Endothelin a receptor antagonist-albumin fusion protein and its application in prevention and treatment of hypotension during anesthesia induction period

By fusing BQ-123 with human serum albumin to form BQFu, the problem of the short half-life of BQ-123 is solved, achieving the effect of maintaining activity in CHO cells and significantly resisting hypotension, which is suitable for the prevention and treatment of hypotension during the anesthesia induction period.

CN122277757APending Publication Date: 2026-06-26THE FIRST AFFILIATED HOSPITAL OF CHONGQING MEDICAL AND PHARMACEUTICAL COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610452368.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-08
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

The existing endothelin A receptor antagonist BQ-123 has a short half-life and is easily enzymatically hydrolyzed, requiring frequent dosing. Furthermore, it lacks systematic validation in anesthesia hypotension models, which affects its application in preventing and treating hypotension during anesthesia induction.

Method used

A fusion protein of endothelin A receptor antagonist BQ-123 and human serum albumin (HSA) was designed. By coupling BQ-123 at Cys34 of HSA to form BQFu, its half-life in vivo was prolonged and its stability was improved, thus maintaining its pharmacological activity.

Benefits of technology

BQFu is correctly expressed in CHO cells and retains its activity after glycosylation modification. Its IC50 is 6.43 nM, which is comparable to BQ-123. It has a significant antihypertensive effect. The maximum MAP reduction in the high-dose group is controlled at 15-25%, and the recovery time is shortened to 20.8 min. It has high safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122277757A_ABST
    Figure CN122277757A_ABST
Patent Text Reader

Abstract

This invention discloses an endothelin A receptor antagonist-albumin fusion protein and its application in preventing and treating hypotension during anesthesia induction. The fusion protein is formed by chemically coupling BQ-123 with human serum albumin (HSA). BQFu significantly enhances its antihypertensive effect by prolonging the half-life of BQ-123 and improving plasma stability. Experiments show that BQFu dose-dependently inhibits the decrease in mean arterial pressure (MAP) in a propofol-induced hypotension model, with a sustained and stable effect in the high-dose group (30 mpk), shortening the recovery time to 20.8 ± 10.5 min, while maintaining BQ-123 activity. This invention provides a long-acting and safe prevention and treatment strategy for hypotension during anesthesia induction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and more specifically, to an endothelin A receptor antagonist-albumin fusion protein and its application in the prevention and treatment of hypotension during anesthesia induction. Background Technology

[0002] Hypotension during anesthesia induction is a common clinical complication caused by the release of endothelin-1 (ET-1) induced by anesthetic drugs such as propofol, which overactivates ETA receptors and leads to strong vasoconstriction. The endothelin A receptor antagonist BQ-123 can selectively block ETA receptors, but its short half-life, frequent dosing requirements, and susceptibility to enzymatic degradation limit its clinical application.

[0003] Existing strategies for extending drug half-life include pegylation and fusion protein technology. Among these, human serum albumin (HSA) is an ideal fusion partner due to its high natural stability and lack of immunogenicity. HSA has a long half-life of up to 19 days in the bloodstream, which can significantly prolong the circulation time of fusion proteins. However, the fusion design of BQ-123 and HSA in existing technologies suffers from problems such as inappropriate linker selection and loss of activity, and lacks systematic validation in anesthesia-induced hypotension models.

[0004] Therefore, developing a BQ-123-HSA fusion protein with both high activity and long half-life is of great value for preventing and treating hypotension during the anesthesia induction period. Summary of the Invention

[0005] The present invention first provides an endothelin A receptor antagonist-albumin fusion protein comprising BQ-123 and mature HSA protein, wherein BQ-123 is modified on Cys34 of HSA.

[0006] In some embodiments, the BQ-123 is Cyclo (D-Trp-D-Asp-Pro-D-Val-Leu).

[0007] The present invention also provides a gene encoding the above-mentioned fusion protein.

[0008] The present invention also provides a recombinant expression vector comprising the above-described genes.

[0009] The present invention also provides a recombinant host cell comprising the above-described expression vector, wherein the host cell is a CHO cell.

[0010] The present invention also provides a pharmaceutical composition comprising the above-described fusion protein and a pharmaceutically acceptable carrier.

[0011] The present invention also provides the application of the above-mentioned fusion protein in the preparation of drugs for preventing and treating hypotension during the anesthesia induction period.

[0012] In some embodiments, the drug is administered intravenously.

[0013] Compared with the prior art, the present invention has at least the following beneficial effects:

[0014] (1) Prolonged half-life: The HSA domain significantly prolongs the cycle time of BQFu. In animal experiments, the effect lasts for 2 hours after a single dose, while BQ-123 requires multiple doses.

[0015] (2) Improved stability: The fusion protein is correctly expressed in CHO cells and remains active after glycosylation modification.

[0016] (3) Maintaining pharmacological activity: Calcium flow experiments confirmed that the IC50 of BQFu was 6.43 nM, which was comparable to that of BQ-123 (3.466 nM), indicating that the fusion did not affect the binding ability of BQ-123 to the ETA receptor.

[0017] (4) Significant antihypertensive effect:

[0018] The high-dose group (30 mpk) controlled the maximum MAP reduction within 15-25% and shortened the recovery time to 20.8 min;

[0019] The low-dose group (10 mpk) was still significantly better than the free BQ-123 and HSA control group (p<0.01).

[0020] (5) High safety: HSA is an endogenous protein with low immunogenicity. Attached Figure Description

[0021] Figure 1 SDS-PAGE identification image of recombinant human HSA.

[0022] Figure 2 : SDS-PAGE identification image of BQFu.

[0023] Figure 3 : Inhibition curve of BQFu on ET-1-induced calcium influx.

[0024] Figure 4 Comparison chart of the decrease in MAP for each group. Detailed Implementation

[0025] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0026] Example 1: Design of BQ-123-albumin fusion protein

[0027] BQ-123 is an endothelin A (ETA) receptor antagonist that selectively binds to ETA receptors rather than ETB receptors, thus possessing good drug development potential. However, it suffers from problems such as a short half-life and susceptibility to enzymatic degradation in the body. Based on these shortcomings, we designed and developed a BQ-123-albumin fusion protein to prolong its half-life, reduce dosing frequency, improve plasma stability, and extend circulation time.

[0028] The amino acid sequence information of BQ-123 obtained from SciFinder (https: / / scifinder.cas.org) is shown in Table 1. The amino acid sequence of the mature protein without the signal peptide of human serum albumin (HSA) was obtained from UniProt (https: / / www.uniprot.org), encoded as P02768, and its detailed sequence is as follows: (SEQ ID No. 1). Human HSA was recombinantly expressed in a CHO cell system, and BQ-123 was conjugated at its free Cys34 site to obtain the BQ-123-HSA fusion protein, which was named BQFu.

[0029] Table 1. Amino acid sequence listing of BQ-123

[0030] BQ-123 CAS No. 136553-81-6 sequence Cyclo (D-Trp-D-Asp-Pro-D-Val-Leu)

[0031] Example 2: Preparation of recombinant human HSA

[0032] The target gene was synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd., and amplified by PCR using primers CCCAAGCTGGCTAGTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCGCCGACCACAA (primer 1) and TGGGTGACCTCGAGCGGCCGCCACTGTGCTGGATATGAGCAAGTGC (primer 2). The empty pcDNA3.1 vector was linearized by double digestion with HindIII and XhoI. The linearized vector was recovered by gel electrophoresis, and seamless cloning was performed using a vector:target gene molar ratio of 1:10. Seamless cloning was performed using a Gibson kit (NEB, E5510S) at 55℃ for 40 min. The ligation product was subjected to 1% agarose gel electrophoresis and recovered using a gel recovery kit (Promega, LS1020), with concentration detected by NanoDrop. 100 μL of DH5α competent cells were removed from a -80℃ freezer and placed in an EP tube to thaw on ice for 15 min. Add 10 ng of the ligation product to competent cells, mix carefully and gently, and incubate on ice for 30 min. After incubating in a 42°C water bath for 90 s, quickly place the EP tube on ice for 3 min, add 900 μL of fresh LB medium without antibiotics, mix well, and incubate at 37°C and 220 rpm for 1 hour. Gently pipette to mix the bacterial cells, spread on LB solid agar medium containing 100 μg / mL ampicillin (Amp), and after the liquid on the LB plate is completely absorbed, invert the plate and incubate overnight at 37°C. The next day, pick single colonies from the plate and send them to Suzhou Genewiz Technology Co., Ltd. for Sanger sequencing. After preserving the correctly sequenced positive strains, inoculate 150 μL into 150 mL of LB liquid medium containing 100 μg / mL Amp and incubate for 16 h at 37°C and 220 rpm. Plasmids were extracted using an endotoxin-free plasmid extraction kit (Qiagen, 12165), filtered through a 0.22 μm filter, aliquoted, and stored at -20°C.

[0033] Example 3: Expression and purification of recombinant human HSA

[0034] CHO-S cells were revived and cultured in suspension at 37°C, 8% CO2, and 125 rpm on a shaker, and passaged to a cell culture size of 0.5 × 10⁻⁶ cells / year. 6 Maintain a cell density of 0.8-1.0 × 10⁶ cells / mL, ensuring a viability greater than 95%. Passage the cells one day before transfection to achieve a density of 0.8-1.0 × 10⁶ cells / mL on the day of transfection. 6Cells were transfected with Lipofectamine 3000 and cultured for 5–7 days. Viability was observed daily. When viability dropped to 60–70%, the supernatant was harvested and centrifuged at 9000 rpm for 20 min at 4°C. The supernatant was then filtered through a 0.22 μm filter to remove cell debris. Protein purification was performed using a Blue Sepharose 6 Fast Flow pre-packed column (Cytiva, 17094801). The column was first equilibrated with 10 column volumes of PBS (pH=7.4), and protein was slowly added. The HSA domains specifically bound to the packing material. The column was then washed with 10 column volumes of PBS containing 0.5 M NaCl. Elution buffer (0.1 M Tris-HCl + 2 M KSCN, pH=7.4) was added to elute the protein. The collected protein solution was immediately dialyzed against PBS to remove KSCN, and then concentrated to 5 mg / mL using a 10 kDa ultrafiltration tube. 3 μg of the pre-purified recombinant human HSA was analyzed by SDS-PAGE, and the results are as follows: Figure 1 As shown in the figure, M represents the protein molecular weight standard, and lane 1 is the gel image of recombinant human HSA in the non-reduced state. There is a clear single band in the figure, corresponding to a molecular weight of about 67 kDa. The theoretical molecular weight of recombinant human HSA is 66.5 kDa. The difference between the two is due to the glycosylation modification of CHO-S during the expression process, which is within a reasonable range.

[0035] Example 4: Preparation of fusion protein BQFu

[0036] Purchase BQ-123 (MCE, Cat No. HY-12378) and Fmoc-NH-PEG4-COOH (Sigma-Aldrich, Cat No. 8.51036). Dissolve BQ-123 in DMSO to prepare a 5 mM solution, and dissolve Fmoc-NH-PEG4-COOH in DMSO to prepare a 15 mM solution. Take 100 μL of Fmoc-NH-PEG4-COOH solution into a clean 1.5 mL EP tube, add 1.5 μmol EDC-HCl, 1.5 μmol HOBt-H2O, and 3 μmol DIEA, and activate at room temperature for 20 min. Add the activated Fmoc-NH-PEG4-COOH dropwise to the BQ-123 solution to make the total volume approximately 400 μL, and stir the reaction at room temperature for 2 h. After the reaction was complete, the reaction system was transferred to 10 mL of pre-cooled diethyl ether, placed at -20 °C for 30 min, centrifuged at 12000 rpm for 10 min, and the supernatant was discarded. The precipitate was then dried under vacuum. The precipitate was dissolved in 5% piperidine dissolved in DMF, placed at room temperature for 30 min, precipitated again with diethyl ether, and dried under vacuum to obtain aminated BQ-123, i.e., NH2-BQ-123. NH2-BQ-123 was dissolved in DMSO to prepare a 10 mM solution, and NHS-PEG4-Maleimide was added at a molar ratio of 1:2, followed by TEA at a molar ratio of 1:10. The reaction was carried out at room temperature for 60 min to obtain Mal-PEG4-BQ-123.

[0037] The recombinant HSA was diluted to 1 mg / mL with PBS. TCEP was prepared as a 100 mM stock solution in PBS. 1 μL of the TCEP stock solution was added to 1 mL of HSA, and the mixture was gently pipetted to mix. The mixture was allowed to stand at room temperature for 30 min. A 10 kDa ultrafiltration tube was used, and the reduced HSA solution was added. The tube was centrifuged at 12000 g for 10 min. The filtrate was discarded, and PBS was added to the ultrafiltration tube. Ultrafiltration was repeated twice to obtain activated HSA-SH. 1 mL of 1 mg / mL HSA-SH was taken, and 120 μL of 1 mM Mal-PEG4-BQ-123 was added. The mixture was mixed and incubated overnight at 4 °C in the dark. The next day, the entire reaction mixture was transferred to a 10 kDa ultrafiltration tube, centrifuged at 12000 g for 10 min, and the ultrafiltrate was discarded. PBS was added, and ultrafiltration was repeated three times. The recovered solution was concentrated to 1 mg / mL, which was the fusion protein BQFu. Because only the Cys group at position 34 of the recombinant HSA is exposed as a free thiol (-SH), the coupling position is specific; the other Cys groups are used to form disulfide bonds. 3 μg of BQFu was analyzed by SDS-PAGE, and the results are as follows: Figure 2 As shown in the figure, there is a single band around 68 kDa, indicating a molecular weight slightly higher than 68 kDa. Figure 1 Recombinant human HSA in the middle.

[0038] Example 5: Detection of the inhibitory effect of BQFu on ET-1-induced increase in intracellular calcium flux.

[0039] Digesting CHO-ET a R cells were counted, and the cells were resuspended in complete culture medium to a concentration of 2.5 x 10⁻⁶. 5 Cells / mL: Add 80 μL of cell suspension per well to a 96-well cell culture plate and incubate at 37°C and 5% CO2 for 24 h until cells adhere and confluence reaches 70–80%. Prepare a 2 mM stock solution of Fluo-4 AM using DMSO, then dilute the stock solution to a 2 μM working solution using the detection solution. The detection solution formula is as follows: 1×HBSS + 20 mM HEPES (pH=7.4) + 0.04% Pluronic F-127 + 0.1% BSA. Fluo-4 AM should be prepared fresh for each use and kept in the dark throughout the preparation process. Discard the cell culture medium, add 100 μL of Fluo-4 working solution to each well, incubate at 37°C in the dark for 30 min, discard the free probe, wash once with 200 μL of preheated detection solution to each well and discard. Add another 100 μL of detection solution and equilibrate at 37°C in the dark for 15 min. Add 100 μL of the sample to be tested to each well. Both BQ-123 and BQFu were serially diluted 5-fold using the detection solution, with a maximum final concentration of 1 μM. HSA at a final concentration of 1 μM served as a negative control, and wells containing only the detection solution served as blank controls. Incubate at 37°C in the dark for 15 min. Quickly add 50 μL of ET-1 working solution (final concentration 1.5 nM) to each well. Immediately after sample addition, transfer to a microplate reader and begin reading continuously for 60 s. Microplate reader parameters were set as follows: 485 nm excitation, 525 nm emission, 1 s / point Kinetic Model, 37°C, 60 s. Inhibition rate calculation: inhibition (%) = (1 - F sample / F blank) * 100%, where F is the maximum fluorescence value read by the microplate reader after ET-1 stimulation. Inhibition rate curves are shown below. Figure 3 The horizontal axis represents the sample concentration (Log10), and the vertical axis represents the inhibition rate. Figure 3 As shown, the IC50 of BQ-123 is 3.466 nM, and the IC50 of BQFu is 6.43 nM. Therefore, the BQ-123 module in BQFu remains active after fusion and can block the increase in intracellular calcium flux signal induced by ET-1.

[0040] Example 6: Application of BQFu in a propofol-induced hypotensive SD rat model

[0041] Thirty male SD rats aged 8-10 weeks were selected. They were fasted for 12 hours prior to the experiment but allowed normal water intake. The animals were randomly divided into 5 groups of 6 rats each (grouping scheme shown in Table 2). After initial anesthesia, the animals were fixed in a supine position on a 37℃ constant-temperature operating table. The bilateral inguinal regions were shaved and disinfected with iodine. A 1.0–1.5 cm longitudinal skin incision was made below the inguinal ligament. The muscles and fascia were bluntly dissected to expose the femoral nerve-femoral artery-femoral vein bundle. The artery was carefully dissected approximately 1 cm, avoiding traction on the femoral nerve. The distal end of the artery was ligated with 8-0 silk suture, and the proximal end was temporarily clamped with an arterial clamp. A small oblique incision was made in the arterial wall using the bevel of a 1 mL syringe needle, and a PE-50 catheter pre-filled with 100 U / mL heparin was inserted. The insertion depth was 2.5–3.0 cm, with the tip positioned in the lower segment of the external iliac artery. The proximal end of the catheter was ligated with silk suture to fix it. The arterial clamp was released, and bright red arterial blood return was observed. After femoral artery cannulation, a pressure sensor was connected, and PowerLab was used to continuously monitor MAP (mean arterial pressure), HR (heart rate), and ECG. Baseline blood pressure was recorded after 30 minutes of stabilization. Blood pressure and heart rate were recorded at 0, 5, 10, 15, 30, 60, 90, and 120 minutes after tail vein administration. Propofol was administered intravenously, and the magnitude of MAP decrease, lowest blood pressure value, and time required for recovery to 80% of baseline blood pressure were continuously monitored.

[0042] Figure 4 The mean arterial pressure (MAP) decreased significantly in the saline group after anesthesia induction, with a maximum decrease of 40%–60%. There was no significant difference in blood pressure changes between the HSA control group and the saline group. The small molecule BQ-123 reduced the maximum MAP decrease to 20%–30%, and the fusion protein BQFu dose-dependently inhibited anesthesia-induced hypotension. In the G3 group, the maximum MAP decrease was controlled at 15%–25%, and the effect remained stable throughout the 2-hour observation period, demonstrating a long-lasting and stable circulatory stabilizing effect, suggesting its promising application in preventing anesthesia-induced hypotension (t-test, p<0.01).

[0043] The baseline arterial pressure (MAP) was approximately 100 mmHg. In both the saline and HSA control groups, MAP decreased significantly after anesthesia induction, with the lowest value only 40–62 mmHg, and the time required to recover to 80% of the baseline blood pressure exceeded 60 minutes. The small molecule BQ-123 significantly reduced the degree of hypotension, maintaining the lowest MAP at 70–80 mmHg and shortening the recovery time to 30 minutes, but its duration of action was short. The fusion protein BQFu improved hypotension during anesthesia induction in a dose-dependent manner. The lowest MAP in the low-dose group was 60–75 mmHg, with a recovery time of 30–45 minutes; the highest MAP in the high-dose group reached 70–90 mmHg, rapidly recovering to a safe level in about 20 minutes, and its effect remained stable throughout the 2-hour observation period, demonstrating a long-lasting and stable circulatory protective advantage.

[0044] Table 2 Experimental Groups

[0045] serial number Group drug dose G1 saline control group physiological saline - G2 BQ-123 control group BQ-123 0.3 mg / kg G3 experimental group BQFu 30mg / kg G4 experimental group BQFu 10mg / kg G5 HSA control group HSA 30mg / kg

[0046] Table 3. Statistics of the lowest blood pressure values ​​and blood pressure recovery time for each group.

[0047] Group Lowest blood pressure value (mmHg) Time (min) required to restore blood pressure to 80% of baseline. G1 45.9±10.7 75.4±15.2 G2 77.8±9.30 32.7±9.30 G3 80.2±10.6 20.8±10.5 G4 65.2±12.4 37.2±11.8 G5 47.6±9.88 72.8±18.3

[0048] Note: "Blood pressure recovery time" refers to the time required for blood pressure to return to 80% of the baseline blood pressure.

[0049] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An endothelin A receptor antagonist-albumin fusion protein, characterized in that, It contains BQ-123 and mature HSA protein, wherein BQ-123 is modified on Cys34 of HSA.

2. The fusion protein according to claim 1, characterized in that, The BQ-123 is Cyclo (D-Trp-D-Asp-Pro-D-Val-Leu).

3. A gene encoding the fusion protein of claim 1.

4. A recombinant expression vector, characterized in that, It contains the gene described in claim 3.

5. A recombinant host cell, characterized in that, It comprises the expression vector of claim 4, wherein the host cell is a CHO cell.

6. A pharmaceutical composition, characterized in that, It comprises the fusion protein of claim 1 and a pharmaceutically acceptable carrier.

7. The use of the fusion protein of claim 1 in the preparation of drugs for preventing and treating hypotension during the anesthesia induction period.

8. The application according to claim 7, characterized in that, The drug is administered intravenously.