A gRNA combination and use thereof in the preparation of a medicament for preventing masld

Abstract

This invention discloses a gRNA combination and its application in the preparation of drugs for the prevention of metabolic-associated fatty liver disease (MASLD). The gRNA combination, when mixed with Cas9 protein, yields an RNP complex, which, when microinjected into mouse zygotes, can breed a stable and heritable mouse strain with TMEM68 gene knockout. Combining lipidomics, transcriptomics, and primary hepatocyte functional verification, the core regulatory role of TMEM68 in hepatic lipid metabolism is revealed for the first time systematically. Experiments demonstrate that TMEM68 deficiency significantly reduces the storage of triglycerides (TAG) in the liver and hepatocytes, decreases lipid droplet formation, and reshapes the metabolic homeostasis of various lipids such as glycerophospholipids, cholesterol esters, and bile acids. Therefore, the gRNA combination of this invention, or the RNP complex obtained by mixing the gRNA combination with Cas9 protein, can be used to prepare drugs for the prevention of MASLD, providing a novel intervention strategy for MASLD prevention with broad application prospects.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a gRNA combination and its application in the preparation of drugs for the prevention of MASLD. Background Technology

[0002] Metabolic-associated fatty liver disease (MASLD), formerly known as non-alcoholic fatty liver disease (NAFLD), is one of the most common chronic liver diseases worldwide, affecting approximately 25-30% of the global population. Its disease spectrum includes simple hepatic steatosis (NAFL), non-alcoholic steatohepatitis (NASH), and can further progress to liver fibrosis, cirrhosis, and even hepatocellular carcinoma (HCC). MASLD is closely associated with metabolic syndromes such as obesity, type 2 diabetes, and insulin resistance, seriously threatening human health.

[0003] The C57BL / 6J strain of mice belongs to the DIO (Diet-induced obesity mouse) mouse family. It is suitable for research or modeling of fatty liver disease. It is sensitive to high-fat diets and is prone to obesity after being fed a high-fat diet. It has wide applications in the preparation of animal models of metabolic-related fatty liver disease induced by a high-fat diet.

[0004] The core pathological feature of MASLD is the abnormal and excessive deposition of triglycerides (TAG) in hepatocytes. Currently, the regulatory mechanisms of hepatic lipid metabolism are a hot research topic. Classical TAG synthesis mainly occurs via the Kennedy pathway, with the final step catalyzed by diacylglycerol acyltransferases (DGAT1 and DGAT2). However, inhibitors targeting DGAT have been limited in clinical trials due to safety or efficacy concerns.

[0005] In recent years, research has discovered an alternative TAG synthesis pathway independent of DGAT. Transmembrane protein 68 (TMEM68) has been identified as a novel acyltransferase capable of catalyzing TAG synthesis in vitro without relying on DGAT1 / 2. However, the specific function, mechanism of action, and potential as a drug target of TMEM68 in hepatic lipid metabolism, particularly in the development and progression of MASLD, remain unclear. Therefore, the development of MASLD-related preventive drugs targeting TMEM68 has significant application value. Summary of the Invention

[0006] The purpose of this invention is to provide a gRNA combination and its application in the preparation of a drug for preventing MASLD.

[0007] Therefore, one objective of this invention is to provide a combination of gRNAs for specifically targeting the TMEM68 gene in CRISPR / Cas9-specific knockout mice. The gRNA combination includes gRNA-A1, gRNA-A2, gRNA-B1, and gRNA-B2. The sequence of gRNA-A1 is shown in SEQ ID NO.1, the sequence of gRNA-A2 is shown in SEQ ID NO.2, the sequence of gRNA-B1 is shown in SEQ ID NO.3, and the sequence of gRNA-B2 is shown in SEQ ID NO.4. The TMEM68 gene is located in the region 3549041..3574853 of chromosome NC_000070.7.

[0008] A second objective of this invention is to provide an RNP complex comprising the aforementioned gRNA and Cas9 protein.

[0009] The third objective of this invention is to provide the application of the above-described gRNA combination or the RNP complex in constructing a TMEM68 gene knockout mouse model; the TMEM68 gene is located in the region 3549041..3574853 of chromosome NC_000070.7.

[0010] The fourth objective of this invention is to provide the application of the above-described gRNA combination or the RNP complex in the prevention of metabolic-associated fatty liver disease.

[0011] The prevention of metabolic-associated fatty liver disease includes reducing the levels of triglycerides (TAG) and / or diglycerides (DAG) in the liver and / or increasing the levels of ether-linked phosphatidylcholine (PC-O) in the liver and / or reducing the levels of cholesterol esters (CE) in the liver and / or regulating bile acid composition, particularly reducing the levels of taurolactone-3-sulfate (TLCA-3-sulfate) and / or lithocholic acid-3-sulfate (LCA-3-sulfate) and / or upregulating the expression of peroxisome proliferator-activated receptor α (PPARα) and its downstream fatty acid oxidation and ketogenic genes and / or reducing the formation and accumulation of lipid droplets in hepatocytes.

[0012] The fifth objective of this invention is to provide a drug for preventing metabolic-related fatty liver disease, characterized in that it comprises the gRNA combination or the RNP complex described above.

[0013] The sixth objective of this invention is to provide a method for constructing a TMEM68 gene knockout mouse model, based on CRISPR / Cas9 gene knockout technology, comprising the following steps:

[0014] 1) Based on the TMEM68 gene sequence, gRNA sequences of the gene to be knocked out in TMEM68 mice were designed and gRNA-A1, gRNA-A2, gRNA-B1, and gRNA-B2 were obtained by in vitro transcription; the TMEM68 gene is located in the region 3549041..3574853 of chromosome NC_000070.7;

[0015] 2) gRNA1, gRNA-A2, gRNA-B1, gRNA-B2 and Cas9 proteins were microinjected into mouse zygotes, and the microinjected zygotes were transplanted into the oviducts of surrogate mother mice.

[0016] 3) The F0 generation mice produced by the surrogate mother mice were first identified by genotype. The F0 generation positive mice were crossed with wild-type mice to obtain F1 generation heterozygous mice. The F1 generation heterozygous mice were crossed to obtain F2 generation mice. The homozygous mice obtained by the second genotype identification are the TMEM68 gene knockout mouse animal model.

[0017] The gRNA-A1 sequence is shown in SEQ ID NO.1, the gRNA-A2 sequence is shown in SEQ ID NO.2, the gRNA-B1 sequence is shown in SEQ ID NO.3, and the gRNA-B2 sequence is shown in SEQ ID NO.4.

[0018] Preferably, the first genotyping identification involves extracting DNA from F0 generation mice and then performing PCR amplification using primer pairs for F1 / R1.

[0019] The sequence of primer F1 is GCTTAACTGCAATAATCACTGTGTG;

[0020] The sequence of primer R1 is GGACATCATACCTGAAGGAGTAGT;

[0021] The amplification product of 492bp indicates a positive F0 generation mouse.

[0022] Preferably, the second genotyping identification involves extracting DNA from F2 generation mice and then performing PCR amplification using primer pairs F1 / R1 and F1 / R2.

[0023] The sequence of primer F1 is GCTTAACTGCAATAATCACTGTGTG;

[0024] The sequence of primer R1 is GGACATCATACCTGAAGGAGTAGT;

[0025] The sequence of primer R2 is TCTGGTATCTTTTCCATCCCATGAA;

[0026] Amplification products of 492 bp indicate F2 generation homozygous mice; amplification products of 492 bp / 695 bp indicate F2 generation heterozygous mice; amplification products of 695 bp indicate F2 generation wild-type mice.

[0027] The seventh objective of this invention is to provide the application of the TMEM68 gene in regulating metabolic-related fatty liver disease; the TMEM68 gene is located in the region 3549041..3574853 of chromosome NC_000070.7.

[0028] The prevention of metabolic-associated fatty liver disease includes reducing the levels of triglycerides (TAG) and / or diglycerides (DAG) in the liver and / or increasing the levels of ether-linked phosphatidylcholine (PC-O) in the liver and / or reducing the levels of cholesterol esters (CE) in the liver and / or regulating bile acid composition, particularly reducing the levels of taurolactone-3-sulfate (TLCA-3-sulfate) and / or lithocholic acid-3-sulfate (LCA-3-sulfate) and / or upregulating the expression of peroxisome proliferator-activated receptor α (PPARα) and its downstream fatty acid oxidation and ketogenic genes and / or reducing the formation and accumulation of lipid droplets in hepatocytes.

[0029] By constructing a TMEM68 gene knockout (Tmem68 KO) mouse model, and combining lipidomics, transcriptomics, and primary hepatocyte function verification, the inventors have for the first time systematically revealed the core regulatory role of TMEM68 in liver lipid metabolism and demonstrated for the first time that TMEM68 functional loss can significantly reduce liver lipid accumulation and reshape the lipid metabolism network.

[0030] Therefore, targeting the TMEM68 gene, this invention provides a gRNA combination and its application in the preparation of drugs for the prevention of metabolic-associated fatty liver disease (MASLD). The gRNA combination and Cas9 protein are mixed to obtain an RNP complex. The gRNA or RNP complex has broad prospects for use in the preparation of drugs for the prevention of MASLD. Attached Figure Description

[0031] Figure 1 This is the PCR verification result of the F1 generation mice of this invention;

[0032] Figure 2 Lipidomics data showing the effect of TMEM68 gene knockout on triglyceride (TAG) content in mouse liver according to this invention;

[0033] Figure 3Oil Red O staining of primary hepatocytes of WT and Tmem68 KO cells in this invention. Figure A is a 20x field of view; Figure B is a 40x field of view; Figure C shows the relative levels of TAG content in primary hepatocytes of WT and Tmem68 KO cells at a 40x field of view.

[0034] Figure 4 The effect of TMEM68 gene knockout on the liver lipidome of mice is shown in Figure A, which includes changes in lipids such as triglycerides (TAG), diglycerides (DAG), phosphatidylcholine (PC), and cholesterol esters (CE).

[0035] Figure 5 To investigate the effects of TMEM68 gene knockout on the mouse liver transcriptome, KEGG pathway enrichment analysis showed significant changes in related pathways such as fatty acid metabolism, and the top 20 differentially enriched KEGG pathways were identified.

[0036] Figure 6 The images show fluorescence staining of lipid droplets in primary hepatocytes from wild-type and Tmem68 KO mice after treatment with the DGAT1 / 2 inhibitor of this invention, illustrating the role of TMEM68 in lipid droplet synthesis. (Blue fluorescence represents cell nuclei, stained with dapi; red fluorescence represents lipid droplets; dark red lipid droplets are stained with the fluorescent dye LipidTOX). Detailed Implementation

[0037] The present invention will be described in detail below with reference to embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples. Any modifications and variations made without departing from the spirit of the present invention should be included within the scope of the present invention. Unless otherwise specified, the experimental materials or reagents used in the following embodiments are all conventional commercially available products.

[0038] The strain of mice used in this invention is named C57BL / 6J-Tmem68. em1C / Cya, strain background: C57BL / 6J (This strain of mice can be induced into an animal model of metabolism-related fatty liver disease by a high-fat diet).

[0039] The feeding conditions for the mice of this invention were as follows: they were fed a high-fat diet (D12492), had free access to water, and were cultured under a light condition of 12 hours of light and 12 hours of darkness, at a temperature of 23-24°C and a humidity of 40-60%.

[0040] Example 1: Construction and Phenotypic Analysis of TMEM68 Gene Knockout Mouse Model

[0041] Experimental methods: Tmem68 knockout (Tmem68 KO) mice were constructed using CRISPR / Cas9 technology.

[0042] Two sets of gRNA target sequences were designed based on the Tmem68 gene sequence (NCBI Gene ID: 72098, GenBank encoding: NM_028097.4, located in the region 3549041..3574853 of chromosome NC_000070.7):

[0043] gRNA-A1:ATCTCATGAGAGGTGCCTAGGGG

[0044] gRNA-A2:GACCTAATCTGCGGATACCAAGG

[0045] gRNA-B1:AATCCAACCCAGCATTGCACTGG

[0046] gRNA-B2:GCTACACCCTACTATCATATTGG

[0047] The main steps include: in vitro transcription of the designed gRNA; mixing the gRNA with Cas9 Nuclease (Vazyme, EN301-01 / 02) to obtain the RNP complex; microinjecting the RNP complex into C57BL / 6J mouse zygotes; transplanting the microinjected zygotes into the oviducts of surrogate mothers; the first generation of mice born to the surrogate mothers are F0 generation mice; extracting tail DNA from F0 generation mice using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (TaKaRa, Code No. 9765); performing PCR amplification using primers F1 / R1; sequencing the product (492 bp indicates an F0 generation positive mouse); crossing F0 generation positive mice with wild-type mice to obtain F1 heterozygous mice (+ / -); extracting tail DNA from F0 generation mice; performing PCR amplification using primers F1 / R1; and sequencing the product for identification. The primers are shown below (5'-3').

[0048] F1: GCTTAACTGCAATAATCACTGTGTG

[0049] R1: GGACATCATACCTGAAGGAGTAGT

[0050] The PCR reaction system included 1 μL of mouse tail genomic DNA, 1 μL of primer F1 (10 μM), 1 μL of primer R1 (10 μM), 12.5 μL of 2×Rapid Taq Master Mix (Vazyme, P222), and 9.5 μL of ddH2O. The PCR reaction conditions are shown in Table 1. Wild-type mouse DNA was used as a negative control (WT, 15088 bp), and ddH2O was used as a blank control. The amplification of a band around 500 bp indicates that the target gene was successfully knocked out in the F1 generation mice. The results are as follows: Figure 1 As shown, mice 12, 14, 21, and 24 tested positive after the target gene was deleted. Mice 12 and 14 were (+ / -) heterozygous male mice of the C57BL / 6J strain; mice 21 and 24 were (+ / -) heterozygous female mice of the C57BL / 6J strain.

[0051] Table 1 PCR reaction conditions

[0052]

[0053] Crossing F1 heterozygous mice yields F2 homozygous mice. Verification was performed using the F1 / R1 primers; if a band (492 bp) was amplified, the Tmem68 gene was successfully knocked out. Verification was performed using the F1 / R2 primers; if a band (695 bp) was amplified, the Tmem68 gene was not successfully knocked out. PCR reaction conditions were the same as in Table 1. The F1 / R2 primers are shown below (5'-3'):

[0054] F1: GCTTAACTGCAATAATCACTGTGTG

[0055] R2:TCTGGTATCTTTTCCATCCCATGAA

[0056] Among them: (- / -) homozygous mice: 492 bp; (+ / -) heterozygous mice: 492 bp and 695 bp; (WT) wild-type mice: 695 bp.

[0057] The (- / -) homozygous mice obtained through verification are the Tmem68 KO mice of this invention.

[0058] Liver tissue was collected from 4-week-old male wild-type (WT) and Tmem68 KO mice.

[0059] Triglyceride assay: The liver TAG content was detected using a tissue triglyceride assay kit.

[0060] Result: As Figure 2As shown, compared with WT mice, there was no significant difference in TAG content between wild-type (WT) and Tmem68 KO mice at week 3. At week 4, the TAG content in the liver of Tmem68 KO mice was significantly reduced (p < 0.001), by about 67.6%.

[0061] Example 2: Isolation, culture and lipid droplet staining of primary hepatocytes

[0062] Experimental Methods: Primary hepatocytes from 4-week-old WT and Tmem68 KO mice were isolated using a two-step collagenase perfusion method. The main steps included anesthetizing the mice and opening the abdominal cavity to expose the liver. Blood was first washed away by perfusion with calcium- and magnesium-free buffer via the portal vein, followed by perfusion with collagenase-containing buffer for cyclic digestion of the liver tissue. The digested liver tissue was minced and filtered to obtain a cell suspension. Cells were purified by centrifugation and washing, and then seeded into adherent culture medium (1640 basal culture medium containing 10% newborn calf serum, 10⁻⁶ mol / L insulin, 10⁻⁶ mol / L dexamethasone, 10 μg / ml Vitamin C, and basal culture medium containing penicillin and streptomycin). After 4 hours, the medium was replaced with growth medium containing bovine serum, and after 24 hours, it was replaced with serum-free hepato-ZYME-SFM medium. After 24 hours of culture, Oil Red O staining was performed, and the cells were observed and photographed under a microscope.

[0063] Result: As Figure 3 As shown, the number of lipid droplets stained red by Oil Red O in primary hepatocytes of Tmem68 KO mice was significantly less than that in WT mice, indicating that TMEM68 deficiency directly leads to a decrease in the ability of hepatocytes to accumulate fat, and replenishment of TMEM68 can significantly restore the number of lipid droplets in KO hepatocytes.

[0064] Example 3: Liver Lipidomics Analysis

[0065] Experimental methods: Liver samples from 4-week-old WT and Tmem68 KO mice (n=4) were collected and subjected to targeted lipidomics analysis by Wuhan Maiwei Metabolic Biotechnology Co., Ltd.

[0066] Result: As Figure 4 As shown, compared with WT, TAG levels in the liver of Tmem68 KO mice decreased by 78%, and diglycerides (DAG) decreased by 42%. Figure 4 A), total cholesterol esters (CE) decreased by 40% ( Figure 4 C), total phosphatidylcholine (PC) decreased by 16% ( Figure 4B), while ether-linked phosphatidylcholine (PC-O) increased by 29%, bile acid composition changed (such as a significant decrease in TLCA-3-sulfate and LCA-3-sulfate), and sphingolipid metabolism was abnormal (HexCer decreased, SM increased). This indicates that TMEM68 regulates multiple lipid metabolisms, systematically restructures the composition of hepatic glycerophospholipids, reduces membrane fluidity, and increases membrane thickness and stability.

[0067] Example 4: Liver Transcriptomic Analysis

[0068] Experimental methods: Liver samples were taken from 4-week-old WT and Tmem68 KO mice (n=4), and transcriptome sequencing (RNA-seq) was performed by Chongqing Qingke Biotechnology. KEGG pathway enrichment analysis was conducted on differentially expressed genes.

[0069] Result: As Figure 5 As shown, the expression of 2006 genes was significantly altered in the liver of Tmem68 KO mice. Differentially expressed genes were significantly enriched in pathways such as fatty acid metabolism, fatty acid degradation, and unsaturated fatty acid biosynthesis. Most genes in these pathways, such as the key transcription factor PPARα and its downstream genes involved in fatty acid oxidation and ketosis (such as Hmgcs2), were downregulated in the liver of Tmem68 KO mice.

[0070] Example 5: Functional Complementarity Experiment of DGAT and TMEM68

[0071] Experimental methods: Primary hepatocytes from WT and Tmem68 KO mice were isolated and treated with DGAT1 inhibitor (T863) and DGAT2 inhibitor (PF-06424439) for 6 hours, respectively. The cells were then stained with HCS LipidTOX (deep red dye) and DAPI, and lipid droplets (red) and cell nuclei (blue) were observed using a laser confocal microscope.

[0072] Result: As Figure 6 As shown, under DGAT1 / 2 dual inhibitor treatment, some lipid droplets remained in WT hepatocytes, while lipid droplets in Tmem68 KO hepatocytes almost completely disappeared. This demonstrates that TMEM68 and DGAT have relatively independent and complementary roles in promoting lipid droplet formation in hepatocytes, and that inhibiting TMEM68 can further enhance the effect of DGAT inhibitors.

[0073] In summary, the above embodiments fully demonstrate that the acyltransferase TMEM68 is a key molecule regulating hepatic lipid metabolism, particularly TAG synthesis. Inhibiting the expression or activity of TMEM68 can significantly reduce hepatic lipid accumulation and improve MASLD-related lipid metabolism disorders. C57BL / 6J TMEM68 gene knockout mice were constructed. After induction with a high-fat diet, the TMEM68 gene knockout mice showed significantly reduced hepatic lipid accumulation compared to wild-type mice. Therefore, this invention provides a gRNA combination. Mixing the gRNA combination with Cas9 protein yields an RNP complex, which can be used to prepare drugs for the prevention of metabolic-associated fatty liver disease.

[0074] The conventional techniques and solutions not described in detail in the above embodiments are all well known in the art, and therefore will not be elaborated upon here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. A combination of gRNAs for specifically targeting the mouse TMEM68 gene in CRISPR / Cas9-specific knockout mice, characterized in that, The gRNA combination includes gRNA-A1, gRNA-A2, gRNA-B1, and gRNA-B2. The sequence of gRNA-A1 is shown in SEQ ID NO.1, the sequence of gRNA-A2 is shown in SEQ ID NO.2, the sequence of gRNA-B1 is shown in SEQ ID NO.3, and the sequence of gRNA-B2 is shown in SEQ ID NO.

4. The TMEM68 gene is located in the region 3549041..3574853 of chromosome NC_000070.

7.

2. An RNP complex, characterized in that, It comprises the gRNA combination of claim 1 and the Cas9 protein.

3. The application of the gRNA combination of claim 1 or the RNP complex of claim 2 in constructing a TMEM68 gene knockout mouse model; wherein the TMEM68 gene is located in the region 3549041..3574853 of chromosome NC_000070.

7.

4. The use of the gRNA combination of claim 1 or the RNP complex of claim 2 in the prevention of metabolic-associated fatty liver disease.

5. A drug for the prevention of metabolic-related fatty liver disease, characterized in that, It comprises the gRNA combination of claim 1 or the RNP complex of claim 2.

6. A method for constructing a TMEM68 gene knockout mouse model, characterized in that, Constructed using CRISPR / Cas9 gene knockout technology, the process includes the following steps: 1) Based on the TMEM68 gene sequence, gRNA sequences of the gene to be knocked out in TMEM68 mice were designed and gRNA-A1, gRNA-A2, gRNA-B1, and gRNA-B2 were obtained by in vitro transcription; the TMEM68 gene is located in the region 3549041..3574853 of chromosome NC_000070.7; 2) gRNA1, gRNA-A2, gRNA-B1, gRNA-B2 and Cas9 proteins were microinjected into mouse zygotes, and the microinjected zygotes were transplanted into the oviducts of surrogate mother mice. 3) The F0 generation mice produced by the surrogate mother mice were first identified by genotype. The F0 generation positive mice were crossed with wild-type mice to obtain F1 generation heterozygous mice. The F1 generation heterozygous mice were crossed to obtain F2 generation mice. The homozygous mice obtained by the second genotype identification are the TMEM68 gene knockout mouse animal model. The gRNA-A1 sequence is shown in SEQ ID NO.1, the gRNA-A2 sequence is shown in SEQ ID NO.2, the gRNA-B1 sequence is shown in SEQ ID NO.3, and the gRNA-B2 sequence is shown in SEQ ID NO.

4.

7. The construction method as described in claim 6, characterized in that, The first genotyping identification involved extracting DNA from F0 generation mice and performing PCR amplification using primer pairs for F1 / R1. The sequence of primer F1 is GCTTAACTGCAATAATCACTGTGTG; The sequence of primer R1 is GGACATCATACCTGAAGGAGTAGT; The amplification product of 492bp indicates a positive F0 generation mouse.

8. The construction method as described in claim 6, characterized in that, The second genotyping identification involved extracting DNA from F2 generation mice and performing PCR amplification using primer pairs F1 / R1 and F1 / R2. The sequence of primer F1 is GCTTAACTGCAATAATCACTGTGTG; The sequence of primer R1 is GGACATCATACCTGAAGGAGTAGT; The sequence of primer R2 is TCTGGTATCTTTTCCATCCCATGAA; Amplification products of 492 bp indicate F2 generation homozygous mice; amplification products of 492 bp / 695 bp indicate F2 generation heterozygous mice; amplification products of 695 bp indicate F2 generation wild-type mice.

9. Application of TMEM68 gene in regulating metabolic-related fatty liver disease; the TMEM68 gene is located in region 3549041..3574853 of chromosome NC_000070.7.

Images