Recombinant gene expression vector and use thereof in preparing a drug for treating pulmonary arterial hypertension
Patent Information
- Application Number
- CN202610193217.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-07-03
Smart Images

Figure CN122326679A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to recombinant gene expression vectors and their use in the preparation of drugs for treating pulmonary arterial hypertension. More specifically, this invention relates to pharmaceutical compositions. Background Technology
[0002] Pulmonary arterial hypertension (PAH) is a malignant cardiovascular disease characterized by pulmonary arteriolar remodeling and progressively increased pulmonary vascular resistance, ultimately leading to right heart failure and even death. The main pathological change in PAH is the abnormal overgrowth and enhanced anti-apoptotic capacity of pulmonary artery smooth muscle cells (PASMCs), resulting in thickening of the vessel wall and narrowing of the lumen, the so-called "vascular remodeling".
[0003] Current clinical drugs mainly include endothelin receptor antagonists, phosphodiesterase-5 inhibitors, and prostacyclin analogs. These drugs primarily relieve symptoms by dilating blood vessels. Although they can improve hemodynamic parameters to some extent, they often fail to fundamentally reverse existing pulmonary vascular remodeling, and long-term use may lead to drug resistance, resulting in a still unfavorable long-term survival rate for patients. Therefore, identifying key molecular targets that can specifically inhibit the abnormal proliferation of vascular smooth muscle cells and reverse vascular remodeling is an urgent need for developing next-generation PAH treatments.
[0004] Ste20-like kinase (SLK) is a serine / threonine kinase involved in cell cycle regulation, cytoskeleton remodeling, and apoptosis and migration. However, the specific role of SLK in the pathogenesis of pulmonary arterial hypertension (PAH) has remained unclear. The inventors of this application found that SLK expression levels were significantly downregulated in pulmonary vascular smooth muscle cells in PAH models and patient samples; and specific knockout of the SLK gene further exacerbated vascular remodeling and PAH symptoms. This suggests that restoring or upregulating SLK expression is a potentially effective strategy for treating PAH.
[0005] In the field of gene therapy, traditional gene overexpression strategies typically involve introducing full-length cDNA sequences into cells. However, the coding region of the SLK gene is relatively long, resulting in bulky overexpression vectors that are difficult to package effectively with clinically common vectors such as adeno-associated virus (AAV). Furthermore, sustained high expression of exogenous cDNA can cause non-physiological side effects. In contrast, small activating RNA (saRNA) technology is an emerging gene regulation approach. saRNA is a double-stranded short RNA molecule that can target gene promoter regions and enhance the transcription of specific endogenous genes by recruiting transcription activation complexes. Compared to traditional cDNA overexpression, saRNA sequences are short (approximately 21 nt), making them easily integrated into various viral or non-viral vectors. They can also utilize the cell's own transcriptional machinery to achieve physiological upregulation of endogenous genes, exhibiting better safety and drug-likeness.
[0006] Against this backdrop, there is an urgent need in the field to develop a therapeutic vector that can specifically upregulate SLK expression in pulmonary vascular smooth muscle cells through the saRNA mechanism, in order to fundamentally reverse vascular remodeling and provide a more effective treatment option for patients with pulmonary hypertension. Summary of the Invention
[0007] This application aims to at least partially address one of the technical problems existing in the prior art. To this end, this application provides a recombinant gene expression vector.
[0008] This application is based on the inventor's following discoveries:
[0009] The inventors discovered that the Ste20-like kinase (SLK) gene is significantly downregulated in pulmonary vascular smooth muscle cells (PASMCs) of patients with pulmonary arterial hypertension (PAH) and animal models. SLK deficiency leads to abnormal proliferation and migration of PASMCs, thereby triggering pulmonary vascular remodeling; while restoring SLK expression can effectively reverse this pathological process.
[0010] However, addressing the challenges of the long coding region of the SLK gene, which results in bulky traditional full-length cDNA overexpression vectors that are difficult to package effectively into clinical-grade viral vectors (such as AAV) and hinder physiological regulation, the inventors have proposed a novel solution: utilizing a small activating RNA (saRNA)-mediated RNA activation (RNAa) mechanism to specifically upregulate endogenous SLK transcription by targeting the SLK gene promoter region. This approach not only circumvents vector capacity limitations but also, compared to forced overexpression of exogenous proteins, more closely approximates the physiological state and offers greater safety.
[0011] To further achieve precise delivery and efficient expression of the aforementioned saRNA in pulmonary vascular smooth muscle cells, the inventors conducted in-depth optimization and screening of the vector elements. They discovered that combining a vascular smooth muscle-specific promoter (e.g., EnSm22a) with a modified miRNA precursor backbone (e.g., the mir-155 backbone) can construct a highly tissue-specific expression system. This system not only strictly restricts expression in non-target tissues to reduce off-target risks but also fully utilizes the cell's endogenous miRNA processing machinery (Drosha / Dicer) to efficiently process the precursor into mature saRNA. Furthermore, the inventors found that introducing post-transcriptional regulatory elements (such as WPRE) into the vector significantly increases transcript stability and nuclear export efficiency, thereby significantly enhancing the intracellular abundance of saRNA and its activation efficacy against the SLK gene, ultimately achieving effective reversal of pulmonary hypertension vascular remodeling.
[0012] In a first aspect, this application proposes a recombinant gene expression vector. According to embodiments of this application, the recombinant gene expression vector includes a nucleotide sequence encoding a small activating RNA (saRNA), wherein the saRNA is adapted to specifically target and upregulate the expression of the endogenous SLK gene. The recombinant gene expression vector according to embodiments of this application successfully overcomes the bottlenecks of traditional macromolecular gene therapy. Addressing the problem of difficulties in vector construction and packaging due to the excessive length of the SLK gene coding region, this application delivers a short saRNA sequence, utilizing the RNA activation (RNAa) mechanism to specifically upregulate the expression of the endogenous SLK gene at the transcriptional level. This strategy not only significantly improves the packaging titer and transduction efficiency of the viral vector but also achieves therapeutic goals by restoring the cell's own gene regulatory network, which is more physiologically consistent than the forced overexpression of exogenous proteins. This vector combines the tissue targeting of the promoter with the sequence specificity of saRNA, achieving dual precise regulation of SLK expression in pulmonary vascular smooth muscle cells.
[0013] In some aspects of this application, the saRNA targets the promoter region of the endogenous SLK gene.
[0014] In some aspects of this application, the target region is located within the range of -1000bp upstream to +500bp downstream of the SLK gene transcription start site.
[0015] In some aspects of this application, the saRNA targets a specific sequence in the promoter region of the SLK gene.
[0016] In some aspects of this application, the specific sequence comprises a nucleotide sequence as shown in SEQ ID NO: 3.
[0017] GCCTGAAAGTGCACTGTTTCC (SEQ ID NO: 3) In some aspects of this application, the saRNA comprises a sense strand and an antisense strand.
[0018] In some aspects of this application, the sense strand has a nucleotide sequence as shown in SEQ ID NO: 1 or having at least 80% identity with it, and / or the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 2 or having at least 80% identity with it.
[0019] 5'-GCCTGAAAGTGCACTGTTTCC-3' (SEQ ID NO: 1).
[0020] 5'-GGAAACAGTGCACTTTCAGGC-3' (SEQ ID NO: 2).
[0021] In some aspects of this application, the sense and antisense strands of the saRNA are each independently 19-27 nucleotides in length, and each has a 1-4 nucleotide overhang at the 3' end, preferably a UU or dTdT overhang.
[0022] In some aspects of this application, the sense and antisense strands of the saRNA are each independently 21-23 nucleotides in length.
[0023] In some aspects of this application, the vector comprises a promoter, a nucleotide sequence encoding the saRNA, and post-transcriptional regulatory elements.
[0024] In some aspects of this application, the promoter is operatively linked to a nucleotide sequence encoding the saRNA.
[0025] In some aspects of this application, the promoter is a vascular smooth muscle cell-specific promoter.
[0026] In some aspects of this application, the promoter is the EnSm22a promoter, or a fragment or variant that has the same function as the EnSm22a promoter.
[0027] In some aspects of this application, the vector further comprises a miRNA precursor backbone, wherein the sequence of the saRNA is located in the miRNA precursor backbone.
[0028] In some aspects of this application, the miRNA precursor scaffold is a mouse or human mir-155 precursor scaffold.
[0029] In some aspects of this application, the backbone of the vector is selected from at least one of lentiviral vectors, adeno-associated virus vectors, adenovirus vectors, and liposome complexes.
[0030] In some aspects of this application, the post-transcriptional regulatory element is a marmot hepatitis virus post-transcriptional regulatory element.
[0031] In some aspects of this application, the vector comprises the following expression cassette elements connected in sequence: (1) an EnSm22a promoter; (2) the reporter gene coding sequence; (3) the mir-155 precursor backbone containing the saRNA coding sequence; (4) the post-transcriptional regulatory element of marmot hepatitis virus; and (5) the BGH polyA signal sequence.
[0032] In some aspects of this application, the connection order of the elements is as follows: the 3' end of the EnSm22a promoter is connected to the 5' end of the reporter gene coding sequence, the 3' end of the reporter gene coding sequence is connected to the 5' end of the mir-155 precursor backbone, the 3' end of the mir-155 precursor backbone is connected to the 5' end of the marmot hepatitis virus post-transcriptional regulatory element, and the 3' end of the marmot hepatitis virus post-transcriptional regulatory element is connected to the 5' end of the BGH polyA signal sequence.
[0033] In some aspects of this application, the reporter gene coding sequence is the coding sequence of enhanced green fluorescent protein (EGFP).
[0034] In a second aspect of this application, a pharmaceutical composition is proposed. According to embodiments of this application, the pharmaceutical composition comprises the recombinant gene expression vector described in the first aspect of this application, and pharmaceutically acceptable excipients. The pharmaceutical composition described in the embodiments of this application significantly enhances the clinical translational potential of gene therapy drugs. By scientifically combining the therapeutic vector with pharmaceutically acceptable excipients, this composition not only effectively maintains the bioactivity and stability of viral particles or plasmid DNA during storage and transportation, but more importantly, it is particularly suitable for preparation as an inhaled formulation or aerosol. This form of administration allows the drug to directly contact the pulmonary vascular system, maintaining a high drug concentration at the lesion site while significantly reducing systemic exposure, thereby minimizing systemic side effects and improving the safety window of treatment.
[0035] In some aspects of this application, the dosage form of the pharmaceutical composition is suitable for administration by nebulization, intratracheal instillation or local injection.
[0036] In a third aspect of this application, the recombinant gene expression vector described in the first aspect or the pharmaceutical composition described in the second aspect is proposed for use in the preparation of a medicament for the prevention and / or treatment of pulmonary arterial hypertension (PAH). The use described in the embodiments of this application provides a disease-modifying therapy targeting the etiology of pulmonary arterial hypertension (PAH). Existing drugs mostly focus on vasodilation to relieve symptoms, while the drug of this application directly inhibits the core pathological mechanism driving PAH development—the abnormal proliferation and migration of smooth muscle cells—by specifically restoring SLK expression in pulmonary vascular smooth muscle cells. Experimental results confirm that the application of this drug can significantly reverse pulmonary vascular remodeling, effectively reduce pulmonary artery pressure and pulmonary vascular resistance, and alleviate right ventricular hypertrophy, thereby delaying the progression of right heart failure. It has significant technical advantages and clinical value in improving the prognosis and quality of life of PAH patients.
[0037] In some aspects of this application, the drug is used for: (i) upregulating the expression of the SLK gene in pulmonary vascular smooth muscle cells; (ii) inhibiting the proliferation and / or migration of pulmonary vascular smooth muscle cells; (iii) reducing pulmonary artery pressure and / or alleviating right ventricular hypertrophy; and / or (iv) reversing pulmonary vascular remodeling.
[0038] Additional aspects and advantages of this application will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of this application. Attached Figure Description
[0039] The above and / or additional aspects and advantages of this application will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which: Figure 1 Example 1 shows a graph illustrating the difference in SLK expression in lung tissues of patients with pulmonary hypertension and healthy volunteers, based on GEO data analysis.
[0040] Figure 2 The figure shown in Example 1 illustrates the experimental results of pulmonary arterial hypertension (PAH) in mice caused by vascular smooth muscle cell (SMC) specific knockout of the SLK gene.
[0041] Figure 3 Example 2 shows the construction map of the therapeutic recombinant gene expression vector (saRNA-SLK) of this application.
[0042] Figure 4 Example 3 shows the verification results of the saRNA-SLK of this application activating SLK expression in pulmonary artery smooth muscle cells (PASMCs) in vitro and its effect on PASMC proliferation.
[0043] Figure 5Example 4 shows the in vivo efficacy evaluation results of the saRNA-SLK therapeutic vector of this application on a mouse PAH model. Detailed Implementation
[0044] The embodiments of this application are described in detail below. The embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application.
[0045] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this application, unless otherwise stated, "multiple" means two or more.
[0046] In this document, the terms “comprising” or “including” are open-ended expressions, meaning that they include the contents specified in this invention, but do not exclude other aspects.
[0047] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.
[0048] In this document, the terms "preferred," "ideal," or "preferred" generally refer to a specific implementation or optimization mode among the many possible solutions provided by the present invention, which aims to achieve better technical effects or performance, as indicated by the technical features, implementation methods, parameters, or events described subsequently. This description should be understood as a non-limiting guideline: it indicates the best implementation or recommended scope of the invention; however, it does not imply that the feature is essential for the basic implementation of the invention; the description of the invention includes both specific solutions containing the "preferred" features and other technical solutions that do not contain the "preferred" features but still fall within the broad scope of protection of the present invention.
[0049] In this paper, the term "saRNA (Small Activating RNA)" refers to a double-stranded small RNA molecule, typically 19-27 nucleotides (nt) in length. Unlike traditional siRNA (small interfering RNA)-mediated gene silencing, saRNA can target the promoter or enhancer regions of specific genes, promoting or upregulating the transcription of the target gene by recruiting transcription activation complexes (such as RNA-induced transcription activation complex, RITA). This phenomenon is known as RNA activation (RNAa). In this application, saRNA specifically refers to a small RNA molecule designed to target and activate the transcription of the SLK gene.
[0050] In this paper, the term "SLK (Ste20-like Kinase)" refers to a serine / threonine protein kinase belonging to the Ste20 kinase family. SLK is involved in regulating various biological processes, including cytoskeleton reorganization, cell migration, proliferation, and apoptosis. In the context of this application, SLK is a key regulator in pulmonary vascular smooth muscle cells, and its downregulation is closely related to the pathological mechanisms of pulmonary hypertension.
[0051] In this document, the term "CV309" refers to a specific recombinant gene expression vector and its backbone system constructed in this application. This vector contains a specific combination of elements (EnSm22a promoter, EGFP, mir-155 backbone, WPRE, etc.) designed to achieve specific gene delivery and expression targeting vascular smooth muscle cells. The term can refer to either an empty vector backbone or a therapeutic vector system with an inserted saRNA sequence.
[0052] In this document, the term "EnSm22a (Enhancer-SM22alpha Promoter)" refers to a complex promoter element containing a promoter fragment of the SM22alpha (smooth muscle 22α protein, also known as Transgelin) gene and its enhancer sequence. SM22alpha is a hallmark protein of smooth muscle cells. In this application, the promoter is used to drive the transcription of downstream genes (such as saRNA precursors and EGFP) primarily or exclusively in vascular smooth muscle cells, thereby conferring tissue specificity to the vector.
[0053] In this document, the term "EnSm22a promoter" refers to a DNA sequence derived from the promoter region of the smooth muscle cell-specific protein 22-alpha (SM22α, also known as Transgelin) gene. In a preferred embodiment of the invention, it refers to a sequence containing the upstream specific enhancer / promoter core region of the mouse or human SM22α gene, which drives the specific expression of downstream genes in smooth muscle cells (SMCs).
[0054] In this document, the term "variant" refers to a nucleotide sequence obtained by substitution, deletion, or insertion of one or more nucleotides (e.g., 1-20, 1-10, or 1-5) compared to the wild-type EnSm22a promoter sequence. The variant has at least 85%, 90%, 95%, or 98% identity with the native EnSm22a promoter sequence.
[0055] The term "functionally active fragment" refers to a truncated version of the EnSm22a promoter (e.g., truncated from its 5' or 3' end), as long as the fragment still contains the core cis-acting element (e.g., CArG box element) necessary to drive SMC-specific expression.
[0056] Regardless of sequence variations, the “variants” or “fragments” described in this invention must possess the following functional characteristics: tissue specificity: transcriptional activity in pulmonary vascular smooth muscle cells (VSMCs) is significantly higher than that in non-smooth muscle cells (such as fibroblasts or endothelial cells) (typically more than 2 times higher); driving efficacy: capable of effectively driving the transcription of downstream linked reporter genes (such as EGFP) or small activating RNA (saRNA) precursors.
[0057] In this paper, the term "mir-155 Backbone" refers to a DNA structure modified based on the natural microRNA-155 precursor sequence. In this structure, the natural mature miRNA sequence is removed and replaced with a multiple cloning site (MCS) or a target small RNA sequence. The role of this backbone is to efficiently process the transcript using the microprocessor complex within the cell nucleus to generate a functional target small RNA (such as saRNA).
[0058] In this paper, the term "WPRE" refers to the posttranscriptional regulatory element of marmot hepatitis virus. It is a cis-acting DNA sequence that, when placed in the 3' untranslated region (3'UTR) of the gene expression cassette, promotes nuclear export of mRNA and increases transcript stability, thereby significantly enhancing transgene expression levels.
[0059] In this paper, the term "RNAa (RNA Activation)" refers to a gene regulation mechanism mediated by small double-stranded RNA (saRNA). In this mechanism, saRNA enters the cell nucleus, targets specific regulatory regions of genomic DNA (such as promoters), and causes changes in the chromatin structure at that specific site (such as histone modifications), thereby enhancing the transcriptional activity of the gene.
[0060] In this paper, the term "pulmonary vascular remodeling" refers to one of the main pathological features of pulmonary hypertension, characterized by thickening of the pulmonary arteriolar media (smooth muscle layer), intimal hyperplasia, and vascular fibrosis. This process is primarily caused by the abnormal proliferation and enhanced anti-apoptotic capacity of pulmonary vascular smooth muscle cells, leading to vascular luminal narrowing and increased vascular resistance. The vector in this application aims to reverse this process by restoring SLK expression.
[0061] In this document, the term "MCS (Multiple Cloning Site)" refers to a synthetically produced sequence on the vector DNA containing multiple unique restriction endonuclease recognition sites (HindIII and KpnI are specifically mentioned in this application). These sites are closely arranged, allowing exogenous DNA fragments (such as sequences encoding saRNA) to be conveniently inserted into specific locations on the vector.
[0062] In this document, the term "operably linked" refers to two or more nucleic acid elements being connected in a manner such that the function of one element is regulated or controlled by the other, or that they can work together to achieve a desired function. In this application, when "promoter is operably linked to a coding sequence," it means that the promoter is located in a position and direction capable of initiating transcription of the coding sequence. This does not require the promoter and coding sequence to be adjacent. There can be spacer sequences (such as introns, enhancers, adapter sequences, etc.), as long as the promoter can still direct RNA polymerase to transcribe the subsequent gene; they are operably linked.
[0063] In this article, the term "sequentially linked" refers to the arrangement of elements in a specific linear order (typically from the 5' end to the 3' end). When we say "containing sequentially linked EnSm22a-EGFP-mir-155-WPRE-BGH PolyA," it means that on the DNA strand, EnSm22a appears first, followed by EGFP, then mir-155, then WPRE, and finally BGH PolyA. Even if there are gaps between the elements, they appear in this order.
[0064] In this paper, the terms “identity” or “homology” are used to describe the percentage of identical nucleotides between two nucleic acid sequences relative to a reference sequence, determined by conventional methods, such as Ausubel et al., eds. (1995), Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN procedure (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research). Foundation, Washington, DC). Numerous algorithms exist for aligning sequences and determining sequence identity, including: the homology alignment algorithm of Needleman et al. (1970) J. Mol. Biol. 48: 443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2: 482; the similarity search method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85: 2444; the Smith-Waterman algorithm (Meth. Mol. Biol. 70: 173-187 (1997); and the BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J. Mol. Biol. 215: 403-410). Computer programs utilizing these algorithms are also available, including but not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul...). See, Meth.Enzym., 266:460-480 (1996); or GAP, BESTFIT, BLAST Altschul, etc., above, FASTA, and TFASTA, available in Genetics Computing Group (GCG) package, version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program provided by Intelligenetics, Mountain View, California.
[0065] In this paper, the term "at least 80% identity" means at least 80% identity with each reference sequence, which may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9%.
[0066] In this document, the term "pharmaceutical composition" generally refers to a unit dosage form and can be prepared by any method well known in the pharmaceutical industry. All methods involve the step of combining the active ingredient with a carrier constituting one or more adjunct components. Typically, compositions are prepared by uniformly and sufficiently combining the active compound with a liquid carrier, a finely chopped solid carrier, or both.
[0067] In this document, the term "pharmaceuticalally acceptable excipient" may include any solvent, solid excipient, diluent, or other liquid excipient, etc., suitable for the specific target dosage form. The use of any conventional excipients, except those that are incompatible with the compounds of the present invention, such as any adverse biological effects or harmful interactions with any other component of the pharmaceutically acceptable composition, is also within the scope of this invention.
[0068] In this document, the term "administration" refers to the introduction of a predetermined amount of a substance into a patient in a suitable manner. The antibodies or antigen-binding fragments, recombinant proteins, multispecific antibodies, or pharmaceutical compositions of the present invention can be administered via any common route, as long as it can reach the intended tissue. Various routes of administration are contemplated, including peritoneal, intravenous, intramuscular, subcutaneous, etc., but the present invention is not limited to these exemplified routes of administration. Preferably, the compositions of the present invention are administered via intravenous or subcutaneous injection.
[0069] In this document, the term "treatment" refers to the administration of a drug or compound to an individual to achieve a desired pharmacological and / or physiological effect. This effect may be preventative in terms of complete or partial prevention of a disease or its symptoms, and / or therapeutic in terms of partial or complete cure of a disease and / or adverse effects caused by the disease. As used herein, "treatment" encompasses diseases in mammals, particularly humans, including: (a) prevention of disease or the onset of a condition in an individual who is susceptible but has not yet been diagnosed with the disease; (b) inhibition of disease, such as blocking disease progression; or (c) relief of disease, such as reducing symptoms associated with the disease. As used herein, "treatment" encompasses any administration of a drug or compound to an individual to treat, cure, relieve, improve, reduce, or inhibit the individual's disease, including but not limited to administration of a drug containing a compound described herein to an individual in need.
[0070] This application discloses a recombinant gene expression vector, a pharmaceutical composition, and their uses, which will be described in detail below.
[0071] Recombinant gene expression vector In a first aspect, this application proposes a recombinant gene expression vector. According to embodiments of this application, the recombinant gene expression vector includes a nucleotide sequence encoding a small activation RNA (saRNA), wherein the saRNA is suitable for specifically targeting and upregulating the expression of the endogenous SLK gene. The recombinant gene expression vector according to embodiments of this application employs a strategy encoding a small activation RNA (saRNA), effectively overcoming the technical bottlenecks of difficult vector construction and packaging by clinical-grade viral vectors (such as AAV) due to the excessive length of the full-length SLK cDNA sequence. By utilizing the RNA activation (RNAa) mechanism, this vector can specifically target the SLK gene promoter region, recruiting the transcriptional activation complex, thereby initiating or enhancing the expression of the cell's own endogenous SLK gene at the transcriptional level. Compared to the forced overexpression of exogenous proteins, this in situ activation method produces a natural endogenous protein, avoiding the cytotoxicity caused by non-physiological high expression, and exhibiting superior biosafety and gene regulation precision. Furthermore, by optimizing the combination of a vascular smooth muscle-specific promoter and a highly efficient miRNA backbone, tissue-specific expression of the therapeutic gene is further achieved, significantly reducing the off-target risk.
[0072] According to an embodiment of this application, the saRNA targets the promoter region of the endogenous SLK gene.
[0073] According to an embodiment of this application, the target region is located within the range of -1000bp upstream to +500bp downstream of the SLK gene transcription start site.
[0074] According to embodiments of this application, the saRNA targets a specific sequence in the promoter region of the SLK gene.
[0075] According to embodiments of this application, the specific sequence comprises a nucleotide sequence as shown in SEQ ID NO: 3.
[0076] GCCTGAAAGTGCACTGTTTCC (SEQ ID NO: 3) According to embodiments of this application, the saRNA comprises a sense strand and an antisense strand.
[0077] According to embodiments of this application, the positive strand has a nucleotide sequence as shown in SEQ ID NO: 1 or having at least 80% identity with it.
[0078] According to embodiments of this application, the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 2 or having at least 80% identity with it. According to embodiments of this application, by limiting the target region of the saRNA to the promoter core region from -1000 bp upstream to +500 bp downstream of the SLK gene transcription start site, particularly by selecting specific sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2, it can precisely bind to the open chromatin region at the SLK gene promoter. This specific target location and sequence is a screened and validated hotspot region that can most effectively recruit the RNA-induced transcriptional activation complex (RITA), thereby maximizing the transcriptional efficiency of the SLK gene while ensuring extremely high specificity, significantly superior to randomly designed saRNA sequences.
[0079] 5'-GCCTGAAAGTGCACTGTTTCC-3' (SEQ ID NO: 1).
[0080] 5'-GGAAACAGTGCACTTTCAGGC-3' (SEQ ID NO: 2).
[0081] According to embodiments of this application, the sense and antisense strands of the saRNA are each independently 19-27 nucleotides long, for example, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides, and contain a 1-4 nucleotide overhang at the 3' end, preferably a UU or dTdT overhang. Setting the sense and antisense strands of the saRNA to 19-27 nucleotides long, and including a 1-4 nucleotide (preferably UU or dTdT) overhang at the 3' end, is to mimic the structural characteristics of native intracellular microRNAs (miRNAs) or small interfering RNAs (siRNAs). This specific length and structural design enhances the stability of the saRNA within the cell, prevents its degradation by nucleases, and facilitates efficient recognition and loading of the saRNA by intracellular Argonaute proteins (such as Ago2), thereby significantly improving the assembly efficiency and functional activity of the RNA activation complex.
[0082] According to embodiments of this application, the sense and antisense strands of the saRNA are each independently 21-23 nucleotides in length.
[0083] According to embodiments of this application, the vector comprises a promoter, a nucleotide sequence encoding the saRNA, and post-transcriptional regulatory elements.
[0084] According to an embodiment of this application, the promoter is operatively linked to a nucleotide sequence encoding the saRNA.
[0085] According to an embodiment of this application, the promoter is a vascular smooth muscle cell-specific promoter.
[0086] According to embodiments of this application, the promoter is the EnSm22a promoter, or a fragment or variant with the same function as the EnSm22a promoter. According to embodiments of this application, a vascular smooth muscle cell-specific promoter, particularly the EnSm22a promoter, is used, endowing the vector with extremely high tissue targeting. The EnSm22a promoter can drive downstream genes to be specifically expressed only in smooth muscle cells, while remaining silent in vascular endothelial cells, fibroblasts, or other organ cells (such as liver and kidney). This design not only ensures that the SLK gene is activated only in diseased vascular smooth muscle, minimizing non-specific effects on normal tissues, but also greatly improves the safety of gene therapy.
[0087] According to embodiments of this application, the vector further comprises a miRNA precursor backbone, wherein the sequence of the saRNA is located in the miRNA precursor backbone.
[0088] According to embodiments of this application, the miRNA precursor backbone is a mouse or human mir-155 precursor backbone. According to embodiments of this application, introducing a miRNA precursor backbone, particularly a mouse or human mir-155 precursor backbone, into a vector to load the saRNA sequence enables precise cleavage and processing of the transcript using endogenous miRNA processing machinery (Drosha and Dicer enzyme systems). Compared to traditional shRNA structures, the mir-155 backbone significantly improves the generation efficiency and intracellular abundance of mature saRNA, while reducing the cytotoxicity that may result from high expression of exogenous RNA, making saRNA expression more efficient and persistent.
[0089] According to embodiments of this application, the backbone of the vector is selected from at least one of lentiviral vectors, adeno-associated virus vectors, adenoviral vectors, and liposome complexes.
[0090] According to embodiments of this application, the post-transcriptional regulatory element is a marmot hepatitis virus post-transcriptional regulatory element. According to embodiments of this application, the marmot hepatitis virus post-transcriptional regulatory element (WPRE) is introduced into the vector. Utilizing its specific tertiary structure, it can significantly promote the transport of the transcription product (mRNA) from the cell nucleus to the cytoplasm and increase the stability of the mRNA. The addition of this element significantly enhances the expression level of the vector in target cells. The results of the embodiments show that the transgene expression efficiency of the vector containing the WPRE element can be increased several times, thereby ensuring an effective therapeutic concentration of SLK activation even under low-dose viral infection.
[0091] According to an embodiment of this application, the carrier comprises the following expression cassette elements connected in sequence: (1) an EnSm22a promoter; (2) the reporter gene coding sequence; (3) the mir-155 precursor backbone containing the saRNA coding sequence; (4) the post-transcriptional regulatory element of marmot hepatitis virus; and (5) the BGH polyA signal sequence.
[0092] According to an embodiment of this application, the connection order of the elements is as follows: the 3' end of the EnSm22a promoter is connected to the 5' end of the reporter gene coding sequence, the 3' end of the reporter gene coding sequence is connected to the 5' end of the mir-155 precursor backbone, the 3' end of the mir-155 precursor backbone is connected to the 5' end of the marmot hepatitis virus post-transcriptional regulatory element, and the 3' end of the marmot hepatitis virus post-transcriptional regulatory element is connected to the 5' end of the BGH polyA signal sequence.
[0093] According to an embodiment of this application, the reporter gene coding sequence is the coding sequence of enhanced green fluorescent protein (EGFP).
[0094] According to embodiments of this application, the vector does not contain the coding sequence of exogenous reporter genes. The explicit exclusion of the vector from the coding sequence of exogenous reporter genes (such as EGFP, RFP, etc.) according to embodiments of this application is based on safety considerations. Removing these non-therapeutic exogenous protein coding sequences eliminates the potential for immune rejection (immunogenicity) induced by exogenous proteins in the human body, improving drug safety; it also further reduces the size of the vector, leaving more space for therapeutic elements and facilitating vector packaging and production.
[0095] According to an embodiment of this application, the connection order of the element from the 5' end to the 3' end is as follows: EnSm22a-EGFP-mir-155-WPRE-BGH PolyA.
[0096] Pharmaceutical Composition In a second aspect, this application provides a pharmaceutical composition. According to embodiments of this application, the pharmaceutical composition comprises the recombinant gene expression vector described in the first aspect of this application, and pharmaceutically acceptable excipients. The pharmaceutical composition according to embodiments of this application significantly enhances the clinical translational potential of gene therapy drugs. By scientifically combining the therapeutic vector with pharmaceutically acceptable excipients, this composition not only effectively maintains the bioactivity and stability of viral particles or plasmid DNA during storage and transportation, but more importantly, it is particularly suitable for preparation as an inhaled formulation or aerosol. This form of administration allows the drug to directly contact the pulmonary vascular system, maintaining a high drug concentration at the lesion site while significantly reducing systemic exposure, thereby minimizing systemic side effects and improving the safety window of treatment.
[0097] According to embodiments of this application, the dosage form of the pharmaceutical composition is suitable for administration by nebulization, intratracheal instillation, or local injection.
[0098] The pharmaceutical compositions of the present invention can be administered by any acceptable method of administration. The pharmaceutical compositions of the present invention can be formulated into solid, semi-solid, liquid, or gaseous forms, such as injections or lyophilized powders, and current methods for preparing these dosage forms are known or obvious to those skilled in the art. Typical routes of administration of such pharmaceutical compositions include, but are not limited to, oral, topical, transdermal, inhalation, parenteral, sublingual, oral, rectal, vaginal, and intranasal routes. The term parenteral, as used herein, includes subcutaneous injection, intravenous, intramuscular, intradermal, intrasternal injection, or infusion techniques. The pharmaceutical compositions of the present invention are formulated to allow the bioactive components contained therein to be bioavailable after administration to a patient.
[0099] use In a third aspect of this application, the recombinant gene expression vector described in the first aspect or the pharmaceutical composition described in the second aspect is proposed for use in the preparation of a medicament for the prevention and / or treatment of pulmonary arterial hypertension (PAH). The use described in the embodiments of this application provides a disease-modifying therapy targeting the etiology of pulmonary arterial hypertension (PAH). Existing drugs mostly focus on vasodilation to relieve symptoms, while the drug of this application directly inhibits the core pathological mechanism driving PAH development—the abnormal proliferation and migration of smooth muscle cells—by specifically restoring SLK expression in pulmonary vascular smooth muscle cells. Experimental results confirm that the application of this drug can significantly reverse pulmonary vascular remodeling, effectively reduce pulmonary artery pressure and pulmonary vascular resistance, and alleviate right ventricular hypertrophy, thereby delaying the progression of right heart failure. It has significant technical advantages and clinical value in improving the prognosis and quality of life of PAH patients.
[0100] According to the embodiments of this application, the mechanism of action of the drug includes: (1) specifically entering pulmonary vascular smooth muscle cells; (2) Transcription produces transcripts containing saRNA precursors; (3) Processes into mature saRNA via intracellular enzyme complexes; (4) Upregulates the expression of endogenous SLK genes via RNA activation (RNAa) mechanism; (5) Inhibits abnormal proliferation and migration of smooth muscle cells and / or reverses pulmonary vascular remodeling.
[0101] According to embodiments of this application, the drug is used to: (i) upregulate the expression of the SLK gene in pulmonary vascular smooth muscle cells; (ii) inhibit the proliferation and / or migration of pulmonary vascular smooth muscle cells; (iii) reduce pulmonary artery pressure and / or alleviate right ventricular hypertrophy; and / or (iv) reverse pulmonary vascular remodeling.
[0102] The following will explain the solution of this application with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.
[0103] Example: Example 1: SMC-specific knockout of SLK exacerbates PAH in mice Objective: To verify the key role of SLK in maintaining pulmonary vascular homeostasis, and that its deficiency promotes the development of PAH.
[0104] method: NCBI Gene Expression Omnibus (GEO) Data Analysis: The GSE272776 dataset was downloaded from the GEO database. This dataset contains transcriptomic data from patients with pulmonary arterial hypertension (PAH) and normal controls, and the differences in SLK expression were analyzed.
[0105] Animal model: SMC-specific Cre tool mice (SMMHC-CreERT2) were crossed with SLK conditional knockout (Slkfl / fl) mice to obtain SMC-specific SLK knockout (Slkfl / fl, SMMHC-CreERT2) mice and their littermate controls (Slkfl / fl) mice. Then, at 4-6 weeks, tamoxifen was injected intraperitoneally at 10 mg / kg / d once on days 1, 3, and 5, for a total of three times, to initiate nuclear translocation and gene knockout of Cre recombinase.
[0106] Genotype identification: Genotype identification was performed using rat tail genotype PCR.
[0107] PAH model establishment: This model was developed for 8-10 week old male Slk. fl / fl SMMHC-CreERT2 mice and Slk fl / fl Mice were treated with hypoxia (10% O2) combined with Sugen-5416 (SU5416, 20 mg / kg, once a week, subcutaneous injection).
[0108] Phenotypic analysis (after 4 weeks): Hemodynamics: Right heart catheterization to measure right ventricular systolic pressure (RVSP).
[0109] Right ventricular hypertrophy: Calculate the right ventricular hypertrophy index [RV / (LV+S)].
[0110] Pulmonary vascular remodeling: Lung tissue was taken for paraffin sectioning, H&E staining was performed, and quantitative analysis of pulmonary arteriolar wall thickness was conducted.
[0111] SLK knockout efficiency verification: The specific knockout effect of SLK protein in SMC (α-SMA positive region) was verified by immunofluorescence staining of lung tissue.
[0112] result: like Figure 1 As shown, compared with healthy volunteers, the expression level of SLK in the lung tissue of PAH patients was significantly reduced.
[0113] like Figure 2 As shown in AC, immunofluorescence confirmed that SLK protein is present in Slk. fl / fl SMMHC-CreERT2 mice showed almost no expression in the pulmonary vascular smooth muscle layer.
[0114] like Figure 2 As shown in DE, under hypoxia + SU5416 (SuHx) induction, Slk fl / fl The RVSP and RV / (LV+S) ratios of SMMHC-CreERT2 mice were significantly higher than those of the control group (p<0.05).
[0115] like Figure 2 As shown in FG, pulmonary vascular morphology analysis revealed that Slk fl / fl The %WT of pulmonary arterioles in SMMHC-CreERT2 mice was significantly increased.
[0116] Conclusion: Specific knockout of the SLK gene in smooth muscle cells significantly aggravates PAH, demonstrating that SLK is a key anti-remodeling factor in pulmonary vascular smooth muscle cells (PASMCs), and its loss of function promotes PAH development.
[0117] Example 2: Construction of a saRNA expression vector targeting SLK (saRNA-SLK) Objective: To construct a saRNA therapeutic vector that can specifically express and activate the SLK gene in SMC.
[0118] method: Vector backbone: The empty CV309 vector described in the vector section of this embodiment is used. The backbone elements of the CV309 vector, from the 5' end to the 3' end, are as follows: EnSm22a promoter, EGFP coding sequence, mir-155 precursor backbone containing multiple cloning site (MCS), WPRE, and BGH polyA sequence. The vector contains a HindIII / KpnI cloning site within the mir-155 backbone for inserting the saRNA coding sequence. (EnSm22a-EGFP-mir-155(MCS)-WPRE-polyA, containing HindIII / KpnI cloning site).
[0119] Insert design: Based on the SLK gene promoter region sequence (SEQ ID NO: 3, GCCTGAAAGTGCACTGTTTCC), a specific small activating RNA (saRNA) was designed. The core sequence of the sense strand is shown in SEQ ID NO: 1 (5'-GCCTGAAAGTGCACTGTTTCC-3'), and the core sequence of the antisense strand is shown in SEQ ID NO: 2 (5'-GGAAACAGTGCACTTTCAGGC-3'). The synthesized oligonucleotide chains were annealed to form double strands, designed to be 21 nt in length with 3'-UU overhangs. Two corresponding DNA oligonucleotide chains were chemically synthesized, annealed to form double strands, with HindIII and KpnI restriction enzyme compatible sticky ends at their 5' and 3' ends, respectively. The middle sequence encodes the double strand of the target saRNA and its flanking mir-155 backbone adaptor sequences.
[0120] Enzyme digestion and ligation: The CV309 empty vector plasmid was digested with HindIII and KpnI, and the linearized large fragment was recovered by gel electrophoresis. The annealed DNA insert was ligated to the linearized vector at a molar ratio of 3:1.
[0121] Cloning and Identification: The ligation product was transformed into competent *E. coli* cells, and ampicillin-resistant clones were selected. Plasmids were extracted, digested with HindIII / KpnI, and sequenced (using universal primers flanking the insertion site on the vector) to confirm correct insertion and orientation of the saRNA sequence. The successfully constructed vector was named saRNA-SLK. Simultaneously, a control vector, saRNA-empty, containing a randomized, meaningless sequence, was constructed.
[0122] Viral packaging: Lentiviral packaging was performed in HEK293T cells using a three-plasmid system (transfer plasmid, packaging plasmid, and envelope plasmid). Cell supernatants were collected after 48 and 72 hours, concentrated by ultracentrifugation, and the viral pellet was resuspended in PBS. The viral physical titer (TU / mL) was determined by qPCR or by counting EGFP-positive cells in infected HEK293T cells.
[0123] result: Plasmid digestion identification showed that saRNA-SLK and saRNA-empty, after double digestion with HindIII / KpnI, released small fragments of the designed size.
[0124] DNA sequencing results confirmed that the saRNA coding sequence was accurately inserted into the mir-155 backbone MCS of the CV309 vector, and the reading frame was correct.
[0125] Conclusion: A system as described above was successfully constructed. Figure 3 The images show a specific therapeutic vector and a control vector based on the CV309 backbone that can express saRNA targeting SLK.
[0126] Example 3: In vitro validation of saRNA-SLK activation of SLK expression in PASMC Objective: To verify whether the saRNA-SLK vector can effectively upregulate SLK expression and inhibit PASMC proliferation in PASMCs.
[0127] method: Primary mouse PASMCs were isolated and cultured. Cells were seeded in 6-well plates and divided into two groups: (1) saRNA-empty group (negative control); (2) saRNA-SLK group (transfected with therapeutic vector).
[0128] Detection: CCK8 data were measured 0 h after transfection, and then again 24 h later. Forty-eight hours later, total RNA and total protein were extracted from cells. SLK mRNA levels were detected by RT-qPCR, and SLK protein expression levels were detected by Western blotting using anti-SLK and anti-β-tubulin antibodies.
[0129] result: RT-qPCR results showed that the expression level of SLK mRNA in the saRNA-SLK group was more than 2.5 times that of the control group. See details... Figure 4Western blotting results showed that, compared with the saRNA-empty group, the expression level of SLK protein in PASMCs was significantly upregulated in the saRNA-SLK group. CCK8 assays showed that, compared with the saRNA-empty group, the saRNA-SLK group significantly inhibited PASMC proliferation.
[0130] Conclusion: The saRNA-SLK vector can effectively transduce PASMCs in vitro, and the expressed saRNA significantly upregulates the protein expression level of the endogenous SLK gene and inhibits PASMC proliferation.
[0131] Example 4: In vivo efficacy evaluation of saRNA-SLK treatment in a mouse PAH model Objective: To evaluate the therapeutic effect of saRNA-SLK gene therapy on PAH in vivo.
[0132] method: PAH Model and Grouping: A PAH model was established using male C57BL / 6 mice. The mice were subcutaneously injected with SU5416 (20 mg / kg, once weekly) and placed in a hypoxic chamber (10% O2) for 4 weeks. One week after modeling, the mice were randomly divided into three groups (n=8): Empty vector control group: lentiviral particles containing saRNA-empty sequences (1×10⁻⁶) were administered via intratracheal nebulization. 11 TU / each).
[0133] Treatment group: lentiviral particles containing the saRNA-SLK sequence (1×10⁻⁶) were administered via intratracheal nebulization. 11 TU / each).
[0134] Efficacy assessment (day 21 after treatment initiation): Hemodynamics and right ventricular hypertrophy: RVSP was measured and RV / (LV+S) was calculated.
[0135] Lung histological analysis: Lung tissue was taken, fixed, embedded, and sectioned. H&E staining was performed, and quantitative analysis of pulmonary arteriolar wall thickness was conducted.
[0136] result: See details Figure 5 Hemodynamics and cardiac remodeling: RVSP and RV / (LV+S) in the treatment group were significantly lower than those in the empty vector control group (p<0.05).
[0137] Pulmonary vascular remodeling: The thickness of the pulmonary arteriole wall in the treatment group mice was significantly lower than that in the empty vector control group.
[0138] Conclusion: Intratracheal nebulization of saRNA-SLK lentivirus effectively targets pulmonary vascular smooth muscle cells, upregulates SLK expression, and significantly alleviates PAH induced by hypoxia in SU5416+ mice, manifested by reduced pulmonary artery pressure, reduced right ventricular hypertrophy, and inhibition of pulmonary vascular remodeling. This demonstrates the effectiveness of the CV309 vector-based saRNA-SLK gene therapy strategy.
[0139] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of this application. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.
[0140] Although embodiments of this application have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting this application. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of this application.
Claims
1. A recombinant gene expression vector, characterized in that, include: The nucleotide sequence encoding saRNA, which is adapted to specifically target and upregulate the expression of the endogenous SLK gene.
2. The recombinant gene expression vector according to claim 1, characterized in that, The saRNA targets the promoter region of the endogenous SLK gene; Preferably, the target region is located within the range of -1000bp upstream to +500bp downstream of the SLK gene transcription start site.
3. The recombinant gene expression vector according to claim 1 or 2, characterized in that, The saRNA targets a specific sequence in the promoter region of the SLK gene; Preferably, the specific sequence comprises a nucleotide sequence as shown in SEQ ID NO: 3; Optionally, the saRNA comprises a sense strand and an antisense strand; Optionally, the sense strand has a nucleotide sequence as shown in SEQ ID NO: 1 or having at least 80% identity with it, and / or the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 2 or having at least 80% identity with it.
4. The recombinant gene expression vector according to claim 1, characterized in that, The sense and antisense strands of the saRNA are each 19-27 nucleotides in length, and each has a 1-4 nucleotide overhang at the 3' end, preferably a UU or dTdT overhang. Optionally, the sense and antisense strands of the saRNA are each 21-23 nucleotides in length independently.
5. The recombinant gene expression vector according to claim 1, characterized in that, The vector contains a promoter, a nucleotide sequence encoding the saRNA, and post-transcriptional regulatory elements; Optionally, the promoter is operatively linked to a nucleotide sequence encoding the saRNA; Optionally, the promoter is a vascular smooth muscle cell-specific promoter; Preferably, the promoter is the EnSm22a promoter, or a fragment or variant that has the same function as the EnSm22a promoter; Optionally, the vector further comprises a miRNA precursor backbone, wherein the sequence of the saRNA is located in the miRNA precursor backbone; Preferably, the miRNA precursor backbone is a mouse or human mir-155 precursor backbone; Optionally, the backbone of the vector is selected from at least one of lentiviral vectors, adeno-associated virus vectors, adenovirus vectors, and liposome complexes; Preferably, the post-transcriptional regulatory element is a post-transcriptional regulatory element of marmot hepatitis virus.
6. The recombinant gene expression vector according to claim 5, characterized in that, The carrier comprises the following expression box elements connected in sequence: (1) EnSm22a promoter; (2) Reporter gene coding sequence; (3) A mir-155 precursor backbone containing the coding sequence of the saRNA; (4) Post-transcriptional regulatory elements of marmot hepatitis virus; and (5) BGH polyA signal sequence; Optionally, the connection order of the elements is as follows: the 3' end of the EnSm22a promoter is connected to the 5' end of the reporter gene coding sequence, the 3' end of the reporter gene coding sequence is connected to the 5' end of the mir-155 precursor backbone, the 3' end of the mir-155 precursor backbone is connected to the 5' end of the marmot hepatitis virus post-transcriptional regulatory element, and the 3' end of the marmot hepatitis virus post-transcriptional regulatory element is connected to the 5' end of the BGH polyA signal sequence.
7. The recombinant gene expression vector according to claim 6, characterized in that, The reporter gene coding sequence is the coding sequence of enhanced green fluorescent protein.
8. A pharmaceutical composition, characterized in that, It comprises the recombinant gene expression vector according to any one of claims 1-7, and pharmaceutically acceptable excipients; Optionally, the dosage form of the pharmaceutical composition is suitable for administration by endotracheal nebulization, endotracheal instillation, or local pulmonary injection.
9. Use of the recombinant gene expression vector according to any one of claims 1-7, or the pharmaceutical composition according to claim 8, in the preparation of a medicament for the prevention and / or treatment of pulmonary hypertension.
10. The use according to claim 9, characterized in that, The drug is used for: (i) Upregulate the expression of the SLK gene in pulmonary vascular smooth muscle cells; (ii) Inhibit the proliferation and / or migration of pulmonary vascular smooth muscle cells; (iii) Reduce pulmonary artery pressure and / or alleviate right ventricular hypertrophy; and / or (iv) Reverse pulmonary vascular remodeling.