A CD4 + T cell-derived tsrna biomarkers and uses thereof
By screening for the tsRNA biomarker 5'tiRNA-36-PheGAA-8 in CD4+ T cells of MG patients, the problems of missed and misdiagnosed MG diagnosis have been solved, enabling accurate monitoring of disease severity and recurrence, and improving the targeting and sensitivity of diagnosis.
Patent Information
- Application Number
- CN202610826336.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-09
- Publication Date
- 2026-07-10
AI Technical Summary
In the current technology, the diagnosis of myasthenia gravis (MG) relies on subjective description and serum antibody detection, which has problems such as missed diagnosis, misdiagnosis and inability to sensitively reflect changes in the condition. In addition, serum markers lack specificity and targeting, making it difficult to achieve dynamic monitoring.
We provide 5'tiRNA-36-PheGAA-8, a tsRNA biomarker derived from CD4+ T cells. By sequencing the tsRNA of pathogenic CD4+ T cells from MG patients, we can screen for biomarkers that are abnormally elevated in MG patients for disease diagnosis and prediction.
It significantly reduces background noise caused by cellular heterogeneity, provides more reliable data support, improves the targeting and accuracy of MG diagnosis, reduces the misdiagnosis rate, and enables dynamic monitoring of disease severity and recurrence risk.
Smart Images

Figure CN122357718A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and molecular diagnostics, and more specifically, to a CD4... + T cell-derived tsRNA biomarkers and their applications. Background Technology
[0002] Myasthenia gravis (MG) is a common autoimmune disease of the nervous system, clinically manifested as easy fatigue of skeletal muscles, and in severe cases, respiratory muscles are also affected, endangering life.
[0003] Among related technologies, the diagnosis of myocardial infarction (MG) relies on the patient's subjective description and the doctor's experience, which is highly subjective and prone to being missed or misdiagnosed as other diseases when symptoms are atypical. Electrophysiology, on the other hand, is an invasive procedure that causes discomfort to the patient, requires high operational skills, and its results are easily affected by factors such as temperature and electrode position, making it unsuitable as a means of frequent follow-up and dynamic monitoring. Therefore, serum antibody testing is the main method for diagnosing MG. However, some patients have negative serum antibodies, and the correlation between antibody titers and disease severity is poor, failing to sensitively reflect short-term changes in the condition. Furthermore, antibody titers decrease slowly after effective treatment, making it difficult to use for real-time efficacy assessment.
[0004] In addition, some markers in serum, such as MIF and miR-30e-5p, are associated with MG recurrence, but these markers are associated with a variety of diseases such as tumors, infections, and inflammation, and lack specificity; moreover, the test samples are derived from serum, which may be a mixture of products released by cells throughout the body, with a broad source and insufficient targeting.
[0005] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of this disclosure, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention
[0006] The technical objective of this application is to address the above shortcomings by providing a CD4 + T cell-derived tsRNA biomarkers and their applications; this application focuses on purified pathogenic CD4+ from MG patients. + T cell tsRNA sequencing significantly reduced background noise caused by cellular heterogeneity, providing more reliable data support for elucidating the regulatory mechanisms of tsRNA at the level of specific immune cells, and screening for CD4+ in MG patients. + The abnormally elevated expression of biomarkers in T cells facilitates dynamic monitoring of patients.
[0007] To achieve the above objectives, this application provides the following technical solution: According to one aspect of this application, a CD4 is provided.+ T cell-derived tsRNA biomarkers, wherein the biomarkers are derived from CD4 + The phenylalanine tRNA fragment of T cells, wherein the phenylalanine tRNA fragment is 5'tiRNA-36-PheGAA-8, and the nucleotide sequence of the 5'tiRNA-36-PheGAA-8 is shown in SEQ ID NO:5.
[0008] In some embodiments, the 5'tiRNA-36-PheGAA-8 in CD4+ of patients with myasthenia gravis + Its expression is significantly upregulated in T cells.
[0009] According to another aspect of this application, a CD4 is provided. + Application of T cell-derived tsRNA biomarkers in the preparation of products for the diagnosis and / or prediction of myasthenia gravis.
[0010] In some embodiments, the diagnosis is a diagnosis of having myasthenia gravis and / or a diagnosis of the severity of myasthenia gravis.
[0011] In some embodiments, CD4 in myasthenia gravis patients + The relative expression level of 5'tiRNA-36-PheGAA-8 in T cells was significantly higher than that in healthy individuals.
[0012] In some embodiments, CD4 in myasthenia gravis patients + The relative expression of 5'tiRNA-36-PheGAA-8 in T cells was positively correlated with quantitative myasthenia gravis scores, daily living ability scale scores, and 15 items of the myasthenia gravis quality of life scale.
[0013] In some embodiments, the prediction is a prediction of relapse of myasthenia gravis.
[0014] In some embodiments, CD4 in patients with relapsed myasthenia gravis + The relative expression of 5'tiRNA-36-PheGAA-8 in T cells was significantly higher than that in patients with non-relapsed myasthenia gravis.
[0015] Compared with the prior art, the advantages and positive effects of this application are as follows: This application provides purified pathogenic CD4 from MG patients. + T cell tsRNA sequencing significantly reduced background noise caused by cellular heterogeneity, providing more reliable data support for elucidating the regulatory mechanisms of tsRNA at the level of specific immune cells, and screening for CD4+ in MG patients. + The abnormally elevated expression of biomarkers in T cells facilitates dynamic monitoring of patients.
[0016] Furthermore, the biomarker in this application is located on a specific pathogenic CD4+. + It is more targeted in T cells, and it also reveals that upregulated 5'tiRNA-36-PheGAA-8 is associated with disease diagnosis, disease severity and recurrence. By monitoring the expression level of 5'tiRNA-36-PheGAA-8, a convenient and effective biomarker can be provided to reduce the misdiagnosis rate of myasthenia gravis and reduce the risk of disease recurrence. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 The results of tsRNA microarray sequencing in Example 1 of this application are shown.
[0019] Figure 2 This application illustrates CD4 in HC and MG patients in Example 2. + T cell 5'tiRNA-36-PheGAA-8 expression and ROC prediction results.
[0020] Figure 3 This application illustrates CD4 in an MG patient in Example 2. + The expression of T cell 5'tiRNA-36-PheGAA-8 is correlated with clinical scores.
[0021] Figure 4 This application illustrates CD4 levels in patients with remission and relapse of MG in Example 2. + T cell 5'tiRNA-36-PheGAA-8 expression and ROC prediction results. Detailed Implementation
[0022] To better understand the above-mentioned objectives, features, and advantages of this application, the application will be further described below with reference to the accompanying drawings and embodiments. It should be noted that, unless otherwise specified, the embodiments and features described in the embodiments of this application can be combined with each other.
[0023] Myasthenia gravis (MG) is an autoimmune disease caused by autoantibodies attacking postsynaptic membrane antigens (such as acetylcholine receptors) at the neuromuscular junction. Its clinical features include skeletal muscle weakness and easy fatigue, and in severe cases, it can lead to respiratory muscle paralysis.
[0024] Real-time quantitative polymerase chain reaction (q-PCR): a technique that uses fluorescence signals to monitor the DNA amplification process in real time and quantifies specific RNA molecules. In this invention, it is used to detect CD4. + Expression level of 5'tiRNA-36-PheGAA-8 in T cells.
[0025] Receiver Operating Characteristic (ROC) curve: A statistical tool used to evaluate the diagnostic efficacy of biomarkers. It quantifies their ability to distinguish between disease and health status by the area under the curve (AUC). The closer the AUC value is to 1, the higher the diagnostic accuracy.
[0026] Peripheral blood mononuclear cells (PBMCs): A collective term for lymphocytes and monocytes in peripheral blood, which can be separated by density gradient centrifugation and used for further sorting of CD4+. + The raw materials for T cells.
[0027] Quantitative Myasthenia Gravis Scale (QMG Scale): A standardized scale used clinically to quantify the severity of myasthenia gravis in MG patients; a higher score indicates a more severe condition.
[0028] Activities of Daily Living (ADL) score: A scale that assesses a patient’s ability to take care of themselves in daily life and is used to reflect the impact of MG on quality of life.
[0029] The Myasthenia Gravis Quality of Life 15-Item Scale (MG-QOL15 score) is a quality of life assessment tool specifically designed for MG patients. It contains 15 items, and the score is positively correlated with the disease burden.
[0030] Fold of difference (FC): The ratio of gene or RNA expression levels in two groups of samples (e.g., disease group vs. healthy group). In this invention, FC ≥ 1.5 and P < 0.05 are defined as significantly differentially expressed.
[0031] The present application will be further described below with reference to the accompanying drawings and specific embodiments.
[0032] Example 1: CD4 in MG patients + Differential tsRNA screening in T cells.
[0033] 1. Sample collection: Blood samples were collected from the antecubital veins of 5 newly diagnosed MG patients hospitalized in the Department of Neurology of a hospital in Xuzhou and 4 healthy individuals recruited for outpatient physical examinations and matched for gender and age, and placed in EDTA-K2 anticoagulant tubes.
[0034] (1) Inclusion criteria for MG patients: 1) Patients must be ≥18 years old, regardless of gender; 2) Meets the diagnostic criteria for MG in the "2020 Chinese Guidelines for the Diagnosis and Treatment of Myasthenia Gravis": Has typical clinical features of MG (fluctuating skeletal muscle weakness) and meets any one of the following three criteria, including pharmacological features (positive neostigmine test), neurophysiological features (positive low-frequency repetitive electrical stimulation test), and positive serum AChR antibody. At the same time, other diseases such as blepharospasm, chronic progressive extraocular muscle palsy, Graves' ophthalmopathy, motor neuron disease, botulinum toxin poisoning, and Lambert-Eaton myasthenia gravis syndrome must be excluded. 3) The student had not received any immunosuppressive therapy within the three months prior to inclusion in the study; 4) Female patients are not pregnant or breastfeeding.
[0035] (2) Exclusion criteria: 1) Comorbid severe diseases of vital organs such as the heart, kidneys, and liver; other autoimmune diseases; tumors (except thymoma); or hematological diseases; 2) Comorbid metabolic disorders such as diabetes and hyperlipidemia, coronary atherosclerotic heart disease, stroke, etc. 3) History of infection within 3 months prior to inclusion in the study or currently in the acute phase of infection; 4) Use of targeted biological agents such as B-cell therapy within 12 months prior to inclusion in the study; 5) Received IVIG, PLEX, or immunoadsorption therapy within 6 months prior to inclusion in the study; 6) Those with incomplete clinical data.
[0036] This study has been approved by the ethics committee of a hospital in Xuzhou, and all participants have signed informed consent forms.
[0037] 2. Isolation of human peripheral blood mononuclear cells (PBMCs) using Ficoll density gradient centrifugation. 1) Add 5 ml of anticoagulated whole blood to a 15 ml centrifuge tube and dilute with an equal volume of 1X phosphate buffer solution (PBS).
[0038] 2) Take a new 15ml centrifuge tube and add lymphocyte separation solution (the volume ratio of blood diluent to separation solution is 2:1). Slowly add the blood diluent along the inclined tube wall to the top of the lymphocyte separation solution, being careful to avoid mixing the blood and separation solution.
[0039] 3) Centrifuge the mixture of blood and lymphocyte separation solution at room temperature (2000 rpm, 20 minutes, slow rise and slow fall mode).
[0040] 4) After centrifugation, the liquid in the centrifuge tube is divided into 4 layers, from top to bottom: a light yellow plasma layer, a white membrane layer of PBMCs, a lymphocyte separation fluid layer, and a red blood cell and granulocyte layer.
[0041] 5) Carefully aspirate the white membrane layer PBMCs into a new 15ml centrifuge tube, add 10ml of PBS to wash the PBMCs, centrifuge at room temperature, 2000rpm, for 5 minutes. Discard the supernatant and repeat the washing once more.
[0042] 6) After centrifugation, discard the supernatant, add 2 ml of red blood cell lysis buffer, vortex to mix, and place in a 4°C refrigerator for lysis for 15 minutes.
[0043] 7) Add 10ml PBS to stop the red blood cell splitting, centrifuge at room temperature, 2000rpm, for 5 minutes.
[0044] 8) Discard the supernatant, resuspend the cells in 1 ml of 1640 complete culture medium, and mix gently for later use.
[0045] 3. Magnetic bead sorting CD4 + T cells.
[0046] 1) Prepare PBMCs and count the cells.
[0047] 2) Every 10 7 40 cells Cells were resuspended in L-buffered saline.
[0048] 3) Every 10 7 Add 10 cells L CD4 + Mix T Cell Biotin-Antibody Cocktail thoroughly and incubate in a refrigerator (2-8℃) for 5 minutes.
[0049] 4) Every 10 7 A total of 20 cells were added. L CD4 + T Cell MicroBead Cocktail cells were mixed thoroughly and incubated in a refrigerator (2-8℃) for 10 minutes. The cells were washed with buffer, centrifuged at room temperature at 2000 rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended in 500 μL of buffer.
[0050] 5) Place the LS column in a suitable MACS magnetic field and rinse the LS column with 3 ml of buffer.
[0051] 6) Add the cell suspension to the assembled LS column, and collect the flowing cell suspension, which represents the enriched CD4+. + T cells.
[0052] 7) Slowly wash the LS column 3 times with 3ml buffer, collect the cell suspension, centrifuge at 2000rpm for 5 minutes at room temperature, and discard the supernatant; 8) Add 1 ml of Trizol solution, shake thoroughly to mix, and store at -80°C until analysis. 4. tsRNA microarray sequencing and differential tsRNA screening.
[0053] 1) The CD4 counts of 4 healthy controls and 5 MG patients saved during the screening phase were used to determine the optimal CD4 counts for each case. + T-cell samples were sent to Shanghai Kangcheng Biotechnology Co., Ltd. for high-throughput tsRNA sequencing.
[0054] The full-length (SEQ ID NO:1) sequence of the tsRNA microarray probe is as follows: GGGCGGGCGCCAAAAGGCGCCCGCCCGTTCAGTCTAATGCTCTCCTATCCTACTATACGT.
[0055] 2) Differentially expressed tsRNAs were analyzed using the R language package. tsRNAs with an absolute fold change (FC) value ≥ 1.5 and a p-value < 0.05 were defined as significantly expressed. Unsupervised K-means clustering analysis was used to generate heatmaps and volcano plots to visualize the differentially expressed tsRNAs.
[0056] Figure 1 The results of tsRNA microarray sequencing in Example 1 of this application are shown. Figure 1 As shown, the expression levels on the heatmap are represented by different colors, ranging from blue (below average) to red (above average); in the figure, HC1 represents healthy control 1; MG1 represents myasthenia gravis patient 1; and so on, representing sample names. tsRNAs with similar expression patterns are clustered together. Based on the cluster analysis heatmap, the CD4 expression levels of MG patients and healthy controls can be visually reflected. + Significant differences in expression patterns were observed in T cells. Volcano plots provided a visual representation of tsRNA upregulation and downregulation. 584 upregulated and 280 downregulated differentially expressed tsRNAs were identified. Upregulated tsRNAs were indicated in red, and downregulated tsRNAs in green. TsRNAs with no significant difference in expression between the two groups were indicated in gray. The differentially expressed tsRNAs were ranked by fold change. 5'tiRNA-36-PheGAA-8 showed the largest fold change and was upregulated, with a full match (FC) of 15.89 and a p-value <0.001.
[0057] The sequence of 5'tiRNA-36-PheGAA-8 (SEQ ID NO:5) is: GCCAAAATAGCTCAGCTGGGAGAGCATTAGACTGAA.
[0058] Example 2: Validation of CD4 in MG patients + The expression of 5'tiRNA-36-PheGAA-8 in T cells is correlated with disease severity and has predictive value for relapse.
[0059] 1. Validation Cohort Sample Collection: Elbow vein blood was collected from 42 newly diagnosed myasthenia gravis (MG) patients hospitalized in the Department of Neurology of a hospital in Xuzhou and 35 age- and sex-matched healthy outpatients recruited for physical examinations. The venous blood was collected in EDTA-K2 anticoagulant tubes. The inclusion and exclusion criteria for MG patients were the same as in Example 1 and will not be repeated here. Simultaneously, venous blood was collected from 25 patients in remission and 25 patients in relapse and placed in EDTA-K2 anticoagulant tubes. Remission was defined as the absence of MG symptoms or signs; relapse was defined as the recurrence or worsening of one or more MG-related myasthenia gravis symptoms or signs, and an increase of ≥2 points in the MG activities of daily living (ADL) score compared to the previous assessment.
[0060] 2. The PBMCs separation steps are the same as in Example 1.
[0061] 3. CD4 + The T-cell sorting procedure is the same as in Example 1.
[0062] 4. RNA extraction using the Trizol method.
[0063] 1) Incubate the cell suspension containing Trizol at room temperature for 5 minutes to allow the nucleic acid-protein complex to completely separate; 2) Add 200 μL of chloroform to the nuclease-free EP tube containing cell suspension, shake vigorously for 15 seconds, and then let stand at room temperature for 3 minutes. 3) Centrifuge at 12,000 rpm for 15 minutes at 4℃, and transfer 500 μL of the supernatant to another nuclease-free EP tube; 4) Add an equal volume of isopropanol to each tube, mix well, and let stand at room temperature for 10 minutes; 5) Centrifuge at 12,000 rpm for 10 minutes at 4℃, then discard the supernatant; 6) Add 1 ml of 75% ethanol to wash the precipitate; 7) Centrifuge at 10,000 rpm for 5 minutes at 4℃, then discard the supernatant; 8) Allow to air dry at room temperature, then dissolve the RNA in 30-100 μL of nuclease-free water; 9) Determine RNA concentration and A260 / 230 ratio using a UV spectrophotometer to determine RNA purity, and store at -80℃.
[0064] 5. tsRNA reverse transcription reaction.
[0065] The specific steps are as follows, where the 5'tiRNA-36-PheGAA-8 reverse transcription primer sequence (SEQ ID NO:3) is: 5'-GTCTGTATGCTTGTTCTCGTCTCTGTGTCATCCCTCAAGCATACAGACTTCAGTCTAA-3'.
[0066] 1) Prepare the RT reaction system on ice, as shown in Table 1.
[0067] Table 1. Reverse transcription reaction system
[0068] 2) Gently mix and then centrifuge briefly; 3) Incubate at 42℃ for 60 minutes, then incubate at 70℃ for 10 minutes.
[0069] 6. Real-time quantitative PCR reaction.
[0070] The specific steps are as follows: The upstream and downstream primer sequences for U6 are as follows: U6 upstream primer (SEQ ID NO:2): ATTGGAACGATACAGAGAAGATT; U6 downstream primer (SEQ ID NO:6): GGAACGCTTCACGAATTTG.
[0071] The upstream and downstream primer sequences for 5'tiRNA-36-PheGAA-8 are as follows: 5'tiRNA-36-PheGAA-8 upstream primer (SEQ ID NO:4): ATAGCTCAGCTGGGAGAGCA; 5'tiRNA-36-PheGAA-8 downstream primer (SEQ ID NO:7): TATGCTTGTTCTCGTCTCTGTGTC.
[0072] 1) Prepare the qPCR reaction system on ice, as shown in Table 2.
[0073] Table 2. qPCR reaction system
[0074] 2) qPCR reaction program settings, see Table 3.
[0075] Table 3. qPCR reaction procedure
[0076] 3) Use the 2-ΔΔCt calculation method to analyze the expression level of the target gene.
[0077] 7. Data processing and analysis.
[0078] Data analysis and graphing were performed using Graphpad Prism 8 software. Normally distributed continuous data were expressed as mean ± standard deviation (χ² ± s). Independent samples t-tests were used for comparisons between two groups, and rank-sum tests were used for comparisons between non-normally distributed groups. Chi-square tests were used for categorical data. Pearson correlation was used for correlation analysis of normally distributed data. Receiver operating characteristic (ROC) curves were used to assess the predictive value of relative 5'tiRNA-36-PheGAA-8 expression for the diagnosis and recurrence of myocardial infarction (MG). A p-value < 0.05 was considered statistically significant.
[0079] Figure 2 This application illustrates CD4 in HC and MG patients in Example 2. + T cell 5'tiRNA-36-PheGAA-8 expression and ROC prediction results. Figure 2 As shown, CD4 in MG patients + The relative expression level of 5'tiRNA-36-PheGAA-8 in T cells was significantly higher than that in healthy controls (P<0.001). The diagnostic value of 5'tiRNA-36-PheGAA-8 for myocardial infarction (MG) was assessed using ROC curves. Figure 2 As shown, the area under the ROC curve (AUC) reached 0.91 (P<0.001), with a sensitivity of 85.71% and a specificity of 100.00%, indicating good diagnostic ability.
[0080] Figure 3 This application illustrates CD4 in an MG patient in Example 2. + T cell 5'tiRNA-36-PheGAA-8 expression is correlated with clinical scores. For example... Figure 3 As shown, CD4 in MG patients +The relative expression of 5'tiRNA-36-PheGAA-8 in T cells was positively correlated with quantitative myasthenia gravis (QMG) scores, activities of daily living (ADL) scores, and the myasthenia gravis quality of life 15-item scale (MG-QOL15) (r=0.71, P<0.001; r=0.59, P<0.001; r=0.33, P=0.03), suggesting that 5'tiRNA-36-PheGAA-8 could serve as a novel biomarker for assessing disease severity.
[0081] Figure 4 This application illustrates CD4 levels in patients with remission and relapse of MG in Example 2. + T cell 5'tiRNA-36-PheGAA-8 expression and ROC prediction results. Figure 4 As shown, CD4 in relapsed MG patients + The relative expression of 5'tiRNA-36-PheGAA-8 in T cells was significantly higher than that in patients with remission of MG (P<0.001). The predictive value of 5'tiRNA-36-PheGAA-8 for MG relapse was evaluated by ROC curve. The area under the ROC curve (AUC) reached 0.88 (P<0.001), with a sensitivity of 80.00% and a specificity of 84.00%, indicating that it has a good ability to predict disease relapse.
[0082] Through the above specific embodiments, those skilled in the art can easily implement this application. However, it should be understood that this application is not limited to the specific embodiments described above. Based on the disclosed embodiments, those skilled in the art can arbitrarily combine different technical features to achieve different technical solutions.
Claims
1. A CD4 + T cell-derived tsRNA biomarkers, characterized by, The biomarker is derived from CD4. + The phenylalanine tRNA fragment of T cells, wherein the phenylalanine tRNA fragment is 5'tiRNA-36-PheGAA-8, and the nucleotide sequence of the 5'tiRNA-36-PheGAA-8 is shown in SEQ ID NO:
5.
2. A CD4 according to claim 1 + T cell-derived tsRNA biomarkers, characterized by, The 5'tiRNA-36-PheGAA-8 in CD4 of patients with myasthenia gravis + Its expression is significantly upregulated in T cells.
3. A CD4 according to claim 1 + Application of T cell-derived tsRNA biomarkers in the preparation of products for the diagnosis and / or prediction of myasthenia gravis.
4. The application according to claim 3, characterized in that, The diagnosis is a diagnosis of myasthenia gravis and / or a diagnosis of the severity of myasthenia gravis.
5. The application according to claim 4, characterized in that, CD4 in patients with myasthenia gravis + The relative expression level of 5'tiRNA-36-PheGAA-8 in T cells was significantly higher than that in healthy individuals.
6. The application according to claim 4, characterized in that, CD4 in patients with myasthenia gravis + The relative expression of 5'tiRNA-36-PheGAA-8 in T cells was positively correlated with quantitative myasthenia gravis scores, daily living ability scale scores, and 15 items of the myasthenia gravis quality of life scale.
7. The application according to claim 3, characterized in that, The prediction is for the recurrence of myasthenia gravis.
8. The application according to claim 7, characterized in that, CD4 in patients with relapsed myasthenia gravis + The relative expression of 5'tiRNA-36-PheGAA-8 in T cells was significantly higher than that in patients with non-relapsed myasthenia gravis.