Application of targeting ABHD17C-BCL6B-CD24 signal axis in preparation of pancreatic cancer treatment product
Patent Information
- Application Number
- CN202610305171.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-13
- Publication Date
- 2026-06-30
AI Technical Summary
Current technologies have not yet revealed the role of ABHD17C in the malignant progression of pancreatic cancer, especially in regulating macrophage phagocytic function and immune escape through depalmitoylation modification, which limits the development of related diagnostic and therapeutic targets.
Targeting the ABHD17C-BCL6B-CD24 signaling axis, this study provides a pancreatic cancer treatment strategy by regulating macrophage phagocytosis. This strategy includes agents that inhibit ABHD17C expression, promote BCL6B expression, and inhibit CD24 expression. Cell lines were constructed using CRISPR/Cas9 gene knockout technology and overexpression vectors, and the function of the signaling axis was verified through in vitro and in vivo experiments.
This study clarifies the tumor-promoting function of the ABHD17C-BCL6B-CD24 signaling axis in pancreatic cancer, providing a novel target for pancreatic cancer treatment. It restores macrophage phagocytic function, reverses immune escape, and has anti-tumor effects, providing a theoretical basis for the precise diagnosis and targeted therapy of pancreatic cancer.
Smart Images

Figure CN122297676A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to the application of targeting the ABHD17C-BCL6B-CD24 signal axis in the preparation of pancreatic cancer treatment products. Background Technology
[0002] The prognosis of pancreatic cancer is closely related to the macrophage-mediated tumor immune microenvironment. Macrophages are the most prevalent immune cell population in the pancreatic cancer tumor microenvironment (TME), and their phenotypic polarization directly determines the malignant progression of the tumor and the patient's survival prognosis. In the tumor microenvironment, resting macrophages (M0) can polarize into two main phenotypes: classically activated pro-inflammatory M1 macrophages and alternatively activated anti-inflammatory M2 macrophages. Generally, macrophages that highly express inducible nitric oxide synthase (iNOS), interferon-gamma (IFN-γ), or tumor necrosis factor-α (TNF-α) have anti-tumor effects; while macrophages that highly express interleukin-10 (IL-10), arginase-1 (Arg-1), CD163, or CD206 exhibit pro-tumor properties. Tumor cells can evade macrophage clearance by overexpressing "don't eat me" signaling molecules (such as CD24).
[0003] Phenotypic polarization, surface receptor activation, and intracellular signaling pathways in macrophages (especially TAMs) all depend on post-translational modifications of key proteins. Post-translational modifications (PTMs), including ubiquitination, methylation, phosphorylation, glycosylation, and esterification, are core mechanisms regulating protein function. Palmitoylation is an esterification modification that covalently links the 16-carbon saturated fatty acid palmitic acid to a specific cysteine residue in a protein via a thioester bond (S-palmitoylation) or an amide bond (N-palmitoylation, less common). Notably, S-palmitoylation is dynamically reversible; the palmitoylation / depalmitoylation cycle can precisely regulate protein activity, intracellular transport, subcellular localization, stability, and downstream signaling. In existing biomedical research, ABHD17C (Abhydrolase Domain Containing 17C), as a protein depalmitoylase, is one of the few validated protein cysteine S-depalmitoylases. Studies have confirmed that its catalytic activity is involved in the depalmitoylation modification of N-Ras and the regulation of intracellular membrane localization. At the same time, it can also act as an acyl protein thioesterase to promote the deacylation of NOD2.
[0004] Currently, the role of ABHD17C-mediated depalmitoylation in the malignant progression of pancreatic cancer remains a blank. Existing technologies have not yet revealed whether ABHD17C regulates macrophage phagocytic function and immune escape by intervening in "don't eat me" signals (such as CD24), limiting the development of related diagnostic and therapeutic targets. This invention aims to elucidate a novel mechanism by which ABHD17C regulates "don't eat me" signals and affects immune escape in pancreatic cancer through depalmitoylation, clarifying its application value as a diagnostic biomarker or therapeutic target, and providing new strategies for the diagnosis and treatment of pancreatic cancer. Summary of the Invention
[0005] To address the shortcomings of the above-mentioned technologies, this invention provides an application of targeting the ABHD17C-BCL6B-CD24 signaling axis in the preparation of products for the treatment and / or prognosis of pancreatic cancer. It reveals the molecular mechanism by which the ABHD17C-BCL6B-CD24 signaling axis promotes the progression of pancreatic cancer by regulating macrophage phagocytosis, and provides a pancreatic cancer treatment strategy targeting this signaling axis.
[0006] The technical solution is as follows: On the one hand, there is the application of targeting the ABHD17C-BCL6B-CD24 signal axis in the preparation of pancreatic cancer treatment products.
[0007] On the other hand, the application of targeting the ABHD17C-BCL6B-CD24 signaling axis in the preparation of pancreatic cancer prognostic products.
[0008] On the other hand, the palmitoylation agent of BCL6B is used in the preparation of pancreatic cancer treatment products.
[0009] Furthermore, the product includes at least one of a reagent that inhibits ABHD17C expression, a reagent that promotes BCL6B expression, and a reagent that inhibits CD24 expression.
[0010] On the other hand, there is the application of a signal axis targeting ABHD17C-BCL6B-CD24 in the preparation of pancreatic cancer detection products.
[0011] Furthermore, the product includes a diagnostic kit, which includes reagents for detecting ABHD17C expression, reagents for detecting BCL6B expression, and reagents for detecting CD24 expression.
[0012] Furthermore, the reagents for detecting ABHD17C include at least one of the following: reagents for detecting whether the ABHD17C gene is overexpressed, reagents for quantitatively detecting the RNA transcription level of ABHD17C, and reagents for quantitatively detecting the protein expression level of ABHD17C.
[0013] Furthermore, in the ABHD17C-BCL6B-CD24 signal axis, ABHD17C expression in pancreatic cancer tumor tissue is higher than that in normal pancreatic tissue, and high ABHD17C expression is associated with malignant phenotype and shortened survival in pancreatic cancer patients.
[0014] Furthermore, in the ABHD17C-BCL6B-CD24 signaling axis, overexpression of ABHD17C drives macrophages to polarize towards the immunosuppressive M2 type by regulating the expression of the signaling molecule CD24, thereby protecting pancreatic cancer cells from phagocytic attack by macrophages and accelerating the growth of pancreatic cancer cells.
[0015] Furthermore, in the ABHD17C-BCL6B-CD24 signaling axis, the biological function of ABHD17C depends on the depalmitoylation modification of cysteine at position 442 of BCL6B. This depalmitoylation modification enhances CD24 transcription, mediates pancreatic cancer cells' resistance to macrophage phagocytosis, and promotes pancreatic cancer progression.
[0016] Beneficial effects: This invention initially screened for abnormally high expression of ABHD17C in pancreatic cancer tissues using bioinformatics analysis of public databases. Further clinical validation was achieved using tissue microarray analysis of pancreatic cancer patient specimens, confirming that ABHD17C specifically targets pancreatic cancer cells, and that its high expression is closely associated with poor patient prognosis. This demonstrates that ABHD17C can serve as a potential molecular marker for the diagnosis and prognostic assessment of pancreatic cancer.
[0017] This invention explores the function of ABHD17C through in vitro cell experiments and in vivo animal experiments. In vitro, ABHD17C silent / knockout stable cell lines were constructed using lentiviral infection and CRISPR / Cas9 gene knockout technology. Mutant stable cells were obtained by combining overexpression vectors and site-directed mutagenesis technology. In vivo, an orthotopic CDX model of pancreas was constructed using NSG mice. Through gain-of-function and loss-of-function experiments, it was determined that ABHD17C is upregulated during the malignant transformation of pancreatic cancer and can significantly promote the progression of pancreatic cancer in vitro and in vivo. This clearly elucidates the tumor-promoting biological function of ABHD17C and lays a solid functional foundation for subsequent targeted intervention research.
[0018] This invention investigates the regulatory role of ABHD17C in the tumor immune microenvironment through a phagocytic experiment using pancreatic cancer cells co-cultured with macrophages. It confirms that ABHD17C can protect pancreatic cancer cells from TAM phagocytosis by regulating the expression of the "don't eat me" signaling molecule CD24, while simultaneously driving macrophages to polarize towards the M2 immunosuppressive phenotype and remodeling the tumor immunosuppressive microenvironment. This invention is the first to clearly identify ABHD17C as a key molecule regulating the interaction between pancreatic cancer and TAM and mediating tumor immune escape, enriching the research perspective on the immune escape mechanism of pancreatic cancer.
[0019] This invention constructs ABHD17C mutants (S211A), BCL6B single-site mutants, and multi-site mutants using site-directed mutagenesis. Combined with functional validation experiments, it is clarified that the biological function of ABHD17C depends on depalmitoylation of cysteine at position 442 of BCL6B. This reveals the specific molecular mechanism by which the ABHD17C-BCL6B-CD24 core signaling axis regulates pancreatic cancer. Furthermore, in vitro and in vivo reverse validation experiments demonstrate that exogenous overexpression of BCL6B can reverse the oncogenic effect of ABHD17C overexpression, thus refining the upstream and downstream regulatory logic of this signaling axis. The experiments also elucidate for the first time a novel mechanism by which depalmitoylation regulates immune escape in pancreatic cancer.
[0020] Through the aforementioned series of experiments, this invention has, for the first time, clearly demonstrated that the ABHD17C-BCL6B-CD24 signaling axis can serve as a novel target for pancreatic cancer treatment. Targeted therapeutic drugs and compositions developed based on this signaling axis can exert anti-tumor effects by restoring macrophage phagocytic function and reversing pancreatic cancer immune escape. Furthermore, they can synergistically enhance existing pancreatic cancer treatments, providing a theoretical basis for the precise diagnosis and targeted therapy of pancreatic cancer and possessing broad clinical application prospects. Simultaneously, the ABHD17C-related gene-modified cell lines, animal models, and experimental systems constructed in this invention can serve as efficient drug screening models, providing reliable technical support for screening candidate drugs targeting this signaling axis and contributing to the development of precision therapies for pancreatic cancer. Attached Figure Description
[0021] Figure 1 Figures showing the expression characteristics of ABHD17C in pancreatic cancer and its association with patient prognosis; A: ABHD17C expression map analyzed from the GEPIA database; B: ABHD17C expression map analyzed from the TNMplot database; CD: ABHD17C expression map analyzed from unpaired datasets (GSE16515, GSE62165) in the GEO database; EF: ABHD17C expression map analyzed from paired datasets (GSE15471, GSE28735) in the GEO database; GH: ABHD17C expression map from survival analysis in the GEPIA database; IJ: ABHD17C expression map from survival analysis in the Kaplan-Meier plotter database; K: Immunohistochemical (IHC) staining image of pancreatic cancer tissue microarray (TMA); L: IHC score statistics of TMA samples; M: Survival curve of TMA samples; NP: ABHD17C in TMA samples. Correlation diagram between IHC score and clinical parameters; Q: Animal model validation of ABHD17 expression, left side is HE staining image; right side is IHC staining image of ABHD17C; Figure 2To verify the phagocytic resistance of ABHD17C in pancreatic cancer cell macrophages, the following diagrams are presented: A: Immunoblotting image of ABHD17C protein expression in pancreatic cell lines; B, C: Immunoblotting images of ABHD17C and CD24 mRNA levels after ABHD17C overexpression; D: Immunoblotting image of CD24 protein levels after ABHD17C overexpression; E: Fluorescence image of in vitro phagocytosis experiment; F: Quantitative statistical graph of in vitro phagocytic events; G: Flow cytometry results of CD163 (a marker of M2 macrophages) on the surface of macrophages; H, I: Comparison of in vitro phagocytic efficiency detected by flow cytometry; J: Mia CCK-8 experimental results of paca-2 cells (ABHD17C knockout group: sgCtrl, sg#1, sg#2); K: CCK-8 experimental results of SW1990 cells (ABHD17C overexpression group: Vector, ABHD17C); L: Tumor sample image of mouse orthotopic pancreatic cancer CDX model; M, N: Quantitative statistical graphs of mouse tumor volume and weight; O: Detection graph of TAM phagocytosis frequency in mouse tumors; P: Comparison graph of mouse survival curve analysis; Q: CD206 in tumors. + Quantitative statistical comparison chart of TAM ratio; R, S: Comparison chart of mRNA levels of inflammatory factors in tumor tissue; Figure 3 The diagram shows the experimental results of ABHD17C inhibiting the phagocytosis of pancreatic cancer cells by macrophages in a depalmitoylation-dependent manner; A: Detection of CD24 expression levels under different treatments, the left image is the flow cytometry detection result, and the right image is the quantitative statistical graph of CD24 mean fluorescence intensity (MFI); B: Fluorescence images and quantitative graphs of in vitro phagocytosis experiments under different treatments, the left image is the fluorescence image of pHrodo-red labeled SW1990 and Panc-1 cells (WT, S211A mutation, ABD957 treatment) co-cultured with PBMC-derived macrophages, and the right image is the quantitative statistical graph of the number of phagocytic events per field of view; C: Flow cytometry detection and quantitative comparison of in vitro phagocytic efficiency under different treatments, the left image is the flow cytometry scatter plot, and the right image is the quantitative statistical graph of the phagocytic ratio; Figure 4Figure 1: Association between ABHD17C and macrophage infiltration and CD24, and the effect of ABHD17C knockout on CD24 expression and macrophage phagocytosis; A: IHC staining comparison of tumor-associated macrophage (TAM) infiltration characteristics in pancreatic cancer; B: Correlation diagram of ABHD17C expression and macrophage infiltration in pancreatic cancer samples analyzed from the TIMER database; C: Correlation analysis diagram of ABHD17C expression level and CD24 expression in pancreatic cancer analyzed from the LinkedOmics database; D: Correlation analysis diagram of transcriptional levels of ABHD17C and CD24 in pancreatic cancer analyzed from the GEPIA database; E: Correlation analysis of ABHD17C expression level and CD24 expression in pancreatic cancer analyzed using the TIMER database; F: Comparison of ABHD17C protein expression in various pancreatic cell lines; G: Comparison of ABHD17C and CD24 mRNA levels before and after ABHD17C knockout; H: Comparison of ABHD17C and CD24 protein levels before and after ABHD17C knockout; I: Comparison of CD24 cell surface expression after ABHD17C overexpression / knockout; J: Comparison of fluorescence images in in vitro phagocytosis experiments before and after ABHD17C knockout; K: Comparison of in vitro phagocytosis efficiency by flow cytometry before and after ABHD17C knockout. Figure 5Experimental diagrams to investigate the interaction between ABHD17C and BCL6B and the mediating role of BCL6B in the anti-phagocytic function of ABHD17C; A: Comparison of silver staining analysis of Flag-ABHD17C immunoprecipitation products; B: Mass spectrometry identification results of Flag-ABHD17C immunoprecipitation products; C: Schematic diagram of molecular docking model of ABHD17C and BCL6B; D: Immunoprecipitation experimental results of the interaction between ABHD17C and BCL6B; E: Comparison of immunoblotting results of HA-ABHD17C and Flag-BCL6B after immunoprecipitation with anti-HA and anti-Flag antibodies, respectively; FG: Comparison of immunoblotting results of Miapaca-2 cells after immunoprecipitation with anti-BCL6B and anti-ABHD17C antibodies, respectively; H: Fluorescence comparison of proximity assay (PLA); I: Mia Comparison of Western blot results of ABHD17C and BCL6B in paca-2 cells (ABHD17C knockout: sgCtrl, sg#1, sg#2) and SW1990 / Panc-1 cells (ABHD17C overexpression: Vector, ABHD17C); J: Comparison of fluorescence images in in vitro phagocytosis experiments; K: Comparison of quantitative analysis in in vitro phagocytosis experiments; L: Representative images of tumor samples from each group in the NSG mouse orthotopic pancreatic cancer CDX model; MN: Quantitative statistical graphs of tumor volume and weight in each group of mice; O: Comparison of survival curve analysis in each group of mice; P: Comparison of TAM phagocytosis frequency under different indicators of the tumor microenvironment; Q: Comparison of the proportion of M2 type TAM (CD206⁺) under different indicators of the tumor microenvironment; R, S: Comparison of mRNA levels of IFN-γ and TNF-α in tumor tissue under different indicators of the tumor microenvironment; T: Comparison of association analysis between BCL6B expression and overall survival of pancreatic cancer patients. Figure 6Figures showing palmitoylation inhibitor treatment, Click-iT assay, mutant validation, and phagocytosis assay; A: Comparison of immunoblotting results of Miapaca-2 / Panc-1 cells after HAM (palmitoylation inhibitor) treatment; B: Click-iT palmitoylation assay results of Miapaca-2 cells after anti-Flag antibody immunoprecipitation; CD: Comparison of immunoblotting results of Miapaca-2 / Panc-1 cells after 2-BP (palmitoylation inhibitor) treatment; E: Comparison of immunoblotting results of Miapaca-2 cells (ABHD17C knockout: sgCtrl, sg#1, sg#2); FG: Comparison of immunoblotting results of SW1990 / Panc-1 cells (ABHD17C overexpression: Vector, OE); H: Mia Comparison of immunoblotting results of paca-2 cells treated with different concentrations of ABD957 (ABHD17C inhibitor); IL: Immunoblotting results of the determination of key BCL6B palmitoylation sites (Click-iT assay); K: Comparison of immunoblotting results of WTBCL6B protein levels and C442S mutant groups in Mia paca-2 / Panc-1 cells; LM: Immunoblotting results of WT BCL6B protein levels and C442S mutant groups in Mia paca-2 / Panc-1 cells; N: Fluorescence image of in vitro phagocytosis assay of Mia paca-2 / Panc-1 cells (WT / C442S) co-cultured with macrophages after pHrodo-red labeling; O: Comparison of flow cytometry quantitative results of WT BCL6B protein levels and C442S mutant groups. Figure 7 Figures showing the results of experiments to verify the regulation of BCL6B protein stability by ABHD17C; A: mRNA levels of ABHD17C knockdown (sg#1, sg#2) in Mia paca-2 cells; BC: mRNA levels of ABHD17C overexpression in SW1990 / Panc-1 cells; D: Changes in BCL6B levels in Mia paca-2 cells under different treatment conditions; E: Immunoblot images of Mia paca-2 cells under different treatment conditions; F, G: Endogenous immunoprecipitation (IP) results in Mia paca-2 / Panc-1 cells; H, I, N, P: Exogenous IP results in Mia paca-2 / Panc-1 / SW1990 cells; J, K, O: Changes in BCL6B levels in Mia paca-2 cells after knockdown of ABHD17C (sg#1, sg#2) or inhibition of its enzyme activity (ABD957, 2-BP). Figure 8Experimental diagram to demonstrate the molecular mechanism by which BCL6B, as a transcription factor, directly binds to and inhibits CD24 gene transcription; A: Scatter plot of correlation analysis of BCL6B and CD24 expression levels in 6 independent clinical datasets (GSE28735, GSE62165, GSE62452, GSE71729, GSE78229, ICGC); BD: Quantitative analysis of BCL6B and CD24 mRNA levels in the Mia paca-2 / Panc-1 / SW1990 pancreatic cancer cell line after different treatments using qPCR; E: Mia Immunoblot images of protein levels in the paca-2 / Panc-1 / SW1990 pancreatic cancer cell line after different treatments; F: MEME motif enrichment analysis; G: Quantitative analysis of luciferase reporter gene assay results; H: Immunoblot image of chromatin immunoprecipitation (ChIP) assay; I: Schematic diagram of the CD24 gene promoter region; J: Sequence alignment of the binding sites of BCL6B and CD24 genes; K: Schematic diagram of the construction of wild-type (WT) and three-site mutant (MUT1-3) reporter gene vectors of the CD24 promoter; LM: Quantitative analysis of luciferase activity in Mia paca-2 and Panc-1 cells; Figure 9 Figure 1 shows experimental results for studying the mechanism of pancreatic cancer tumor immunotherapy; A: Fluorescence micrograph of SW1990 pancreatic cancer cells being phagocytosed by macrophages; B: Quantitative analysis of SW1990 pancreatic cancer cells being phagocytosed by macrophages; C: [Image showing results obtained using GFP]. + Cancer cells and CD11b + Flow cytometry graphs showing the proportion of macrophages with double positivity and quantitative phagocytic efficiency; D: Quantitative analysis of phagocytic efficiency in different treatment groups; E: Physical image of tumor tissue from subcutaneous xenografts in mice during in vivo tumor growth and survival experiments; F, G: Comparison of tumor volume and weight in subcutaneous xenografts in mice after different treatments; H, I: Survival curves of mice in different treatment groups; JM: Detection of TAM functional phenotype; J: Quantitative comparison of phagocytic rate of TAM isolated from mouse tumor tissue in different treatment groups; K: Quantitative comparison of expression of M2 markers in cells of different treatment groups; L, M: Quantitative comparison of mRNA expression of cytokines IFN-γ and TNF-α in different treatment groups. Detailed Implementation
[0022] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further described below in conjunction with specific embodiments.
[0023] It should be noted that in the examples, DMSO was purchased from Sorlabio (catalog number D8371); 2-BP was purchased from Sigma-Aldrich (catalog number 21604, 50 μM); ABD957 was purchased from Med ChemExpress (catalog number HY-142161, 500 nM); cyclohexylimide (CHX) was purchased from MedChem Express (catalog number HY-12320, 100 μg / mL); MG132 was purchased from Sigma-Aldrich (catalog number M8699, 10 μM); carfilzomib was purchased from Selleck (catalog number S2853, 50 nM); NH4Cl was purchased from Med Chem Express (catalog number HY-Y1269, 20 mM); and chloroquine was purchased from Med ChemExpress. The company's product number is HY-17589A, 50 μM.
[0024] Example 1 This embodiment aims to demonstrate that ABHD17C is abnormally highly expressed in pancreatic cancer tissue.
[0025] 1. Data Mining and Bioinformatics Analysis The expression, prognosis, and function of ABHD17C were analyzed using GEPIA (matched TCGA+GTEx), TNMplot, Human Protein Atlas, LinkedOmics, TISIDB, TIMER, Kaplan-Meier plotter, and the GEO database. Expression analysis in GEPIA used the "matched TCGA normal and GTEx data" option, and survival analysis was performed in 42 vs 42 groups. The GEO datasets GSE16515, GSE62165, GSE15471, and GSE28735 were used to compare ABHD17C transcription levels in pancreatic cancer and normal tissues; GSE71729 was used to analyze the differential expression of ABHD17C in primary lesions, metastatic lesions, and normal tissues. The transcriptional correlation between BCL6B and CD24 was analyzed using GSE28735, GSE62165, GSE62452, GSE71729, GSE78229, and the ICGC database. All GEO data were quantile-normalized. The expression of ABHD17C in various cell subpopulations of pancreatic cancer was analyzed using TISCH single-cell RNA sequencing data (CRA001160). CSS-Palm 4.0 was used to predict BCL6B palmitoylation sites, and JASPAR was used to predict the binding sites of BCL6B in the CD24 promoter region.
[0026] 2. Study subjects and specimen collection Pancreatic cancer tissue microarrays (TMA) were purchased from Shanghai Chipchao Biotechnology Co., Ltd., containing 97 pancreatic cancer tissue samples and 89 adjacent normal tissue samples (8 with missing pairs). Samples were collected between January 2014 and October 2015. Inclusion criteria: age ≥18 years; pathologically confirmed pancreatic ductal adenocarcinoma; pancreaticoduodenectomy or distal pancreatectomy. Exclusion criteria: neoadjuvant chemoradiotherapy before surgery; death within 3 months postoperatively; refusal to follow up. Staging was performed according to AJCC version 8. The median age of patients was 67 years (range 42-78 years), with a maximum follow-up of 114 months. At the last follow-up, 70 patients died and 27 survived. Peripheral blood was obtained from 3 healthy volunteers (mean age 30.7 years). This study was approved by the Ethics Committee of the First Affiliated Hospital of the University of Science and Technology of China (2024-KY-246), and all participants signed informed consent forms.
[0027] 3. Hematoxylin-eosin (H&E) staining and immunohistochemical (IHC) staining The primary antibodies used for IHC staining included: anti-ABHD17C antibody (1:200, ab151040, Abcam), anti-F4 / 80 antibody (1:200, ab111101, Abcam), and anti-CD68 antibody (1:200, ab201340, Abcam). Two senior pathologists used a double-blind method to score the IHC results of ABHD17C in the tissue microarray. Discrepancies in scores were resolved through joint re-examination to reach a consensus. The IHC scoring criteria were based on staining intensity (0, 1, 2, 3 points) and the percentage of positive cells (0%-100%). The final score was the product of the intensity score and the positive rate. Using the median IHC score as a threshold, specimens were divided into a high-expression group and a low-expression group for subsequent experiments.
[0028] The results of H&E and IHC staining of the above experimental specimens are as follows: ABHD17C is abnormally highly expressed in pancreatic cancer and is associated with poor patient prognosis. A pancreatic cancer tissue microarray (TMA) was constructed and IHC staining was performed. Figure 1 K). ABHD17C expression in pancreatic cancer tissue is higher than in adjacent normal tissue. Figure 1 L). Furthermore, high expression of ABHD17C has been identified as a poor prognostic factor for pancreatic cancer patients (L). Figure 1 M), the median overall survival (OS) was 24 months in the high expression group and 52 months in the low expression group. Furthermore, ABHD17C expression was higher in pancreatic cancer with a diameter >4 cm, pancreatic cancer with lymph node metastasis, and pancreatic cancer with a later TNM stage. Figure 1 NP). The KPC natural pancreatic cancer mouse model suggests that ABHD17C expression is upregulated in pancreatic tissue after malignant transformation, and further increased in lung metastases (NP). Figure 1 Q).
[0029] Example 2 This embodiment aims to investigate the anti-phagocytic mechanism of ABHD17C in pancreatic cancer cells.
[0030] 1. Preparation of experimental materials Human immortalized pancreatic ductal epithelial cell line (HPNE), human pancreatic cancer cell lines (Panc-1, AsPC-1, BxPC-3, Mia Paca-2, SW1990, CFPAC-1, T3M4), and human embryonic kidney cell line HEK293T were all purchased from the American Type Culture Collection (ATCC) or the China National Biobank. Cells were cultured in appropriate media (DMEM, RPMI-1640, or L-15) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, and routinely incubated at 37°C in a 5% CO2 incubator. HPNE cell culture medium was supplemented with 10 ng / mL recombinant human epidermal growth factor (P00033, Solarbio).
[0031] Lentiviral infection and CRISPR / Cas9 gene knockout: Mia Paca-2 and SW1990 cells were infected with lentivirus carrying the GFP-purinomycin resistance gene (Gikai gene). After 48 hours, Mia Paca-2-GFP-Puro was obtained by flow cytometry sorting. + and SW1990-GFP-Puro + Stable cell lines were established. sgRNA targeting human ABHD17C or BCL6B was incubated with Cas9-3NLS nuclease at 37°C for 60 min to assemble an RNP complex. Two × 10⁻⁶ cells were collected. 5 Mia Paca-2-GFP + and SW1990-GFP + Cells, mixed with the RNP complex, were used with Neon TM Electroporation was performed using an electroporation system (1150V, 30ms, 2 pulses). After 48 hours of recovery, cells were screened for 7 days with 2μg / mL puromycin to obtain stable knockout cell lines.
[0032] The sgRNA sequence used for CRISPR / Cas9 gene knockout is as follows: hABHD17CsgRNA#1: CGAGCCCACCTACACGGTGC; hABHD17CsgRNA#2: ACCTCAGCGAGCGCGCCGAC; hBCL6BsgRNA:TCGCCACTCCTCCGACGTGCTGG.
[0033] Lentiviral plasmid construction: The coding sequences of human ABHD17C and BCL6B were cloned into the vector GV492 (Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin) to construct an overexpression plasmid. The ABHD17CS211A mutant and a series of BCL6B mutants (C59S, C177S, C389S, C417S, C442S, and 5C-5S) were constructed using site-directed mutagenesis. All mutants were constructed using overlap extension PCR and the QuikChange site-directed mutagenesis kit, and were verified by full-length Sanger sequencing.
[0034] Western blot: Total protein was extracted from cells using a lysis buffer containing 2% SDS and a protease inhibitor. After BCA assay to determine the concentration, 30 μg of protein was subjected to SDS-PAGE electrophoresis and transferred to a nitrocellulose membrane. After blocking with 5% skim milk powder, the membrane was incubated overnight at 4°C with specific primary antibody. Following TBST washing, HRP-labeled secondary antibody was added and incubated at room temperature for 1 h. The membrane was then developed using an ECL kit. The primary antibodies used include: anti-ABHD17C (1:1000, ab151040, Abcam), anti-CD24 (1:1000, sc-19585, Santa Cruz Biotechnology), anti-BCL6B (1:1000, NBP1-80434, Novus Biologicals), anti-HA tag (1:2000, ab236632, Abcam), anti-Flag tag (1:2000, 14793, Cell Signaling Technology), anti-ubiquitin (Ub) tag (1:2000, 3936, Cell Signaling Technology), anti-histone H3 (1:1000, 4620, Cell Signaling Technology), anti-streptavidin-HRP (1:5000, SA00001-0, Proteintech), and anti-GAPDH (1:5000, 10494-1-AP, Proteintech).
[0035] mRNA detection: Total RNA was extracted using TRIzol reagent (9108, Takara), and cDNA was synthesized according to the reverse transcription kit (RR037A, Takara). Real-time quantitative PCR was performed using TB Green Premix ExTaq (RR420A, Takara), with GAPDH as an internal control. -ΔΔCT The relative expression levels of genes were calculated using a method. Primer sequences are shown in Table 1 below: Table 1. Primer sequences for PCR identification .
[0036] Human peripheral blood mononuclear cells (PBMCs) isolation and macrophage induction: PBMCs were isolated using lymphocyte separation medium (7111011, Dakowei) at 400×g for 20 min. The obtained cells were seeded in a medium containing 50 ng / mL GM-CSF (RP00094, Abclonal) and induced for 7 days to differentiate into macrophages.
[0037] 2. Pancreatic cancer mouse model Laboratory animals used in this study included 6-8 week old female C57BL / 6 mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.) and NOD. Cg- Prkd c scid Il2rg em1Smoc (NSG) mice (Jackson Laboratories, USA). All animal experiments were approved by the Laboratory Animal Ethics Committee of the First Affiliated Hospital of the University of Science and Technology of China [Approval No.: 2024-N(A)-39].
[0038] A mouse model of pancreatic cancer was established following methods described in published literature. C57BL / 6 mice were anesthetized, and the pancreatic tail was exposed via an incision in the left flank. A 1 cm diameter sac was created using CV-7 sutures, and 1 mg of dimethylbenzanthracene (DMBA) (D3254, Sigma-Aldrich) was implanted before suturing. The incision was closed layer by layer after confirming no peritoneal leakage. Two months post-surgery, mice were euthanized, and pancreatic tissue was harvested to assess the lesion.
[0039] Orthotopic pancreatic cancer xenograft mouse model: After NSG mice were acclimatized for one week, the pancreas tail was exposed by an incision in the left flank under anesthesia, and 5×10⁻⁶ mcg of the pancreas was slowly injected. 6 Transfected pancreatic cancer cells (resuspended in 100 μl PBS) were pressed and sutured layer by layer. In the antibody treatment group, anti-CD24 monoclonal antibody or IgG1 isotype control antibody (400 μg / mouse, twice weekly) was injected intraperitoneally from day 7 to 28 post-inoculation. Mice were monitored daily for health status. Euthanasia was performed 4 weeks post-inoculation or at the humane endpoint. Tumor tissue was dissected, weighed, and its volume measured, and analyzed by flow cytometry, qPCR, and paraffin embedding.
[0040] Flow cytometry (FCM) assay: Cells were collected using a standard enzymatic digestion method, centrifuged, and resuspended in pre-chilled cell staining buffer, with the concentration adjusted to 5 × 10⁻⁶. 5 Cells / ml, 1ml per sample. Add 5μl of human TruStainFc to the human cell sample. TMFor blocking, mouse cell samples were added with 0.25 μg of anti-mouse CD16 / 32 blocking buffer and incubated at room temperature or 4°C for 10 min. After centrifugation, fluorescently labeled specific antibodies or isotype controls were added and incubated on ice in the dark for 30 min. After washing twice, the cells were resuspended in staining buffer and incubated on ice for 5 min before flow cytometry analysis. Data were acquired using a BD LSR Fortessa flow cytometer and analyzed using FlowJo V10 software. The flow cytometry antibodies and isotype controls used were as follows: CD11b (101230, BioLegend), CD45 (103112, BioLegend), F4 / 80 (111604, BioLegend), CD206 (141717, BioLegend), CD24 (983602, BioLegend), mouse IgG1 isotype control (clone MOPC-21), and human IgG1 isotype control (clone QA16A12). Cell proliferation assay: Cell proliferation was detected using the CCK-8 assay kit (CK04, Tongren Chemical). Transfected cells were seeded into 96-well plates, and the absorbance (OD450) at 450 nm was measured using a microplate reader (SpectraMax190, MolecularDevices) at 6, 24, 48, 72, and 96 h of culture.
[0041] 3. Macrophage phagocytosis experiment Direct co-culture: GFP⁺ pancreatic cancer cells were collected, labeled with pHrodo Red (1:30000 diluted in PBS) at 37℃ for 1 h, and washed three times with complete culture medium. Macrophages derived from PBMCs were collected and cultured in a culture medium of 5 × 10⁶ cells / mL. 4 One macrophage and 1×10 6 Labeled pancreatic cancer cells were suspended in serum-free culture medium, with a final concentration of 10 μg / mL of anti-CD24 monoclonal antibody or IgG1 isotype control added. After inoculation, the cells were incubated at 37°C for 6 h and washed three times with PBS. Observation was performed using an Olympus IX83 fluorescence microscope. Five fields of view were randomly selected from each sample for imaging, and the number of phagocytic particles within each macrophage was counted to quantify phagocytic activity.
[0042] Indirect co-culture: PBMC-derived M0 macrophages were seeded in the lower chamber of a Transwell cell line (0.4 μm pore size), and pancreatic cancer cells were seeded in the upper chamber. The cells were co-cultured for 72 h. Macrophages from the lower chamber were collected, and the expression of the M2 marker CD163 was detected by flow cytometry.
[0043] To investigate the biological function of ABHD17C in pancreatic cancer cells, the protein expression of ABHD17C in the normal pancreatic ductal epithelial cell line HPNE and seven pancreatic cancer cell lines was first detected. The results showed that, except for SW1990, the expression of ABHD17C in the other pancreatic cancer cell lines was higher than that in HPNE. Figure 2 A, Figure 4 F). Subsequently, stable transgenic cells overexpressing ABHD17C were constructed in SW1990 and Panc-1 cells, and ABHD17C knockout monoclonal cell lines (sg#1 and sg#2) were constructed in Mia Paca-2 cells using CRISPR / Cas9 technology. The results showed that ABHD17C overexpression significantly upregulated the mRNA and protein levels of CD24. Figure 2 BD), knockout significantly downregulates CD24 expression ( Figure 4 GI). A phagocytic assay using pHrodo Red-labeled macrophages revealed that ABHD17C knockout pancreatic cancer cells were more readily phagocytosed and degraded by macrophages. Figure 4 J); ABHD17C overexpression significantly resisted macrophage phagocytosis (J); Figure 2 EF), while anti-CD24 monoclonal antibodies can effectively reverse this anti-phagocytic effect (EF). Figure 2 EF). Flow cytometry further validated the above results. Figure 4 K, Figure 2 HI). Macrophage polarization induction experiments suggested that ABHD17C knockout inhibited the M0-to-M2 polarization of pancreatic cancer-induced macrophages, while ABHD17C overexpression promoted this polarization process. Figure 2 G). In summary, ABHD17C protects pancreatic cancer cells from macrophage attack through CD24 signaling and drives macrophage polarization toward the immunosuppressive M2 type.
[0044] In vitro experiments confirmed that ABHD17C does not affect the autonomous proliferation ability of pancreatic cancer cells. Figure 2 JK). To investigate the expression and function of ABHD17C, a DMBA-induced mouse pancreatic cancer model and an NSG mouse orthotopic CDX model of pancreatic cancer were constructed. In vivo functional experiments showed that ABHD17C overexpression significantly accelerated tumor growth, while the anti-CD24 monoclonal antibody could block this effect (JK). Figure 2 LN). Flow cytometry analysis showed that the phagocytic level of TAMs was significantly reduced in tumors overexpressing ABHD17C, and CD24 blockade could eliminate this anti-phagocytic effect. Figure 2 O). Accompanied by weakened phagocytic clearance, the survival of tumor-bearing mice in the ABHD17C overexpression group was significantly shortened, while CD24 blockade could reverse this phenomenon ( Figure 2P). Furthermore, TAMs in ABHD17C-overexpressing tumors exhibit a stronger immunosuppressive phenotype (enhanced M2 polarization), and CD24 blockade can inhibit this polarization trend (P). Figure 2 Q); Simultaneously, the levels of IFN-γ and TNF-α in the tumor microenvironment were significantly reduced, and CD24 blockade could reverse this inhibitory effect (Q). Figure 2 In summary, ABHD17C mediates pancreatic cancer cell escape from TAMs via the CD24 signaling pathway, promoting the formation of an immunosuppressive microenvironment.
[0045] Significant macrophage infiltration was observed in both DMBA-induced immune-intact spontaneous pancreatic cancer mouse models and human pancreatic cancer tissues. Figure 4 A). TIMER database analysis showed that ABHD17C expression was negatively correlated with the degree of macrophage infiltration ( Figure 4 B), suggesting its potential role in regulating macrophage function in the tumor microenvironment. Further searches of the LinkedOmics, GEPIA, and TIMER databases unexpectedly revealed a significant positive correlation between ABHD17C expression and the "don't eat me" signaling molecule CD24. Figure 4 (CE). This leads to the hypothesis that ABHD17C may mediate pancreatic cancer cells escaping macrophage phagocytosis by upregulating CD24 anti-phagocytic signaling.
[0046] Example 3 This embodiment aims to investigate how the ABHD17C-BCL6B-CD24 signaling axis inhibits macrophage phagocytosis in a depalmitoylation-dependent manner.
[0047] In vivo macrophage depletion assay: Two weeks before tumor inoculation and until the end of the experiment, anti-CSF1R antibody (400 μg / mouse; A2159, Selleck) was injected intraperitoneally every other day to deplete NSG mouse macrophages. Peritoneal lavage fluid was collected before inoculation, and the depletion effect was verified by flow cytometry. After successful depletion, mice were randomly divided into groups and inoculated with WT or BCL6B knockout (ΔBCL6B) pancreatic cancer cells, and treated with anti-CD24 monoclonal antibody or control antibody. Survival analysis was conducted in an independent cohort under the same experimental conditions. Humanitarian endpoint criteria: body weight loss >20%; distant organ metastasis; persistent abnormal behavior or inability to feed independently. The survival endpoint was day 60 after inoculation, and survival curves were plotted. Tumor tissue was dissected, photographed, weighed, and its volume was measured for subsequent experiments.
[0048] Tumor tissue single-cell digestion experiment: A single-cell suspension of tumor tissue was prepared. The tumor tissue was weighed and minced using surgical scissors. The minced tissue was added to a digestion solution (RPMI-1640 medium containing 10% FBS, 0.5 mg / mL collagenase IV (C5138, Sigma-Aldrich), and 0.15 mg / mL DNase I (DN25, Sigma-Aldrich), with a digestion solution volume 5 times the tissue mass. Digestion was carried out in a 37°C water bath for 1 hour, with gentle shaking every 10 minutes. After digestion, a large amount of complete culture medium was added for dilution, and the supernatant was discarded after centrifugation. The pellet was resuspended and filtered through a 40 μm cell sieve to remove undigested tissue fragments. Finally, the cells were resuspended in pre-chilled cell staining buffer (420201, BioLegend) and the cell concentration was adjusted to 1 × 10⁻⁶ cells / mL. 6 Quantities / ml, used for subsequent flow cytometry analysis.
[0049] In vivo flow cytometry phagocytosis assay: A single-cell suspension of tumor tissue was prepared as described above. After blocking the Fc receptor, fluorescently labeled antibody or isotype control was added, and the cells were incubated on ice in the dark for 30 min. The cells were washed twice and resuspended in buffer containing 1 μg / ml DAPI to remove dead cells. Data were acquired using an LSR Tortessa flow cytometer (BD Biosciences). Phagocytic macrophages were defined as: DAPI... - CD45 + F4 / 80 + CD11b + GFP + The definition of M2 macrophages is: DAPI - CD45 + F4 / 80 + CD11b + CD206 + .
[0050] Co-immunoprecipitation (Co-IP) assay: After cell transfection and drug treatment, cells were lysed on ice for 30 min with IP lysis buffer containing protease inhibitor, centrifuged at 12000×g, 4℃ for 20 min, and the supernatant was collected. Protein concentration was determined by BCA method, and 150 μg of total protein was used as the input control. The remaining supernatant was added with specific primary antibody and protein A / G agarose beads, and incubated overnight at 4℃ by rotation. The agarose beads were washed three times with lysis buffer, and bound proteins were eluted with 1×SDS loading buffer. The target protein was detected by Western blot.
[0051] Liquid chromatography-tandem mass spectrometry (LC-MS / MS) analysis: After washing the immunoprecipitated products, they were resuspended in reaction buffer and incubated at 60°C for 1 h to complete denaturation, reduction, and alkylation. After dilution with ultrapure water, 1 μg of sequencing-grade trypsin was added, and the mixture was digested overnight at 37°C. Peptides were desalted using an SDB column, vacuum-dried, and stored at -20°C for later use. LC-MS / MS analysis (timsTOF Pro mass spectrometer coupled with nanoElute liquid chromatography system) was performed by Shanghai Bio-Tech Co., Ltd. Protein identification and label-free quantification were performed using MaxQuant software, and bioinformatics analysis was conducted using the Lab-4D platform.
[0052] Neighborhood ligation assay (PLA): Mia Paca-2 or Panc-1 cells were co-transfected with ABHD17C and BCL6B expression vectors and cultured on coverslips. After fixation, permeabilization, and blocking according to immunofluorescence staining methods, primary antibodies were added and incubated overnight at 4°C. After washing with PBS, Duolink® PLA probes were added and incubated at 37°C for 1 hour. Hybridization, ligation, and rolling circle amplification were performed according to the manufacturer's instructions, followed by DAPI counterstaining. The amplification products were observed under a confocal microscope (green fluorescent spots).
[0053] Acyl-Biotin Exchange (ABE) Assay: Performed according to the IP-ABE kit instructions. Pancreatic cancer cells were collected and lysed, and immunoprecipitated overnight at 4°C with beads conjugated to anti-BCL6B or Flag antibodies. Unmodified cysteine residues were blocked by N-ethylmaleimide (NEM) treatment for 30 min. After washing, the beads were divided into two groups: one group was treated with 1M hydroxylamine (HAM) at room temperature for 1 h to cleave thioester bonds (+HAM), and the other group was treated without HAM (-HAM) as a control. After washing, both groups were labeled with thiol-reactive biotin at room temperature for 1 h. The beads were resuspended in SDS loading buffer and boiled for 10 min. Palmitoylation levels were detected by streptavidin-HRP immunoblotting.
[0054] Click-iT palmitoylation assay: After plasmid transfection, pancreatic cancer cells were incubated at 37°C for 6 h in medium containing 100 mM Click-iT palmitate azide. After washing with PBS, lysis was performed on ice for 20 min, followed by sonication and centrifugation at 12000×g, 4°C for 10 min. Protein concentration was determined using the BCA method. A Click-iT protein reaction buffer kit was used to couple biotinyne to the palmitoylated protein. Streptavidin captured the biotin-palmitate-protein complex, and BCL6B was detected by Western blotting.
[0055] Ubiquitination detection: Pancreatic cancer cells were transfected for 48 h and then treated with 10 μM MG132 for 6 h. Lysis was performed on ice using RIPA lysis buffer (containing protease inhibitor), followed by centrifugation at 12000×g, 4℃ for 20 min, and the supernatant was collected. Protein concentration was determined by BCA method, with 150 μg of protein used as an input control. An equal volume of protein was incubated overnight at 4℃ with pre-conjugated target antibody-coated protein A / G magnetic beads. The immunoprecipitated product was eluted with 1×SDS loading buffer, and the ubiquitination level was detected by Western blot.
[0056] Dual-luciferase reporter gene assay: Cells were seeded in 24-well plates and co-transfected with wild-type or mutant CD24 reporter plasmid and Renilla luciferase internal control plasmid pRL-TK. 24 h after transfection, cells were lysed using a dual-luciferase reporter gene assay kit (E1910, Promega), and fluorescence intensity was detected using a Tecan microplate reader. The relative activity of the reporter gene was expressed as the ratio of firefly luciferase activity to Renilla luciferase activity.
[0057] Chromatin immunoprecipitation (ChIP): using Pierce TM The agarose ChIP kit (26156, Thermo Fisher) was used. Cells were cross-linked with 1% formaldehyde at room temperature for 10 min, and the process was terminated with 125 mM glycine. Micrococcal nuclease was used to cleave chromatin for 20 min at 37°C. The protein-DNA complex was immunoprecipitated overnight at 4°C with rabbit anti-BCL6B antibody or rabbit IgG. After washing, decross-linking, and digestion with proteinase K, the DNA was purified by column centrifugation. The enrichment level of the target fragment was detected by qPCR using gene-specific primers.
[0058] SPSS 22.0 software was used for analysis, and GraphPad Prism 7.0 software was used for plotting. Experiments were repeated ≥3 times, and data are expressed as mean ± standard deviation. For comparisons between two groups: normally distributed data were analyzed using Student's... t The Mann-Whitney test is used for non-normal distributions. U Tests. One-way or two-way ANOVA was used for comparisons among multiple groups, and Dunnett's or Tukey's test was used for subsequent pairwise comparisons.
[0059] The results showed that the serine 211→alanine mutation (S211A) led to the loss of palmitoylation activity of ABHD17C, manifested as downregulation of CD24 expression and enhanced macrophage phagocytosis. Figure 3 AC. Treatment of pancreatic cancer cells expressing ABHD17C with ABD957 (an ABHD17 family-specific inhibitor) also resulted in decreased CD24 expression and enhanced macrophage phagocytosis. Figure 3 AC).
[0060] Silver staining of the immunoprecipitate product of Flag-ABHD17C in Panc-1 cells revealed potential interacting proteins ( Figure 5 A). IP-MS identified BCL6B as a candidate binding partner ( Figure 5 B). Molecular docking prediction and visualization of the interaction between ABHD17C and BCL6B ( Figure 5 C). Co-IP experiments confirmed the binding of exogenous and endogenous ABHD17C to BCL6B ( Figure 5 DG). PLA experiments further verified the transient interaction between the two in the cytoplasm ( Figure 5 H). ABHD17C knockout significantly upregulated BCL6B protein expression, while overexpression significantly downregulated BCL6B, suggesting that BCL6B is a key substrate for ABHD17C. Figure 5 L). Functional experiments showed that BCL6B overexpression promoted macrophage phagocytosis of pancreatic cancer cells and completely reversed the ABHD17C-mediated anti-phagocytic effect. Figure 5 JK).
[0061] An orthotopic CDX model of pancreas was constructed using Panc-1 cells transfected with ABHD17C and / or BCL6B. Figure 5 The results showed that BCL6B overexpression significantly inhibited tumor growth and completely eliminated the ABHD17C-mediated pro-tumor effect. Figure 5 LM). BCL6B overexpression enhances intratumoral phagocytosis and clearance, resulting in a significant survival benefit in tumor-bearing mice and reversing the shortened survival caused by ABHD17C. Figure 5 NO). Furthermore, BCL6B overexpression reduces M2-type TAMs polarization and reverses the ABHD17C-driven immunosuppressive phenotype. Figure 5 P), and significantly upregulated the levels of anti-tumor cytokines IFN-γ and TNF-α, eliminating the inhibitory effect of ABHD17C (P). Figure 5 QR). Clinical data analysis shows that high BCL6B expression is associated with better overall survival in pancreatic cancer patients. Figure 5 Therefore, BCL6B is a key downstream substrate of ABHD17C, mediating its macrophage polarization regulation and anti-phagocytic effects.
[0062] ABE and click chemistry assays confirmed that BCL6B in pancreatic cancer cells underwent palmitoylation modification, and this modification was dependent on thioester bonds (both 2-BP treatment and HAM deletion significantly reduced the modification level). Figure 6 AD). ABHD17C knockout increases BCL6B palmitoylation levels ( Figure 6 E), overexpression reduces its palmitoylation level ( Figure 6FG. ABD957 treatment can dose-dependently enhance BCL6B palmitoylation ( Figure 6 In summary, ABHD17C is a depalmitoylase of BCL6B.
[0063] CSS-Palm 4.0 predicted five candidate palmitoylation sites for BCL6B (C59, C177, C389, C417, and C442). Azide palmitate incorporation experiments showed that the 5C-5S and C442S mutations almost eliminated BCL6B palmitoylation, confirming Cys442 as the major modification site. Figure 6 IJ). The ABE experiment further validated that the C442S mutation blocks exogenous BCL6B palmitoylation (IJ). Figure 6 K). ABHD17C knockout significantly enhanced WT BCL6B palmitoylation, but had no effect on the C442S mutant; ABHD17C overexpression had the opposite effect. Figure 6 LM indicates that ABHD17C mediates BCL6B depalmitoylation at the Cys442 site. Functional experiments showed that the C442S mutant significantly reduced macrophage phagocytic uptake of pancreatic cancer cells (LM). Figure 6 NO). In summary, ABHD17C-mediated depalmitoylation at the Cys442 site of BCL6B is a key mechanism for resisting macrophage phagocytosis.
[0064] ABHD17C knockout reduces BCL6B protein levels but does not affect its transcription, while overexpression has the opposite effect. Figure 7 AC, Figure 8 G), suggesting that ABHD17C regulates BCL6B at the post-translational level. CHX follow-up experiments showed that 2-BP treatment led to BCL6B instability, and proteasome inhibitors (MG132, carfilzomib) could reverse this effect, while lysosomal inhibitors were ineffective. Figure 7 DE indicates that BCL6B is primarily degraded via the proteasome pathway. 2-BP treatment significantly enhanced BCL6B ubiquitination levels. Figure 7 FI). ABHD17C knockout or ABD957 processing increases BCL6B stability ( Figure 7 JK); ABHD17C overexpression induces BCL6B instability, which can be reversed by proteasome inhibitors (JK). Figure 7 LM). ABHD17C overexpression increases BCL6B ubiquitination, while knockout reduces it. Figure 7 N). The C442S mutation accelerates BCL6B degradation ( Figure 7 O), whose ubiquitination level was significantly higher than WT ( Figure 7 P), and ABHD17C overexpression had no further effect on the C442S mutant. Figure 7In summary, palmitoylation protects BCL6B from ubiquitination degradation, and ABHD17C-mediated depalmitoylation at Cys442 drives BCL6B degradation via the ubiquitin-proteasome pathway.
[0065] To investigate whether CD24 is a downstream target of BCL6B, a meta-analysis of five GEO datasets and the ICGC database showed that BCL6B was negatively correlated with CD24 transcription levels. Figure 8 A). Functional experiments showed that BCL6B overexpression significantly downregulated CD24 mRNA and protein levels in Mia paca-2 and Panc-1 cells, while BCL6B knockout upregulated CD24 expression in SW1990 cells. Figure 8 BE indicates that regulation occurs at the transcriptional level. The JASPAR database predicts the presence of a potential BCL6B binding site in the CD24 promoter region. Figure 8 F). Luciferase reporter gene assays confirmed that BCL6B inhibits CD24 promoter activity (F). Figure 8 G); ChIP experiments showed that BCL6B was enriched in the CD24 promoter region ( Figure 8 H). Site-directed mutagenesis further clarified that binding site 3 (MUT3) is a key site for BCL6B-mediated transcriptional repression. Figure 8 In summary, BCL6B acts as a transcriptional repressor, inhibiting its expression by directly binding to the CD24 promoter.
[0066] Fluorescence imaging revealed that ΔBCL6B pancreatic cancer cells were more difficult for macrophages to phagocytose and degrade than WT cells; and treatment with CD24 blocking antibody significantly enhanced phagocytosis and reversed the ΔBCL6B-mediated phagocytic inhibition. Figure 9 AB). Flow cytometry analysis further confirmed that the phagocytic proportion of ΔBCL6B cells was significantly lower than that of the WT control, and CD24 blockade treatment could eliminate this difference. Figure 9 Therefore, BCL6B affects the phagocytic clearance of pancreatic cancer cells by macrophages by regulating CD24 expression.
[0067] Based on the NSG mouse pancreatic orthotopic CDX model, it was found that BCL6B knockout significantly accelerated tumor growth, while CD24 blockade could completely eliminate this pro-tumor effect. Figure 9 EG). TAM depletion not only reversed the pro-tumor effect of ΔBCL6B, but also eliminated the anti-tumor effect of anti-CD24 antibody ( Figure 9 EG indicates that changes in tumor burden depend on TAM-mediated clearance. Survival analysis showed that ΔBCL6B significantly shortened the survival of tumor-bearing mice, and CD24 blockade could reverse this effect. Figure 9 H); TAM exhaustion eliminated the survival difference between the two groups ( Figure 9Mechanistically, BCL6B knockout reduces TAM phagocytosis levels, while CD24 blockade enhances phagocytosis and reverses ΔBCL6B-mediated in vivo phagocytic resistance. Figure 9 J). Increased abundance of M2-type TAMs and decreased levels of anti-tumor cytokines TNF-α and IFN-γ in ΔBCL6B tumors; CD24 blockade reversed these changes. Figure 9 Therefore, BCL6B deficiency protects pancreatic cancer cells from TAM phagocytosis through CD24 signaling, promoting an immunosuppressive microenvironment and tumor progression.
[0068] Both in vitro and in vivo experiments confirmed that BCL6B overexpression can reverse the promoting effect of exogenous ABHD17C expression on pancreatic cancer. In summary, these results indicate that ABHD17C-mediated depalmitoylation at cysteine 442 of BCL6B enhances CD24 transcription, making pancreatic cancer cells resistant to macrophage phagocytosis and promoting pancreatic cancer progression.
[0069] The foregoing has described the basic principles, main features, and advantages of the present invention. It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered illustrative and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the scope of the invention. No reference numerals in the claims should be construed as limiting the scope of the claims.
[0070] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. Application of targeting the ABHD17C-BCL6B-CD24 signal axis in the preparation of pancreatic cancer treatment products.
2. Application of targeting the ABHD17C-BCL6B-CD24 signal axis in the preparation of pancreatic cancer prognostic products.
3. Application of palmitoylation reagent of BCL6B in the preparation of pancreatic cancer treatment products.
4. The application according to claim 1 or 2, characterized in that, The product includes at least one of the following: a reagent that inhibits ABHD17C expression, a reagent that promotes BCL6B expression, and a reagent that inhibits CD24 expression.
5. Application of a targeted ABHD17C-BCL6B-CD24 signal axis in the preparation of pancreatic cancer detection products.
6. The application according to claim 5, characterized in that, The product includes a diagnostic kit, which includes reagents for detecting ABHD17C expression, reagents for detecting BCL6B expression, and reagents for detecting CD24 expression.
7. The application according to claim 6, characterized in that, The reagents for detecting ABHD17C include at least one of the following: reagents for detecting whether the ABHD17C gene is overexpressed, reagents for quantitatively detecting the RNA transcription level of ABHD17C, and reagents for quantitatively detecting the protein expression level of ABHD17C.
8. The application according to any one of claims 1, 2, or 5, characterized in that, In the ABHD17C-BCL6B-CD24 signal axis, ABHD17C expression is higher in pancreatic cancer tumor tissue than in normal pancreatic tissue.
9. The application according to any one of claims 1, 2, or 5, characterized in that, In the ABHD17C-BCL6B-CD24 signaling axis, overexpression of ABHD17C drives macrophages to polarize towards the immunosuppressive M2 type by regulating the expression of the signaling molecule CD24, protecting pancreatic cancer cells from phagocytic attack by macrophages and accelerating the growth of pancreatic cancer cells.
10. The application according to any one of claims 1, 2, or 5, characterized in that, The ABHD17C-BCL6B-CD24 signaling axis inhibits nuclear translocation and promotes degradation via the ubiquitin-proteasome pathway by specifically catalyzing the depalmitoylation of cysteine at position 442 of BCL6B through ABHD17C. The nuclear deletion of BCL6B relieves transcriptional repression of CD24, and CD24 is upregulated to enhance the anti-macrophage phagocytic ability of pancreatic cancer cells.