to optimize the genetic improvement process of breeding pigs.
It enables rapid and accurate selection of pig body size and carcass traits, significantly accelerating the breeding process and improving the economic benefits of breeding pigs.
Smart Images

Figure CN122256532A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular markers and animal genetic breeding technology, specifically to a molecular marker located on chromosome 4 of pigs that is associated with pig body size and carcass traits and its application. Background Technology
[0002] Body size traits are primarily obtained by measuring specific parts of a pig's body, directly reflecting its size and health status. Common body size trait indicators include body length, straight carcass length, oblique carcass length, total cervical vertebrae length, femur length, and cannon bone circumference. Carcass traits are indicators obtained by measuring and analyzing carcass weight, visceral weight, etc., after slaughter. They directly determine pork yield and commercial value. Common carcass traits include body weight, carcass weight, biceps brachii length, biceps brachii weight, kidney weight, liver weight, heart weight, hind leg weight, lung weight, head weight, and small intestine length. Body size and carcass traits together affect the pig's meat yield and efficiency, ultimately determining product quality. They are the core indicator system for evaluating pig production performance and directly relate to the economic benefits of the pig farming industry. In current intensive pig farming, even small genetic advances in these economic traits can bring considerable returns; therefore, they are key traits to focus on for the high-quality development of the pig breeding industry.
[0003] With the rapid development of molecular biology and genomics technologies, marker-based genetic improvement methods (genome-wide selection and marker-assisted selection) have become an indispensable part of modern pig breeding systems. The core of these methods is to utilize molecular markers closely associated with target traits for precise genotypic selection of breeding materials. They offer significant advantages in terms of economy, speed, and efficiency, enabling early selection of target traits, shortening generation intervals, and increasing selection intensity, thereby significantly improving genetic progress. In particular, single nucleotide polymorphism (SNP) markers, due to their wide distribution in the genome, stability, heritability, and ease of detection, have become the core tool for marker-assisted selection, providing a novel technological pathway for the precise improvement of pig growth traits. Genome resequencing (WGS) and genome-wide association analysis (GWAS) are important tools for realizing marker-based genetic improvement. WGS provides researchers with a wealth of genetic variation information, while GWAS helps researchers identify key mutation sites that truly affect target traits. These key mutation sites can be directly developed into molecular markers for subsequent marker-assisted selection.
[0004] Current research largely focuses on identifying molecular markers associated with single traits. This strategy has limitations and shortcomings in application, struggling to address the complex genetic networks among important economic traits in pigs. Pleiotropic markers are key to overcoming this bottleneck and achieving a leap in breeding efficiency. They can break down the negative genetic correlations between traits, enabling a shift from single-trait selection to selection based on comprehensive breeding value. Therefore, given the central role of body size and carcass traits in pig genetics and their decisive impact on economic benefits, it is necessary to move beyond single-trait research models and systematically identify and validate pleiotropic molecular markers associated with both body size and carcass traits. This will provide crucial molecular foundations and technical support for breeding high-yielding, high-efficiency, and high-comprehensive-economic-benefit superior pig breeds. Summary of the Invention
[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a molecular marker located on chromosome 4 of pigs that is associated with pig body size and carcass traits.
[0006] Another object of the present invention is to provide applications of the above-mentioned molecular markers.
[0007] Another object of the present invention is to provide an application for detecting the above-mentioned molecular markers in a product.
[0008] A fourth objective of this invention is to provide a method for identifying pig body size and / or carcass traits.
[0009] The fifth object of the present invention is to provide a method for genetic improvement of pigs.
[0010] The objective of this invention is achieved through the following technical solution:
[0011] A molecular marker located on pig chromosome 4 and associated with pig body size and carcass traits, comprising at least one of molecular markers (I)-(III), wherein the location and variation information of the mutation sites corresponding to the molecular markers are as follows:
[0012] (I) The mutation site corresponds to the CGGGGC>CGGGC mutation at nucleotide position 75898477-75898482 on chromosome 4 of the international pig genome version 11.1 reference sequence;
[0013] (II) The mutation site corresponds to the T>C mutation at nucleotide position 76,078,396 on chromosome 4 of the international pig genome version 11.1 reference sequence;
[0014] (III) The mutation site corresponds to the G>A mutation at nucleotide position 63843151 on chromosome 4 of the International Pig Genome Version 11.1 reference sequence.
[0015] For molecular marker (Ⅰ), its nucleotide sequence is preferably as shown in SEQ ID NO:1, where M in the sequence is CGGGGC or CGGGC, and its mutation site is the nucleotide mutation of CGGGGC101_106-CGGGC101_106 at position 101-106 of the sequence marked in SEQ ID NO:1.
[0016] For molecular marker (II), its nucleotide sequence is preferably as shown in SEQ ID NO:2, where M is T or C, and its mutation site is the T101-C101 nucleotide mutation at position 101 of the sequence marked in SEQ ID NO:2.
[0017] For molecular marker (Ⅲ), its nucleotide sequence is preferably as shown in SEQ ID NO:3, where M is G or A, and the mutation site is the G187-A187 nucleotide mutation at position 187 of the sequence marked in SEQ ID NO:3.
[0018] The aforementioned pig body size characteristics include body length, straight carcass length, oblique carcass length, total cervical vertebrae length, femur length or canal circumference, etc.
[0019] The carcass characteristics mentioned include body weight, carcass weight, biceps brachii length, biceps brachii weight, kidney weight, liver weight, heart weight, hind leg weight, lung weight, head weight, or small intestine length, etc.
[0020] The application of the molecular markers located on chromosome 4 of pigs that are associated with pig body size and carcass traits includes at least one of the following (1)-(6):
[0021] (1) Identify the body size and / or carcass characteristics of pigs;
[0022] (2) Prepare products for identifying pig body size traits and / or carcass traits;
[0023] (3) Select pigs with excellent body size and / or carcass traits;
[0024] (4) Prepare products for screening pigs with excellent body size and / or carcass traits;
[0025] (5) Genetic breeding of pig body size and / or carcass traits;
[0026] (6) Prepare products for genetic breeding of pig body size traits and / or carcass traits.
[0027] The application of a product for detecting molecular markers located on chromosome 4 of pigs that are associated with body size and carcass traits, the application comprising at least one of the following (1)-(6):
[0028] (1) Identify the body size and / or carcass characteristics of pigs;
[0029] (2) Prepare products for identifying pig body size traits and / or carcass traits;
[0030] (3) Select pigs with excellent body size and / or carcass traits;
[0031] (4) Prepare products for screening pigs with excellent body size and / or carcass traits;
[0032] (5) Application in the genetic breeding of pig body size traits and / or carcass traits;
[0033] (6) Prepare products for genetic breeding of pig body size traits and / or carcass traits.
[0034] The products described for detecting molecular markers located on pig chromosome 4 that are associated with pig body size and carcass traits include reagents, kits, chips, or detection devices.
[0035] The reagent comprises primer pairs or probes, wherein the primer pairs are used to amplify nucleic acid fragments containing the above-mentioned mutation sites, and the probes are able to specifically recognize and bind to the nucleic acid sequence of the mutation sites; probes carrying different labeling groups (e.g., fluorescent groups) can be designed to correspond to different genotypes of the above-mentioned mutation sites, thereby achieving genotyping detection.
[0036] The primer pairs preferably include at least one of primer pairs primer-F1 and primer-R1, primer pairs primer-F2 and primer-R2, and primer pairs primer-F3 and primer-R3, the nucleotide sequences of which are shown in SEQ ID NO:4-9.
[0037] The kit contains the aforementioned primer pairs or probes, and preferably also contains reaction buffer, etc.
[0038] The chip uses a solid-phase carrier to fix the primer pairs or probes to achieve high-throughput detection.
[0039] The aforementioned detection equipment is compatible with the detection process of the above-mentioned reagents, kits, and chips, and completes signal acquisition, genotype interpretation, and result output.
[0040] A method for identifying body size and / or carcass traits in pigs, comprising the following steps:
[0041] The above-mentioned molecular markers in pigs were detected, and the body size and / or carcass traits of the pigs were determined based on the mutation sites of the molecular markers:
[0042] For (I), the nucleotides detected at the corresponding mutation sites are CGGGGC or CGGGC; wherein, the body size traits and / or carcass traits of the pigs are ordered from best to worst according to the genotypes at nucleotide sites 75898477-75898482 on chromosome 4 of the International Pig Genome Version 11.1 reference sequence, in the following order: CGGGGC / CGGGGC, CGGGGC / CGGGC and CGGGC / CGGGC genotypes;
[0043] For (II), the nucleotides detected at the corresponding mutation sites are T or C; wherein, the body size traits and / or carcass traits of the pigs are ordered from best to worst according to the genotype at the 76,078,396th nucleotide site on chromosome 4 of the International Pig Genome Version 11.1 reference sequence, in the following order: T / T, T / C and C / C genotypes.
[0044] For (III), the nucleotides corresponding to the mutation sites are detected as G or A; wherein, the body size traits and / or carcass traits of the pigs are ordered from best to worst according to the genotype at the 63,843,151st nucleotide site on chromosome 4 of the International Pig Genome Version 11.1 reference sequence, in the following order: G / G, G / A and A / A genotypes.
[0045] The detection method includes the following steps:
[0046] (1) Extract genomic DNA from the pigs to be tested;
[0047] (2) Using the above primer pair as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products;
[0048] (3) Sequencing the PCR amplification products to obtain sequencing results;
[0049] (4) Determine the genotype based on the sequencing results.
[0050] A method for genetic improvement of pigs, comprising the following steps:
[0051] Identify the aforementioned molecular markers of breeding pigs in the core breeding pig herd, and make corresponding selections based on these molecular markers:
[0052] For (I), in the core breeding pig population, select breeding pig individuals with genotypes CGGGGC / CGGGGC and CGGGGC / CGGGC at nucleotide positions 75898477-75898482 on chromosome 4 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the CGGGC / CGGGC genotype to increase the frequency of the CGGGGC allele at this locus generation by generation; preferentially select breeding pig individuals with the CGGGGC / CGGGGC genotype, and cull breeding pig individuals with the CGGGGC / CGGGC and CGGGC / CGGGC genotypes to increase the frequency of the CGGGGC allele at this locus generation by generation;
[0053] For (II), in the core breeding pig population, select breeding pig individuals with the T / T and T / C genotypes at nucleotide position 76,078,396 on chromosome 4 of the International Swine Genome Version 11.1 reference sequence, and cull breeding pig individuals with the C / C genotype, in order to increase the frequency of the T allele at this locus generation by generation; prioritize breeding pig individuals with the T / T genotype, and cull breeding pig individuals with the T / C and C / C genotypes, in order to increase the frequency of the T allele at this locus generation by generation.
[0054] For (III), in the core breeding pig population, select breeding pig individuals with the G / G and G / A genotypes at nucleotide position 63843151 on chromosome 4 of the International Pig Genome Version 11.1 reference sequence, and cull breeding pig individuals with the A / A genotype to increase the frequency of allele G in each generation; prioritize breeding pig individuals with the G / G genotype, and cull breeding pig individuals with the G / A and A / A genotypes to increase the frequency of allele G at this locus in each generation.
[0055] The pigs are Western pig breeds, subspecies of pigs, or synthetic lines or hybrid groups containing Western pig breeds and / or subspecies of pig blood.
[0056] The pigs mentioned can be Duroc, Landrace, Large White, Pietrain, Erhualian, Laiwu, Bama miniature pig, Tibetan pig or their synthetic lines or hybrid groups.
[0057] The pigs mentioned are F7 generation individuals of chimeric families bred from Duroc pigs, Landrace pigs, Large White pigs, Pietrain pigs, Erhualian pigs, Laiwu pigs, Bama miniature pigs, and Tibetan pigs.
[0058] The present invention has the following advantages and effects compared with the prior art:
[0059] This invention uses F7 individuals from chimeric families bred from four typical Western pig breeds (Duroc, Landrace, Large White, and Pietrain) and four typical Asian pig breeds (Erhualian, Laiwu, Bama Xiang, and Tibetan pigs) as research subjects. Using pig whole-genome resequencing and GWAS analysis, the invention studied and identified three molecular markers that significantly and synchronously affect pig body size and carcass traits. At least one of the molecular markers in this invention can be used to detect relevant indicators in pigs, or at least one of these SNP markers can be used for corresponding genetic improvement.
[0060] (2) Based on molecular markers related to pig body size and carcass traits, this invention establishes a set of efficient and accurate molecular marker-assisted breeding technology, including products such as primers and kits for detecting the molecular markers, methods for identifying pig body size traits and / or carcass traits, methods for genetic improvement of pigs, etc. When applied to the genetic improvement of pig body size traits and / or carcass traits, it can quickly and accurately select and breed body size traits and / or carcass traits, significantly accelerate the breeding process, and provide a molecular basis and technical support for breeding superior pigs.
[0061] (3) By selecting the superior alleles of the above molecular markers, the present invention can increase the frequency of superior alleles generation by generation, accelerate the progress of pig genetic improvement, and thus effectively improve the economic benefits of breeding pigs. Attached Figure Description
[0062] Figure 1 This is a Manhattan plot of body size and carcass traits (taking cannula circumference as an example) on chromosome 4 of pigs; where the X-axis represents the location of the molecular marker site on the chromosome, and the Y-axis represents the -log10 (P-value) corresponding to the molecular marker site.
[0063] Figure 2 This is a box plot of different genotypes at the g.75898477 locus in body size traits (including body length, straight carcass length, oblique carcass length, cannon bone circumference, total cervical vertebra length, and femur length) in F7 generation pigs of a chimeric family; where the X-axis represents the genotype of the molecular marker, and the Y-axis represents the phenotypic value of the individual; CC represents CGGGC / CGGGC; CCG represents CGGGGC / CGGGC; CGCG represents CGGGGC / CGGGGC.
[0064] Figure 3This is a box plot showing the different genotypes at the g.75898477 locus in the carcass traits (including body weight, head weight, hind leg weight, carcass weight, biceps brachii length, and biceps brachii weight) of F7 generation pigs from a chimeric family; where the X-axis represents the genotype of the molecular marker, and the Y-axis represents the phenotypic value of the individual; CC represents CGGGC / CGGGC; CCG represents CGGGGC / CGGGC; and CGCG represents CGGGGC / CGGGGC.
[0065] Figure 4 This is a box plot showing the different genotypes at the g.75898477 locus in the carcass traits (including heart weight, liver weight, lung weight, kidney weight, and small intestine length) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker, and the Y-axis represents the phenotypic value of the individual; CC represents CGGGC / CGGGC; CCG represents CGGGGC / CGGGC; CGCG represents CGGGGC / CGGGGC.
[0066] Figure 5 This is a box plot of different genotypes at the g.76078396 locus in body size traits (including body length, straight carcass length, oblique carcass length, cannon bone circumference, total cervical vertebra length, and femur length) in F7 generation pigs of a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual.
[0067] Figure 6 This is a box plot of different genotypes at the g.76078396 locus in the carcass traits (including body weight, head weight, hind leg weight, carcass weight, biceps brachii length, and biceps brachii weight) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual.
[0068] Figure 7 This is a box plot of different genotypes at the g.76078396 locus in the carcass traits (including heart weight, liver weight, lung weight, kidney weight, and small intestine length) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual.
[0069] Figure 8 This is a box plot of different genotypes at the g.63843151 locus in body size traits (including body length, straight carcass length, oblique carcass length, cannon bone circumference, total cervical vertebra length, and femur length) in F7 generation pigs of a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual.
[0070] Figure 9This is a box plot of different genotypes at the g.63843151 locus in the carcass traits (including body weight, head weight, hind leg weight, carcass weight, biceps brachii length, and biceps brachii weight) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual.
[0071] Figure 10 This is a box plot of different genotypes at the g.63843151 locus in the carcass traits (including heart weight, liver weight, lung weight, kidney weight, and small intestine length) of F7 generation pigs in a chimeric family; where the X-axis represents the genotype of the molecular marker and the Y-axis represents the phenotypic value of the individual. Detailed Implementation
[0072] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0073] Example 1
[0074] 1. Experimental pig herd
[0075] The experimental pig population used in this invention was: F7 generation individuals from a chimeric family (Ji J, Zhou L, Huang Y, Zheng M, Liu X, Zhang Y, Huang C, Peng S, Zeng Q, Zhong L, Yang B, Li W, Xiao S, Ma J, Huang L. A whole-genome sequence based association study on porkeating quality traits and cooking loss in a specially designed heterogeneous F6 pig population. Meat Sci. 2018 Dec;146:160-167. doi: 10.1016 / j.meatsci.2018.08.013. Epub 2018 Aug 23. PMID: 30153624.) (Yang, H., Wu, J., Huang, X. et al. ABO genotype alters the gut microbiota by regulating GalNAclevels in pigs. Nature 606, 358–367 (2022). (https: / / doi.org / 10.1038 / s41586-022-04769-z) (bred from four typical Western pig breeds (Duroc, Landrace, Large White, and Pietrain) and four typical Asian pig breeds (Erhualian, Laiwu, Bama Xiangzhu, and Tibetan pig), totaling 671 pigs.
[0076] 2. Phenotypic determination
[0077] The 240-day weight is the weight measured when the pigs are 240 days old. Pigs are fasted for 20 hours before slaughter but have free access to water. The entire slaughter process is carried out according to standard commercial procedures. Pre-slaughter measurements include individual live body length and cannon bone circumference. Live body length is measured using a tape measure along the backline to the tail root from the midpoint of the line connecting the bases of the pig's ears. Cannon bone circumference refers to the circumference of the left hind leg, measured with a tape measure. Post-slaughter measurements include: straight carcass length (from the midpoint of the anterior edge of the pubic symphysis to the midpoint of the anterior edge of the first cervical vertebra); oblique carcass length (from the midpoint of the anterior edge of the pubic symphysis to the junction of the first rib and sternum); total cervical vertebral length (measured with a tape measure from the first cervical vertebra to the last cervical vertebra); femur length (from the greater trochanter to the intercondylar fossa); and biceps brachii length and small intestine length, all measured post-slaughter using a tape measure. Carcass weight, biceps weight, kidney weight, liver weight, heart weight, hind leg weight, lung weight, and head weight were all measured using an electronic scale after slaughter.
[0078] Example 2
[0079] 1. Acquisition, quality control, and genotyping of whole-genome resequencing data in pigs.
[0080] (1) DNA extraction: Ear tissue samples were collected from each individual pig in the experimental herd in Example 1, and genomic DNA was extracted from each individual using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was detected using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was around 1.8-2.0 and the A260 / 230 ratio was around 1.7-1.9.
[0081] (2) DNA sequencing: The concentration of DNA samples that meet the standards is diluted to 50 ng / μL. The whole genome resequencing (paired-end 150 bp sequencing mode) is completed by the BGI T7 sequencing platform. The average sequencing depth of the sample reaches 30×, and the raw sequencing data in fastq format is obtained. Clean reads are obtained through fastp (v0.23.0) quality control for subsequent analysis.
[0082] (3) Sequence alignment: The raw sequencing data obtained in step (2) were aligned with the Sscrofa 11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.
[0083] (4) Variation detection: Use samtools (v1.10) to sort and convert the sam format file in step (3) into a bam format file, and then use Sambamba (v0.8.2) to remove PCR repeat sequences in the bam format file. Finally, use Graphtyper (v2.7.7) to perform genetic variation detection on all individual bam files to obtain population-level genotype data (vcf file).
[0084] (5) Variation Quality Control: The population-level genotype data obtained in step (4) was quality controlled using samtools. High-quality genotype sites were retained only if they met the condition "FILTER="PASS"" and the variation detection quality value (GQ) > 20. Furthermore, Plink (v1.9) software was used to perform quality control on the population-level genotype data, excluding variant sites with a minor allele frequency (MAF) below 5% and samples with an individual genotype call rate below 80%. Finally, beagle (r1399) was used to autofill the genotypes to obtain high-quality genotype data.
[0085] 2. Genome-wide association study (GWAS) analysis
[0086] Genome-wide association analysis was performed on phenotypic data corrected for confounding factors using the Genome-wide Efficient Mixed Model Association algorithm (GEMMA v0.98.1). Specifically:
[0087] (1) Phenotypic processing: This invention uses the lm() function in R language to perform simple linear regression on gender and batch number, and the corrected residuals are used as the phenotypes for the final association analysis.
[0088] (2) The analysis uses a univariate linear mixed model (ULMM) for statistical inference, and its mathematical expression is constructed as follows:
[0089]
[0090] Where y represents the n-dimensional vector of the phenotype (quantitative trait or binary vector) to be analyzed, which in this study is the measurement value of body size or carcass related traits in Example 1; W represents a matrix consisting of a column of "1"s (n×c dimensions); α is the vector of the effect and intercept of the corresponding covariate (c dimensions); x represents the vector of the genotype of the detection locus (n dimensions); β represents the vector of the magnitude of the effect of the detection locus; u represents a vector with a mean of 0 and a covariance-variance matrix of λτ. -1 The random effects vector (n-dimensional) of a K-multivariate normal distribution; ε indicates that it follows a mean of 0 and a covariance-variance matrix of τ. -1 I n The remaining residual vector (n-dimensional). In two n-variable normal distributions, n represents the number of phenotypes, τ -1 Let represent the variance of the residuals, and λ represent the ratio of the variance of the random effects to the variance of the residuals; K represents the n×n kinship matrix and I... n Let represent an n×n identity matrix; MVNn represents an n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, a genome-wide significance threshold of 5E-8 is set.
[0091] Based on GWAS analysis ( Figure 1 (Taking the tube enclosure as an example), this invention found three representative mutation sites on chromosome 4, and their basic genetic parameters are shown in Table 1.
[0092] Table 1. Basic genetic parameters of three representative mutation sites.
[0093]
[0094] Note: Body size characteristics include body length, straight length of carcass, oblique length of carcass, total length of cervical vertebrae, length of femur, and circumference of canal, etc. Carcass characteristics include body weight, carcass weight, biceps brachii length, biceps brachii weight, kidney weight, liver weight, heart weight, hind leg weight, lung weight, head weight, and small intestine length, etc.
[0095] 3. Association analysis between different genotypes and phenotypes
[0096] (1) Loci g.75898477 and g.76078396
[0097] ① Using Plink (v1.9) software, the linkage disequilibrium of the above three mutation sites was calculated using conventional methods. The results showed that the two mutation sites (g.75898477 and g.76078396) near the PLAG1 gene were highly linked (r 2 ≥0.8).
[0098] ② This invention further analyzes the association between genotypes and pig body size and carcass phenotypes for two mutation sites (g.75898477 and g.76078396). The specific method is as follows: Plink (v1.9) software is used to extract the genotypes of each individual in the F7 generation of chimeric family experimental pigs at the g.75898477 or g.76078396 sites from the sequencing file. After counting the number of individuals for each genotype, the genotypes of these individuals are correlated with their corresponding body size and carcass traits. Then, the multGomp package in R language is used to statistically analyze the differences in phenotypic distribution under different genotypes in the F7 chimeric family.
[0099] The results are shown in Tables 2 and 3. Figure 2 , Figure 3 , Figure 4 , Figure 5 , Figure 6 and Figure 7 The p-value was obtained from the variance test. The analysis shows that:
[0100] The g.75898477 locus significantly affected all indicators (P < 0.01). From the perspective of allele effects, the CGGGGC allele showed a clear positive association trend: the phenotypic mean of the genotypes carrying the CGGGGC allele (CGGGGC / CGGGGC and CGGGGC / CGGGC) was generally higher than that of the CGGGC / CGGGC genotype without the CGGGGC allele. Furthermore, the mean value of homozygous CGGGGC / CGGGGC was the highest among all indicators, suggesting that the CGGGGC allele is a potentially dominant allele. Further multiple comparison analyses of the phenotypic data corresponding to different genotypes showed that the body size and carcass traits corresponding to the CGGGGC / CGGGGC and CGGGGC / CGGGC genotypes were significantly better than those of the CGGGC / CGGGC genotype (P < 0.05). Therefore, when selecting breeding pigs, individuals with the CGGGGC / CGGGGC and CGGGGC / CGGGC genotypes should be given priority as parents for subsequent breeding.
[0101] The g.76078396 locus significantly affected all indicators (P < 0.001). From the perspective of allele effects, the T allele showed a clear positive association trend: the phenotypic mean of the T allele-carrying genotypes (T / T and T / C) was generally higher than that of the C / C genotype without the T allele, and the mean of T / T homozygotes was the highest among most indicators, suggesting that the T allele is a potentially dominant allele. Further multiple comparison analysis of the phenotypic data corresponding to different genotypes showed that the body size and carcass traits corresponding to the T / T and T / C genotypes were significantly better than those of the C / C genotype (P < 0.05). Therefore, in breeding pigs, individuals with the T / T and T / C genotypes should be preferentially selected as parents for subsequent reproduction.
[0102] Table 2. Effects of locus g.75898477 on body size and carcass traits in mosaic family F7.
[0103]
[0104] Table 3. Effects of locus g.76078396 on body size and carcass traits in mosaic family F7.
[0105]
[0106] (2) Locus g.63843151
[0107] Referring to step (1), the genotype at the g.63843151 locus of each individual in the F7 generation of chimeric family experimental pigs was extracted from the sequencing file using Plink (v1.9) software. After counting the number of individuals with each genotype, the genotypes of these individuals were correlated with their corresponding body size and carcass traits. Then, the differences in phenotypic distribution under different genotypes were statistically analyzed in the F7 chimeric family using the multGomp package in R language.
[0108] Results Table 4 and Figure 8 , Figure 9 and Figure 10 The p-values were obtained from the variance test. Analysis showed that the g.63843151 locus significantly affected all indicators (P<0.001). Regarding allele effects, the G allele showed a clear positive association: the phenotypic mean of the G allele-carrying genotypes (G / G and G / A) was generally higher than that of the A / A genotype without G, and the mean of the G / G homozygous genotype was the highest among most indicators, suggesting that the G allele is a potential dominant allele. Further multiple comparison analysis of the phenotypes corresponding to different genotypes showed that the body size and carcass traits corresponding to the G / G genotype were significantly better than those of the G / A and A / A genotypes (P < 0.05). Therefore, in breeding pigs, individuals with the G / G genotype should be preferentially selected as parents for subsequent reproduction.
[0109] Table 4. Effects of locus g.63843151 on body size and carcass traits in mosaic family F7.
[0110]
[0111] Note: n is the number of individuals with each genotype.
[0112] Example 3
[0113] This embodiment further provides a specific method and process for detecting the molecular marker in Example 2, as follows:
[0114] 1. Primer design
[0115] The target fragment containing the mutation site associated with the body size and carcass traits of pigs located on chromosome 4 is shown in SEQ ID NO:1-3. The nucleic acid sequences of the upstream and downstream primers used to detect the mutation site associated with the body size and carcass traits of pigs located on chromosome 4 are shown in Table 5 below.
[0116] Table 5 Primer sequences
[0117]
[0118] 2. PCR amplification
[0119] Add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCR StarMixwith Loading Dye, and 0.3 μL each of forward and reverse primers to a 10 μL reaction system. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 5 min, followed by 94℃ denaturation for 30 s, 55-65℃ annealing for 30 s, and 72℃ extension for 45 s, for 35 cycles, and a final extension at 72℃ for 5 min.
[0120] 3. DNA sequencing
[0121] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced in both forward and reverse directions. The obtained sequences were compared with the NCBI genome sequence to identify the corresponding mutation sites.
[0122] SEQ ID NO:1 (chr4: 75898377-75898577):
[0123] TTCCTCGCCAGCCTCCTCCTCCCGCAGGCCTCCTGCCACAGC TCTGCTCTCCGTGACACAG CTTCCCCGTGGAAAGCAGAAGTGGGCCTCCCTCTCCAGTM(CGGGGC / CGGGC)CCTCTGAGACCAGCTTCCCCTCCGCCCTCTCGCCTGTGGGGCTAACATTTACTGGAAGAGCTGAAGCACCCA GGAAAAGCCCAAACACCCAG GAG
[0124] SEQ ID NO:2 (chr4: 76078296-76078496):
[0125] CACTGGCCTGTTTAGAAGGATC TGGAGTCACAGCATTTATGGG AGAGTGACGGCGCCTGGGTCCCCGGGGTTTACCATCAGGTGTTCATCCTGATGAAGGM(T / C)GCTGGCTGCTCACCCACGCGCAGCGTTCTTATGCTTGGAGGGCTTGGAAGCGGGCCC AGAGGATGCAGACTGGTGAC CATGACCCAAGGTAAATAAAATC
[0126] SEQ ID NO:3 (chr4: 63842965-63843251):
[0127] TGCTGACAGTTCTATTCATGGAAATATTATTTTATATATTATTATATATAATAAATATAATAAAAGAATATATAATAAATATATATTATATATTATAAATATAATGCAAACACATATAATAAATACATAAATAAATATAAATATGTTTTTTATTTATAATAAATATTTTATATAATATATAGGTAAATM(G / A)TGTTTTTTATAATACATATTATATATATTTATTATTTTATAATAAATTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AGAGCACCCTGGGAAGC ACA
[0128] Note: M in the sequence indicates the mutation site (the mutated base in parentheses represents the allele mutation), and the underlined part indicates the primer binding site.
[0129] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of a molecular marker located on chromosome 4 of pigs and associated with pig body size and carcass traits, characterized in that... Its application includes at least one of the following (1)-(6): (1) Identify the body size and / or carcass characteristics of pigs; (2) Prepare products for identifying pig body size traits and / or carcass traits; (3) Select pigs with excellent body size and / or carcass traits; (4) Prepare products for screening pigs with excellent body size and / or carcass traits; (5) Genetic breeding of pig body size and / or carcass traits; (6) Prepare products for genetic breeding of pig body size traits and / or carcass traits; The molecular markers located on pig chromosome 4 that are associated with pig body size and carcass traits include at least one of molecular markers (I)-(III), and the locations and variation information of the mutation sites corresponding to the molecular markers are shown below in sequence: (I) The mutation site corresponds to the CGGGGC>CGGGC mutation at nucleotide position 75898477-75898482 on chromosome 4 of the international pig genome version 11.1 reference sequence; (II) The mutation site corresponds to the T>C mutation at nucleotide position 76,078,396 on chromosome 4 of the international pig genome version 11.1 reference sequence; (III) The mutation site corresponds to the G>A mutation at nucleotide position 63843151 on chromosome 4 of the international pig genome version 11.1 reference sequence; The aforementioned pig body size traits include body length, straight carcass length, oblique carcass length, total cervical vertebrae length, and femur length or canal circumference; The carcass characteristics mentioned include body weight, carcass weight, biceps brachii length, biceps brachii weight, kidney weight, liver weight, heart weight, hind leg weight, lung weight, head weight, or small intestine length.
2. The application according to claim 1, characterized in that: For molecular marker (Ⅰ), its nucleotide sequence is shown in SEQ ID NO:1, where M in the sequence is CGGGGC or CGGGC; For molecular marker (Ⅱ), its nucleotide sequence is shown in SEQ ID NO:2, where M is T or C; For molecular marker (Ⅲ), its nucleotide sequence is shown in SEQ ID NO:3, where M is G or A.
3. The application of a product for detecting molecular markers located on chromosome 4 of pigs that are associated with body size and carcass traits, characterized in that... Its application includes at least one of the following (1)-(6): (1) Identify the body size and / or carcass characteristics of pigs; (2) Prepare products for identifying pig body size traits and / or carcass traits; (3) Select pigs with excellent body size and / or carcass traits; (4) Prepare products for screening pigs with excellent body size and / or carcass traits; (5) Application in the genetic breeding of pig body size traits and / or carcass traits; (6) Prepare products for genetic breeding of pig body size traits and / or carcass traits; The molecular markers located on pig chromosome 4 and associated with pig body size and carcass traits are the molecular markers described in claim 1.
4. The application according to claim 3, characterized in that: The products described for detecting molecular markers located on pig chromosome 4 that are associated with pig body size and carcass traits include reagents, kits, chips, or detection devices.
5. The application according to claim 4, characterized in that: The reagents described contain primer pairs or probes.
6. The application according to claim 5, characterized in that: The primer pairs include at least one of primer pairs primer-F1 and primer-R1, primer pairs primer-F2 and primer-R2, and primer pairs primer-F3 and primer-R3, and their nucleotide sequences are shown in SEQ ID NO:4-9.
7. The application according to claim 4, characterized in that: The kit contains primer pairs or probes; the kit also contains a reaction buffer.
8. A method for identifying body size and / or carcass traits in pigs, characterized in that... It includes the following steps: Detect the molecular markers described in claim 1 in pigs, and determine the pig's body size and / or carcass traits based on the mutation sites of the molecular markers: For (I), the nucleotides detected at the corresponding mutation sites are CGGGGC or CGGGC; wherein, the body size traits and / or carcass traits of the pigs are ordered from best to worst according to the genotypes at nucleotide sites 75898477-75898482 on chromosome 4 of the International Pig Genome Version 11.1 reference sequence, in the following order: CGGGGC / CGGGGC, CGGGGC / CGGGC and CGGGC / CGGGC genotypes; For (II), the nucleotides detected at the corresponding mutation sites are T or C; wherein, the body size traits and / or carcass traits of the pigs are ordered from best to worst according to the genotype at the 76,078,396th nucleotide site on chromosome 4 of the International Pig Genome Version 11.1 reference sequence, in the following order: T / T, T / C and C / C genotypes. For (III), the nucleotides corresponding to the mutation sites are detected as G or A; wherein, the body size traits and / or carcass traits of the pigs are ordered from best to worst according to the genotype at the 63,843,151st nucleotide site on chromosome 4 of the International Pig Genome Version 11.1 reference sequence, in the following order: G / G, G / A and A / A genotypes.
9. The method for identifying pig body size and / or carcass traits according to claim 8, characterized in that: The detection method includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using primer pairs as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products; (3) Sequencing the PCR amplification products to obtain sequencing results; (4) Determine the genotype based on the sequencing results; The primer pairs include at least one of primer pairs primer-F1 and primer-R1, primer pairs primer-F2 and primer-R2, and primer pairs primer-F3 and primer-R3, and their nucleotide sequences are shown in SEQ ID NO:4-9.
10. A method for genetic improvement of pigs, characterized in that... It includes the following steps: Identify the molecular markers described in claim 1 for the breeding pigs in the core breeding herd, and make corresponding selections based on the molecular markers: For (I), in the core breeding pig population, select breeding pig individuals with genotypes CGGGGC / CGGGGC and CGGGGC / CGGGC at nucleotide positions 75898477-75898482 on chromosome 4 of the International Pig Genome Version 11.1 reference sequence, and cull breeding pig individuals with the CGGGC / CGGGC genotype to increase the frequency of the CGGGGC allele at this locus generation by generation; For (II), select breeding pig individuals with the T / T and T / C genotypes at nucleotide position 76078396 on chromosome 4 of the International Swine Genome Version 11.1 reference sequence in the core breeding pig population, and cull breeding pig individuals with the C / C genotype, so as to increase the frequency of the T allele at this position generation by generation. For (III), in the core breeding pig population, breeding pig individuals with the G / G and G / A genotypes at nucleotide position 63843151 on chromosome 4 of the International Pig Genome Version 11.1 reference sequence are selected, and breeding pig individuals with the A / A genotype are culled, in order to increase the frequency of allele G generation by generation.