A method for detecting pathogenic bacteria based on magnetic encoding and microfluidic separation system

Abstract

This invention relates to a method for detecting pathogenic bacteria based on magnetic coding and a microfluidic separation system, belonging to the field of microbial analysis and detection technology. The core of the magnetic coding-based spatial separation system of this invention includes a single-channel microfluidic chip, a 3D-printed magnetic separation module, and a fluorescence-UV dual-mode detection light source and a fluorescence-UV dual-mode probe. The microfluidic device of this invention can precisely control the fluid dynamics and magnetic field gradient distribution within the channel, thereby efficiently manipulating and separating magnetic nanospheres, further enhancing the accuracy of multi-target analysis. Simultaneously, the directional enrichment of magnetically labeled particles within the microchannel can directly eliminate the lengthy sample concentration step, significantly shortening the total analysis time. Combined with optical or electrochemical sensors, it can achieve rapid real-time detection of target molecules.

Description

Technical Field

[0001] This invention relates to the field of microbial analysis and detection technology, and in particular to a method for detecting pathogens based on magnetic coding and microfluidic separation systems. Background Technology

[0002] The public health crisis caused by pathogen contamination is becoming increasingly severe. It is not only a core cause of foodborne disease outbreaks, the spread of clinical infections, and environmental biosafety risks, but also poses a continuous challenge to the safety of the food supply chain and the prevention and control capabilities of the medical system. Complex scenarios are frequently encountered in clinical settings, such as mixed infections of multidrug-resistant bacteria and opportunistic pathogens, the simultaneous presence of multiple pathogens such as Salmonella, Listeria, and pathogenic Escherichia coli on a single carrier in the food production chain, and the combined contamination of pathogens and putrefactive bacteria in environmental water bodies. Traditional single-target detection technologies have significant shortcomings: culture methods take 3-7 days, making them unsuitable for emergency screening needs and unable to cover unculturable strains; conventional ELISA technology is susceptible to cross-reaction interference in low-concentration multi-target coexistence systems, resulting in a high false-positive rate; while traditional PCR technology has high specificity, it can only detect a single target per experiment, and the sample pretreatment process is cumbersome and relies on specialized equipment, failing to meet the actual needs of "rapid response and comprehensive screening" in multi-contamination scenarios.

[0003] Against this backdrop, developing a multi-target pathogen simultaneous detection technology that combines high sensitivity, high specificity, and ease of operation is not only an urgent need to solve the problems of low detection efficiency and high risk of missed detection in current complex contamination / infection scenarios, but also a key support for achieving precise public health prevention and control, food quality and safety traceability, and early diagnosis of clinical infections. It has important practical significance for improving public health emergency response capabilities, reducing the incidence of foodborne diseases, and protecting public health. It is also a core direction for breaking through the bottlenecks of existing detection technologies and promoting the upgrading of pathogen prevention and control systems. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a method for detecting pathogens based on magnetic coding and a microfluidic separation system. Specifically, it comprises a magnetically coded spatial separation system and a method for simultaneously detecting multiple pathogens on a single-channel microfluidic chip. This system integrates a dual-mode aptamer sensor, enabling rapid and accurate on-site detection of multiple pathogens. The core of the magnetically coded spatial separation system of this invention includes a single-channel microfluidic chip, a 3D-printed magnetic separation module, and a fluorescence-UV dual-mode detection light source and a fluorescence-UV dual-mode probe. The single-channel microfluidic chip is fabricated using computer numerical control (CNC) technology and, after assembly with the 3D-printed magnetic module and detection module, forms a compact on-site separation and fluorescence-UV detection platform. This eliminates the need for complex multi-channel network structures, reducing device manufacturing difficulty and platform size.

[0005] The microfluidic device of this invention can precisely control the fluid dynamics and magnetic field gradient distribution within the channel, thereby efficiently manipulating and separating magnetic nanospheres and further enhancing the accuracy of multi-target analysis. At the same time, the directional enrichment of magnetically labeled particles within the microchannel can directly eliminate the lengthy sample concentration steps, significantly shortening the total analysis time. When combined with optical or electrochemical sensors, it can also achieve rapid real-time detection of target molecules.

[0006] This invention is achieved through the following technical solution:

[0007] The purpose of this invention is to provide a method for detecting pathogens based on magnetic coding and microfluidic separation systems, comprising the following steps:

[0008] S1. Weakly magnetic magnetic coding materials W-MNSs and strongly magnetic magnetic coding materials S-MNSs loaded with Fe3O4 were prepared by reverse microemulsion method; after amino modification, amino-modified W-MNSs and amino-modified S-MNSs were obtained.

[0009] S2. The obtained amino-modified W-MNSs and amino-modified S-MNSs are coupled with activated carbon dots to obtain W-MNSs-CDs and S-MNSs-CDs, respectively; then the obtained W-MNSs-CDs and S-MNSs-CDs are coupled with the cDNA of pathogens to obtain S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA, respectively.

[0010] S3. Gold nanoparticles AuNPs are coupled with the aptamer Apt of pathogenic bacteria to obtain AuNPs-Apt.

[0011] S4. The obtained S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA are hybridized with the corresponding AuNPs-Apt to form fluorescent-UV dual-mode probes S-MNSs-CDs-cDNA-AuNPs-Apt and W-MNSs-CDs-cDNA-AuNPs-Apt, respectively; the obtained fluorescent-UV dual-mode probes are incubated with a solution containing the target pathogen to obtain a mixed solution;

[0012] S5. The resulting mixed solution is injected into a single-channel microfluidic chip. When passing through the 3D-printed magnetic separation module, separation is completed under an external gradient magnetic field. Fluorescence and ultraviolet absorption data are collected to quantitatively detect the concentration of pathogens.

[0013] In one embodiment of the present invention, the magnetic coding and microfluidic separation system includes a fluorescence-ultraviolet dual-mode probe, a single-channel microfluidic chip, a 3D-printed magnetic separation module, and a 3D-printed signal detection and acquisition module; the 3D-printed magnetic separation module and the 3D-printed signal detection and acquisition module include intelligent quantitative analysis and a fluorescence-ultraviolet dual-mode detection light source;

[0014] The fluorescent-UV dual-mode probes include S-MNSs-CDs-cDNA-AuNPs-Apt and W-MNSs-CDs-cDNA-AuNPs-Apt.

[0015] In one embodiment of the present invention, in step S1, the weakly magnetic magnetic coding material W-MNSs is prepared by the following method:

[0016] Under mechanical stirring, an oil phase, a surfactant, and a co-surfactant were added to a reaction vessel and mixed and stirred. Fe3O4NPs, a cationic polymer solution, and a silicon source precursor were added and stirred to obtain a reaction precursor solution.

[0017] Ammonia was added to the reaction precursor solution to react, a demulsifier was added to destroy the microemulsion structure, the solid precipitate was collected by centrifugation, and an external magnetic field was applied for 240 s-250 s to obtain the weakly magnetic magnetic coding material W-MNSs.

[0018] In one embodiment of the present invention, in step S1, the strongly magnetic coding material S-MNSs is prepared by the following method:

[0019] Under mechanical stirring, an oil phase, a surfactant, and a co-surfactant were added to a reaction vessel and mixed and stirred. Fe3O4NPs, a cationic polymer solution, and a silicon source precursor were added and stirred to obtain a reaction precursor solution.

[0020] Ammonia was added to the reaction precursor solution to react, a demulsifier was added to destroy the microemulsion structure, the solid precipitate was collected by centrifugation, and an external magnetic field was applied for 40-50 s to obtain the strongly magnetic magnetic coding material S-MNSs.

[0021] In one embodiment of the present invention, in step S1, the amino modification is: using a silane coupling agent to modify the weakly magnetic magnetic coding material W-MNSs and the strongly magnetic magnetic coding material S-MNSs respectively.

[0022] In one embodiment of the present invention, in step S2, the activated carbon dots are obtained by mixing carbon dots with EDC / NHS in a buffer solution and then sonicating.

[0023] In one embodiment of the present invention, in step S2, the pathogenic bacteria are Staphylococcus aureus and Escherichia coli;

[0024] And / or, the cDNA of the pathogen includes cDNA of Staphylococcus aureus and cDNA of Escherichia coli;

[0025] The cDNA of the Staphylococcus aureus is: 5′-NH2-TTAGCAAAGTAGCGT-3′ (SEQ ID NO.1);

[0026] The cDNA of the *E. coli* is: 5′-NH2-GCTCTATGCCACCTAGTGTC-3′ (SEQ ID NO.2).

[0027] In one embodiment of the present invention, in step S3, the aptamer Apt of the pathogenic bacteria includes Ap of Staphylococcus aureus and Apt of Escherichia coli.

[0028] The Apt sequence of the Staphylococcus aureus is: 5′- GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA-SH-3′ (SEQ ID NO.3);

[0029] The Apt sequence of the *E. coli* is: 5′- CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG – SH- 3′ (SEQ ID NO.4).

[0030] In one embodiment of the present invention, in step S5, the injection flow rate of the mixed solution is 23 μL / min. -1 -27μL min -1 .

[0031] In one embodiment of the present invention, in step S5, the concentration of pathogens in the test solution is 10. 1 CFU·mL −1 -10 7 CFU·mL −1 .

[0032] The detection principle of this invention is as follows: Under the action of a magnetic field, by adjusting the intensity of the action, quantitative capture of CDs-MNSs composite materials with specific magnetic properties can be achieved, and this spatial separation process can be completed within a single microfluidic channel.

[0033] During the detection process, a portable magnetic separator was used to perform magnetic separation of the mixed sample. A 3D-printed magnetic separator was used to spatially separate CDs-MNSs composite materials with different magnetic intensities at different locations in the detection area. Subsequently, a visible spectrum sensor was used to detect changes in fluorescence and ultraviolet absorption signals at each separation location. The detection data was read and analyzed using a computer application to obtain the specific concentration measurement value of the target pathogen.

[0034] Using a 3D-printed magnetic separation module, strongly magnetic beads are captured in a weakly magnetic circular region at the inlet of a single-channel microfluidic chip under the influence of a gradient magnetic field. Weakly magnetic beads are captured in a strongly magnetic circular region further away from the chip inlet.

[0035] After separating, capturing, and enriching different magnetic beads using a microfluidic chip and a magnetic separation device, the captured magnetic beads are detected using a 3D printing signal detection device. The detection data is then read and analyzed using a computer application to obtain the specific concentration measurement value of the target pathogen.

[0036] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:

[0037] (1) Simplified channel design and high device integration: Existing research often relies on complex multi-channel microfluidic structures, which require high-precision microfabrication processes, resulting in high costs and cumbersome operation. This invention achieves multi-target spatial separation within a single-channel microfluidic chip through a magnetic coding strategy, completely eliminating the reliance on complex multi-channel structures and significantly reducing the complexity and cost of device manufacturing. Existing magnetic separation detection systems often require multiple independent external modules, resulting in large size and poor portability. This invention integrates a self-developed 3D-printed magnetic separation device and detection unit to form a compact detection platform that does not require complex external equipment and is more suitable for rapid on-site detection scenarios such as food safety and environmental monitoring.

[0038] (2) Dual-mode sensing and magnetic coding provide dual protection for superior detection performance: Existing detection methods mostly use a single signal (fluorescence only or ultraviolet only), which is easily affected by interference. This invention achieves differentiated magnetic response by "coating MNSs with different Fe contents with SiO2" on the one hand, and constructs a fluorescence recovery-ultraviolet absorption dual-mode sensing mechanism by combining CDs fluorescent labeling and AuNPs aptamer recognition on the other hand. The dual signals work together to improve the detection specificity and accuracy, avoiding the risk of misjudgment by a single signal.

[0039] (3) High scalability and support for high-throughput detection: This invention expands the number of analytes to be detected by increasing the types of magnetically encoded probes. Theoretically, it can achieve high-throughput detection of multiple targets by simply extending the microfluidic channel, thus solving the bottleneck of "difficult expansion and low throughput" in the existing technology. Attached Figure Description

[0040] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0041] Figure 1 This is a schematic diagram illustrating the operation and separation principle of the pathogen detection system based on magnetic coding and microfluidic separation in this invention.

[0042] Figure 2 These are images of the 3D printing signal detection and acquisition device of this invention; wherein, A is the 3D printing detection device; B is the fluorescence and ultraviolet signal receiving device; C is the light source device; and D is the laptop computer signal output device.

[0043] Figure 3 These are images of the 3D-printed magnetic separation device in this invention;

[0044] Figure 4 These are the detection results of fluorescence and ultraviolet signals using the signal acquisition device in this invention; wherein, A is the detection result of fluorescence signal of the target Staphylococcus aureus; B is the detection result of fluorescence signal of the target Staphylococcus aureus; C is the detection result of fluorescence signal of the target Escherichia coli; and D is the detection result of fluorescence signal of the target Escherichia coli. Detailed Implementation

[0045] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0046] The purpose of this invention is to provide a method for detecting pathogens based on magnetic coding and microfluidic separation systems (operation and separation principle diagram shown in the figure). Figure 1 As shown in the figure, this method integrates a dual-mode aptamer sensor and a single-channel microfluidic chip to achieve rapid and accurate detection of various pathogens such as Staphylococcus aureus and Escherichia coli, including the following steps:

[0047] S1. Microfluidic Chip: The sample introduction area of ​​this self-designed chip adopts a serpentine channel, 800 μm wide and 800 μm deep. Subsequently, magnetic beads are enriched in a circular enrichment region with a depth of 800 μm and a radius of 3.27 mm in the main reaction channel.

[0048] S2. 3D Printed Magnetic Separation Module: When the mixed solution flows through the magnetic separation area of ​​the 3D printed magnetic separation module, the magnetic beads in the solution are precisely adsorbed onto specific areas of the module by an externally applied gradient magnetic field, achieving efficient separation of the detection magnetic beads from impurity components and improving the enrichment efficiency of the target substance.

[0049] S3. 3D Printing Signal Detection and Acquisition: After magnetic separation is completed, the light source of the 3D printed detection module is replaced to start the fluorescence signal and ultraviolet absorption signal acquisition process. The fluorescence intensity and ultraviolet absorption value of the specific label are captured by dual signal detection technology. The dual signal data provide complementary basis for subsequent quantitative analysis and enhance the reliability of the detection results.

[0050] S4. Intelligent Analysis: Import the collected fluorescence and UV absorption raw data into the matching data processing software, and output the fluorescence intensity and UV absorption value to achieve rapid quantification of pathogen content in the sample.

[0051] S5. Integrated Detection Closed-Loop Construction: Utilizing microfluidic chips, 3D-printed magnetic separation modules, and 3D-printed signal detection and acquisition (device diagram shown) Figures 2-3 As shown in the figure, a closed-loop detection process is constructed, from sample injection and magnetic separation enrichment to signal acquisition and quantitative output. This design significantly shortens the detection cycle and reduces operational complexity, making it suitable for practical application needs in on-site rapid detection scenarios.

[0052] In this invention, the magnetically encoded spatial separation system includes a single-channel microfluidic chip, a 3D-printed magnetic separation module, a 3D-printed signal detection and acquisition system, an intelligent quantitative analysis system, and a fluorescence-ultraviolet dual-mode detection light source.

[0053] In this invention, the 3D printed magnetic separation module is designed and modeled using Creo Parametric software and 3D printed using nylon material. The magnetic separation module includes two regions: a strong magnetic field and a weak magnetic field.

[0054] In this invention, a 3D-printed signal detection and acquisition device is designed and modeled using Creo Parametric software and 3D printed using nylon material. It includes a light source placement area and a detection element placement area. A 385nm lamp is used for fluorescence signal detection, and a 520nm lamp is used for ultraviolet absorption value detection.

[0055] In this invention, intelligent quantitative analysis uses signal output software on a laptop computer to output the detected fluorescence and ultraviolet signals.

[0056] In this invention, a single-channel microfluidic chip, a 3D printing magnetic separation module, a 3D printing signal detection and acquisition, an intelligent quantitative analysis and a fluorescence-ultraviolet detection light source are integrated. The signal is output through a laptop computer, and the target concentration is calculated.

[0057] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are commercially available.

[0058] The microfluidic chip was manufactured by Shenzhen Bowang Chuxin Semiconductor Technology Co., Ltd., and it needs to meet the requirement of stable mechanical properties after curing. The specific method is as follows: the PMMA template is processed by CNC. The A glue (polydimethylsiloxane prepolymer) and B glue (siloxane oligomer containing crosslinking agent) of PDMS are mixed evenly and poured into the mold. The mold is covered with a glass plate and baked in an oven at 80°C for 120 minutes. After cooling, the mold is removed. After surface plasma treatment, it is bonded to a glass slide and fixed in an oven at 80°C for 15 minutes.

[0059] Example 1: Preparation of Fe3O4@SiO2 MNSs with different magnetic strengths.

[0060] Under mechanical stirring, 7.5 mL of cyclohexane, 1.8 mL of Triton X-100, and 1.6 mL of n-hexanol were added sequentially to a flask. After stirring for 30 min, 0.8 mL of Fe3O4NPs, 0.1 mL of PDDA solution, and 0.1 mL of TEOS (tetraethyl orthosilicate) were added. After stirring for 20 min, 0.12 mL of ammonia solution was added and the reaction was carried out for 24 h. After the reaction was completed, 20 mL of acetone was added to disrupt the microemulsion system. The precipitate was collected by centrifugation at 5000 rpm for 10 min. By controlling the duration of the external magnetic field (40 s and 240 s), MNSs complexes that did not meet the required magnetic field strength range were separated and removed, finally yielding weakly magnetically encoded materials W-MNSs and strongly magnetically encoded materials S-MNSs.

[0061] Example 2: Synthesis of MNSs-CDs-cDNA magnetic / fluorescent nanocomposite material.

[0062] Take 30 mg of S-MNSs or W-MNS and dissolve 15 μL of APTES (3-aminopropyltriethoxysilane) in 30 mL of anhydrous ethanol, stir the reaction for 24 h, and dry under vacuum at 50 °C for 12 h to obtain amino-modified S-MNSs or amino-modified W-MNS.

[0063] Dissolve 5 mg of EDC / NHS in 1 mL of PBS buffer (10 mM, pH 7.4). Mix 100 μL of CDs (carbon dots) solution with 100 μL of the EDC / NHS solution and sonicate for 30 min. Add 20 μL of the reaction solution to PBS buffer containing 80 μL of amino-modified S-MNSs or amino-modified W-MNSs. Incubate at 25 °C for 24 h. Collect the product with a magnet to obtain S-MNSs-CDs and W-MNSs-CDs.

[0064] Mix 100 μL of S-MNSs-CDs solution or W-MNSs-CDs solution with 100 μL of EDC / NHS solution and sonicate for 30 min. Take 80 μL of this reaction solution and add PBS buffer containing 20 μL of 5 μM specific cDNA (W-MNSs-CDs ligated with Staphylococcus aureus cDNA, and S-MNSs-CDs ligated with Escherichia coli cDNA). Incubate at 37°C for 12 h and collect the product with a magnet to obtain S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA.

[0065] The cDNA sequence of Staphylococcus aureus is: 5′-NH2-TTAGCAAAGTAGCGT-3′ (SEQ ID NO.1).

[0066] The cDNA sequence of Escherichia coli is: 5′-NH2-GCTCTATGCCACCTAGTGTC-3′ (SEQ ID NO.2).

[0067] Example 3: Synthesis of gold nanoparticles (AuNPs) and coupling with SH-modified aptamers.

[0068] AuNPs synthesis: 100 mL of chloroauric acid solution (0.01%, w / v) was added to a round-bottom flask, stirred and heated to boiling at 300 rpm, and 1 mL of trisodium citrate solution (2%, w / v) was quickly added. The mixture was stirred and heated for 15 min until the solution turned wine-red. The AuNPs solution was centrifuged at 10000 rpm for 15 min, and the precipitate was resuspended in 10 mM PBS solution. 0.01% PVP was added to prevent AuNPs aggregation. 12 μL of -SH modified ssDNA (37.5 μM) was added to 24 μL TCEP solution (2 mM) and incubated for 1 h to reduce disulfide bonds. Subsequently, 252 μL of purified AuNPs and 12 μL of NaCl solution (1 M) were added, and the mixture was incubated at -20℃ for 2 h, then transferred to a 25℃ dark environment for 12 h. The AuNPs-Apt complex was collected by centrifugation at 12000 rpm for 15 min, and the precipitate was resuspended in 300 μL of PBS solution. In Tris-HCl buffer (pH 7.4).

[0069] The Apt sequence of Staphylococcus aureus is: 5′- GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA-SH-3′ (SEQ ID NO.3);

[0070] The Apt sequence of Escherichia coli is: 5′- CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG– SH- 3′ (SEQ ID NO.4).

[0071] Co-incubation of target and detection probe: 100 μL of S-MNSs-CDs-cDNA, 100 μL of W-MNSs-CDs-cDNA and 100 μL of the corresponding AuNPs-Apt were hybridized at 37℃ for 6 h to form S-MNSs-CDs-cDNA-AuNPs-Apt and W-MNSs-CDs-cDNA-AuNPs-Apt FRET aptamer pairs. Then, the target Staphylococcus aureus and Escherichia coli were added to the solution and incubated at 37℃ for 1 h to obtain a magnetic bead mixed solution.

[0072] Example 4: 3D printing magnetic separation device performs magnetic separation on samples.

[0073] After modeling using Creo Parametric software, a gradient magnetic field was constructed on the magnetic separation device by adjusting the distance between the magnet and the top of the separation device. A detection device was printed using nylon. The detection device was then placed on the detection channel, with either a fluorescence or ultraviolet light source placed in the respective channel. The detection device was then connected to a laptop computer via a data cable. By changing the codes for fluorescence or ultraviolet absorption intensity, the corresponding detection light source was matched; fluorescence detection was matched with a 385 nm light source, and ultraviolet absorption detection was matched with a 520 nm light source, thus achieving the assembly of the signal detection device and signal acquisition. Figure 2 ).

[0074] Take 400 μL of the magnetic bead mixture obtained in Example 3 (500 μg mL) −1 ), respectively at 20 μL min −1 25 μLmin −1 30 μL min −1 40 μL min −1 60 μL min −1 100 μL min −1 The MNSs were injected into the microfluidic chip at a flow rate of 25 μL / min; an external magnetic field was applied to trap them at the bottom of the glass in the separation chamber, and the outlet liquid was collected to measure the fluorescence intensity. Using the initial solution as a control, the trapping efficiency was calculated, and the optimal flow rate was determined to be 25 μL / min. −1 ;

[0075] Example 5: Plotting the standard curves for the concentrations of Escherichia coli and Staphylococcus aureus.

[0076] (1) Mix the aqueous solution of the obtained aptamer pairs with 200 μL of Staphylococcus aureus and Escherichia coli of equal concentration gradient (each of which has a concentration of 10 μL). 1 CFU·mL −1 10 2 CFU·mL −1 10 3 CFU·mL −1 10 4 CFU·mL −1 10 5 CFU·mL −1 10 6 CFU·mL −1 10 7 CFU·mL −1 After incubation with the mixed aqueous solution of ), the solution was added at a rate of 25 μL / min. −1 The flow rate was injected into the microfluidic chip; after separation, the chip was transferred to a portable detection platform, and the fluorescence intensity and ultraviolet absorption intensity data were collected by computer; all experiments were independently repeated 3 times, and the data were expressed as mean ± standard deviation (SD).

[0077] (2) The linear relationship between fluorescence and ultraviolet absorption intensity in the solution was calculated and plotted. For example... Figure 4 As shown, using a microfluidic device for separation and detection, the fluorescence intensity increased linearly with increasing concentrations of Staphylococcus aureus and Escherichia coli, with linear regression equations of y = 3374x – 3432 (R²). 2 = 0.9948), y =3515x − 4755 (R 2 = 0.9964). The UV absorption intensity increased linearly with increasing concentrations of Staphylococcus aureus and Escherichia coli, with linear regression equations of y = 0.04993x − 0.0533 (R = 0.9964). 2 = 0.9937), y =0.04639x − 0.0617 (R 2 = 0.9923). The detection limits for Staphylococcus aureus and Escherichia coli were 18 CFU·mL, respectively. −1 30 CFU·mL −1 .

[0078] Example 6: Determination of the concentrations of Escherichia coli and Staphylococcus aureus in actual samples.

[0079] To further verify the practical application and analytical reliability of the magnetically encoded spatial separation system for detecting pathogens, actual pond water samples were analyzed. The analytical capability of the aptamer sensor for these actual samples was evaluated using the standard sample addition method, with each sample tested three times. The results are shown in Tables 1 and 2:

[0080] Table 1. Fluorescence test results of Staphylococcus aureus and Escherichia coli

[0081]

[0082] Table 2. Results of UV test for Staphylococcus aureus and Escherichia coli

[0083]

[0084] Based on the results in Tables 1 and 2, the recoveries of samples detected by fluorescence signals were 86%–119%, with RSDs of 2.55%–10.11%, while the recoveries of samples detected by ultraviolet signals were 93%–114%, with RSDs of 5.06%–9.71%. These results indicate that the magnetically encoded spatially separated biosensors have great potential for detecting Staphylococcus aureus.

[0085] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A method for detecting pathogenic bacteria based on magnetic coding and a microfluidic separation system, characterized in that, Includes the following steps: S1. Weakly magnetic magnetic coding materials W-MNSs and strongly magnetic magnetic coding materials S-MNSs loaded with Fe3O4 were prepared by reverse microemulsion method; after amino modification, amino-modified W-MNSs and amino-modified S-MNSs were obtained. S2. The obtained amino-modified W-MNSs and amino-modified S-MNSs are coupled with activated carbon dots to obtain W-MNSs-CDs and S-MNSs-CDs, respectively; then the obtained W-MNSs-CDs and S-MNSs-CDs are coupled with the cDNA of pathogens to obtain S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA, respectively. S3. Gold nanoparticles AuNPs are coupled with the aptamer Apt of pathogenic bacteria to obtain AuNPs-Apt. S4. The obtained S-MNSs-CDs-cDNA and W-MNSs-CDs-cDNA are hybridized with the corresponding AuNPs-Apt to form fluorescent-UV dual-mode probes S-MNSs-CDs-cDNA-AuNPs-Apt and W-MNSs-CDs-cDNA-AuNPs-Apt, respectively; the obtained fluorescent-UV dual-mode probes are incubated with a solution containing the target pathogen to obtain a mixed solution; S5. The resulting mixed solution is injected into a single-channel microfluidic chip. When passing through the 3D-printed magnetic separation module, separation is completed under an external gradient magnetic field. Fluorescence and ultraviolet absorption data are collected to quantitatively detect the concentration of pathogens.

2. The method according to claim 1, characterized in that, The magnetic coding and microfluidic separation system includes a fluorescence-ultraviolet dual-mode probe, a single-channel microfluidic chip, a 3D-printed magnetic separation module, and a 3D-printed signal detection and acquisition module; the 3D-printed magnetic separation module and the 3D-printed signal detection and acquisition module include intelligent quantitative analysis and a fluorescence-ultraviolet dual-mode detection light source; The fluorescent-UV dual-mode probes include S-MNSs-CDs-cDNA-AuNPs-Apt and W-MNSs-CDs-cDNA-AuNPs-Apt.

3. The method according to claim 1, characterized in that, In step S1, the weakly magnetic encoded material W-MNSs is prepared by the following method: Under mechanical stirring, an oil phase, a surfactant, and a co-surfactant were added to a reaction vessel and mixed and stirred. Fe3O4NPs, a cationic polymer solution, and a silicon source precursor were added and stirred to obtain a reaction precursor solution. Ammonia was added to the reaction precursor solution to react, a demulsifier was added to destroy the microemulsion structure, the solid precipitate was collected by centrifugation, and an external magnetic field was applied for 240 s-250 s to obtain the weakly magnetic magnetic coding material W-MNSs.

4. The method according to claim 1, characterized in that, In step S1, the strongly magnetic encoded material S-MNSs is prepared by the following method: Under mechanical stirring, an oil phase, a surfactant, and a co-surfactant were added to a reaction vessel and mixed and stirred. Fe3O4NPs, a cationic polymer solution, and a silicon source precursor were added and stirred to obtain a reaction precursor solution. Ammonia was added to the reaction precursor solution to react, a demulsifier was added to destroy the microemulsion structure, the solid precipitate was collected by centrifugation, and an external magnetic field was applied for 40-50 s to obtain the strongly magnetic magnetic coding material S-MNSs.

5. The method according to claim 1, characterized in that, In step S1, the amino modification is performed by using a silane coupling agent to modify the weakly magnetic magnetic coding material W-MNSs and the strongly magnetic magnetic coding material S-MNSs, respectively.

6. The method according to claim 1, characterized in that, In step S2, the activated carbon dots are obtained by mixing carbon dots with EDC / NHS in a buffer solution and then sonicating.

7. The method according to claim 1, characterized in that, In step S2, the pathogens are Staphylococcus aureus and Escherichia coli; And / or, the cDNA of the pathogen includes cDNA of Staphylococcus aureus and cDNA of Escherichia coli; The cDNA of the Staphylococcus aureus is: 5′-NH2-TTAGCAAAGTAGCGT-3′; The cDNA of the *E. coli* is: 5′-NH2-GCTCTATGCCACCTAGTGTC-3′.

8. The method according to claim 1, characterized in that, In step S3, the aptamer Apt of the pathogen includes Ap of Staphylococcus aureus and Apt of Escherichia coli; The Apt sequence of the Staphylococcus aureus is: 5′- GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA -SH- 3′; The Apt sequence of the *E. coli* is: 5′- CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG– SH- 3′.

9. The method according to claim 1, characterized in that, In step S5, the injection flow rate of the mixed solution is 23 μL / min. -1 -27 μL min -1 .

10. The method according to claim 1, characterized in that, In step S5, the concentration of pathogens in the test solution is 10. 1 CFU·mL −1 -10 7 CFU·mL −1 .

Images