A method for constructing a high-yield succinic acid pichia pastoris cell factory

Abstract

This invention discloses a method for constructing a high-succinic acid-producing Pichia pastoris cell factory, using Pichia pastoris (… Komagataella phaffii Using GS115 as the chassis, a reductive TCA cycle enhancement strategy and an sdh5 knockout strategy were first constructed, respectively. It was found that a single strategy was insufficient to effectively achieve succinic acid accumulation. Further, the two strategies were combined to obtain the engineered strain SAOG, which achieved succinic acid accumulation. Based on this, the malate transporter SpMAE was introduced to enhance the transmembrane transport capacity of succinic acid, and histidine auxotrophic recovery was combined to improve the growth and fermentation performance of the strain, resulting in the engineered strain SH, whose succinic acid accumulation was 25.1% higher than that of SAOG. Finally, the engineered strain SH achieved a succinic acid yield of 10.47 g / L in shake-flask fermentation and 112.6 g / L after 120 h of continuous fed-batch fermentation in a 5 L fermenter. This invention achieves efficient succinic acid synthesis in the Pichia pastoris chassis through the synergistic regulation of reductive TCA pathway enhancement, succinic acid oxidation blocking, enhanced transmembrane transport, and auxotrophic recovery, exhibiting stable fermentation performance, high yield, and good industrial application potential.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and industrial microbiology, and in particular to a recombinant Pichia pastoris cell factory for producing succinic acid, its construction method, and its application in the fermentation production of succinic acid. Background Technology

[0002] Succinic acid is an important C4 platform compound with wide applications in biodegradable plastics, polyurethanes, pharmaceutical intermediates, food additives, and fine chemicals. Current succinic acid production mainly relies on petrochemical routes, which suffers from problems such as non-renewable raw materials, high energy consumption, and a heavy environmental burden. With the development of biomanufacturing technology, the production of succinic acid using microbial fermentation has become an important research direction, offering advantages such as a wide availability of raw materials, mild reaction conditions, and environmental friendliness.

[0003] Currently, the main hosts for succinic acid biosynthesis include *Escherichia coli*, *Actinomyces*, and some naturally occurring acid-producing bacteria. However, these hosts generally suffer from insufficient acid tolerance, excessive byproduct accumulation, poor fermentation stability, or limited efficiency in genetic manipulation, hindering their industrial application. *Pichia pastoris*, as an important industrial microbial substrate, possesses advantages such as rapid growth, strong tolerance, suitability for high-density fermentation, and a relatively mature genetic manipulation system, showing good application potential in the field of organic acid biomanufacturing. In particular, *Pichia pastoris* is a methanol-nutritional yeast, capable of utilizing inexpensive carbon sources such as methanol for growth and metabolism, possessing the potential to develop processes for producing succinic acid based on one-carbon feedstocks. However, *Pichia pastoris* (… Komagataella phaffii As a methanol-nutritional yeast, *Pichia pastoris* exhibits significant differences in metabolic characteristics compared to the aforementioned model microorganisms, including predominantly respiratory metabolism, an active tricarboxylic acid cycle, a metabolic flux biased towards complete oxidation, and a relatively weak capacity for organic acid secretion. Therefore, existing metabolic engineering strategies for *Saccharomyces cerevisiae* or bacteria are difficult to directly apply to the *Pichia pastoris* system. Specifically, constructing a succinic acid synthesis pathway in *Pichia pastoris* faces the following technical challenges: (1) unstable expression efficiency and activity of key enzymes in the heterologous reducing tricarboxylic acid cycle; (2) severe carbon flux competition, making it difficult to effectively guide succinic acid accumulation; (3) succinic acid is easily further oxidized, making high-level accumulation difficult; and (4) metabolic interventions (such as key enzyme knockout) easily lead to inhibited strain growth. Therefore, how to achieve efficient succinic acid synthesis and maintain good growth performance in *Pichia pastoris* is a pressing technical problem that needs to be solved in this field. Summary of the Invention

[0004] The primary objective of this invention is to address the problems of poor host compatibility, limited metabolic flux, and insufficient product accumulation capacity in existing succinic acid biomanufacturing processes by providing a recombinant Pichia pastoris strain that produces succinic acid.

[0005] A second objective of this invention is to provide a method for constructing the aforementioned recombinant strain.

[0006] A third objective of this invention is to provide the application of the above-mentioned recombinant strain in the fermentation production of succinic acid.

[0007] To address the aforementioned technical problems, this invention provides a recombinant Pichia pastoris strain that produces succinic acid, which achieves carbon flow redirection, enhanced reducing power supply, and improved product accumulation capacity through systematic metabolic engineering.

[0008] The technical solution adopted in this invention is as follows: A recombinant Pichia pastoris strain producing succinic acid was introduced into Pichia pastoris to construct a reducing tricarboxylic acid cycle succinic acid synthesis module by introducing expression cassettes of malate dehydrogenase ScMdh, pyruvate carboxylase RoPyc, fumarate reductase ScFrd, and fumarate PkFum. The succinate dehydrogenase subunit encoding gene sdh5 in the TCA cycle was further knocked out to reduce the further oxidation of succinate. Simultaneously, an expression cassette of malate transporter SpMAE and His tag complementation were introduced.

[0009] The host strain is Pichia pastoris strain GS115.

[0010] The malate dehydrogenase ScMdh and fumarate reductase ScFrd are derived from Saccharomyces cerevisiae, and the pyruvate carboxylase RoPyc is derived from Rhizopus oryzae. Rhizopus oryzae The fumarate enzyme PkFum is derived from Pichia kudriavirida (a type of yeast). Pichia kudriavzevii The malate transporter SpMAE is derived from *Schizosaccharomyces cerevisiae* (Saccharomyces cerevisiae). Schizosaccharomyces pombe ) The NCBI-GeneID of the malate dehydrogenase encoding gene ScMdh is 853994; the NCBI-GeneID of the pyruvate carboxylase encoding gene RoPyc is 93623380; the NCBI-GeneID of the fumarate reductase encoding gene ScFrd is 856664; the NCBI-GeneID of the fumarate enzyme encoding gene PkFum is 40382569; and the NCBI-GeneID of the malate transport protein encoding gene SpMAE is 2543334.

[0011] The promoter of the expression cassette is the pADH2 promoter, pGAP promoter, pPDC1 promoter, pGPM1 promoter, or pFBA1 promoter of Pichia pastoris; the terminator is the RPS2tt terminator, RPP1Btt terminator, CYC1tt terminator, IDP1tt terminator, or TDH3tt terminator of Pichia pastoris.

[0012] The promoter of malate dehydrogenase ScMdh is pADH2, and the terminator is RPS2tt; the promoter of pyruvate carboxylase RoPyc is pGAP, and the terminator is RPP1Btt; the promoter of fumarate reductase ScFrd is pGPM1, and the terminator is IDP1tt; the promoter of fumarate oxidase PkFum is -pFBA1, and the terminator is TDH3tt; the promoter of malate transport protein SpMAE is pPDC1, and the terminator is CYC1tt.

[0013] The recombinant Pichia pastoris also expresses a marker gene, which is an resistance selection marker expression cassette on plasmid BB3aK-AE.

[0014] A method for constructing a recombinant Pichia pastoris strain involves introducing the expression cassettes of ScMdh, RoPyc, ScFrd, and PkFum into the Pichia pastoris genome via plasmids and integrating them into its genome. Then, an sdh5 knockout plasmid is constructed using the CRISPR-Cas9 system to knock out sdh5 in the host genome. Following histidine auxotrophic restoration and the introduction of the SpMAE expression cassette, a succinic acid-producing recombinant Pichia pastoris strain is obtained. This includes: (1) An expression cassette BB3aK-AE-SA containing key enzymes of the reductive tricarboxylic acid cycle was constructed using the Golden Gate modular assembly method and integrated into the genome of Pichia pastoris strain GS115 to obtain strain PPGS115-SA. (2) The SDH5 knockout plasmid was constructed using the CRISPR-Cas9 system to knock out the sdh5 gene, blocking the succinic acid oxidation pathway, and strains PPGS115-▲Sdh and SA0G were obtained. (3) By restoring the growth capacity of the strain through histidine nutritional deficiency and introducing the transport protein SpMAE to enhance the succinic acid transport capacity, an engineered Pichia pastoris strain SH was obtained.

[0015] Specifically, as follows: (1) The gene fragments of ScMdh, RoPyc, ScFrd, PkFum and SpMAE were inserted into plasmid BB1-23 by Golden Gate method to obtain the corresponding donor plasmids BB1-23-ScMDH, BB1-23-RoPYC, BB1-23-ScFRD, BB1-23-PkFUM and BB1-23-SpMAE; (2) Assemble the donor plasmid with the corresponding promoter and terminator to form BB2 / BB3aK14 grade expression cassettes; Example: Plasmid BB1-23-ScMDH, along with plasmids BB1-12-pADH2 and BB1-34-RPS2tt, is inserted into plasmid BB2-AB using the GoldenGate method to obtain plasmid BB2-AB-pADH2-ScMDH-RPS2tt; thereby obtaining the corresponding BB2-level expression cassettes: BB2-BC-pGAP-RoPYC-RPP1Btt; BB2-CD-pGPM1-ScFRD-IDP1tt; BB2-DE-pFBA1-PKFUM-TDH3tt; and BB3aK14-pPDC1-SpMAE-CYC1tt.

[0016] (3) Multiple BB2-level expression cassettes were further assembled into plasmid BB3aK-AE to obtain an integrated plasmid BB3aK-AE-SA containing a reducing tricarboxylic acid cycle succinic acid synthesis module, and introduced into Pichia pastoris to obtain recombinant strain PPGS115-SA. (4) Design a gRNA targeting sdh5, replace it with the corresponding site of the pCAI-gRNA plasmid, construct the SDH5 knockout plasmid pCAI-gRNA-kSdh, and introduce it into strains PPGS115 and PPGS115-SA to obtain engineered strains PPGS115-▲Sdh and SA0G. (5) To further increase the succinic acid production of the strain, the transport protein SpMAE and His tag were introduced into the strain SA0G to obtain strain SH; During the experiment, strain PPGS115-SA was discovered. and PPGS115-▲Sdh did not yield a Pichia pastoris strain capable of producing succinic acid. Only by further knocking out the sdh gene in strain PPGS115-SA or by supplementing the PPGS115-▲Sdh strain with histidine auxotrophic nutrient recovery—that is, when the tricarboxylic acid cycle (TCA) is blocked and the reductive tricarboxylic acid cycle (rTCA) coexists—can succinic acid production be achieved on the Pichia pastoris chassis.

[0017] Application of the recombinant Pichia pastoris strain in the production of succinic acid.

[0018] This invention also provides the application of the engineered strain in the fermentation production of succinic acid. The strain can utilize glycerol as a preferred carbon source for fermentation and accumulation of succinic acid.

[0019] The application includes the following steps: S1. Streak the engineered strain SH on a fresh YPD plate, select a single colony and inoculate it into a YPD test tube culture medium. Incubate at 30℃ and 200rpm for 16-20 h with shaking. When OD... 600When the concentration is 4-6, it is determined to be a primary seed culture for further transfer; S2. The primary seed culture was transferred to YPG medium at an inoculation rate of 1% (v / v) and cultured with shaking at 30°C and 200 rpm. Samples were taken every 24 h to measure cell growth and succinic acid production. The culture period was 4 days.

[0020] YPG medium: 20 g / L glycerol, 10 g / L yeast extract and 20 g / L tryptone.

[0021] Beneficial effects:

[0022] (1) This invention uses Pichia pastoris as the chassis to construct a reducing tricarboxylic acid cycle enhancement strategy and an sdh5 knockout strategy, respectively, proving that a single strategy is difficult to effectively achieve succinic acid accumulation, providing a basis for subsequent combined modification; (2) Further combining the enhancement of the reducing tricarboxylic acid cycle with sdh5 knockout, the engineered strain SAOG was obtained, achieving the accumulation of succinic acid in Pichia pastoris. Under the condition of shake-flask fermentation without feeding, the yield of succinic acid reached 8.37 g / L after 4 days of fermentation; (3) At the same time, the dicarboxylic acid transporter SpMAE was further introduced and histidine auxotrophic deficiency was compensated to enhance the transmembrane transport capacity of succinic acid, and at the same time improve the growth and acid production performance of the strain, so that the succinic acid accumulation of the engineered strain SH was 25.1% higher than that of SAOG; (4) This invention achieves efficient succinic acid synthesis through the synergistic regulation of multiple strategies, including pathway enhancement, product oxidation blocking, transport enhancement, and nutrient deficiency compensation. The engineered strain SH achieved a succinic acid yield of 10.47 g / L in shake flasks and 112.6 g / L after continuous fed fermentation in a 5 L fermenter for 120 h, demonstrating good potential for industrial application. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of the modular assembly of plasmid BB3aK-AE-SA; Figure 2 A schematic diagram illustrating the construction of the SDH5 knockout plasmid pCAI-gRNA-kSdh; Figure 3 This is a schematic diagram illustrating the construction of plasmid HIS-MAE-PNS3-5; Figure 4 Biomass of different engineered strains; Figure 5 A comparative diagram of the fermentation production of succinic acid by different engineered strains; Figure 6 The case of high-density fermentation production of succinic acid using recombinant Pichia pastoris strain SH. Detailed Implementation

[0024] The present invention will be further described below with reference to specific embodiments.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0026] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0027] The original strain of Pichia pastoris used in the examples was Pichia pastoris PPGS115, which can be purchased from commercial channels.

[0028] The primer sequences used in the examples are shown in Table 8.

[0029] Example 1: Construction of plasmid BB3aK-AE-SA According to the relevant gene sequences published in NCBI, the NCBI-GeneID of the malate dehydrogenase gene ScMdh is 853994; the NCBI-GeneID of the pyruvate carboxylase gene RoPyc is 93623380; the NCBI-GeneID of the fumarate reductase gene ScFrd is 856664; the NCBI-GeneID of the fumarate enzyme gene PkFum is 40382569; and the NCBI-GeneID of the malate transporter gene SpMAE is 2543334.

[0030] The malate dehydrogenase ScMdh and fumarate reductase ScFrd gene sequences from *Saccharomyces cerevisiae* were selected and amplified by PCR using the *Saccharomyces cerevisiae* genome as a template. For exogenous genes requiring heterologous expression, the nucleotide sequences of pyruvate carboxylase RoPyc from *Rhizopus oryzae*, transport protein SpMAE from *Schizosaccharomyces cerevisiae*, and fumarate fumarase PkFum from *Pichia pastoris*, provided on NCBI, were artificially synthesized after optimization based on the codon bias of *Pichia pastoris*. The optimized sequences are shown in Table 9.

[0031] The construction of recombinant plasmids BB1-23-RoPyc, BB1-23-SpMAE, and BB1-23-PkFum was entrusted to GenScript Biotech Inc. to synthesize the gene sequences of RoPyc, SpMAE, and PkFum. Recombinant plasmids BB1-23-ScMdh and BB1-23-ScFrd were amplified by PCR using the Saccharomyces cerevisiae genome as a template to obtain the ScMdh and ScFrd gene sequences. The gene fragments were then inserted into plasmid BB1-23 using the GoldenGate method to obtain recombinant plasmids BB1-23-ScMdh and BB1-23-ScFrd.

[0032] Using ScMdh-F and ScMdh-R as primers and the ScMdh gene sequence as a template, the ScMdh fragment was amplified. The primer sequences are shown in Table 8. Using ScFrd-F and ScFrd-R as primers and the ScFrd gene sequence as a template, the ScFrd fragment was amplified. The primer sequences are shown in Table 8.

[0033] The PCR enzyme used for amplification was Phanta Max Super-Fidelity DNA Polymerase from Nanjing Novizan Biotechnology Co., Ltd. The system is as follows: Table 1 PCR fragment amplification system Add reagents Added amount Phanta Max Super-Fidelity DNA Polymerase 1µL buffer 25µL dNTP 1µL above 1µL quoted below 1µL template 1µL <![CDATA[ddH2O]]> Up to 50 µL The amplified ScMdh and ScFrd fragments were recovered and purified by agarose gel electrophoresis.

[0034] GoldenGate was assembled using Bsa1 enzyme and T4 ligase from Beyotime Biotechnology Co., Ltd., and the reaction system is as follows: Table 2. Reaction systems for constructing BB1-23-ScMdh and BB1-23-ScFrd plasmids. Add reagents Added amount BB1-23 1µL ScMdh / ScFrd 1µL Bsa1 0.5µL BSA 1µL T4 ligase 0.5µL T4buffer 1µL <![CDATA[ddH2O]]> Up to 10 µL The recombinant plasmids were transformed into Escherichia coli DH5α competent cells, screened by LB-KanR plates, and verified by colony PCR and sequencing to obtain positive recombinant plasmids BB1-23-ScMdh and BB1-23-ScFrd.

[0035] Furthermore, taking BB2-AB-ScMdh containing the ScMdh expression cassette as an example, the reaction system and procedure of Golden Gate Assembly are as follows: Table 3. Golden Gate Assembly reaction system for constructing BB2-AB-ScMdh plasmid. Add reagents Added amount BB1-12-pADH2 40 nM BB1-23-ScMdh 40 nM BB1_34_RPS2tt 40 nM BB2_AB 40 nM Bpi I 10 U T4 Ligase 40 U CutSmart™ Buffer (10×, NEB) 2µL ATP (10 mM, NEB) 2µL <![CDATA[ddH2O]]> Up to 50 µL The reaction conditions are: Table 4. Golden Gate Assembly reaction procedure for constructing the BB2-AB-ScMdh plasmid reaction temperature reaction time 37℃ 3 min 16℃ 3 min, step 1, 35 cycles 37℃ 10 min 55℃ 30 min 80℃ 10 min After the reaction was completed, the reaction system was transformed into E. coli DH5α, and E. coli carrying the recombinant plasmid BB2-AB-ScMdh were screened using LB-AmpR plates. Similarly, recombinant plasmids BB2-BC-RoPYC, BB2-CD-ScFRD, BB2-DE-PKFUM, and BB2-EF-SpMAE were obtained.

[0036] The expression plasmid BB3aK-AE-SA was also constructed using Golden Gate Assembly. The reaction system was as follows: Table 5. Golden Gate Assembly reaction system for constructing BB3aK-AE-SA plasmid. Add reagents Added amount BB2-AB-ScMdh 40 nM BB2-BC-RoPYC 40 nM BB2-CD-ScFRD 40 nM BB2-DE-PKFUM 40 nM BB3aK-AE 40 nM Bsa I 10 U T4 Ligase 40 U CutSmart™ Buffer (10×, NEB) 2µL ATP (10 mM, NEB) 2µL <![CDATA[ddH2O]]> Up to 50 µL The reaction conditions are: Table 6. Golden Gate Assembly reaction procedure for constructing BB3aK-AE-SA plasmid. reaction temperature reaction time 37℃ 3 min 16℃ 3 min, step 1, 40 cycles 37℃ 10 min 55℃ 30 min 80℃ 10 min After the reaction was completed, the reaction system was directly transformed into *E. coli* DH5α. *E. coli* carrying the recombinant plasmid BB3aK-AE-SA were screened using LB-KanR plates. The constructed plasmid BB3aK-AE-SA was linearized by Asc I restriction enzyme digestion, purified by a gel extraction kit, electroporated into *Pichia pastoris* PPGS115, and screened using YPD-G418 plates to obtain recombinant *Pichia pastoris* PPGS115-SA. Example 2: Construction of the knockout plasmid pCAI-gRNA-kSdh Gene knockout was performed using CRISPER-Cas9, employing the knockout plasmid pCAI-gRNA to knock out the succinate dehydrogenase subunit encoding gene sdh5. Specifically, based on the target sequence of the succinate dehydrogenase subunit encoding gene sdh5 from *Pichia pastoris* provided at https: / / chopchop.cbu.uib.no / , a corresponding gRNA-N20 sequence was designed and inserted into the original gRNA site in the pCAI-gRNA plasmid to obtain the succinate dehydrogenase knockout plasmid pCAI-gRNA-kSdh. Further, using the *Pichia pastoris* genome as a template, the upper and lower homologous arm fragments sdh5 up and sdh5 down were amplified, and PCR amplification was performed to the sdh5-donor fragment. The relevant primer sequences are shown in Table 8. The plasmids pCAI-gRNA-kSdh and sdh5-donor were electroporated into strains PPGS115 and PPGS115-SA, and the recombinant Pichia pastoris strains PPGS115-▲Sdh and SA0G were obtained by screening with YPD-bleomycin plates.

[0037] Example 3: Construction of complement plasmid HIS-MAE-PNS3-5 Because knocking out the sdh5 gene in the TCA cycle impairs the activity of the succinate dehydrogenase complex, it leads to a decrease in the strain's respiratory metabolism and energy supply. Figure 4The growth performance was weakened, so histidine was added to improve the nutritional status of the strain to enhance its biomass accumulation and fermentation production capacity. To further enhance succinic acid transport capacity, the malic acid transporter SpMAE from *Fissococcus yeast* was introduced to construct the addition plasmid HIS-MAE-PNS3-5. The His sequence was amplified by PCR using the pPIC9K plasmid (purchased from Thermo Fisher Scientific) as a template, and the SpMAE expression cassette was amplified by PCR using BB3aK14-SpMAE as a template. The addition plasmid HIS-MAE-PNS3-5 was obtained by one-step cloning. The relevant primer sequences are shown in Table 8. The recombinant strain SH was obtained by electroporation into the recombinant *Pichia pastoris* strain SA0G. Table 7. Plasmids and strains used in this invention strain or plasmid Related characteristics source plasmid BB1_12_pADH2 BB1 carrying ADH2 promoter GoldenPiCS Kit BB1_12_pGAP BB1 carrying GAP promoter GoldenPiCS Kit BB1_12_pPDC1 BB1 carrying PDC1 promoter GoldenPiCS Kit BB1_12_pGPM1 BB1 carrying GPM1 promoter GoldenPiCS Kit BB1_12_pFBA1 BB1 carrying FBA1 promoter GoldenPiCS Kit BB1_12_pPDC11 BB1 carrying PDC1 promoter GoldenPiCS Kit BB1_34_RPS2tt BB1 carrying RPS2 terminator GoldenPiCS Kit BB1_34_RPP1Btt BB1 carrying RPP1B terminator GoldenPiCS Kit BB1_34_ScCYC1tt BB1 carrying ScCYC1 terminator GoldenPiCS Kit BB1_34_IDP1tt BB1 carrying IDP1 terminator GoldenPiCS Kit BB1_34_TDH3tt BB1 carrying TDH3 terminator GoldenPiCS Kit BB1_34_CYC1tt BB1 carrying CYC1 terminator GoldenPiCS Kit BB1_23 BB1 for CDS cloning GoldenPiCS Kit BB2_AB BB2 carrying fusion sites A-B GoldenPiCS Kit BB2_BC BB2 carrying fusion sites B-C GoldenPiCS Kit BB2_CD BB2 carrying fusion sites C-D GoldenPiCS Kit BB2_DE BB2 carrying fusion sites D-E GoldenPiCS Kit BB3aK14 BB3 carrying fusion sites 1-4 GoldenPiCS Kit BB1_23_ScMDH BB1_23 carrying ScMDH gene This study BB1_23_RoPYC BB1_23 carrying RoPYC gene This study BB1_23_ScFRD BB1_23 carrying ScFRD gene This study BB1_23_PKFUM BB1_23 carrying PKFUM gene This study BB1_23_SpMAE BB1_23 carrying SpMAE gene This study BB2_AB- ScMDH BB2_AB, pADH2- ScMDH -RPS2tt This study BB2_BC- RoPYC BB2_BC, pGAP- RoPYC -RPP1Btt This study BB2_CD- ScFRD BB2_CD, pGPM1- ScFRD -IDP1tt This study BB2_DE- PKFUM BB2_DE, pFBA1- PKFUM -TDH3tt This study BB2_EF - SpMAE BB2_EF, pFBAPDC1 - SpMAE - CYC1tt This study BB3aK_AE - SA BB3aK_AF, ENO1::SA expression cassette This study BB3aK14 - SpMAE BB3_Ak14, pPDC1 - SpMAE - CYC1tt This study pPIC9K Commercial plasmid HIS - MAE - PNS3 - 5 <![CDATA[pPDC1- SpMAE -CYC1tt, His + ]]> This study Strain PPGS115 <![CDATA[ his4 - , But + ]]> CBS7435[1] PPGS115 - SA PPGS115, expression of SA pathway This study PPGS115 - ▲Sdh PPGS115, deletion of Sdh5 subunit This study SA0G PPGS115 - SA, deletion of Sdhgene This study SH <![CDATA[SA0G, expression SpMAE,HIS + ]]> This study Table 8 Primers used in this invention Primer name Sequence (5’—3’) ScMDH - F cacaggtctcccatggtcaaagtcgcaattcttgg ScMDH - R gatcggtctccaagctcatagcttggaagagtctaggatga ScFRD - F cacaggtctcccatgtctctctctcccgttgttgtt ScFRD - R gatcggtctccaagctCacttgcggtcattggcaa P - His - PNS3 - 5 - F CGGAGCATGTAGGTCTAGAT P - His - PNS3 - 5 - R ggtctccgatcgcgaaaa P - up - F tagagaactcattcttgttc P - up - R acaagcagaactccactttttccacgataaaccgttcaag P - down - F cttgaacggtttatcgtggaaaaagtggagttctgcttgt P - down - R catcgatcttggctctgt P - Ppdc1 - SpMAE - CYCtt - F ttttcgcgatcggagaccggagagcaaataaacgca P - Ppdc1 - SpMAE - CYCtt - R GCAAATTAAAGCCTTCGAGATCTAGACCTACATGCTCCG gSdhN20 - F ACAAATCAAAGACCCGCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCCTGGGCCGTGAAAAACTACGGTTTTAGAGCTAGAAATAGCAAGTTAA gSdhN20-F GTTTCGTCCTCACGGACTCATCAGCGGGTCTTTGATTTGTTTAGGTAACTTGAACTGGATGTATTAGTTTGG Example 4: Application of recombinant bacteria in the production of succinic acid The engineered bacteria were cultured using the recombinant bacteria PPGS115 from the examples. 、 PPGS115-SA, PPGS115-▲Sdh, SA0G, and SH were subjected to shake-flask fermentation to evaluate their succinic acid production capacity.

[0038] The specific method is as follows: After activating each engineered strain in the preservation tube by streaking, it was inoculated into YPD test tube medium at a 1% inoculum rate and cultured at 30℃ for 24 h to obtain seed culture. Then, the seed culture was inoculated into a 250 mL shake flask containing 50 mL of fermentation medium at a 1% inoculum rate and cultured at 30℃ and 200 rpm for 4 days with shaking. Samples were taken every 24 h to determine cell growth and succinic acid production. The fermentation medium consisted of 20 g / L glucose, 10 g / L yeast extract, and 20 g / L trypsin.

[0039] After fermentation, the fermentation broth was centrifuged, and the supernatant was used to determine the succinic acid content. For example... Figure 5 As shown, the results showed that only the recombinant strains SA0G and SH, which knocked out Sdh5 and expressed the reducing TCA pathway, could achieve effective accumulation of succinic acid. Moreover, the recombinant strain SH had the highest succinic acid yield in the shake flask, reaching 10.47 g / L. Example 5: High-density fermentation production of succinic acid using recombinant strain SH ① Seed culture: a. Primary seed culture: Take 1% of the recombinant strain SH bacterial culture from the cryopreservation tube and inoculate it into YPD test tubes. Incubate at 30°C and 200 rpm for 16-20 hours to obtain the primary seed culture. The YPD medium contains 2% peptone, 1% yeast extract and 2% glucose. b. Secondary seed culture: Take 10% of the primary seed culture and inoculate it into a new seed culture medium. Incubate under the same conditions as in a, at a constant temperature, to obtain the seed culture for fermentation. The seed culture medium contains: 20 g / L glycerol, 10 g / L yeast extract, and 20 g / L peptone. ② The seed culture obtained from the continuously fed fermentation was inoculated into a 5 L fermenter containing 2 L of fermentation medium (40 g / L glycerol, 20 g / L yeast extract, and 40 g / L peptone). The recombinant SH strain underwent continuously fed fermentation in the 5 L fermenter at 30 ℃, 500 rpm, dissolved oxygen maintained at 30%, and pH adjusted to 6.5 using ammonia. The initial glycerol concentration in the fermenter was 40 g / L. When the glycerol was nearly depleted, glycerol was added continuously to maintain the glycerol concentration below 5 g / L. Samples were taken every 12 h to determine cell growth and succinic acid yield. After 120 h of fermentation, the cell OD... 600 The yield reached 172, and the succinic acid production reached 112.6 g / L (see...). Figure 6 ).

[0040] This invention enhances the growth and succinic acid transport capabilities of *Pichia pastoris* by introducing a reducing TCA synthesis pathway, knocking out the sdh5 subunit in the tricarboxylic acid pathway, and further introducing the transporter protein SpMAE and histidine supplementation. This successfully achieved a succinic acid yield of 10.47 g / L in shake flasks using engineered *Pichia pastoris* strains. Finally, continuous fed-batch fermentation in a 5 L fermenter resulted in the production of 112.6 g / L of succinic acid by the recombinant *Pichia pastoris* strain SH within 120 h, laying the foundation for subsequent industrialization.

[0041] Table 9. Sequences of codon-optimized genes involved in this invention. Gene name Gene sequence RoPYC ATGCCCGCGGCACCTGTTAGGGAGCATTCTGTGGACACAATTCGACGAAATTCCGAGGTGATGGGCAACCTCAGGAAACTGATGGTGGTGAATCGAGGAGAAATTGCAATCCGAGTGTTCAGGACAGCTCACGAGCTTTCAATGAAAACTGTAGCAATTTTTAGCCATGAGGACCGTCTAAGTATGCACAGATATAAAGCAGATGAGTCCTATCAGTTGGGCCGTATAGGTCAATATACACCTGTTGGGGCGTACCTAGCCCAGGATGAAGTCGTGCGCATTGCCAAGGAACGAGGTGTGTCGATGATACACCCGGGATACGGCTTCCTGTCAGAAAATGCGGAGTTCGCCAGAAAAGTGGAAGCGGCCGGAATAACGTTTATCGGACCGAGCCTTGATGTCATAGAATCGCTCGGGGATAAGACGAAGGCACGGACTATCGCTATGAAGTGTGAAGTTCCTGTAGTACCCGGGACGCCTGGTCCAGTGTCTGAGTATAAAGAAGCACTGAATTTCATCAAGGAGTATGGATTTCCCATCATCATAAAAGCGGCGATGGGTGGAGGTGGCCGTGGAATGAGGGTAGTCCGGGATGAGGCAAGTTTAGAAGATGCCTTTACCAGAGCTAAGTCAGAAGCTCTTGCTGCCTTCGGAGATGGAACAGTTTTTATAGAACGGTTCCTAGACAAGCCGCGTCATATAGAAGTTCAGTTGCTAGCCGACCGCGCTGGTAATGTAGTACACTTATTCGAACGGGATTGTTCCGTACAGCGACGCCACCAGAAGGTTGTGGAAATTGCGCCCGCTAAGAATCTCGACAACAAGGTACGGGAGGCGATCTTGAACGATGCCATCAAAATCGCTAAAGCCGTGAAATACAAGAACGCAGGTACCGCAGAATTCCTCGTCGATAATCAAAATCGCCATTACTTCATCGAGATCAACCCTCGCATACAAGTGGAACACACTATCACTGAGGAAATCACAGGTATTGACATTGTCGCGGCTCAAATACAAATTGCCGCTGGGGCCCTTCTGCCACAACTCGGATTGACACAACAAAGGATAAGACAGAGGGGCTTTGCGATACAGTGCCGGGTAACCACGGAGGACCCGGAGAAAAACTTCCAACCCGATACCGGGAAAATAGAGGTATATCGATCCTCGGGCGGTAATGGGGTCCGCCTCGATGGGGGGGCTGGTTATGCGGGCGCAATTATAACGCCCCACTATGACTCGCTCCTAGTGAAAGTTAGTTGTTCAGGAAGTACATATGAAGTCGCGCGACGAAAGATCGTACGGGCCTTAGTAGAATTTCGTATTCGAGGCGTCAAAACCAATATCCCTTTCTTGCAGAGACTCTTAACCCACGACACGTTTATCAACGGTAACTGTTGGACGACCTTTATTGACGACACTCCAGATCTTTTTCGCTTAGTACAGTTCCAGAATCGGGCCCAACGCCTGTTGGGGTATCTCGGCGATGTTGTAGTCAACGGTTCTCAGATCAAAGGGCAAATGGGGGACCCTATATTAAAACAGGAAATCGAAATCCCGGTGTTACGTGAGTCTGGCTCGGATAAAACGGTCGACGTATCCGCCCCAGCAACCGAAGGTTGGCGCAAGATAATCGTGGAGCAGGGACCAGAAGCATTTGCTAAGGCCGTGAGAGCTTACCCAGGCGTACTTATTACTGATACAACATGGCGCGATGCTCACCAAAGTCTACTCGCAACGCGCGTAAGAACGGTTGACTTGTTGCGCATTGCTCCCGCAACTAGTCATGCCCTTGCCAACGCATTCAGTCTTGAATGTTGGGGCGGCGCAACCTTCGATGTGGCAATGCGTTTCCTCCATGAAGATCCTTGGGACCGGCTGGCGGCGCTTCGGAAATTAGTTCCAAATGTTCCATTCCAGATGCTTCTTCGGGGCGCTAACGCTGTGGGATATACCTCTTACCCTGATAATGTCATATATGAATTTTGCGACAAAGCAGTGAAATGCGGAATGGATGTCTTTAGGATATTCGATTCATTGAACTATGTTGAAAATATGAGGCTAGGGATTGATGCCGTTAAGAAGGCCGGGGGGGTAGTAGAAGCGACTATATGCTACACTGGAGACGTTAGTAACCCGAACCGTAAAAAGTACGATCTGAAATATTACTTAGATCTGACGCAGTCGCTAGTCAATGAAGGGATCCATATACTGGGCATCAAGGACATGGCAGGTTTACTGAAGCCCGAGGCGGCGAAATTGTTAGTTTTTTCTATTCGTGCAAAATTCCCCGACCTACCAATACATGTGCATACTCATGACACGGCCGGGACGGGCGTTGCGAGCATGATGGCGGCCGCAGCCGCTGGCGCAGATATTGTCGATGTTGCAGTTGACGCTATGAGTGGAATGACCAGTCAACCAGCAATGGGGGCTATAGTGGCGGGACTTGAGCAAACTAATTTAGGAACCGGGATACGTATGGAAGATATCCACGCGATTAATTCTTACTGGGAGCAGTGCAGACTACTTTACTCGTGCTTTGAGGCGAACGTCCGGTCAGCGGACTCAGGTGTGTACGAGCATGAGATGCCGGGCGGGCAATATACAAACCTAATGTTTCAAGCTCAACAGCTGGGACTGGGCACACAGTGGAAACAGATAAAGAAGGCATATAAAGAAGCGAACGAATTGTGTGGGGACTTGGTCAAGGTAACTCCGTCATCGAAAGTTGTAGGCGATCTAGCACAGTTTATGGCTAGCAACCAACTCTCCGCTAAAGAGTTTGAAGAGCGGGCCTCGAGCCTTAGTTTGCCAACGTCAGTCATTGAATTTTTTCAGGGTTACCTCGGCCAACCATACGGCGGGTTTCCTGAGCCGTTAAGGTCTAACATTCTAAGGGACCTACCTCGTTTAGACGGTCGTCCTGGCGCGTCTTTGCCGCCCCTAGATATGGCTAAACTCAAAGAAGAATTGGTGGAAAAGTACGGTTCCTCTATTAGAGACTACGACGTGATTAGCGCTGCCCTTTATCCAAAGGTTTTTGCTGATTACCGAGACACAGTTTCTCAATACGGGGACTTGTCCGTTCTTCCTACTCGATACTTCCTCAGCAAACCCGAAATTAATGAGGAGTTCCACGTCGGTATCGAGGAGGGCAAGACCCTCATTATCAAACTCCTAGCGGTCGGACCGCTGAACAATGATGGTAAGAGGGACGTATATTTTGAGTTAAACGGAGAAGCAAGAGTGGTCGGAATAGTTGACCGCAACTCTGCGATTGAGATAGTAACTCGGGAGAAGGCGAATCCAAGCAATCCTGGAGATATTGGGGCTCCTATGTCCGGTGTTGTTGTTGAGATCAGGGCTAAGGAGGGTAGCCATGTTAAAGCAGGAGATCCTTTAGCTGTACTGTCCGCGATGAAGATGGAGACTGTCGTGACAGCTCCGGTCGCTGGTAGAGTCGAGAGAGTCGCCATCCAAGAGGGAGACTCGCTCTCAGCGGGTGATCTGGTCGCAAAGGTTGTAAAGGAGGAAGCCTGA PKFUM ATGCTAGCAGCGCGTTCTTTAAAAGCGCGTATGTCTACCAGGGCTTTCTCGACGACGTCAATCGCTAAACGAATAGAAAAAGATGCCTTTGGTGATATAGAAGTACCCAATGAAAAATATTGGGGAGCACAAACTCAACGTAGCTTACAGAACTTCAAGATCGGTGGTAAGCGAGAAGTAATGCCCGAGCCTATTATAAAGAGCTTTGGAATCCTCAAGAAAGCTACAGCAAAAATTAACGCGGAATCCGGCGCACTTGACCCCAAGTTAAGCGAAGCTATACAACAGGCCGCAACCGAGGTGTACGAAGGTAAGCTAATGGATCACTTCCCACTAGTTGTTTTCCAGACAGGCTCCGGAACACAGAGTAACATGAATGCAAATGAAGTGATTTCGAATCGCGCCATCGAGATTCTCGGTGGTGAACTGGGGTCCAAAACGCCGGTGCACCCCAATGATCATGTAAACATGTCTCAATCCAGTAACGACACCTTTCCGACCGTCATGCATATCGCTGCCGTTACTGAAGTCTCGTCACATCTGTTGCCTGAGTTGACTGCCCTGCGTGACGCTCTACAGAAGAAAAGTGACGAGTTTAAAAACATAATAAAGATTGGGCGAACACACCTTCAGGACGCTACACCTTTAACATTAGGCCAAGAGTTTTCTGGATACGTACAACAATGTACGAATGGGATTAAGCGGATCGAGATAGCTCTTGAGCATCTGAGGTATCTCGCACAGGGAGGCACTGCCGTAGGCACGGGTTTGAACACCAAGAAAGGTTTTGCTGAAAAAGTCGCGAATGAGGTAACTAAACTGACTGGCCTCCAGTTCTACACGGCACCAAATAAATTTGAGGCACTGGCCGCTCACGACGCGGTTGTCGAGATGAGCGGCGCGCTTAATACCGTAGCAGTCTCCTTATTCAAAATTGCGCAGGACATTCGCTATCTTGGGTCGGGGCCGAGATGCGGATACGGTGAACTCGCCTTGCCGGAGAACGAACCTGGAAGTAGCATCATGCCTGGGAAGGTGAACCCCACGCAGAATGAAGCGCTCACGATGCTATGTACCCAGGTGTTCGGAAATCACTCCTGTATTACTTTTGCTGGAGCCTCAGGCCAATTTGAGTTGAACGTGTTCAAACCAGTCATGATAAGTAACCTTTTGAGTTCAATTAGATTGTTAGGGGATGGGTGCAATTCTTTTCGCATCCATTGCGTTGAGGGGATCATCGCGAACACAGATAAGATAGATAAGCTCCTGCATGAATCGTTGATGTTGGTTACCGCACTTAACCCGCATATTGGGTACGACAAAGCGTCTAAGATAGCCAAAAACGCGCACAAGAAGGGTCTGACACTAAAGCAATCAGCCTTAGAACTAGGCTATCTAACTGAGGAACAATTCAATGAGTGGGTCCGGCCAGAGAATATGATCGGCCCAAAGGATTGA SpMAE ATGGGTGAACTTAAGGAAATCCTTAAACAACGCTATCACGAGCTGCTTGACTGGAACGTAAAGGCGCCACACGTGCCGCTCAGCCAACGACTGAAACATTTCACGTGGTCATGGTTTGCATGCACAATGGCCACCGGTGGTGTTGGGCTTATAATAGGTTCATTCCCGTTCCGGTTCTACGGCTTGAATACGATAGGAAAGATTGTCTATATCTTGCAGATATTCTTATTCTCACTTTTCGGCAGTTGTATGCTATTCAGGTTTATTAAGTACCCCTCCACTATAAAAGACAGTTGGAATCACCACTTAGAGAAGCTCTTTATCGCAACTTGCCTTCTAAGCATATCCACGTTTATTGATATGCTGGCGATTTATGCTTATCCTGATACCGGGGAGTGGATGGTGTGGGTAATCCGAATCTTGTATTACATTTACGTGGCCGTTTCTTTCATCTATTGCGTTATGGCGTTTTTTACTATCTTCAATAACCATGTATATACGATAGAAACTGCTAGTCCCGCTTGGATCTTACCTATTTTTCCTCCCATGATATGTGGAGTGATAGCAGGTGCCGTGAACTCGACACAGCCGGCGCATCAGTTAAAAAATATGGTCATTTTTGGAATCCTATTTCAGGGGCTAGGCTTCTGGGTCTATTTACTACTTTTCGCTGTCAACGTACTGCGTTTCTTCACTGTGGGGTTAGCGAAACCGCAAGATAGACCTGGAATGTTCATGTTCGTCGGCCCACCTGCCTTCTCGGGGCTGGCCCTCATTAACATAGCACGGGGAGCCATGGGGAGCCGCCCCTACATCTTTGTTGGAGCTAATAGTTCTGAATATTTGGGCTTTGTATCCACATTCATGGCTATATTTATCTGGGGACTAGCAGCTTGGTGTTACTGTTTGGCGATGGTATCCTTTCTGGCCGGTTTTTTCACCCGTGCACCGTTAAAGTTTGCGTGTGGCTGGTTTGCATTCATTTTTCCAAATGTGGGATTCGTCAACTGTACGATTGAAATAGGCAAGATGATCGACTCTAAGGCGTTTCAGATGTTTGGTCATATAATTGGGGTAATTCTCTGCATCCAATGGATTTTGCTGATGTACCTCATGGTCAGGGCATTTTTGGTTAACGATCTCTGCTACCCAGGGAAAGATGAGGACGCTCATCCACCACCGAAACCTAATACCGGCGTTCTGAACCCAACATTTCCCCCCGAGAAAGCTCCCGCCTCGCTAGAGAAAGTAGATACCCACGTTACATCGACTGGTGGCGAATCTGACCCGCCTTCCAGCGAGCATGAATCAGTTTGA

Claims

1. A recombinant Pichia pastoris strain producing succinic acid, characterized in that, The recombinant Pichia pastoris strain is a strain of Pichia pastoris ( Komagataella phaffii The expression cassettes of malate dehydrogenase ScMdh, pyruvate carboxylase RoPyc, fumarate reductase ScFrd, and fumarate PkFum were introduced into the matrix; the succinate dehydrogenase subunit encoding gene sdh5 was further knocked out; and the expression cassette of malate transport protein SpMAE and His tag were further introduced to obtain the matrix.

2. The recombinant Pichia pastoris strain according to claim 1, characterized in that, The Pichia pastoris strain is GS115.

3. The recombinant Pichia pastoris strain according to claim 1, characterized in that, The malate dehydrogenase ScMdh and fumarate reductase ScFrd are derived from Saccharomyces cerevisiae, and the pyruvate carboxylase RoPyc is derived from Rhizopus oryzae. Rhizopus oryzae The fumarate enzyme PkFum is derived from Pichia kudriavirida (a type of yeast). Pichia kudriavzevii ), and the malate transporter SpMAE is derived from the yeast Schizosaccharomyces cerevisiae ( Schizosaccharomyces pombe Histidine (His) originates from the pPIC9K plasmid.

4. The recombinant Pichia pastoris strain according to claim 3, characterized in that, The NCBI-GeneID of the malate dehydrogenase encoding gene ScMdh is 853994; the NCBI-GeneID of the pyruvate carboxylase encoding gene RoPyc is 93623380; the NCBI-GeneID of the fumarate reductase encoding gene ScFrd is 856664; the NCBI-GeneID of the fumarate enzyme encoding gene PkFum is 40382569; and the NCBI-GeneID of the malate transport protein encoding gene SpMAE is 2543334.

5. The recombinant Pichia pastoris strain according to claim 1, characterized in that, The promoter of the expression cassette is the pADH2 promoter, pGAP promoter, pPDC1 promoter, pGPM1 promoter, or pFBA1 promoter of Pichia pastoris; the terminator is the RPS2tt terminator, RPP1Btt terminator, CYC1tt terminator, IDP1tt terminator, or TDH3tt terminator of Pichia pastoris.

6. The strain according to claim 1, characterized in that, The recombinant Pichia pastoris also expresses a marker gene, which is an resistance selection marker expression cassette on plasmid BB3aK-AE.

7. The method for constructing the recombinant Pichia pastoris strain according to any one of claims 1 to 6, characterized in that, The expression cassettes of ScMdh, RoPyc, ScFrd, and PkFum were introduced into the Pichia pastoris in plasmid form and integrated into its genome. Then, an SDH5 knockout plasmid was constructed using the CRISPR-Cas9 system to knock out sdh5 in the host genome. Subsequently, histidine auxotrophic restoration and the introduction of the SpMAE expression cassette resulted in a succinic acid-producing recombinant Pichia pastoris strain.

8. The construction method according to claim 7, characterized in that, Includes the following steps: (1) An expression cassette BB3aK-AE-SA containing key enzymes of the reductive tricarboxylic acid cycle was constructed using the Golden Gate modular assembly method and integrated into the genome of Pichia pastoris strain GS115 to obtain strain PPGS115-SA. (2) Constructing SDH5 knockout plasmids using the CRISPR-Cas9 system. sdh5 Genes were used to block the succinic acid oxidation pathway, resulting in strain SA0G. (3) By restoring the growth capacity of the strain through histidine nutritional deficiency and introducing the transport protein SpMAE to enhance the succinic acid transport capacity, an engineered Pichia pastoris strain SH was obtained.

9. The use of the recombinant Pichia pastoris strain according to any one of claims 1 to 8 in the production of succinic acid.

10. The application according to claim 9, characterized in that: The engineered strain SH was seed cultured and then inoculated into a fermentation medium, and cultured at 30°C to produce succinic acid.

Images