A pigeon adenovirus type I and type II differential diagnosis method based on real-time fluorescent quantitative PCR and application

Abstract

This invention relates to the quantitative detection of pigeon adenovirus and the simultaneous differential diagnosis of type I and type II. Specific primers and probes for pigeon adenovirus type I and II are designed using specific gene sequences. Real-time quantitative PCR can accurately detect and differentiate between pigeon adenovirus types I and II. Verification has shown that this technology can rapidly and accurately differentiate between PiAdV-I and PiAdV-II, exhibiting high specificity and sensitivity. Furthermore, it is cost-effective, easy to operate, and suitable for import / export quarantine and specialized laboratories for the detection and differentiation of PiAdV-I and PiAdV-II.

Description

Technical Field

[0001] This invention belongs to the field of animal virus molecular biology detection technology, and relates to a real-time quantitative PCR technique for the differential diagnosis of pigeon adenovirus type I and II. Specific primers and probes are designed targeting the Hexon II gene of pigeon adenovirus type I and II, respectively. Specific amplification is performed to identify the specific virus, establishing a method for the differential diagnosis of pigeon adenovirus type I and II in suspected infected pigeons using a single reaction. This method is highly specific, sensitive, and reproducible. Background Technology

[0002] Pigeon adenovirus (PiAdV) is a common pathogen in pigeon flocks. Due to various factors such as racing pigeon training and cross-regional trade of meat pigeons, the virus has spread widely around the world.

[0003] Pigeon adenovirus infection has a clear seasonality. Although current research has not revealed the mechanism by which season affects pigeon adenovirus infection, epidemiological surveys show that the peak period for infection and onset of the disease is from March to July. Of course, it cannot be ruled out that the infection is caused by the pigeons' bodies being stressed due to extreme mental tension or other factors during high-intensity training. This stress leads to immunosuppression and infection.

[0004] Based on the clinical symptoms of pigeon adenovirus infection, pigeon adenoviruses are classified into two categories: pigeon type I adenovirus (also known as PiAdV-I or classic adenovirus) and pigeon type II adenovirus (PiAdV-II). PiAdV-I mainly infects pigeons under one year old, causing diffuse necrosis of the liver tissue or sudden death, with a mortality rate of 10%–13%. This virus infects 5–6 month old homing pigeons, reducing their feed intake and affecting their racing performance; however, its spread in meat pigeon farms is slower and lasts longer, often resulting in weight loss in infected pigeons, with a disease course lasting up to 3 months and sudden death, with a cumulative mortality rate of approximately 15%. PiAdV-II can infect pigeons of all ages, and compared to PiAdV-I, PiAdV-II has a higher mortality rate and more typical clinical symptoms: widespread liver necrosis or acute death. It has a more severe impact on chicks under one year old, causing growth retardation, vomiting, diarrhea, anorexia, and occasional deaths.

[0005] PiAdV, a contagious pathogen transmitted through contact, is characterized by its wide spread and high morbidity. The virus can be vertically transmitted through pigeon breeding; it can also spread horizontally, primarily via fecal-oral transmission, in intensive pigeon farms or racing lofts. When infected pigeons shed the virus, their feces or feed troughs become contaminated with high concentrations of viral particles, facilitating rapid virus spread in confined spaces. The incubation period for PiAdV infection is 3–5 days, but its transmission is extremely rapid, with viral shedding beginning within 1–2 days after the incubation period, subsequently infecting the entire flock. For racing pigeons, when pigeons are under stress during training or competition, due to weakened immunity or co-infection with other bacteria or viruses, the morbidity rate in young pigeons can reach 100%, with a mortality rate of 2%–6% without intervention. The primary target organ for PiAdV infection is the liver, but the target sequence can also be detected by PCR testing of swabs collected from the pigeon's eyes, upper respiratory tract mucosa, and digestive tract mucosa. Pigeons are not easily infected when they are healthy, but in intensive farming, pigeons often engage in pecking and other behaviors that can damage their skin and mucous membranes, which increases the probability of PiAdV infection.

[0006] Currently, there is a lack of technology for detecting PiAdV on the market, and no method has been found to differentiate between PiAdV-I and PiAdV-II. This technology can fill the market gap in PiAdV detection. Summary of the Invention

[0007] This invention relates to the quantitative detection of pigeon adenovirus and the simultaneous differential diagnosis of type I and type II. Specific primers and probes for pigeon adenovirus type I and II are designed using specific gene sequences. Real-time quantitative PCR can accurately differentiate between pigeon adenovirus type I and type II. Specific primers and probes are designed using the conserved Hexon II gene of pigeon adenovirus type I and II. The probe corresponding to PiAdV-I is modified with Cy5-BHQ2 fluorescence, and the probe for PiAdV-II is labeled with FAM-BHQ1 fluorescence. During detection, the different excitation wavelengths of Cy5 and FAM allow for simultaneous detection and differential diagnosis of PiAdV in the sample. When PiAdV-I is present, PiAdV-I primers specifically amplify it, and the Cy5 fluorescence signal can be detected. The content of PiAdV-I in the sample can be quantitatively detected by calculating the standard curve plotted using the standard plasmid. Similarly, when PiAdV-II is present in the sample being tested, PiAdV-II primers specifically amplify it, and the FAM fluorescence signal can be detected. The content of PiAdV-II in the sample can be quantitatively detected by calculating the standard curve plotted using the standard plasmid.

[0008] Testing and verification have shown that this technology can quickly and accurately differentiate between PiAdV-I and PiAdV-II, and it features high specificity and high sensitivity. Furthermore, the reagent cost is low, and the operation is convenient. It is suitable for import and export quarantine, professional laboratories, and other fields for the detection and identification of PiAdV-I and PiAdV-II. Attached Figure Description

[0009] Figure 1 PiAdV amplification curve and standard curve

[0010] 1A PiAdV amplification curve

[0011] 1B 1-9, PiAdV-I standard plasmid 1×10 12 ~1×10 4 copies·μL -1 Amplification curve and standard curve

[0012] 1C 1-9, PiAdV-Ⅱ standard plasmid 1×10 12 ~1×10 4 copies·μL -1 Amplification curve and standard curve

[0013] Figure 2 PiAdV TaqMan RT-qPCR Specificity Detection

[0014] PiAdV-Ⅱ; 2. PiAdV-I; 3. PiHV; 4. PiCV; 5. Ccontrol

[0015] Figure 3 PiAdV standard plasmid 1×10 0 ~1×10 12 copies·μL -1 TaqMan RT-qPCR Sensitivity Detection

[0016] 3A PiAdV Sensitivity Amplification Curve

[0017] 3B 1-9, PiAdV-I standard plasmid 1×10 12 ~1×10 4 copies·μL -1 ;10-13, 1×10 3 ~1×10 0 copies·μL -1 14. Control

[0018] 3C 1-9, PiAdV-Ⅱ standard plasmid 1×10 12 ~1×10 4 copies·μL-1 ;10-13, 1×10 3 ~1×10 0 copies·μL -1 14. Control

[0019] Figure 4 PiAdV Clinical Sample Testing Detailed Implementation

[0020] The specific test methods described in the examples are merely exemplary descriptions used to elaborate on the present invention, but do not constitute a limitation on the scope of the present invention. Many variations of the present invention are well known to those skilled in the art.

[0021] Example 1 Design Concept

[0022] By analyzing the differences between Hexon II of pigeon adenovirus type I and type II, specific primers and probes were designed for the Hexon II genes of pigeon adenovirus type I and type II, respectively. Through specificity detection, repeatability detection and sensitivity detection, a method for differential diagnosis of pigeon adenovirus type I and type II in infected pigeons was established.

[0023] Example 2: Primer and Probe Design

[0024] The complete genome sequences of pigeon adenovirus type I (FN824512) and pigeon adenovirus type II (KX121164) were obtained from NCBI's GenBank. Hexon II sequences were then compared, and highly specific gene regions were selected for primer and probe design. Primer and probe sequences are shown in Table 1. The highly specific gene sequences are as follows:

[0025] PiAdV-I (FN824512) specific sequence:

[0026] CCGCGAGTCCACTTTCCCCAACTGGCGGGAGGTGACTCCCTCTACGGGAGGATCCGCCAACAATTACATCACGGCACAGCTGAGCAACGTCTACGCGAACGAGGACGGTCAAGAACAGGCGAAAACGGGGGCACAGCTGCAGGCCTTTAGCGCCACGGTGCCCAATCCCAATGCGGGACCGACCCTTACCAACACCGGTGTCAACAACGCCGCCAACAAGAACGAGATCGGCTTCACCGGGAAGATCGCTAAGGTGACAGGCACCGGCCTGACCTACGGCGCCTACGTGCCACCGGTGAACAACCAAGGCGGACAAGCGGTGACGCAGACGGGATACTTCTTGATGGACTCGACAGGCGCAAATTACGAGGGCGCGGTGTCTGTGGAGGACTACAGCACCACGATCGTCTACCCCGACTCCATCTACCTGCCTCCTTCTAACGACGAGAACACCCTCTTCAACGCCGGCGTCAACAAGGGCATGCGACCCAACTACATCGGCTTCCGGGACAACTTCATCAATCTCCTCTACCACGACTCCGGCGTTTGTTCCGGCACGCTCAACTCGGAGCGGTCGGGCATGAACGTGGTGGTAGAGTTGCAGGACAGAAACACGGAACTGAGTTACCAGTACATGTTGGCCGACATGATGAGCCGGCACCACTACTTCGCCCTCTGGAATCAGGCGG

[0027] Specific sequence of PiAdV-II (KX121164):

[0028]

[0029] Table 1 Primer and probe sequences for PiAdV-I and PiAdV-II

[0030]

[0031] Example 3: Construction of Standard Plasmids

[0032] The Hexon II gene sequences of pigeon adenovirus type I (FN824512) and type II (KX121164) were obtained from Genbank of NCBI. Primers with homologous arms of the pCold-N-His vector were designed (see Table 2). The target gene was amplified by PCR using DNA extracted from positive samples as a template. At the same time, the pCold-N-His vector was double-digested according to the designed restriction enzyme sites (KpnⅠ, EcoRI) to obtain the linearized vector fragment. 1.0% agarose gel electrophoresis was performed to recover the vector fragments containing PiAdV-I-HexonII, PiAdV-II-HexonII, and the linearized vector fragments. Homologous recombination was performed between PiAdV-I-HexonII and the linearized vector fragments, and between PiAdV-II-HexonII and the linearized vector fragments. The resulting cells were transformed into DH5α competent cells. Single colonies were picked for Sanger sequencing. The sequencing results showed that the conserved region sequence was consistent with the reference strain sequence, thus completing the construction of the PiAdV-I-HexonII and PiAdV-II-HexonII standard plasmids.

[0033] Table 2 Primer sequences for PiAdV-I and PiAdV-II

[0034]

[0035] Example 4: Establishment of Standard Curve

[0036] The constructed standard plasmid was diluted to a final concentration of 1×10⁻⁶. 3 ~1×10 12 copies·μL -1 Using the diluted plasmid as a template, the corresponding reaction system was prepared according to Table 3, and the reaction was carried out according to the reaction procedure in Table 4. The Ct values ​​were collected, and a standard curve was plotted with the logarithm of the copy number to the base 10 as the ordinate and the detected Ct values ​​as the abscissa and ordinate.

[0037] like Figure 1 As shown, the amplification curve exhibits a standard "S-shaped" curve. The standard curve was plotted using a Bio-Rad fluorescence quantitative instrument. We defined a CT value ≥36 as the negative cutoff value and used a 1×10⁻⁶ standard. 4 ~1×10 12 copies·μL -1The Ct values ​​of the standard plasmids at different concentrations were used as the x-axis to construct a standard curve, and statistical analysis was performed. R 2 A value greater than 0.99 indicates that the established standard curve can be used.

[0038] Table 3 TaqMan RT-qPCR reaction system

[0039] Reagents / Template Volume (μL) TaqProbe 2×qPCR-Multiplex Mastermix 5 PiAdV-IF / R 0.25 / 0.25 PiAdV-I-Probe 0.2 PiAdV-Ⅱ-F / R 0.25 / 0.25 PiAdV-Ⅱ-Probe 0.2 <![CDATA[H2O]]> 2.6 PiAdV-I standard plasmid 0.5 PiAdV-Ⅱ standard plasmid 0.5

[0040] Table 4 TaqMan RT-qPCR reaction program

[0041]

[0042] Example 5 Specificity Test

[0043] Using PiAdV-I, PiAdV-II, PiCV, and PiH standard plasmids constructed in the laboratory as templates, 1×10⁻⁶ plasmids were added. 7 copies·μL -1 Standard plasmids and negative controls were prepared using sterile deionized water as a template. The reaction solution was prepared according to the reaction system in Table 3, and qPCR was performed according to the reaction procedure in Table 4.

[0044] like Figure 2 As shown, only PiAdV-I and PiAdV-II were positive, while the standard plasmid test results for other viruses were negative, proving that the technology has strong specificity.

[0045] Example 6 Sensitivity Test

[0046] Select 1×10 0 ~1×10 12 copies·μL -1 Using standard plasmids as templates, reaction solutions were prepared according to the reaction system in Table 3, and qPCR was performed using the reaction procedure in Table 4. The sensitivity of this technique was evaluated based on Ct values ​​and amplification curves for different copy numbers.

[0047] like Figure 3 As shown, the amplification curve exhibits a standard "S-shaped" curve. We define a CT value ≥36 as the negative threshold, meaning the lowest detectable copy number of PiAdV-I is 1×10⁻⁶. 4 The minimum copy number of PiAdV-II is 1×10⁻⁶. 4 .

[0048] Example 7 Repeatability Test

[0049] With 1×10 7 1×10 9 1×10 11 copies·μL -1Using PiAdV-I-HexonII and PiAdV-II-HexonII standard plasmids as templates, the reaction solution was prepared according to the reaction system in Table 3, and qPCR was performed according to the reaction procedure in Table 4. Repeatability experiments were conducted, with each concentration replicated in triplicate for intra-group repeatability. Simultaneously, detection was performed at three different time points within one week for inter-group repeatability. Statistical analysis was performed on the obtained data, calculating the mean Ct, SD, and CV% to assess intra-group and inter-group repeatability.

[0050] The results of the intra-group repeatability analysis showed that the intra-group differences were between 0.04% and 2.10%, and the results of the inter-group repeatability analysis showed that the inter-group differences were between 0.60% and 2.52%. The results are shown in Table 5, indicating that the multiple detection method of this technology is repeatable and stable.

[0051] Table 5. TaqMan RT-qPCR Repeatability Tests

[0052]

[0053] Example 8: Clinical Sample Test Results

[0054] Twenty-six clinical samples were tested. First, DNA was extracted. Using the extracted DNA as a template, the reaction solution was prepared according to the reaction system in Table 3 (DNA template 0.5 μL, total volume made up to 10 μL with water). qPCR was performed according to the reaction procedure in Table 4.

[0055] The results are shown in Table 6. The TaqMan RT-qPCR method established in this study detected 24 PiAdV-I positive samples, with a positive detection rate of 92.31%; and 9 PiAdV-II positive samples, with a positive detection rate of 34.62%.

[0056] The TaqMan real-time quantitative PCR detection method established in this study can provide technical support for the future clinical identification and detection of PiAdV-I and PiAdV-II strains.

[0057] Table 6. TaqMan RT-qPCR detection of clinical samples

[0058]

[0059]

Claims

1. A differential diagnostic technique for pigeon adenovirus, which is designed according to the Hexon II gene of pigeon adenovirus, and is realized by TaqMan RT-PCR.

2. The pigeon adenovirus Hexon II gene sequence of claim 1.

3. Six nucleic acid molecules, which are designed as one pair of probe and primer for two kinds of pigeon adenovirus respectively.

4. A vector containing the nucleic acid molecule of claim 2.

5. The pigeon adenovirus differential diagnostic technique of claim 1, which comprises a reaction system and reaction conditions.

6. The application of the pigeon adenovirus differential diagnostic technique of claim 1.

Images