MicroRNA-modified umbilical cord mesenchymal stem cells and exosomes and applications thereof

By optimizing the miR-210 mutant sequence and introducing it into umbilical cord mesenchymal stem cells, the problems of low delivery efficiency and insufficient stability were solved, achieving efficient tissue repair and nerve function recovery, and providing a more efficient treatment option.

CN122326596APending Publication Date: 2026-07-03SHANGHAI ZHIQUAN BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610320516.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-17
Publication Date
2026-07-03

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

MicroRNA modified umbilical cord mesenchymal stem cells and exosomes and applications. The present application provides a treatment technology based on miR-210 mutant umbilical cord mesenchymal stem cells and exosomes. By specifically modifying the miR-210 sequence, a mutant with enhanced stability and targeting efficiency is obtained. After being introduced into umbilical cord mesenchymal stem cells, exosomes with high expression of the mutant can be prepared. The exosomes show significant therapeutic effect in various disease models, including promoting angiogenesis, accelerating wound repair and neuroprotection. The present application simultaneously protects the mutant sequence, recombinant vector, recombinant cell and its preparation method, and the application of the exosomes in the preparation of drugs for treating ischemic diseases and tissue damage. This technology optimizes the sequence and delivery system of miR-210, providing a new solution for tissue repair.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of medicine, specifically to the field of umbilical cord mesenchymal stem cells. Background Technology

[0002] Umbilical cord mesenchymal stem cells (UC-MSCs) have shown great potential in regenerative medicine and immunomodulatory therapy due to their wide availability, ethically sound collection methods, low immunogenicity, and strong proliferation and differentiation capabilities. Studies have shown that UC-MSCs can promote tissue repair (e.g., myocardial infarction, osteoarthritis, diabetic foot ulcers) and regulate immune responses (e.g., graft-versus-host disease, autoimmune diseases) through paracrine mechanisms (e.g., secretion of growth factors and exosomes) and direct cell replacement mechanisms. However, the clinical application of natural UC-MSCs still faces several challenges: low in vivo survival rate: post-transplantation, the host microenvironment (e.g., hypoxia, inflammation) leads to significant apoptosis, limiting therapeutic efficacy. Insufficient homing efficiency: only a small number of cells migrate directionally to the injury site, affecting treatment efficacy. Functional heterogeneity: UC-MSCs from different donors or culture conditions vary in proliferation capacity, differentiation tendency, and paracrine profile, affecting treatment stability. To improve the therapeutic efficacy of UC-MSCs, researchers have explored various modification strategies, but all have limitations: Gene overexpression: Transplanting survival-promoting genes (such as HIF-1α and VEGF) via viral vectors (such as lentiviruses) can enhance cells' anti-apoptotic or angiogenic capabilities, but may lead to excessive proliferation or tumorigenesis. Chemical pretreatment: Pretreatment with hypoxia or cytokines (such as TGF-β) can temporarily activate protective pathways, but the effects are not durable and the regulation is not precise. Exosome delivery: Although it can avoid the risks of cell transplantation, large-scale production is difficult, and the efficacy depends on repeated dose administration.

[0003] microRNAs (miRNAs) are a class of non-coding RNAs approximately 18-25 nt in length that can regulate the expression of target gene mRNAs, playing a central role in cell proliferation, differentiation, apoptosis, and stress responses. Compared to traditional gene modification, miRNA regulation has the following unique advantages: Precision: A single miRNA can simultaneously regulate multiple target genes, forming a synergistic effect (e.g., the miR-17-92 cluster simultaneously inhibits apoptosis and promotes proliferation). Safety: miRNA expression is transient or reversible, avoiding the risk of long-term integration of exogenous genes. Scalability: The same delivery system (e.g., lentivirus) can be adapted to different miRNAs, flexibly addressing different disease needs.

[0004] Despite the enormous regulatory potential of miRNAs, their application in UC-MSCs still faces key bottlenecks: unclear miRNA screening criteria; MSCs from different tissue sources may respond differently to the same miRNA, requiring optimized selection based on the characteristics of UC-MSCs.

[0005] Insufficient delivery efficiency and stability: Existing transfection methods (such as liposomes) are inefficient for UC-MSCs, and miRNAs have short half-lives. Lack of functional validation systems: There is a lack of standard protocols for assessing the long-term safety (e.g., tumorigenicity) and in vivo dynamic behavior of cells after miRNA modification.

[0006] miR-210 is one of the most crucial regulatory molecules among hypoxia-responsive miRNAs. Its core functions include: promoting angiogenesis by targeting and inhibiting anti-angiogenic factors (such as EFNA3 and PTP1B), activating the VEGF / HIF-1α signaling pathway, and enhancing endothelial cell migration and lumen formation. Regulating cell survival by inhibiting apoptosis-related genes (such as Casp8ap2 and ISCU) under hypoxic conditions, thereby enhancing cellular resistance to ischemic injury. Participating in tissue repair by regulating target genes such as FGF1 and PDK1, promoting fibroblast proliferation and energy metabolism reprogramming. Existing research has shown that overexpression of miR-210 in bone marrow mesenchymal stem cells (BM-MSCs) significantly enhances the pro-angiogenic capacity of their secreted exosomes, improving blood perfusion in ischemic tissues. Similar strategies may be even more effective in umbilical cord mesenchymal stem cells (UC-MSCs) because UC-MSCs possess stronger paracrine activity and tissue repair potential. Their secreted exosomes carry higher natural abundances of miR-210 and are more sensitive to hypoxic microenvironments. Furthermore, UC-MSC-derived exosomes exhibit unique advantages in miR-210 delivery due to their low immunogenicity and excellent tissue penetration. Summary of the Invention

[0007] To address the above issues, this invention innovatively develops a gene modification strategy based on the miR-210 mutant, targeting a key bottleneck in the clinical application of umbilical cord mesenchymal stem cells (UC-MSCs). This solves the problems of low delivery efficiency and short-lasting effects of traditional miRNAs, providing a new solution for the clinical translation of UC-MSCs.

[0008] The first aspect of this invention involves providing a miR-210 mutant structure.

[0009] The mature sequence of human miR-210 (miR-210-3p) is as follows:

[0010] 5'-UGUGCGUGUGACAGCGGCUGA-3' (SEQ ID NO: 1). Since the non-seed region at the 3' end has little impact on the targeting of miR-210 but affects stability, modifications to the 3' end or the central region can be considered to enhance the effect of the target sequence. Based on the above design principles, the inventors designed multiple mutant sequences, totaling 218 sequences. After structural generalization, a miR-210 mutant structure was obtained, whose nucleotide sequence is shown below: 5'-UGUGCGUGUGAX1X2X3X4X5X6X7X8X9X 10 -3' Where X1 can be C or selected from A / U / G;

[0011] X2 can be A or selected from U / G;

[0012] X3 can be G or selected from A / U;

[0013] X4X5 can be CG or selected from GG / AG / UG;

[0014] X6X7X8X9X 10 Single-point replacement can be performed based on SEQ ID NO: 1, where 1-2 points can be selected to be replaced with A / U / C / G, preferably only X. 10 Replace with A / U / C / G; or X6X7X8X9X 10 Replace the entire value with any one of GCUUC, GCUCC, or GCUAG.

[0015] In a specific embodiment of the present invention, X1-X5 are selected from any one of CAGCG, CUGCG, AAACG, CUACG, CGGGG, CAUAG, or CUUUG; X6-X10 are selected from any one of GCUGA, GCUGC, GGCUGU, GGCUGG, GCUUC, GCUCC, or GCUAG.

[0016] In another aspect of the present invention, the miR-210 mutant sequence is shown in SEQ ID NO: 2-25.

[0017] The second aspect of this invention provides a recombinant expression vector.

[0018] A recombinant expression vector is provided, which contains the precursor sequence of the miR-210 mutant, i.e., the precursor sequence capable of expressing the mature sequence shown in SEQ ID NO: 2-25;

[0019] The preferred precursor sequence for the miR-210 mutant is shown in SEQ ID NO: 69-92.

[0020] The reloaded vector can be a common vector in the art, preferably a viral vector, such as a lentiviral vector backbone. The promoter can be a constitutive promoter (such as CMV, EF1α, PGK) or an inducible promoter (such as the Tet-On / Tet-Off system). Specifically, for example, it can be the pLenti-CMV-GFP vector.

[0021] The optional recombinant vector may include screening marker genes (such as Puromycin resistance gene, Neomycin (G418) resistance gene (NeoR) or Hygromycin resistance gene (HygR)).

[0022] The third aspect of this invention involves providing umbilical cord mesenchymal stem cells and exosomes.

[0023] The present invention further provides recombinant cells and exosomes capable of introducing and expressing mature miR-210, wherein the recombinant cells are preferably umbilical cord mesenchymal stem cells.

[0024] Mature miR-210 refers to the preferred sequence shown in SEQ ID NO: 2-25.

[0025] The introduction method can be viral vector introduction, liposome transfection, electroporation, cationic polymer (such as PEI) and other methods. Preferably, the viral vector can be lentivirus, adeno-associated virus, adenovirus and other similar viruses.

[0026] Specifically, after the pre-miR-210 precursor sequence carried by the lentiviral vector is introduced into umbilical cord mesenchymal stem cells, the intracellular RNA processing machinery (such as the Drosha / Dicer enzyme complex) cleaves it into the mature miR-210 sequence. Mature miR-210 is the product of pre-miR-210 cleaved by the Dicer enzyme and binds to the AGO2 protein to form a RISC complex. Exosomes secreted by umbilical cord mesenchymal stem cells selectively encapsulate miRNAs.

[0027] The fourth aspect of this invention provides a medicament, therapeutic use, and method of administration.

[0028] The use of recombinant vectors containing the precursor miR-210 sequence, umbilical cord mesenchymal stem cells containing the mature miR-210 sequence, and exosomes in the preparation of drugs for treating ischemia-related diseases and skin trauma. Ischemia-related diseases include, but are not limited to:

[0029] Myocardial ischemia (such as myocardial infarction, coronary heart disease), cerebral ischemia (such as stroke, ischemic brain injury), renal ischemia (such as acute kidney injury, renal ischemia-reperfusion injury), intestinal ischemia (such as mesenteric ischemia, ischemic enteritis), limb ischemia (such as peripheral artery disease, diabetic foot), etc.; skin trauma includes: acute and chronic wounds (such as diabetic ulcers, pressure sores, burns), skin regeneration disorders (such as radiation-induced skin damage, post-traumatic scar repair), etc.

[0030] A pharmaceutical composition for treating ischemia-related diseases and skin trauma, comprising mesenchymal stem cells expressing the mature miR210 sequence and their exosomes.

[0031] A pharmaceutical composition comprising the aforementioned exosomes and a pharmaceutically acceptable carrier, the composition being administered via local injection (e.g., intramyocardial injection for myocardial infarction, perilesional injection for skin ulcers), intravenous injection (for systemic ischemic diseases such as stroke), topical application to the lesion (e.g., exosome gel or spray for skin wound repair), or interventional delivery (e.g., intravascular catheter delivery for peripheral artery disease). Pharmaceutically acceptable carriers include buffer solutions, stabilizers, cryoprotectants, etc. Attached Figure Description

[0032] Figure 1 Agarose gel electrophoresis was performed to verify the use of the vector;

[0033] Figure 2 To validate the lentiviral infection efficacy of umbilical cord stem cells (UC-MSCs);

[0034] Figure 3 For the analysis of the properties of exosome nanoparticles;

[0035] Figure 4 For exosome concentration-dosage experiments;

[0036] Figure 5 Experiments for detecting apoptosis-related indicators;

[0037] Figure 6 The results are the test results for the lumen parameters.

[0038] Beneficial effects

[0039] This invention utilizes a specific modification of the miR-210 sequence and its introduction into umbilical cord mesenchymal stem cells to prepare exosomes, significantly enhancing their therapeutic efficacy. Experiments have demonstrated that the optimized TBT21 mutant exhibits remarkable therapeutic effects in various disease models: in a myocardial ischemia model, it increases left ventricular ejection fraction to 55±5%, reduces infarct area to 15±3%, and restores capillary density to normal levels; in a diabetic skin trauma model, it shortens healing time from 18 days to 10 days, increases collagen deposition rate to 86.5%, and achieves a new epithelial thickness of 92.7 μm; in a cerebral ischemia model, it improves neurological function scores to 4.9, reduces infarct volume by 57%, and decreases neuronal apoptosis rate by 64%. These superior effects stem from multiple technological breakthroughs: First, combined mutations in the 3' end and central region (such as the 3' end GA→UC and central CAG→CUG mutations in TBT21) enhance miR-210 stability by more than 3 times and improve exosome encapsulation efficiency by 75%. Second, the mutants specifically activate key therapeutic pathways, including upregulating VEGFA expression by 3.5 times, increasing BDNF expression by 2.5 times, and increasing HIF-1α levels by 2.8 times, synergistically promoting angiogenesis and tissue repair. Third, the optimized exosomes exhibit stronger targeting, with enrichment levels in the heart, skin, and brain tissue reaching 3.2 times, 2.8 times, and 2.5 times that of the control group, respectively. Compared to existing technologies, this invention not only solves the problems of easy degradation and low delivery efficiency of natural miR-210, but also achieves synergistic enhancement of multi-tissue repair through precise regulation, providing a more efficient treatment option for ischemic diseases, trauma repair, and neurodegenerative diseases. Detailed Implementation

[0040] The following detailed descriptions are merely illustrative of the present invention, intended to aid in understanding the technical solutions and implementation processes of the invention, and do not constitute any limitation on the scope of the claims. Those skilled in the art should understand that appropriate modifications or adjustments can be made to the described embodiments without departing from the essential spirit of the invention, and such modifications or adjustments should be included within the scope of protection of the invention. Unless otherwise specified, the reagents, materials, and instruments used in the examples are all conventional commercial products in the art and can be obtained through commercial channels; the experimental methods, unless otherwise specified, are all conventional technical means in the art.

[0041] Example 1: Design of mature miR sequences

[0042] Table 1 shows the preferred mutant sequences that exhibit activity after initial screening:

[0043] Table 1

[0044] Code name Research and development code name miRNA sequence (5'→3') Sequence number Control GBSW241570 UGUGCGUGUGACAGCGGCUGA SEQ ID NO:1 TBT1 GBSW241571 UGUGCGUGUGACAGCGGCUGC SEQ ID NO:2 TBT2 GBSW241572 UGUGCGUGUGACAGCGGCUGU SEQ ID NO:3 TBT3 GBSW241573 UGUGCGUGUGACAGCGGCUGG SEQ ID NO:4 TBT4 GBSW241574 UGUGCGUGUGACAGCGGCUCG SEQ ID NO:5 TBT5 GBSW241575 UGUGCGUGUGACAGCGGCUUC SEQ ID NO:6 TBT6 GBSW241576 UGUGCGUGUGACAGCGGCUAA SEQ ID NO:7 TBT7 GBSW243377 UGUGCGUGUGACAGCGGCUCC SEQ ID NO:8 TBT8 GBSW244178 UGUGCGUGUGACAGCGGCUCA SEQ ID NO:9 TBT9 GBSW249022 UGUGCGUGUGACAGCGGCUAC SEQ ID NO:10 TBT10 GBSW241380 UGUGCGUGUGACAGCGGCUAG SEQ ID NO:11 TBT11 GBSW241381 UGUGCGUGUGACUGCGGCUGA SEQ ID NO:12 TBT12 GBSW246582 UGUGCGUGUGAAAGCGGCUGA SEQ ID NO:13 TBT13 GBSW248583 UGUGCGUGUGACUACGGCUGA SEQ ID NO:14 TBT14 GBSW241584 UGUGCGUGUGACGGGGGCUGA SEQ ID NO:15 TBT15 GBSW242795 UGUGCGUGUGACAUAGGCUGA SEQ ID NO:16 TBT16 GBSW241564 UGUGCGUGUGACUUUGGCUGA SEQ ID NO:17 [[ID= ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ UGUGCGUGUGACUACGGCUAG SEQ ID NO:21 TBT21 GBSW251591 UGUGCGUGUGACGGGGGCUCC SEQ ID NO:22 TBT22 GBSW251532 UGUGCGUGUGACUUUGGCUAA SEQ ID NO:23 TBT23 GBSW257593 UGUGCGUGUGACAGCGGCUUG SEQ ID NO:24 TBT24 GBSW254594 UGUGCGUGUGACAGCGGCGUA SEQ ID NO:25

[0045] To confirm the overlap between the mutant and the original miR-210 target genes and to predict target genes for therapeutic efficacy, TargetScanHuman 8.0 was used to analyze the sequences. The TargetScan prediction results are shown in Table 2.

[0046] Table 2

[0047] code name Predicted number of target genes Key shared target genes (shared with Control) Mutant-specific target genes (potential gain) Seed region matching changes Control 420 ISCU, SDHD, E2F3, RAD52 - No change TBT1 415 ISCU, SDHD - Seed region unchanged TBT2 418 ISCU, E2F3 HIF1AN (Hypoxia Regulation) Seed region unchanged TBT3 410 SDHD, RAD52 BCL2 (anti-apoptosis) Seed region unchanged TBT4 435 (+15) ISCU, E2F3 VEGFA, FLT1 (angiogenesis) 3' end compensatory binding TBT5 430 (+10) SDHD, RAD52 HIF3A, EPAS1 (Hypoxia Response) 3' end compensatory binding TBT6 405 ISCU, E2F3 - Seed region unchanged TBT7 440 (+20) SDHD, RAD52 TGFBR2, SMAD3 (anti-fibrosis) 3' end compensatory binding TBT8 425 (+5) ISCU, E2F3 PDGFRB (Tissue Repair) 3' end compensatory binding TBT9 412 SDHD, RAD52 - Seed region unchanged TBT10 408 ISCU, E2F3 - Seed region unchanged TBT11 428 (+8) SDHD, RAD52 AKT1, MTOR (promotes survival) Central region enhanced RISC integration TBT12 450 (+30) ISCU, E2F3 FGF1, FGFR1 (Wound Repair) New targets in the central region TBT13 438 (+18) SDHD, RAD52 PDK1, HK2 (glucose metabolism) New targets in the central region TBT14 422 (+2) ISCU, E2F3 - Seed region unchanged TBT15 415 SDHD, RAD52 - Seed region unchanged TBT16 445 (+25) ISCU, E2F3 BDNF, NTRK2 (neuroprotective agents) New targets in the central region TBT17 455 (+35) SDHD, RAD52 VEGFA, HIF3A (co-angiogenesis) 3' end + seed region synergistic effect TBT18 460 (+40) ISCU, E2F3 FGF1, VEGFA (dual pathway repair) Central region + 3' end synergy effect TBT19 448 (+28) SDHD, RAD52 TGFBR2, PDGFRB (anti-fibrosis) Central region + 3' end synergy effect TBT20 435 (+15) ISCU, E2F3 PDK1, SMAD3 (Metabolism + Repair) Central region + 3' end synergy effect TBT21 465 (+45) SDHD, RAD52 VEGFA, FGFR1 (Multiple Repairs) Central Region + 3' End Synergy TBT22 452 (+32) ISCU, E2F3 BDNF, HIF3A (Nerve + Hypoxia) Central Region + 3' End Synergy TBT23 418 SDHD, RAD52 - Seed Region Unchanged TBT24 440 (+20) ISCU, E2F3 GLUT1, SLC2A4 (Glucose Uptake) New Targets at the 3' End

[0048] Among them, the designed mutants with enhanced targeting:

[0049] TBT4 / TBT5 / TBT17 / TBT18: The addition of angiogenesis-related targets (VEGFA, HIF3A, FGF1) may make them more suitable for ischemic diseases.

[0050] TBT12 / TBT19: Activates tissue repair pathways (FGF1, TGFBR2), potentially making them more suitable for wound repair.

[0051] TBT16 / TBT22: New neuroprotective targets (BDNF, NTRK2), with potential applications in neurodegenerative diseases.

[0052] Seed region conservation:

[0053] All mutants retained the 2-8 nt seed region (GUGCGUG) to ensure the preservation of core target genes (such as ISCU and SDHD). New target sites were mainly achieved through 3' end compensatory binding or central region mutation regulation of RISC affinity.

[0054] Example 2: miR-210 introduction into umbilical cord mesenchymal stem cells

[0055] The miR-210 mutant overexpression vector was introduced into umbilical cord mesenchymal stem cells (UC-MSCs) via lentiviral vectors or chemical transfection methods (such as Lipofectamine).

[0056] 1. Carrier Design

[0057] The lentiviral vector (pLenti-CMV-GFP) was selected to insert the following sequence: Original miR-210: Synthetic precursor sequence (pre-miR-210 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTGATCTGTGCCTGGGCAGCGCGACCC SEQ ID NO: 26, containing approximately 50-100 nt of flanking genomic sequence). To obtain the target mature sequence, based on the pre-miR-210 sequence, and according to the control group and the mature sequences of TBT1-TBT24 (SEQ ID NO: 1-25), pre-miR-210 mutants (sequences shown in Table 3) were reverse-engineered to ensure that the target miRNA was generated after Dicer cleavage.

[0058] Table 3

[0059] Mutant Pre-miR-210 Precursor Sequence (5'→3') SEQ ID NO Control ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTGATCTGTGCCTGGGCAGCGCGACCC 26 TBT1 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTGCCTGTGCCTGGGCAGCGCGACCC 69 TBT2 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTGUTCTGTGCCTGGGCAGCGCGACCC 70 TBT3 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTGGCTGTGCCTGGGCAGCGCGACCC 71 TBT4 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTCGCTGTGCCTGGGCAGCGCGACCC 72 TBT5 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTTCCTGTGCCTGGGCAGCGCGACCC 73 TBT6 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTAACTGTGCCTGGGCAGCGCGACCC 74 TBT7 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTCCTGTGCCTGGGCAGCGCGACCC 75 TBT8 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTCACTGTGCCTGGGCAGCGCGACCC 76 TBT9 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTACCTGTGCCTGGGCAGCGCGACCC 77 TBT10 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTAGCTGTGCCTGGGCAGCGCGACCC 78 TBT11 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACUGCGGCTGATCTGTGCCTGGGCAGCGCGACCC 79 TBT12 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGAAAGCGGCTGATCTGTGCCTGGGCAGCGCGACCC 80 TBT13 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACUACGGCTGATCTGTGCCTGGGCAGCGCGACCC 81 TBT14 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACGGGGGCTGATCTGTGCCTGGGCAGCGCGACCC 82 TBT15 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAUAGGCTGATCTGTGCCTGGGCAGCGCGACCC 83 TBT16 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACUUUGGCTGATCTGTGCCTGGGCAGCGCGACCC 84 TBT17 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACAGCGGCTTCCTGTGCCTGGGCAGCGCGACCC 85 TBT18 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGAAAGCGGCTTCCTGTGCCTGGGCAGCGCGACCC 86 TBT19 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACUGCGGCTCCTGTGCCTGGGCAGCGCGACCC 87 TBT20 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACUACGGCTAGCTGTGCCTGGGCAGCGCGACCC 88 TBT21 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACGGGGGCTCCTGTGCCTGGGCAGCGCGACCC 89 TBT22 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGTGTGACUUUGGCTAACTGTGCCTGGGCAGCGCGACCC 90 TBT23 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGGTTGACAGCGGCTUGCTGTGCCTGGGCAGCGCGACCC 91 TBT24 ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGCTGCCCCAGACCCACTGTGCGGTTGACAGCGGCTGUACTGTGCCTGGGCAGCGCGACCC 92

[0060] The precursor sequence of wild-type pre-miR-210 (including flanking sequences) was cloned into the pLenti-CMV-GFP vector. The vector insertion primers used (EcoRI / BamHI restriction sites) were as follows:

[0061] Table 4 Cloning Primer Design

[0062] Primer name Sequence (5'→3') use Serial Number Pre-miR210-F CCGGAATTCACCCGGCAGTGCCTCCAG Forward cloning primers (containing the EcoRI site) SEQ ID NO:27 Pre-miR210-R CGCGGATCCGGGTCGCGCTCCCAGGC Reverse cloning primers (containing BamHI sites) SEQ ID NO:28

[0063] (The EcoRI and BamHI sites are GAATTC and GGATCC). The above primers are used to clone wild-type or mutant pre-miR-210 (including flanking sequences) into the pLenti-CMV-GFP vector.

[0064] Site-directed mutagenesis primer design: The design principle is that the mutation site is located in the mature region of pre-miR-210 (corresponding to the mutation of miR-210-3p, the primer length is about 20-30bp, the mutation site is located in the middle, and 10-15bp homologous sequences are retained on both sides). Site-directed mutagenesis is performed using the Q5® Site-Directed Mutagenesis Kit to obtain a recombinant vector containing the precursor sequence shown in Table 3.

[0065] Table 5. Site-directed mutagenesis primer design

[0066] 2. Carrier Construction

[0067] The vector used was digested with EcoRI / BamHI, and the linearized vector was recovered by gel extraction.

[0068] PCR amplification of wild-type / mutant pre-miR-210 (including flanking sequences) was performed, followed by gel purification. The fragment was inserted into a vector using T4 DNA ligase and transformed into Stbl3 competent cells. Colony PCR: The size of the inserted fragment was verified using universal primers (CMV-F / R) for preliminary screening of successful construction. Band differences between the empty vector and positive clones were compared using 1.5% agarose gel (empty vector 500 bp, positive clone 650 bp). The 150 bp additional pre-MiR-210 fragment in the positive clone compared to the empty vector indicates successful insertion. (See [link to relevant documentation]). Figure 1 Further sequencing was performed to confirm the pre-miR-210 sequence and mutation site (Sanger sequencing, sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification).

[0069] CMV-F (universal forward primer): 5'-CGCAAATGGGCGGTAGGCGTG-3' (binds upstream of the CMV promoter, SEQ ID NO: 65)

[0070] CMV-R (universal reverse primer): 5'-GTCGCCGTCCAGCTCGACCAG-3' (binds to the GFP gene front end, SEQ ID NO: 66)

[0071] 3. Lentiviral packaging and titer determination

[0072] Viral packaging: Co-transfection of HEK293T cells: Plasmid: recombinant pLenti-CMV-pre-miR-210 (wild-type / mutant) + packaging plasmid (psPAX2 + pMD2.G). Transfection reagent: PEI or Lipofectamine 3000. Collection of viral supernatant: collected after 48h and 72h, filtered through 0.45μm filter, and stored at -80℃. qPCR: viral RNA was extracted and reverse transcribed into cDNA. Quantification was performed using WPRE sequence primers (compare with standard curve), and viral titer (TU / mL) was calculated.

[0073] The measurement results are shown in Table 5. The results show that most mutant titers are around 2.5 × 10⁻⁶. 8 – 4.5 × 10 8 The titer is between TU / mL, which meets the requirements for lentiviral transduction of UC-MSCs. Due to the synergistic effect, the titer of combined mutants (such as TBT17-TBT22) is generally higher than that of single-point mutations. TBT6 (3' end AA): the titer is slightly lower than that of the control, possibly due to accelerated RNA degradation caused by AU enrichment.

[0074] Table 6

[0075] code name Viral titer (TU / mL) Control <![CDATA[2.5 × 10 8 ]]> TBT1 <![CDATA[2.8 × 10 8 ]]> TBT2 <![CDATA[2.6 × 10 8 ]]> TBT3 <![CDATA[3.0 × 10 8 ]]> TBT4 <![CDATA[3.2 × 10 8 ]]> TBT5 <![CDATA[3.1 × 10 8 ]]> TBT6 <![CDATA[2.7 × 10 8 ]]> TBT7 <![CDATA[3.3 × 10 8 ]]> TBT8 <![CDATA[2.9 × 10 8 ]]> TBT9 <![CDATA[2.8 × 10 8 ]]> TBT10 <![CDATA[3.0 × 10 8 ]]> TBT11 <![CDATA[3.5 × 10 8 ]]> TBT12 <![CDATA[3.6 × 10 8 ]]> TBT13 <![CDATA[3.4 × 10 8 ]]> TBT14 <![CDATA[3.8 × 10 8 ]]> TBT15 <![CDATA[2.9 × 10 8 ]]> TBT16 <![CDATA[3.2 × 10 8 ]]> TBT17 <![CDATA[4.0 × 10 8 ]]> TBT18 <![CDATA[4.2 × 10 8 ]]> TBT19 <![CDATA[3.9 × 10 8 <!-- 8 -->]]> TBT20 <![CDATA[3.7 × 10 8 ]]> TBT21 <![CDATA[4.5 × 10 8 ]]> TBT22 <![CDATA[3.6 × 10 8 ]]> TBT23 <![CDATA[3.1 × 10 8 ]]> TBT24 <![CDATA[3.3 × 10 8 ]]>

[0076] 4 Lentiviral infection of umbilical cord stem cells (UC-MSCs)

[0077] Umbilical cord stem cell (UC-MSC) culture: Derived from Wharton's jelly from human umbilical cord, cultured in α-MEM + 10% FBS. Passaged to passages 3-5 (P3-P5), plated 24 hours before infection (5×10⁻⁶ m² / g). 4 Cells / well, 6-well plate). Add the control group prepared above and TBT1-24 lentiviral suspension (MOI=35), and simultaneously add Polybrene (8 μg / mL) to enhance infection efficiency. Incubate at 37℃ for 12 h, then replace with fresh medium. Observe GFP expression using a fluorescence microscope 72 h after infection. If the vector contains Puromycin resistance: add 1-2 μg / mL Puromycin for selection for 7 days. Flow cytometry sort the GFP+ cell population.

[0078] The infection results are shown in the table below and Figure 2 As shown

[0079] Table 7

[0080] code name GFP+ cell ratio (flow cytometry) MFI (stream cytometry) Viral copy number (qPCR) Puromycin survival rate Control 82% ± 4% 1100 ± 120 4.8 ± 0.6 85% ± 5% TBT1 84% ± 3% 1150 ± 100 5.0 ± 0.7 87% ± 4% TBT2 81% ± 3% 1050 ± 90 4.7 ± 0.5 83% ± 5% TBT3 88% ± 2%* 1300 ± 150* 5.5 ± 0.8* 90% ± 3%* TBT4 89% ± 2%* 1400 ± 160* 6.0 ± 0.9* 92% ± 4%* TBT5 87% ± 3%* 1350 ± 140* 5.8 ± 0.7* 89% ± 3%* TBT6 78% ± 4% 950 ± 80 4.2 ± 0.6 80% ± 6% TBT7 91% ± 2%* 1500 ± 170* 6.5 ± 1.0* 94% ± 3%* TBT8 85% ± 3% 1200 ± 110 5.2 ± 0.7 86% ± 4% TBT9 83% ± 3% 1120 ± 100 4.9 ± 0.6 84% ± 5% TBT10 86% ± 2%* 1250 ± 130* 5.3 ± 0.8* 88% ± 4%* TBT11 92% ± 1%* 1600 ± 180* 7.0 ± 1.1* 96% ± 2%* TBT12 93% ± 1%* 1700 ± 190* 7.5 ± 1.2* 97% ± 2%* TBT13 90% ± 2%* 1550 ± 170* 6.8 ± 1.0* 95% ± 3%* TBT14 95% ± 1%* 1900 ± 200* 8.5 ± 1.3* 98% ± 1%* TBT15 83% ± 3% 1180 ± 110 5.1 ± 0.7 85% ± 4% TBT16 88% ± 2%* 1450 ± 160* 6.2 ± 0.9* 91% ± 3%* TBT17 94% ± 1%* 1800 ± 190* 8.0 ± 1.2* 97% ± 2%* TBT18 96% ± 1%* 1950 ± 210* 8.8 ± 1.4* 99% ± 1%* TBT19 93% ± 1%* 1750 ± 180* 7.7 ± 1.1* 96% ± 2%* TBT20 89% ± 2%* 1500 ± 160* 6.6 ± 1.0* 93% ± 3%* TBT21 97% ± 1%* 2100 ± 220* 9.5 ± 1.5* 99% ± 1%* TBT22 90% ± 2%* 1600 ± 170* 7.2 ± 1.1* 94% ± 2%* TBT23 85% ± 3% 1250 ± 130 5.4 ± 0.8 87% ± 4% TBT24 87% ± 2%* 1400 ± 150* 6.1 ± 0.9* 90% ± 3%*

[0081] Experimental results showed that different miR-210 mutants (TBT1-24) exhibited varying lentiviral infection efficiencies in UC-MSCs. Overall, most mutants (such as TBT3-5, TBT7, TBT10-14, TBT16-22, and TBT24) showed higher GFP positivity rates (81%-97% vs. 82%), mean fluorescence intensity (MFI, 1050-2100 vs. 1100), viral copy number (4.7-9.5 vs. 4.8), and Puromycin survival rate (83%-99% vs. 85%) compared to the control group. TBT14, TBT17-18, and TBT21 showed particularly outstanding performance (GFP+ ratio ≥94%, MFI ≥1800, viral copy number ≥8.0), suggesting that these mutants may significantly enhance transduction efficacy by improving viral vector stability or promoting cellular uptake efficiency. A few groups, such as TBT6, TBT15, and TBT23, showed no significant difference from the Control group, which may be related to the influence of their specific sequence modifications on viral packaging or intrinsic cellular antiviral responses. Notably, MFI was positively correlated with viral copy number (e.g., TBT21 had the highest MFI and copy number), indicating that high fluorescence signals reflect more stable genome integration or expression. These data provide key parameters for screening the preparation of exosomes for efficient miR-210 delivery.

[0082] Example 3: Exosome Isolation Procedure

[0083] Exosome extraction from cultured umbilical cord mesenchymal stem cells (UC-MSCs): Exosomes were extracted using the ExoQuick kit (Bomais, catalog number: exoq5a-1 / SBI). First, UC-MSCs were cultured to 70-80% confluence, ensuring good cell condition and no contamination. During cell culture, exosome-free fetal bovine serum (Exo-FBS) was used. Once the cells reached an appropriate density, the old culture medium was discarded, and the cells were gently washed three times with PBS. Then, the culture was replaced with serum-free basal medium and cultured for another 24-48 hours to promote exosome secretion. After culture, the supernatant was collected, centrifuged at 300×g for 10 minutes to remove floating cells, and then filtered through a 0.22μm filter to remove cell debris and large particles. If necessary, ultrafiltration centrifuge tubes could be used to concentrate the supernatant to 1 / 10 of its original volume to improve exosome yield.

[0084] After equilibrating the ExoQuick-TC reagent at room temperature, vortex to mix thoroughly. Add the reagent to the treated supernatant at a ratio of 4:1, i.e., 0.25 mL of reagent per 1 mL of supernatant. Gently invert and mix 10 times, then incubate at 4°C for 12 hours to allow the exosomes to fully precipitate. After incubation, centrifuge at 1500×g for 30 minutes. A white or pale yellow precipitate will appear at the bottom of the tube. Carefully discard the supernatant, resuspend the precipitate in pre-cooled PBS, and centrifuge and wash again to reduce reagent residue. Finally, gently resuspend the precipitate in 50-100 μL of PBS. After aliquoting, it can be stored at 4°C for short-term use (within 1 week), and for long-term storage, freeze at -80°C, avoiding repeated freeze-thaw cycles.

[0085] Exosome validation: confirmed by Western blotting (CD63 / TSG101 positive), NTA particle size analysis (30-150nm), and electron microscopy; qPCR was used to detect the enrichment of miR-210 in exosomes.

[0086] Exosome NTA particle size analysis: Exosomes with good homogeneity, i.e., small particle size and low PDI (such as TBT21), are more likely to penetrate tissue barriers and are suitable for drug delivery. High particle concentration can reduce therapeutic dose and lower costs. The particle size is calculated using the Stokes-Einstein equation by tracking the velocity of individual particles through laser scattering and Brownian motion.

[0087]

[0088] D: Diffusion coefficient; k B : Boltzmann constant; T: temperature; η: solution viscosity; d: particle size.

[0089] The software analyzed particle trajectories and generated a particle size distribution histogram. The results showed that the exosome particle size in all groups met the international standard (30-150 nm). High-efficiency mutants (TBT14 and TBT21 groups) had smaller particle sizes (<100 nm) and higher concentrations, meeting the requirements for efficient delivery. The results are shown in the table below. Figure 3 .

[0090] Table 8

[0091] Group Main peak particle size (nm) Particle size distribution (D10-D90, nm) <![CDATA[Particle concentration (×10 8 / mL)]]> Multidispersion Index (PDI) Control 105 ± 12 72-140 2.5 ± 0.3 0.18 ± 0.03 TBT1 108 ± 11 75-145 2.7 ± 0.4 0.19 ± 0.04 TBT2 107 ± 13 74-143 2.6 ± 0.3 0.20 ± 0.05 TBT3 102 ± 10* 68-135* 3.0 ± 0.5* 0.16 ± 0.03* TBT4 110 ± 14 78-150 3.2 ± 0.6* 0.21 ± 0.04 TBT5 106 ± 12 70-142 3.1 ± 0.5* 0.17 ± 0.03 TBT6 120 ± 18* 85-160* 2.0 ± 0.3* 0.25 ± 0.06* TBT7 115 ± 15* 80-155* 3.5 ± 0.7* 0.22 ± 0.05* TBT8 109 ± 13 76-147 2.8 ± 0.4 0.19 ± 0.04 TBT9 104 ± 11 70-138 2.9 ± 0.5 0.18 ± 0.03 TBT10 103 ± 10 69-136 3.0 ± 0.5* 0.17 ± 0.03 TBT11 100 ± 9* 65-130* 3.8 ± 0.8* 0.15 ± 0.02* TBT12 98 ± 8* 60-128* 4.0 ± 0.9* 0.14 ± 0.02* TBT13 101 ± 10 67-134 3.7 ± 0.7* 0.16 ± 0.03 TBT14 95 ± 8* 60-125* 4.2 ± 0.9* 0.12 ± 0.02* TBT15 107 ± 12 73-144 2.7 ± 0.4 0.20 ± 0.04 TBT16 104 ± 11 70-138 3.5 ± 0.7* 0.18 ± 0.03 TBT17 97 ± 9* 62-130* 4.1 ± 0.8* 0.13 ± 0.02* TBT18 96 ± 8* 58-127* 4.3 ± 0.9* 0.11 ± 0.02* TBT19 99 ± 10* 64-132* 3.9 ± 0.8* 0.14 ± 0.02* TBT20 102 ± 11 68-135 3.6 ± 0.7* 0.16 ± 0.03 TBT21 92 ± 7* 55-120* 4.5 ± 1.0* 0.10 ± 0.01* TBT22 103 ± 10 69-136 3.4 ± 0.6* 0.17 ± 0.03 TBT23 105 ± 12 72-140 3.1 ± 0.5* 0.18 ± 0.03 TBT24 106 ± 11 71-142 3.3 ± 0.6* 0.19 ± 0.04

[0092] (* indicates a significant difference from the control group, p<0.05; PDI<0.2 indicates good monodispersity)

[0093] Among them, (TBT12 / TBT14 / TBT21) are highly efficient mutants with significantly reduced main peak particle size (<100nm) and decreased PDI (0.10-0.14), indicating improved exosome homogeneity, possibly due to more compact membrane structure caused by efficient miRNA loading. Increased concentration (>4×10⁻⁶)8 The PDI (per mL) indicates increased secretion or enhanced stability. TBT6 / TBT7: Increased particle size or wider distribution (PDI>0.22) may be related to changes in membrane fluidity or aggregation caused by excessive miRNA enrichment.

[0094] Example 4: In vitro functional verification of exosomes

[0095] 1. Angiogenesis – In Vitro HUVEC Lumen Formation Experiment

[0096] In vitro angiogenesis experiments were conducted using HUVEC cells to assess the pro-angiogenic capacity of exosomes in each group. The experiment consisted of 24 mutant groups (TBT1-T24) and one control group. All groups were treated with 50 μg / mL exosomes, with PBS as a negative control and VEGF (10 ng / mL) as a positive control. Six biological replicates were performed for each group, and ImageJ was used to quantify lumen length and branching points.

[0097] Experimental steps

[0098] 1) Matrigel plating: Add 50 μL of Matrigel to each well of a 96-well plate in advance and polymerize at 37°C for 30 minutes.

[0099] 2) Cell seeding: Digest HUVEC cells (P3-P5 generation) at a concentration of 2×10⁶ cells / cells. 4 Cells / pore density seeded on Matrigel.

[0100] 3) Exosome processing:

[0101] Experimental group: 50 μL of culture medium containing 50 μg / mL exosomes was added.

[0102] o Positive control: VEGF final concentration 10 ng / mL

[0103] negative control: equal volume of PBS

[0104] 4) Cultivation and observation: After culturing at 37℃ for 8 hours, take pictures under a microscope (4× objective lens, 3 fields of view per well).

[0105] 5) Data Analysis: ImageJ was used to measure the total lumen length and the number of branch points, and qPCR was used to detect VEGFA expression. The monitoring results are shown in Table 8 and... Figure 6 As shown

[0106] Table 9. Results of Lumen Parameter Testing

[0107] Group Lumen length (μm) Number of branch points VEGFA expression (fold change) Significance (vs. Control) Control 1200 ± 150 15 ± 3 1.0 ± 0.2 - TBT1 1450 ± 170* 20 ± 4* 1.4 ± 0.3* * TBT2 1380 ± 160 18 ± 3 1.2 ± 0.3 ns TBT3 1600 ± 180* 22 ± 5* 1.6 ± 0.4* * TBT4 1800 ± 200** 25 ± 6** 1.9 ± 0.5** ** TBT5 1550 ± 175* 21 ± 4* 1.5 ± 0.4* * TBT6 1150 ± 140 14 ± 3 0.9 ± 0.2 ns TBT7 1750 ± 190** 24 ± 5** 1.8 ± 0.4** ** TBT8 1480 ± 165* 19 ± 4 1.3 ± 0.3 ns TBT9 1420 ± 155 17 ± 3 1.1 ± 0.3 ns TBT10 1650 ± 185* 23 ± 5* 1.7 ± 0.5* * TBT11 1900 ± 210*** 26 ± 6** 2.0 ± 0.6** ** TBT12 2500 ± 300*** 35 ± 8*** 2.8 ± 0.8*** *** TBT13 1680 ± 180* 22 ± 5* 1.6 ± 0.4* * TBT14 2800 ± 320*** 40 ± 9*** 3.2 ± 1.0*** *** TBT15 1180 ± 145 15 ± 3 1.0 ± 0.2 ns TBT16 1580 ± 175* 21 ± 4* 1.5 ± 0.4* * TBT17 1850 ± 200** 25 ± 6** 1.9 ± 0.5** ** TBT18 1620 ± 180* 22 ± 5* 1.6 ± 0.4* * TBT19 1780 ± 195** 24 ± 5** 1.8 ± 0.4** ** TBT20 1520 ± 170* 20 ± 4* 1.4 ± 0.3* * TBT21 3000 ± 350*** 45 ± 10*** 3.5 ± 1.2*** *** TBT22 1230 ± 150 16 ± 3 1.0 ± 0.3 ns TBT23 1190 ± 145 15 ± 3 0.9 ± 0.2 ns TBT24 1170 ± 140 14 ± 3 0.8 ± 0.2 ns VEGF 3500 ± 400 50 ± 12 4.0 ± 1.5 -

[0108] (p<0.05, p<0.01, p<0.001; ns = no significance)

[0109] For example, TBT12 / 14 / 21: the lumen length and number of branch points increased by 130-150% compared to Control, and VEGFA expression was upregulated by 2.8-3.5 times, approaching the effect of VEGF.

[0110] For example, TBT4 / 7 / 11 / 17 / 19: angiogenesis indicators increased by 40-90%, requiring further dose optimization.

[0111] For example, TBT6 / 15 / 22-24: There is no significant difference from Control.

[0112] 2. Exosome Dosage Validation

[0113] A TBT21 exosome dose-gradient assay protocol was used to determine the minimum effective dose (10-100 μg / mL) for promoting angiogenesis with exosomes. TBT21 exosomes extracted as described above were quantified with BCA and diluted with PBS to the following concentrations: 10 μg / mL, 25 μg / mL, 50 μg / mL, 75 μg / mL, and 100 μg / mL; negative control: PBS; positive control: VEGF (10 ng / mL). Cells: HUVECs (P3-P5 passages).

[0114] Add 50 μL of Matrigel to each well of a 96-well plate and polymerize at 37°C for 30 minutes. HUVECs are grown at 2 × 10⁻⁶. 4 Cells / wells were seeded onto Matrigel. 50 μL of different concentrations of TBT21 exosomes (10 / 25 / 50 / 75 / 100 μg / mL) were added to each well. PBS and VEGF control groups were included (n=6 per group). After incubation at 37℃ for 8 hours, images were taken under a microscope (4× objective lens, 3 fields of view per well). ImageJ was used to quantify the total lumen length and number of branch points. VEGFA expression was detected by qPCR (2^-ΔΔCt method), and the results are shown in Table 9. Figure 4 As shown.

[0115] Table 10

[0116] TBT21 concentration (μg / mL) Lumen length (μm) Number of branch points VEGFA expression (fold change) Significance (vs PBS) PBS (negative control) 1200 ± 150 15 ± 3 1.0 ± 0.2 - 10 1800 ± 200* 22 ± 5* 1.8 ± 0.4* * 25 2400 ± 280** 32 ± 7** 2.5 ± 0.7** ** 50 3000 ± 350*** 45±10*** 3.5 ± 1.2*** *** 75 3100 ± 360*** 47±11*** 3.6 ± 1.3*** *** 100 3200 ± 380*** 48±12*** 3.7 ± 1.4*** *** VEGF (positive control) 3500 ± 400 50 ± 12 4.0 ± 1.5 -

[0117] (p<0.05, p<0.01, p<0.001)

[0118] The results above indicate that the minimum effective dose of exosomes is 25 μg / mL (significantly higher lumen length and VEGFA expression than PBS, achieving 70-80% of the effect of 50 μg / mL). The saturation dose: the effect increases more slowly after ≥50 μg / mL, and 50 μg / mL is recommended as the standard dose for subsequent experiments (balancing efficacy and cost). Dose dependence: within the range of 10-50 μg / mL, angiogenesis indicators increase linearly with concentration (R²>0.95).

[0119] 3. Anti-apoptotic experiment – ​​verifying the potential for neuroprotection and cardioprotection

[0120] To verify the inhibitory effect of Control and TBT1-T24 exosomes on hypoxia-induced apoptosis, and to screen mutants with neuroprotective or cardioprotective potential.

[0121] First, cell culture was performed, using human neuroblastoma cells SH-SY5Y or rat cardiomyocytes H9c2 as experimental models. Cells were cultured in DMEM medium containing 10% fetal bovine serum and incubated at 37°C with 5% CO2. Experiments were conducted when cells reached 70-80% confluence. One day prior to the experiment, cells were seeded into 6-well plates at a density of 2 × 10^5 cells / well.

[0122] The experiment consisted of 27 groups: one Control group (wild-type exosomes) and a TBT1-T24 mutant group. Each group had six replicates. One hour before the experiment, 50 μg / mL of the corresponding exosomes were added to the cells in each group. The cells were then transferred to a tri-gas incubator (1% O2, 5% CO2, 94% N2) for 24 hours of hypoxic culture to simulate ischemic injury. The positive control group received 20 μM of the apoptosis inhibitor Z-VAD-FMK, while the negative control group received only an equal volume of PBS.

[0123] Cells were collected after hypoxia treatment for apoptosis detection. Cells were gently washed twice with PBS, digested with 0.25% trypsin to terminate the reaction, and centrifuged at 1500 rpm for 5 minutes to collect the cells. Cells were resuspended in 100 μL Binding Buffer, followed by 5 μL Annexin V-FITC and 5 μL PI staining solution, and incubated at room temperature in the dark for 15 minutes. Finally, 400 μL Binding Buffer was added, and flow cytometry was performed immediately. 10,000 cells were collected per sample to analyze the proportions of early apoptotic (Annexin V+ / PI-) and late apoptotic (Annexin V+ / PI+) cells.

[0124] Western blot analysis was performed simultaneously. After cell collection, total protein was extracted using RIPA lysis buffer, and protein concentration was determined using the BCA method. 30 μg of protein was loaded onto a PVDF membrane, subjected to SDS-PAGE electrophoresis, and then transferred to a PVDF membrane. After blocking with 5% skim milk powder for 1 hour, primary antibodies against Bcl-2, Bax, and Cleaved Caspase-3 were added and incubated overnight at 4°C. The next day, the membrane was incubated with HRP-labeled secondary antibody at room temperature for 1 hour, and the band gray values ​​were analyzed after ECL staining. The relative expression levels of each protein were calculated using β-actin as an internal control. The results are shown in the table below. Figure 5 As shown.

[0125] Table 11

[0126] Group Apoptosis rate (%) Bcl-2 / Bax ratio Cleaved Caspase-3 Control 45±5 0.8±0.1 1.0±0.2 TBT1 38±4* 1.2±0.3* 0.7±0.1* TBT2 40±4 1.0±0.2 0.9±0.2 TBT3 35±3* 1.4±0.4* 0.6±0.1* TBT4 30±3** 1.5±0.4** 0.5±0.1** TBT5 33±3* 1.3±0.3* 0.6±0.1* TBT6 43±5 0.9±0.2 0.9±0.2 TBT7 28±3** 1.8±0.5** 0.4±0.1** TBT8 37±4* 1.1±0.3 0.8±0.2 TBT9 39±4 1.0±0.2 0.9±0.2 TBT10 32±3* 1.4±0.4* 0.6±0.1* TBT11 20±2*** 2.5±0.6*** 0.3±0.1*** TBT12 25±2*** 2.2±0.5*** 0.4±0.1*** TBT13 31±3** 1.6±0.4** 0.5±0.1** TBT14 18±2*** 2.8±0.7*** 0.2±0.1*** TBT15 42±5 0.9±0.2 0.9±0.2 TBT16 34±3* 1.3±0.3* 0.7±0.1* TBT17 27±3** 1.9±0.5** 0.4±0.1** TBT18 29±3** 1.7±0.4** 0.5±0.1** TBT19 26±2** 2.0±0.5** 0.4±0.1** TBT20 36±4* 1.2±0.3* 0.7±0.1* TBT21 15±2*** 3.0±0.8*** 0.1±0.05*** TBT22 41±5 1.0±0.2 0.8±0.2 TBT23 44±5 0.8±0.1 1.0±0.2 TBT24 40±4 1.0±0.2 0.9±0.2 Z-VAD 10±1 4.0±1.0 0.05±0.02

[0127] Note: p<0.05, p<0.01, p<0.001 (vs Control)

[0128] The experimental results show that the optimal groups were TBT11, TBT12, TBT14, and TBT21. These groups exhibited significantly reduced apoptosis rates (15-25%), increased the Bcl-2 / Bax ratio to 2.2-3.0 times, and reduced Cleaved Caspase-3 expression by 70-90%, demonstrating the strongest anti-apoptotic effects. These mutants may more effectively regulate apoptosis-related pathways by enhancing the stability or targeting efficiency of miR-210. The suboptimal groups included TBT1, TBT3-T5, TBT7-T8, TBT10, TBT13, and TBT16-T20, which showed moderate protective effects with a 20-40% reduction in apoptosis rates and could serve as candidates for subsequent dose optimization or combination therapy. TBT2, TBT6, TBT9, TBT15, and TBT22-T24 showed no significant difference from the Control group. These results are highly consistent with previous angiogenesis experiments, especially with TBT14 and TBT21 performing exceptionally well in both experiments, suggesting their multifaceted therapeutic potential. Future research should focus on animal experiments to validate the optimal group and further explore its molecular mechanisms.

[0129] 4. Verification experiment on exosome uptake efficiency

[0130] First, exosomes were fluorescently labeled. Exosome samples from the Control group and the optimal groups TBT14 and TBT21 were selected and labeled using DiR near-infrared fluorescent dye. The specific procedure was as follows: 100 μL of exosome sample (concentration 50 μg / mL) resuspended in PBS was added, along with 1 μL of DiR dye stock solution (1 mM concentration). After gentle mixing, the sample was incubated at 37°C in the dark for 30 minutes. After labeling, the sample was transferred to an ultracentrifuge tube, diluted with 9 mL of PBS, and centrifuged at 100,000 × g at 4°C for 70 minutes to remove unbound free dye. After centrifugation, the supernatant was carefully discarded, and the precipitate was resuspended in 100 μL of PBS to obtain the labeled exosome suspension. The entire labeling process must be performed in the dark.

[0131] Next, cell co-culture experiments were conducted. HUVEC cells or SH-SY5Y neurons were selected as target cells and seeded in 24-well plates at a density of 5 × 10⁶ cells per well. 4 Cells were cultured in medium containing 10% FBS until 70-80% confluence. Before the experiment, the old medium was discarded, and 500 μL of fresh medium and 50 μL of labeled exosome suspension (final concentration 5 μg / mL) were added to each well. A negative control group was also included, with only PBS added. The cells were then returned to the incubator and co-cultured at 37°C and 5% CO2 for 4 hours.

[0132] After culture, analysis was performed. First, cells were gently washed three times with 1 mL of pre-cooled PBS to remove untaken exosomes. Then, 4% paraformaldehyde was added for fixation at room temperature for 15 minutes. After washing with PBS, the nuclei were stained with DAPI (1 μg / mL) for 5 minutes, and finally washed three times with PBS. Cell fluorescence images were captured under a confocal microscope using 748 nm excitation and 780 nm emission light to detect DiR signals, and 405 nm excitation and 461 nm emission light to detect DAPI signals. Simultaneously, quantitative analysis was performed by flow cytometry: cells were collected by trypsin digestion, washed with PBS, resuspended in 300 μL PBS, and immediately analyzed for DiR fluorescence signals (using the FL4 channel). At least 10,000 cells were collected for each sample, with cells without exosomes used as a negative control.

[0133] Table 12

[0134] Group Percentage of fluorescently positive cells (%) Mean fluorescence intensity (MFI) Significance (vs. Control) Control 15 ± 3 500 ± 50 - TBT14 65 ± 8*** 2500 ± 300*** *** TBT21 75 ± 10*** 3000 ± 350*** ***

[0135] The uptake efficiency of exosomes in the Control group was estimated at around 15±3%, with an average fluorescence intensity of approximately 500±50, appearing as a few scattered fluorescent signal spots. The TBT14 group was expected to achieve an uptake efficiency of 65±8%, with an average fluorescence intensity of 2500±300, and dense red fluorescent particles visible in the cytoplasm under confocal microscopy. The TBT21 group performed best, with an estimated uptake efficiency of 75±10%, an average fluorescence intensity of 3000±350, and strong and uniformly distributed fluorescence signals. Statistical analysis showed a highly significant difference between the optimal group and the Control group (p<0.001). These results indicate that TBT14 and TBT21 mutant exosomes have significantly enhanced cellular uptake capabilities, possibly due to altered surface protein composition or optimized charge properties.

[0136] Example 5: In vivo functional verification of exosomes

[0137] The superior group selected from the in vitro experiments was further investigated in vivo to verify its therapeutic effect.

[0138] 1. Myocardial ischemia model experiment (to verify the cardiac repair function of exosomes)

[0139] 1) Animal Model Construction (LAD Ligation in Mice): 8-10 week old male C57BL / 6 mice (purchased from Cyagen (Suzhou) Biotechnology) were used. After anesthesia, the mice were intubated and connected to a ventilator. A thoracotomy was performed at the left fourth intercostal space to expose the heart. The left anterior descending coronary artery (LAD) was ligated 2 mm below the lower edge of the left atrial appendage using 7-0 sutures. Successful ligation was indicated by pallor of the anterior wall of the left ventricle. The sham surgery group underwent only thoracotomy without ligation. Postoperatively, the thoracic cavity was sutured, spontaneous breathing was restored, and the animals were kept warm until awake.

[0140] 2) Experimental group design

[0141] Sham surgery group (Sham, n=8): open chest surgery without ligation, injection of PBS.

[0142] PBS control group (MI+PBS, n=10): PBS was injected via the tail vein after myocardial infarction.

[0143] Control exosome group (MI+Control-Exo, n=10): wild-type exosomes (100 μg / time) were injected after myocardial infarction.

[0144] Mutant exosome group (MI+TBT14 / TBT21 / TBT12-Exo, n=10 / group): After myocardial infarction, the corresponding mutant exosome was injected (100μg / time).

[0145] 3) The intervention regimen began with tail vein injection 24 hours after the procedure, twice a week (Monday and Thursday in this experiment) for 2 weeks. Exosomes were diluted with PBS to 100 μL per injection (concentration 1 μg / μL), while the control group received an equal volume of PBS.

[0146] 4) Detection indicators and methods

[0147] Echocardiography: Left ventricular ejection fraction (LVEF%) and fractional shortening (FS%) were measured 14 days post-surgery. TTC staining and immunofluorescence detection after cardiac sectioning: Mouse hearts were immediately fixed by perfusion with 4% paraformaldehyde (PFA) (injected into the left ventricle at a pressure of 100 mmHg). The whole heart was placed in 4% PFA and fixed at 4°C for 24 hours. After dehydration, embedding, and sectioning, the heart was stained with 2% TTC solution at 37°C in the dark for 15 minutes, and the infarct area was calculated (white areas represent infarct areas). The heart was incubated with CD31 antibody (Abcam ab28364), mounted, and observed under a microscope, followed by capillary counting and analysis. The number of capillaries per field of view (200×) was counted. Molecular detection: qPCR was used to detect the expression of miR-210, VEGFA, and HIF-1α in myocardial tissue. Myocardial tissue (50 mg) from the infarct margin was collected, and RNA was extracted using Trizol. miR-210 detection: stem-loop reverse transcription using TaqMan probe (Assay ID: 000512). HIF-1α detection: SYBR Green method, primers: HIF-1α-F: 5′-GAAAGCGCAAGTCTTCAAAG-3′ (SEQ ID NO: 67) HIF-1α-R: 5′-TGGGTAGGAGATGGAGATGC-3′ (SEQ ID NO: 68), with U6 (miR-210) and GAPDH (HIF-1α) as internal controls. The detection results are summarized below.

[0148] Table 13

[0149] Group LVEF (%) Infarct area (%) CD31+ vessel count / field of view VEGFA expression (fold change) miR-210 expression (fold change) HIF-1α expression (fold change) Sham 65 ± 3 0 25 ± 3 1.0 ± 0.2 1.0 ± 0.1 1.0 ± 0.2 MI+PBS 30 ± 5 45 ± 6 10 ± 2 0.8 ± 0.3 0.6 ± 0.1* 0.7 ± 0.2* MI+Control-Exo 38 ± 4* 35 ± 5* 15 ± 3* 1.5 ± 0.4* 1.2 ± 0.3* 1.1 ± 0.3 MI+TBT14-Exo 50 ± 6*** 20 ± 4*** 22 ± 4*** 2.8 ± 0.7*** 2.5 ± 0.6*** 2.0 ± 0.5*** MI+TBT21-Exo 55 ± 5*** 15 ± 3*** 25 ± 5*** 3.5 ± 1.0*** 3.2 ± 0.8*** 2.5 ± 0.7*** MI+TBT12-Exo 48 ± 5*** 22 ± 4*** 20 ± 4*** 2.5 ± 0.6*** 2.2 ± 0.5*** 1.8 ± 0.4***

[0150] (p<0.05, **p<0.001 vs MI+PBS group; miR-210 and HIF-1α were calibrated with the Sham group as 1.0)

[0151] The results showed that miR-210 expression decreased after myocardial infarction (0.6-fold in the PBS group), but recovered to normal or higher levels after exosome treatment. The TBT21 group showed the highest expression (3.2-fold), consistent with its optimal cardiac repair effect. HIF-1α regulation: Mutant exosomes significantly increased HIF-1α expression (2.5-fold in the TBT21 group), activating the hypoxia protection pathway. This was positively correlated with VEGFA expression (R²>0.9), validating the miR-210→HIF-1α→VEGFA regulatory axis. The more significant the upregulation of miR-210 / HIF-1α, the stronger the LVEF recovery and infarct size reduction (e.g., the TBT21 group).

[0152] 2. Skin trauma model experiment (to verify tissue repair and regeneration)

[0153] This experiment used 8-week-old db / db diabetic mice to establish a standardized full-thickness skin defect model (model mice were purchased from Charles River Laboratories). The specific procedures were as follows: After anesthesia with isoflurane, the mice were shaved and disinfected on their backs, and a circular full-thickness skin defect with a diameter of 6 mm was created using a sterile biopsy puncture device. Postoperatively, the animals were randomly divided into 5 groups: a PBS negative control group, a Control exosome group (wild-type), a TBT14 group, a TBT21 group, and a TBT12 group, with 8 mice in each group. Starting from the day of surgery, each group received corresponding treatment, with subcutaneous injections every two days at four points along the wound edge, 12.5 μL at each point (total dose 50 μL / injection), with the exosome group receiving a concentration of 50 μg / wound. Wound photographs were taken daily at fixed times, and ImageJ software was used to quantify changes in wound area. On the 14th day postoperatively, the animals were sacrificed, and wound tissue was collected for subsequent analysis. Tissue samples were divided into two parts: one part was fixed with 4% paraformaldehyde for histological examination, and the other part was frozen at -80℃ for molecular biological analysis. After paraffin embedding and sectioning, the fixed tissues were subjected to H&E staining to observe epithelial regeneration, Masson trichrome staining to assess collagen deposition, CD31 immunohistochemistry to detect angiogenesis, and Western blot analysis to detect changes in the expression of repair-related factors such as FGF1 and VEGFA.

[0154] Table 14

[0155] Group Healing time (days) Epithelial thickness (μm) Collagen deposition rate (%) CD31+ vessel count FGF1 expression level PBS control group 18.2±1.8 32.5±5.2 42.3±7.8 9.8±2.1 1.0±0.2 Control-Exo 15.3±1.5* 51.6±8.3* 61.7±9.5* 15.2±3.4* 1.6±0.3* TBT14-Exo 12.1±1.2*** 82.4±12.6*** 76.3±11.2*** 22.8±4.9*** 2.3±0.5*** TBT21-Exo 10.4±1.0*** 92.7±14.8*** 86.5±13.4*** 26.3±5.7*** 2.9±0.7*** TBT12-Exo 13.2±1.3*** 77.6±10.9*** 72.8±10.6*** 20.5±4.2*** 2.1±0.4***

[0156] Note: ** indicates p<0.05, ** indicates p<0.001, both compared with the PBS control group.

[0157] The results showed that the three optimal mutant groups (TBT14, TBT21, and TBT12) exhibited significant healing-promoting effects across all indicators. The TBT21 group showed the most significant effect, shortening the healing time from 18.2 days in the control group to 10.4 days, a reduction of 43%. Histological examination revealed that the epithelial regeneration thickness in the TBT21 group reached 92.7 μm, significantly superior to the 51.6 μm in the control group, indicating its effective promotion of epidermal regeneration. Masson staining results showed that the collagen deposition rate in the TBT21 group reached 86.5%, more than double that of the control group, demonstrating its significant improvement in dermal tissue repair quality. Regarding the molecular mechanism, the FGF1 expression level in the TBT21 group was 2.9 times that of the control group, and the number of CD31-positive vessels also increased by 168% compared to the control group. This explains its mechanism of action in promoting wound repair: improving the wound microenvironment by upregulating growth factor expression and promoting angiogenesis. It is worth noting that there are also some differences among the three mutant groups. TBT21 outperformed TBT14 and TBT12 in all indicators, which is consistent with the results of previous in vitro experiments and further verifies the potential of TBT21 as the optimal candidate. Although the control group also showed some therapeutic effect, its indicators only reached 50-70% of the mutant group, which fully demonstrates the necessity of mutant optimization.

[0158] 3. Cerebral ischemia model experiment

[0159] Adult SD rats weighing 250-300g were used in this experiment to establish a cerebral ischemia model via middle cerebral artery occlusion (MCAO). The specific procedure was as follows: After anesthesia with isoflurane, the rats were fixed in a supine position. A midline cervical incision was made to expose the right common carotid artery (CCA), external carotid artery (ECA), and internal carotid artery (ICA). After ligating the distal ECA, a small incision was made at the proximal end of the CCA, and a 0.22mm diameter nylon suture was inserted and advanced through the ICA to the origin of the middle cerebral artery (approximately 18-20mm), causing ischemia in the middle cerebral artery region. The suture was slowly withdrawn after 90 minutes to achieve reperfusion. In the sham-operated group, only the vessels were exposed without inserting a suture. Postoperatively, the animals were randomly divided into 6 groups: sham-operated group (Sham), cerebral ischemia + PBS group, cerebral ischemia + Control exosome group, and cerebral ischemia + TBT14 / TBT21 / TBT12 exosome group, with 10 rats in each group. Two hours after reperfusion, exosomes (100 μg / time, dissolved in 100 μL PBS) were injected via the tail vein for three consecutive days. Animal condition was observed daily post-surgery, and neurological function was assessed on days 1, 3, and 7, including the modified neurological deficit score (mNSS, 0-18 points) and the rotarod test (recording fall latency). Animals were sacrificed on day 7, and brain tissue was harvested for further analysis. One portion of the brain tissue was sectioned coronally and stained with 2% TTC, incubated at 37°C in the dark for 15 minutes, and the infarct volume percentage was calculated. Another portion underwent TUNEL staining and immunofluorescence staining (NeuN labeling neurons, GFAP labeling astrocytes) to observe cell apoptosis and survival. Simultaneously, cortical tissue surrounding the infarct was harvested, and the expression levels of miR-210, BDNF, and HIF-1α were detected by qPCR and Western blot.

[0160] Table 15

[0161] Group mNSS rating (7 days) Infarct volume (%) TUNEL+ cell count (cells / field of view) BDNF expression (multiples) Sham 0.5±0.3 0±0 5±1 1.0±0.1 MCAO+PBS 11.8±1.7 34.6±4.8 118±14 0.6±0.1 MCAO+Control-Exo 8.9±1.2* 27.5±3.9* 88±11* 1.3±0.3* MCAO+TBT14-Exo 6.8±1.0** 21.7±3.2** 68±9** 1.7±0.4** MCAO+TBT21-Exo 4.9±0.8*** 14.5±2.3*** 42±7*** 2.4±0.5*** MCAO+TBT12-Exo 7.5±1.1** 24.8±3.6** 82±10** 1.5±0.3**

[0162] Note: p<0.05, p<0.01, p<0.001, compared with the MCAO+PBS group.

[0163] The results showed that the three optimal mutant groups exhibited differentiated therapeutic effects in the cerebral ischemia model. The TBT21 group demonstrated the best protective effect across all indicators: the mNSS score decreased to 4.9 points, significantly better than the 8.9 points in the Control group; the infarct volume decreased to 14.5%, a 58% reduction compared to the PBS control group; the number of TUNEL-positive apoptotic cells decreased by 64%; and BDNF expression increased to 2.4 times that of the control group. These data suggest that TBT21 exosomes may significantly inhibit neuronal apoptosis and promote neural repair by efficiently delivering miR-210, activating the BDNF-TrkB signaling pathway.

[0164] In comparison, while the TBT14 and TBT12 groups also showed significant therapeutic effects, their performance across all indicators was slightly inferior to that of the TBT21 group. The infarct volume in the TBT14 group was 21.7%, and BDNF expression was 1.7-fold higher; the infarct volume in the TBT12 group was 24.8%, and BDNF expression was 1.5-fold higher. The therapeutic efficacy of these two groups was approximately 70-80% of that of the TBT21 group. This difference may stem from the unique triple mutation design of TBT21 (joint mutation at the 3' end and central region), which gives it higher blood-brain barrier penetration and target cell uptake efficiency.

[0165] It is noteworthy that while the Control exosome group showed some therapeutic effect, all indicators only reached 50-60% of the mutant group's levels, further validating the importance of miR-210 sequence optimization. Mechanistically, the HIF-1α expression level in the TBT21 group was also significantly higher than in other groups (data not shown), suggesting that it may enhance neuroprotective effects by regulating the hypoxic stress pathway. These results not only confirm the outstanding efficacy of TBT21 in a cerebral ischemia model but also provide a clear direction for subsequent dose optimization and mechanistic studies.

Claims

1. A miRNA mutant of miR-210, the nucleotide sequence of which is shown below: 5'-UGUGCGUGUGAX1X2X3X4X5X6X7X8X9X 10 -3' in, X1 can be C or selected from A / U / G; X2 can be A or selected from U / G; X3 can be G or selected from A / U; X4X5 can be CG or selected from GG / AG / UG; X6X7X8X9X 10 Single-point replacement can be performed based on SEQ ID NO: 1, where 1-2 points can be selected to be replaced with A / U / C / G, preferably only X. 10 Replace with A / U / C / G; or X6X7X8X9X 10 Replace the entire string with any one of GCUUC, GCUCC, or GCUAG.

2. The miR-210 mutant according to claim 1, X1-X5 are selected from any one of CAGCG, CUGCG, AAACG, CUACG, CGGGG, CAUAG, or CUUUG; X6-X10 can be selected from any one of GCUGA, GCUGC, GCUUGU, GCUUGG, GCUUC, GCUCC, and GCUAG.

3. The miR-210 mutant according to claim 1 or 2, wherein the miR-210 mutant is shown in SEQ ID NO: 2-25.

4. A recombinant vector comprising a precursor sequence of a miR-210 mutant, wherein the precursor sequence is a precursor sequence capable of expressing the mature miR-210 sequence as shown in claims 1-3.

5. The recombinant vector according to claim 4, wherein the precursor sequence of the miR-210 mutant is shown in SEQ ID NO: 69-92.

6. The recombinant vector according to claim 4, wherein the recombinant vector is selected from at least one of lentivirus, adeno-associated virus, and adenovirus.

7. Introduce and express mature miR-210 recombinant cells and their exosomes, preferably umbilical cord mesenchymal stem cells.

8. The recombinant cells and their exosomes according to claim 7, wherein the mature miR-210 is selected from the mature miR-210 sequence shown in claims 1-3; the introduction includes at least one of the following methods: viral vector introduction, liposome transfection, electroporation, cationic polymer, etc.; preferably, the viral vector can be at least one of lentivirus, adeno-associated virus, and adenovirus.

9. Use of the miR-210 mutant of claims 1-3, the recombinant vector of claims 4-6, the recombinant cells and their exosomes of claims 7-8 in the preparation of medicaments for treating ischemia-related diseases and skin trauma; The ischemic diseases mentioned can include myocardial ischemia, cerebral ischemia, renal ischemia, intestinal ischemia, etc.

10. A pharmaceutical composition for treating ischemia-related diseases and skin trauma, comprising mesenchymal stem cells expressing the mature miR-210 sequence of claims 1-3 and their exosomes; the pharmaceutical composition comprising exosomes and a pharmaceutically acceptable carrier; the composition being administered by local injection, intravenous injection or topical application to the lesion.