Recombinant vector for creating high-arsenic-accumulation engineering rice and application of recombinant vector in arsenic-polluted water body and soil remediation

Abstract

To provide a recombinant vector for creating high-arsenic-accumulation engineering rice and application of the recombinant vector in arsenic-polluted water body and soil remediation.SOLUTION: By selecting a rice OsLsi1 gene promoter pLsi1 to drive expression of a Pteris vittata PvACR3 gene of ciliate in rice, under such driving the PvACR3 protein can transfer arsenic absorbed by rice roots to an above-ground part, and since an expression amount is lower than that of a common constitutive Ubiquitin promoter pUbi, a poisoning phenomenon caused by excessive accumulation of heavy metals can be avoided, a balance between an accumulation amount and tolerance is achieved, and not only an increase in arsenic accumulated in the above-ground part of rice is ensured but also biomass is ensured.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] The present invention relates to the technical field of genetic engineering, in particular to a method for producing engineered rice with high arsenic accumulation. Recombinant vectors and their application to arsenic-contaminated water and soil remediation. [Background technology]

[0002] The problem of arsenic contamination in water and soil has become a global concern. Arsenic in the environment is distributed throughout the food chain. Arsenic-contaminated water and soil may cause toxic and carcinogenic effects in humans through the Soil purification is an urgent need. Existing arsenic-contaminated water treatment technologies mainly include ultrafiltration, precipitation, coagulation, ion exchange, and adsorption technologies. There are physical and chemical methods for treating arsenic-contaminated soil, but they are expensive and depend on certain methods. The techniques mainly include soil leaching, in-situ chemical oxidation and reduction, solidification and stabilization, thermal treatment, and electrochemical However, these methods require a large investment and are expensive. Not only is it difficult to promote large-scale application, but it also has the potential to destroy soil structure and reduce microbial activity. It is important to understand that trace amounts of contaminated soil can lead to a decline in soil fertility and have serious effects on soil health. It cannot be applied to purify large areas of rice paddies. Plant purification technology, which uses hyperaccumulator plants to absorb, convert, and concentrate pollutants, is a new type of environmental Ciliate desert grasses are among the most arsenic-hyperaccumulating plants discovered to date. However, it has a long growth and reproduction cycle and is easily affected by environmental conditions. This drawback limits its application to arsenic contamination remediation. Summary of the Invention

[0003] To solve the above problems, the present invention provides a recombinant vector for producing highly arsenic-accumulating engineered rice. The recombinant vectors described in the present invention are useful for the purification of arsenic-contaminated water and soil. The aboveground parts of engineered rice plants produced by this method have high arsenic accumulation, are highly arsenic tolerant, and have high biomass. It is large, has a short growth cycle, and has mature planting techniques. It is suitable for hydroponic cultivation and for both wet and dry paddy fields. It has the advantages of being economical, quick, simple and effective in reducing and purifying heavy metals in water and soil. Furthermore, harvesting before the hulling period when biomass reaches its maximum shortens the purification cycle. This not only reduces the risk of rice consumption but also avoids the risk of rice consumption. In order to achieve the above objectives, the present invention provides the following technical solutions: The present invention provides a recombinant vector for producing engineered rice with high arsenic accumulation, The recombinant gene is expressed in a plant expression vector containing the pLsi1 promoter and PvACR 3 genes, and the nucleotide sequence of the pLsi1 promoter is SEQ ID NO: .1, and the nucleotide sequence of the PvACR3 gene is set forth in SEQ ID NO.2. is shown. Preferably, the plant expression vector comprises the pSN1301 vector. The present invention provides a primer set for constructing the recombinant vector described in the above technical solution. and a first primer pair and a second primer pair, wherein the sequence of the first primer pair is SEQ The sequences of the second primer pair are shown in SEQ ID NO. 7 and SEQ ID NO. 8. are shown in SEQ ID NO. 9 and SEQ ID NO. 10. The present invention provides a method for constructing a recombinant vector according to the above technical solution, comprising the following steps: Includes: The first PCR amplification was performed using rice total DNA as a template to obtain the pLsi1 promoter. , The second PCR amplification was performed targeting the ciliate desert grass cDNA to obtain the PvACR3 gene; The pLsi1 promoter was inserted into the plant expression vector by double enzyme digestion to form pL Obtaining a transformation vector containing the si1 promoter, The PvACR3 gene was transformed into the pLsi1 gene in the transformation vector by homologous recombination. The recombinant vector is obtained by inserting the fragment downstream of the promoter. Preferably, the primer pair for the first PCR amplification is the primer pair described in the above technical solution. The primer pair for the second PCR amplification comprises the first primer pair in the set, The second primer pair in the primer set described in the solution is included. The present invention relates to a recombinant vector according to the above technical solution, a primer according to the above technical solution, The recombinant vector constructed by the method described in the above technical solution or , and provide applications in creating highly arsenic-accumulating engineered rice. The present invention provides a highly arsenic-accumulating engineered rice, which is obtained by combining the recombinant vector described in the above technical solution with Transgenic recipient rice plants are included. Preferably, the transgenic recipient rice variety is Zhonghua11. include. The present invention relates to a recombinant vector according to the above technical solution, a primer according to the above technical solution, A recombinant vector constructed by the method described in the above technical solution or or the arsenic-contaminated water and / or soil of the hyperarsenic-accumulating engineered rice described in the above technical solutions. Applications in soil purification are provided. The present invention provides a method for remediating arsenic-contaminated water bodies and / or soil, comprising the steps of: : High arsenic-accumulating engineered rice is planted in the water area and / or soil to be purified, and the rice soil is Harvest the top plants. The present invention has the following beneficial effects: The present invention provides a recombinant vector for producing engineered rice with high arsenic accumulation, The recombinant gene is expressed in a plant expression vector containing the pLsi1 promoter and PvACR 3 genes, and the nucleotide sequence of the pLsi1 promoter is SEQ ID NO: .1, and the nucleotide sequence of the PvACR3 gene is set forth in SEQ ID NO.2. The recombinant vector provided by the present invention is a rice root specific promoter. pLsi1 was selected to drive the expression of the ciliate desert grass PvACR3 gene in rice, and its Under stimulation, the PvACR3 protein translocates arsenic absorbed by rice roots to the shoots. The expression level is lower than that of the general constitutive promoter pUbi, so it is difficult to detect heavy metals. It is possible to avoid the poisoning caused by excessive accumulation, achieve a balance between accumulation amount and tolerance, and This ensures an increase in the amount of arsenic accumulated in the above-ground parts of the plant, and also ensures biomass. The engineered rice plants created using vectors have high arsenic accumulation in the aboveground parts and are highly arsenic tolerant. It has a high rate of effective arsenic removal from water and soil, a large biomass, a short growth cycle, and is easy to cultivate. The cultivation technology is mature and suitable for water areas, paddy fields and dry fields. It has a long history of reducing and purifying heavy metals. It has the advantages of being economical, quick, simple and effective. Furthermore, the present invention selects a simple rice harvesting method, and soil arsenic is transported and accumulated in the above-ground parts of rice. By harvesting only the above-ground parts without removing the root stumps, arsenic removal can be achieved, and good crop yields can be achieved. It has business nature. [Brief explanation of the drawings]

[0004] In order to more clearly describe the embodiments of the present invention or the technical solutions in the prior art, the following The accompanying drawings which may be used in the examples will now be briefly described. [Figure 1] Figure 1 shows a flowchart of the pLsi1::PvACR3 transgenic process to generate highly arsenic-accumulating engineered rice. [Figure 2] Electropherogram of pLsi1 promoter and PvACR3 gene amplification. [Figure 3] Schematic diagram of pLsi1::PvACR3 binary expression vector construction. [Figure 4] Quantitative expression diagram of the PvACR3 gene in pUbi::PvACR3 and pLsi1::PvACR3 transgenic plants. [Figure 5] Growth maps and biomass measurements of pLsi1::PvACR3 transgenic plants in contaminated water and soil are shown. [Figure 6] Figure 1 shows the accumulated arsenic content in contaminated water and soil from pLsi1::PvACR3 transgenic plants. [Figure 7] Figure 10. Effective arsenic residues in contaminated soil after remediation of pLsi1::PvACR3 transgenic plants. [Figure 8] pUbi promoter amplification electropherogram. [Figure 9] FIG. 1 is a schematic diagram of the pUbi::PvACR3 binary expression vector construction. [Figure 10] FIG. 1 shows the results of growth of pUbi::PvACR3 transgenic plants in contaminated waters. [Figure 11] FIG. 1 shows the results of pUbi::PvACR3 transgenic plants after two weeks of incubation in contaminated soil. DETAILED DESCRIPTION OF THE INVENTION

[0005] The present invention provides a recombinant vector for producing engineered rice with high arsenic accumulation, The recombinant gene is expressed in a plant expression vector containing the pLsi1 promoter and PvACR 3 genes, and the nucleotide sequence of the pLsi1 promoter is SEQ ID NO: .1, and the nucleotide sequence of the PvACR3 gene is set forth in SEQ ID NO.2. Specifically, the following are shown: SEQ ID NO.1:5'-aagtaaaaccatggttattctgaat ctaaacgatgcttcttcagagaatggttcagggcaccata tcaacttagcagatatcggatggtacacctgacctcaaca tggggtgcttttgctactgcttgatcacagggtagggcct agcattatgccaggaaatgtagttagattcatacacacaa aagtgattaacaagaactacactagtggcctgaggagcgc agacaaaagaagatcaataatcagcgaaggtaattatgcc agcttctggatggatggtgcatctgtgattgattcactga tctgatcgctcactcgtcagctatcttggttccatgcctc tcatgaaaagctaaggggttgcagagaagcgtggattttc ccctcttgtggcctggcctcatgccaatgcgctagtctcat ctcaggcagcacaagctgtcttttcatcctgtagatcgtg caaaataaggtgctggttctaaacgtgccccagaaagcgc tctctgtttgcacatgtgtgtatttagtggtatttttcag taccaatatccatttattttcatttaatttgctttgctcg taaagtagttcttgattctacatgtatacatctacaaagt attgatgagtgctcattacagaaggcatctcaaatcaata aattatctgcatttttgcgaaagaaacctgattgaaacac ctcgtgaacgaaatacctagcaaactctgtaaggcctgag attttcaccaagtcgagtggctgatctgcaacgagctgta ccgatcaaaatatgggttctttcattctttgtgatgtgtg ctgattttccaatcgaaaatcattgtggcaagattttgtc agggcatcgccgtccacactctgctcccccaccggggatg cctaccaagggaagaagaggcgtcataactgccatacact tgtgctgtctacggccatcagagcattgaccatacgggcc tacttcacagaacatgattgacctgtaaaaatcagcttca gactttgagttccgaatcctgttgatttttcattgagttt aattaggagtaggtggcattgctcttcagatgatatgtcg atttctggcattgctctttttaatacaaggtgatgaaaat tcagctgcctgaattggagttttgttttcctgaactgtag tatctgaactctgaagacagttactgatagtggtagtaca agatagtactccctccgttttgaaatgtttgacgccgttg actttttatcacatgtttgatcattcgtcttattcaaaaa atttaagtaattattaattattttcctatcatttgattca ttattaaatatatttttatgtagacatataattttacata tctcacaaaagtttttgaataagacgaacagttaaacatg tgctaaaaagtcaacggtgtcaaacatttcgaactggagg gagtatcctacaggtacagtacggcaaaaaaagaaaaact gaatgtgagctaagctcaatgagagaagctaggattgcaa attgctgaagtactccaactgacatgagatttttcaatag tagcaggtcagttttgacagtgaccatccaagtgcaacgt cctctgctctgacattgcttagcattgctaaccgaagcat gcacactgcgtaatagagtggttaggataaccccttattg taatgtcacctttgcaaatccttaactgctcggatatttc aatttggtcaccagagatggcaatcctacaattgaaaatt tgttcagttgccacggatccatcattaatctggcaatggc ggcaacctctgacagggacaatggcaaattcggccaatag taaatttcggtacggtttatcctagttggcattggcacac atggttcgtctcttctacgagtatagattatgaaaaatgt caacttacaacaggtgacgaatttcgcaaaaaaaacgtat taacattcggcatggaaaacgtacgtagaatgaccaaaaa tatccatccctatagtatcatttctttcaggggagccccc aatctacaaaagaaaaagaatttgttcgtcacccatatat cggcgtcatgacctcgacgtcgcgctttatccaggcatat agtttacaacaccttgtgaattgaaaacccacaattattt cagtctaacagcagacagaggcaacgttgctctcgttgtc gttcacggggggatgacgcgcggttttatgccctcgacga gaatacaaaatcaagtatgcgtttctgtttctcggccaat gctgatccgacaacgtgtttgaacggattaaacaaaatct gaatccccgtcgaaaaattagaccagaaacaatgatctta tgctgattaattagggctaatgagctatgcatgcaagcac tgtacccagtggtgctccgacaagtaggcctgcctaatca aaaggcagtgaggactgtaactactagtacctgcc-3’、 SEQ ID NO.2:5’-atggagaactcaagcgcggagcgga agcagcaactggccctggacattgctgatgggaacgaccc gtccgatgcggcaaaaaaccctgacggcagaactaaactg caagggcttttcaagcagctttcgctgctcgatagatatc tctatgtctggattttcatagtcatggcagtgtccatcat ctttgggtactatgtcaagggtgtgaagaaggcgttccaa gtagcggagataacatccgtttcactacccatcgcaattg ggctgtgggtaatgatgtaccctgtcctatgcaaggtgca gtatgaaattctgggtggggtcttaaggcaagcagggtca ctcaagacaatctcactgagtgttgtgctgaactgggtag taggacccgcactcatgacaggtttagcgtgggcgaccct cccagatttgccagatttccgcactggtgtgatcctggtt ggcatagcacgatgcatagcgatggttctgatttggaatg atctcgcaaaaggagacgctgactattgcgccattctggt ggccatcaattcgattttgcagattatcctgtttactccg gtggcactcttatacctcaaagtggtctcccgaggcaagg gatttcatgtgagctcatggacagtggcaaagagtgtgct ccttttccttggggttccgcttgcggcaggtgttcttaca cgactcatcttgatgaatgcttttgggcggaagtggtacg agtcgaagtttctgcgctttatcggaccttgggctctcat tggtttgctgtacaccatttttgtcatgttctcaattcaa gctcatcagattgttgacaacatagggcatgtggtaagag ttgcagtaccacttcttctgtactttggcattcttttctt tgggtcattgggcatatgtaggtggctgaaggtgccatac ccattgatggtcacacaatgctttacggctgcgagcaaca atttcgagcttgcgattgcagttgcagttggtagctttgg cattgattccacgcaggctcttgctgccacaattggccct cttattgaagtaccggtgctgttgctgttcgtatacatcg ttggcttctttcagaggaaggggccttctgtttag-3'. In the present invention, the plant expression vector preferably comprises the pSN1301 vector. The present invention uses a target gene construction recombinant vector derived from the desert grass of a naturally occurring arsenic hyperaccumulating plant ciliate. We selected the gene PvACR3, which encodes an arsenite transporter protein, and The encoded protein has high transporter efficiency for arsenic and is a target gene The rice root-specific promoter pLsi1 was used as a regulatory element to control expression. This promoter specifically expresses the target gene in rice roots, and the expression level is higher than that of the general It employs a weaker promoter than the constitutive promoter pUbi, allowing downstream target genes to be expressed. By starting the treatment, it is possible to avoid the phenomenon of poisoning caused by excessive accumulation of heavy metals. The present invention provides a primer set for constructing the recombinant vector described in the above technical solution. and a first primer pair and a second primer pair, wherein the sequence of the first primer pair is SEQ The sequences of the second primer pair are shown in SEQ ID NO. 7 and SEQ ID NO. 8. are shown in SEQ ID NO. 9 and SEQ ID NO. 10. The first primer pair specifically amplifies the pLsi1 promoter sequence, and the second primer pair The pair can specifically amplify the PvACR3 gene.

[0006] The present invention provides a method for constructing a recombinant vector according to the above technical solution, comprising the following steps: Includes: The first PCR amplification was performed using rice total DNA as a template to obtain the pLsi1 promoter. , The second PCR amplification was performed targeting the ciliate desert grass cDNA to obtain the PvACR3 gene; The pLsi1 promoter was inserted into the plant expression vector by double enzyme digestion, and pL Obtaining a transformation vector containing the si1 promoter, The PvACR3 gene was transformed into the pLsi1 gene in the transformation vector by homologous recombination. The recombinant vector is obtained by inserting the fragment downstream of the promoter. In the present invention, the primer pair for the first PCR amplification is preferably the first primer pair in the primer set described above, and the primers for the second PCR amplification The pair preferably includes the second primer pair in the primer set described in the above technical solution. . The present invention relates to a recombinant vector according to the above technical solution, a primer according to the above technical solution, The recombinant vector constructed by the method described in the above technical solution or , and provide applications in creating highly arsenic-accumulating engineered rice. The present invention provides a highly arsenic-accumulating engineered rice, which is obtained by combining the recombinant vector described in the above technical solution with In the present invention, the transgenic recipient rice is The recipient rice varieties include Zhonghua 11. The recipient plant was rice variety Zhonghua 11, which was stably Not only are they genetically transformed, but they also have large biomass, short growth cycles, and cultivation techniques. It is mature and has wide adaptability, and has the advantage of being able to be planted in both wet and dry fields. It can be widely used and applied to both dry and wet rice fields in the south and north of China, and therefore contributes to soil purification. It has a wide range of potential applications in the chemical field. The present invention relates to a recombinant vector according to the above technical solution, a primer according to the above technical solution, A recombinant vector constructed by the method described in the above technical solution or or the arsenic-contaminated water and / or soil of the hyperarsenic-accumulating engineered rice described in the above technical solutions. Applications in soil purification are provided. The present invention provides a method for remediating arsenic-contaminated water bodies and / or soil, comprising the steps of: : High arsenic-accumulating engineered rice is planted in the water area and / or soil to be purified, and the rice soil is Harvest the top plants. In this invention, a simple rice harvesting method was selected to prevent arsenic from the soil from being transported and accumulated in the aboveground parts of the rice. By harvesting only the above-ground parts without removing the root stumps, arsenic removal can be achieved. It has good workability and can be harvested before the hulling period when the biomass reaches its maximum. This not only shortens the purification cycle but also avoids the risk of rice consumption. To further illustrate the present invention, the following description, taken in conjunction with the accompanying drawings and examples, provides Recombinant vectors for generating engineered rice with high arsenic accumulation and remediation of arsenic-contaminated soil Although the application to the present invention is described in detail, it should not be construed as limiting the scope of protection of the present invention. There is no.

[0007] Example 1 Cloning of the regulatory element pLsi1 promoter and the arsenic hyperaccumulation gene PvACR3 : The root system of rice Zhonghua 11 seedlings was crushed into powder using liquid nitrogen and then transferred to Novozy The rice OsLsi1 gene was isolated using a total plant DNA extraction kit. The upstream 2500 bp sequence of the gene (SEQ ID NO. 1) was used as a template for amplification of pLsi The promoter was selected as 1, and the upstream and downstream primers were synthesized by Beijing Genomics Institute. , the nucleotide sequence of which is as follows: Upstream primer: 5'-aagtaaaaccatggttattctgaat-3', SEQ ID NO. 3, Downstream primer: 5'-ggcaggtactagtagttacagtcct-3', SEQ ID NO.4. Ciliate desert grass seedlings were ground into powder using liquid nitrogen and then treated with Novozymes Plant Whole RNase. Total RNA was extracted using the A extraction kit and the Novozymes reverse transcription extraction kit. The cDNA sequence of the PvACR3 gene provided by NCBI ( The upstream and downstream primers were designed according to SEQ ID NO. 2. The nucleotide sequence is as follows: Upstream primer: 5'-atggagaactcaagcgcggagc-3', SEQ ID No. 5, Downstream primer: 5'-ctaaacagaaggccccttcctctga-3', SEQ ID NO.6. After primer synthesis, the total DNA from rice roots and the ciliate sand were respectively purified using the KOD high-fidelity enzyme. PCR amplification was performed using the dwarf grass cDNA as a template to obtain pLsi1 and PvACR3. The reaction system for the PCR amplification is as follows: 2x PCR Buffer for KO D 25 μl, dNTP 10 μl, E (KOD×NEO high fidelity enzyme) 1.25 μl, upstream primer 1.25 μl, downstream primer 1.25 μl, template 2 0.5 μl and ddH 2 O 8.75 μl, The PCR amplification reaction procedure is as follows: the law of nature: Pre-denatured at 94°C for 2 min, denatured at 98°C for 30 s, and annealed at 60°C for 10 s. , and elongated at 72°C for 3 min / kb, for a total of 32 cycles, followed by a 10 min reaction at 72°C. 。 The amplification products were subjected to 1% agarose gel electrophoresis to separate the target bands. Electrophoresis of pLsi1 and PvACR3 amplification products using a 1000 μL gel recovery and extraction kit The dynamic diagram is shown in Figure 2. The recovered product was then extracted using the pEASY-Blunt Cloning Kit. The resulting vector was ligated into the pEASYR-Blunt vector and used to express the E. coli receptor Top1 After transformation into 0, monoclonal strains were picked for sequencing and correctly sequenced. The sequenced monoclones were inoculated into LB medium containing ampicillin and incubated at 37°C. After overnight shaking culture, plasmids were extracted using a plasmid mini-extraction kit. Obtain and prepare 19B and PvACR3-19B. Example 2 Construction of heterologous fusion expression binary vector: pSN1301 binary vector containing chaotropic screening genes A born vector was constructed, and a heterologous fusion expression binary vector was further constructed. (1) Obtaining pLsi1 promoter: Contains the Hind III and Sal I digestion junction PCR upstream and downstream primers for the pLsi1 promoter were designed and provided by the Beijing Genomics Institute. The nucleotide sequence is as follows: Upstream primer: 5'-aagcttaagtaaaaccatggttattctga atctaa-3', SEQ ID NO. 7, Downstream primer: 5'-gtcgacggcaggtactagtagttacagtc ctca-3', SEQ ID NO. 8. After primer synthesis, the DNA was amplified using the KOD high-fidelity enzyme with pLsi1-19B as a template. PCR amplification was carried out using the same reaction system and procedure as in Example 1, and 1% agarose was used. Electrophoresis was performed on the fragment, and approximately 2.5 kb was isolated using the All-in-One Gold Gel Recovery and Extraction Kit. A band of the size of 1000 kJ / ml was collected and purified by PCR using Hind III and Sal I enzymes. The material was digested and the digestion products were collected. Construction of pSN1301-pLsi1 backbone vector: Hind III and Sal Digest the pSN1301 vector with 1% agarose gel and perform electrophoresis. The large band of the digested vector was collected and ligated with the prepared Hind III and Sal I digested vector. The pLsi1 digestion product containing the ligation site and the recovered product of the digested vector were ligated overnight with T4 ligase. Gation was performed, and the E. coli receptor Top10 was transformed and monoclonal strains were selected. The correctly sequenced monoclones were then isolated using a plasmid containing kanamycin. The LB medium was inoculated and cultured overnight at 37°C with shaking, and the plaque was extracted using a Plasmid Mini Extraction Kit. The plasmid was extracted and prepared, and the resulting vector plasmid pSN1301-pLsi1 was formed. This is the backbone vector used for transformation. (3) Construction of pSN1301-pLsi1::PvACR3 transformation vector:Xba PCR upstream and downstream fragments of the PvACR3 gene containing the I and KpnI homologous recombination digestion junctions. The primer was designed and synthesized by the Beijing Genome Institute, and its nucleotide sequence is as follows: It is: Upstream primer: 5'-gagaacacgggggactctagaatggagaa ctcaagcgcgc-3', SEQ ID NO. 9, Downstream primer: 5'-gggaaattcgagctcggtaccctaaacag aaggccccttcctc-3',SEQ ID NO.10. After primer synthesis, the KOD high-fidelity enzyme was used to amplify PvACR3-19B as a template. PCR amplification was carried out using the same reaction system and procedure as in Example 1, and 1% agarose was added. Electrophoresis was performed using the All-in-One Gold Gel Recovery and Extraction Kit. The band of size b was collected and prepared. The sudo was double-digested with Xba I and Kpn I, and the digestion products were electrophoresed on 1% agarose gel. The larger fragments are collected and prepared using the All-in-One Gold Gel Collection Kit. pSN13 containing the PvACR3 gene and Xba I and Kpn I fragments Double digestion of the O1-pLsi1 plasmid and extraction of the homologous recombination kit OROIVD R One Step Fusion Cloning Mix The reaction system is as follows: One step fusion cloning mix 5 μl, double-digested linear vector 200 ng, target gene 200 ng, dd H2 After preparing the reaction mixture, gently wipe the plate several times to mix the components. After placing the reaction mixture at 0°C and incubating for 60 minutes, the reaction mixture was cooled on ice and either directly transformed or or stored at -20°C. The homologous recombination product was transformed into E. coli receptor Top10 by thermal excitation, and monoclonal antibodies were isolated. The clone strains were selected and sequenced, and correctly sequenced monoclones were isolated. The cells were inoculated into LB medium containing kanamycin, and cultured overnight at 37°C with shaking. The plasmid was extracted and prepared using a kit, and the resulting recombinant plasmid was transformed into pSN130 1-pLsi1::PvACR3, and the recombination plasmid profile is shown in Figure 3 Correctly sequenced pSN1301-pLsi1::PvACR3 recombinant plasmid ramisud was transformed into Agrobacterium rhizogenes EHA105 by thermal excitation method. Plates containing kanamycin and rifampicin were coated and positive monoclonal antibodies were identified. Select and store Globacterium for preparation. Example 3 pLsi1::PvACR3 rice genetic transformation and identification of transgenic positive seedlings Fixed: The positive monoclonal Agrobacterium selected in Example 2 was cultured in 50 mg / L rifampicin. The strain was inoculated into 5 ml of LB liquid medium containing 100 mg / L kanamycin and cultured overnight. (28℃, 200 rpm). 2 mL of Agrobacterium cultured overnight was taken and diluted to 40 mL. The OD of the bacterial solution was measured by adding 100 ml of fresh culture medium. 600 Repeat twice under similar conditions until the value reaches 0.8. The cultured Agrobacterium was centrifuged at 4000 g for 10 min. The supernatant was removed, and the precipitate was collected and resuspended in 5 mL of MS liquid medium. Contains 0 μM acetosyringone to induce gene activation in the Agrobacterium Vir region This facilitated the entry and integration of Agrobacterium T-DNA into the plant genome. The solution will be used in subsequent gene transformation experiments. At the same time, uniform and full-bodied Zhonghua 11 rice seeds were selected and soaked in 75% alcohol for 3 days. Disinfect for 0 s, then disinfect with 20% sodium hypochlorite for 20 min, and place in healing tissue medium (MS medium + 2.0 mg / L 2,4-D) to induce healing. After one week, the activated tissue was EHA105 Agrobacterium rhizogenes was infiltrated into the healing tissue. M containing L 6-BA, 1.0 mg / L 2,4-D, and 100 μM acetosyringone After inoculating the medium into S medium and co-cultivating it for 3 days in a dark environment, the medium was incubated with 300 mg / L cephalosporin. Wash it with sterile water containing 100mg / L of thaumatinib and then add it to the screening medium (MS medium + 30mg / L thaumatinib). cephalosporin + 500 mg / L cephalosporin + 1.0 mg / L 2,4-D) The transformants were cultured for 1 week and subcultured every 2 weeks. After a few weeks, the untransformed cells died. The transformed resistant healing tissue was then excised and the transformants were able to continue their healing. Transplant the seedlings into differentiation medium (MS medium + 1.0 mg / L 6-BA + 0.2 mg / L NAA). The culture was continued until the seedlings grew. After the seedlings were grown, they were transferred to the seedling induction medium (MS medium + 30 mg / L thaumatin + 600mg / L cephalosporin) and rooting culture was performed. The plants were transplanted into soil and cultivated to obtain transgenic plants. The resulting transgenic plants were screened for three generations by self-crossing at a segregation ratio of 3:1. The T3 generation (referred to as L1 and L2) was obtained as single copy pure line material. After sowing, rice seedlings (wild type is referred to as WT) were ground into powder using liquid nitrogen. Total RNA was extracted from the top and root sections and used in RT-qPCR with the HiScript premix. Reverse transcription using Q Select RT SuperMix for qPCR cDNA was obtained by the above procedure, and PvAC of transgenic plants was isolated using the SYBR method. The R3 gene expression level was identified, and the internal reference gene was OsActin. The timer sequence is as follows: PvACR3-F:5′-atggagaactcaagcgcggagcgga-3′ , SEQ ID NO. 17, PvACR3-R:5′-ctaaacagaaggccccttcctctga-3′ , SEQ ID NO. 18, OsActin-F:5′-gaagatcactgccttgctcc-3′, SEQ ID No. 19, OsActin-R:5′-cgataacagctcctcttggc-3′, SEQ ID No. 20, The identification results are shown in Figure 4. The PvACR3 gene is not expressed in the aboveground tissues of rice. , and was expressed only in rice roots. Example 4 The amount of arsenic removal from polluted water by pLsi1::PvACR3 transgenic rice measurement: The obtained T3 generation positive transgenic plants were transplanted into arsenic-contaminated waters and subjected to hydroponic experiments. The arsenic-containing test water was a 1 / 2 Hoagland trophic water with 5 μM NaAsO2 exogenously added. After transplanting, the rice was hydroponically cultured for 15 days. The growth of the rice at the time of harvest is shown in Figure 5a and Table 1. is shown. Table 1. Biomass (g) of wild-type and transgenic rice in the contaminated waters TIFF2025184769000002.tif30141As can be seen from Figure 5a and Table 1, the transgenic rice showed superior growth in the contaminated water area. showed arsenic resistance. Plant samples were collected, washed thoroughly with tap water and deionized water alternately, and then heated at 105°C for 30 min. The samples were then dried at 65°C until a constant value of 0.0500±0.00 was reached. Weigh out a 0.5g sample and digest it in a graphite digester with 5ml of HNO3 and 2ml of H2O2. The mixture was digested completely at 120°C until clarification was achieved, and then the volume was adjusted to 50 mL. The arsenic accumulation levels in the roots and aboveground parts of wild-type and transgenic rice were detected, respectively. The amount of arsenic removed from the contaminated water was analyzed, and the results are shown in Figure 6a and Table 2. Table 2. Arsenic removal from contaminated water by wild-type and transgenic rice TIFF2025184769000003.tif42135As can be seen from a in Figure 6 and Table 2, the amount of arsenic accumulated in the root tissue of transgenic rice was low. However, the amount of arsenic accumulated in the aboveground tissues was significantly higher than that in the wild control group, and a large amount of arsenic was found in the rice. At the same time, arsenic poisoning is reduced due to low accumulation in the roots, improving the arsenic tolerance of rice. Among them, the aboveground parts of L2 rice had a higher ability to remove arsenic. Example 5 Arsenic removal from contaminated soil by pLsi1::PvACR3 transgenic rice and soil Determination of soil available arsenic residues: The obtained T3 generation positive transgenic plants were transplanted to arsenic-contaminated soil and potted. The test soil was collected from rice paddy soil in Xuzhou City, Jiangsu Province (pH 5.15, total arsenic content 100%). After transplanting the rice, the plant was potted and cultured for 90 days, and before flowering and threshing, The rice growth at harvest is shown in Figure 5b and Table 3. Table 3. Biomass (g) of wild-type and transgenic rice As can be seen from Figure 5b and Table 3, the transgenic rice plants showed better growth in the contaminated soil. showed arsenic resistance. Plant samples were collected, washed thoroughly with tap water and deionized water alternately, and then heated at 105°C for 30 min. The samples were then dried at 65°C until a constant weight was reached. After grinding, the sample was 0.5000±0.00 Weigh out a 0.5g sample and digest it in a graphite digester with 5ml of HNO3 and 2ml of H2O2. The mixture was thoroughly digested at 120°C until clarified, and then the volume was adjusted to 50 mL. The arsenic accumulation levels in the roots and aboveground parts of wild-type and transgenic rice were detected, respectively. The amount of arsenic removed from the contaminated soil was analyzed, and the results are shown in Figure 6b and Table 4. Table 4. Amount of arsenic removed from contaminated soil by wild-type and transgenic rice TIFF2025184769000005.tif40135 As can be seen from Figure 6b and Table 4, the amount of arsenic accumulated in the root tissue of transgenic rice was Although the amount of arsenic accumulated in the aboveground tissues was low, it was significantly higher than that in the wild control group, and a large amount of arsenic was At the same time, the low accumulation in the roots reduces arsenic poisoning, and the arsenic tolerance of rice is improved. Among them, the arsenic removal ability of the aboveground parts of L1 rice was higher. After purification, the potting soil was collected and analyzed by ICP-MS for residual DGT-available arsenic and B The CR stage extractable arsenic content was detected, and the DGT extractable arsenic method was [Sun, Q., Chen, J., Zhang, H., Ding, SM, Li, Z., Wil. Liams, P.N., Cheng, H., Han, C., Wu, L.H., & Zhang, CS Improved diffusive gradient s in thin films (DGT) measurement of tota l dissolved inorganic arsenic in waters and soils using a hydrous zirconium oxide e binding layer. Analytical Chemistry 86 , 3060-3067 (2014)], and the BCR step-extraction method for arsenic extraction is as follows: Pueyo, M., Mateu, J., Rigol, A., Vidal, M., Lopez-Sanchez, JF, & Rauret, G. Use of t he modified BCR three-step sequential ex traction procedure for the study of trac e element dynamics in contaminated soils Environmental Pollution 152, 330-341 (2 008)]. The results are shown in Figure 7 and Table 5. Table 5. Results of DGT available arsenic and BCR stage-extractable arsenic content in soil after different phytoremediation TIFF2025184769000006.tif95168Note: Original soil refers to unpurified soil. As can be seen from Figure 7 and Table 5, the available arsenic concentration in the remediated soil was higher than that in the control soil. significantly decreased. As can be seen from the above results, the present invention is a method for producing a medaka-like medaka-like medaka by using the rice pLsi1 promoter and the desert grass ciliate. Highly arsenic-accumulating engineered rice constructed by heterologous fusion of the PvACR3 gene exhibits enhanced arsenic tolerance Not only does it have the effect of removing arsenic from above ground, but it also has a high arsenic removal effect from the soil. By harvesting the above-ground parts of rice plants, effective treatment of arsenic-contaminated soil can be achieved without removing the root stumps. This is an effective method for remediating arsenic-contaminated soil. Comparative Example 1 Regulatory elements pUbi promoter cloning: Corn seedlings were ground into powder using liquid nitrogen and then incubated with Novozymes Plant Whole Genome Total DNA was extracted using a DNA extraction kit and the maize Ub provided by NCBI. Design pUbi upstream and downstream primers according to the iqutin promoter sequence, and use them in Beijing Ge It was synthesized by NOM Laboratories and its nucleotide sequence is as follows: Upstream primer: 5'-ctgcagtgcagcgtgacccggtcgt-3', SEQ ID NO. 11, Downstream primer: 5'-ctgcagaagtaacaccaaacaacag-3', SEQ ID NO. 12. After primer synthesis, the KOD high-fidelity enzyme was used to amplify the nucleotide sequence of the corn total DNA as a template. pUbi was amplified using the same reaction system and procedure as in Example 1. Isolate the target band by agarose gel electrophoresis and extract with the All-in-One Gold Gel. The kit was used to recover the pUbi amplified product, and the electrophoresis diagram is shown in Figure 8. The product was ligated into the pEASYR-Blunt vector and transfected with E. coli receptor T. Transform into op10, select monoclonal strains, and sequence the correct sequences. The sequenced monoclones were inoculated into LB medium containing ampicillin and incubated overnight at 37°C with shaking. The plasmid was extracted using a plasmid mini-extraction kit and used to obtain pUbi-19B Obtain and prepare. Binary vector construction: (1) Obtaining pUbi promoter: p containing HindIII and BamHI digestion junction PCR upstream and downstream primers for the Ubi promoter were designed and synthesized by the Beijing Genomics Institute. The nucleotide sequence is as follows: Upstream primer: 5'-aagcttctgcagtgcagcgtgaccc-3', SEQ ID NO. 13, Downstream primer: 5'-ggatccctgcagaagtaacaccaaacaac ag-3', SEQ ID NO. 14. After primer synthesis, the KOD high-fidelity enzyme was used to amplify the DNA using pUbi-19B as a template. PCR amplification was carried out (the reaction system and reaction procedure were the same as in Example 1), and electrophoresis was carried out with 1% agarose. After electrophoresis, a fragment of approximately 2.0 kb was extracted using the All-in-One Gold Gel Recovery and Extraction Kit. The band was recovered and the PCR recovered product was digested with HindIII and BamHI. The digestion products were collected. Construction of pSN1301-pUbi backbone vector: Hind III and BamHI The pSN1301 vector was digested with 1% agarose gel electrophoresis. Recover the large band digested vector and prepare a HindIII and BamHI digestion junction. The pUbi digestion product containing the vector and the recovered product were ligated overnight with T4 ligase. The vector was then transformed into E. coli receptor Top10, and monoclonal strains were selected and sequenced. The correctly sequenced monoclones were cultured in LB medium containing kanamycin. The medium was inoculated and cultured overnight at 37°C with shaking, and the plasmodial mini-extraction kit was used to extract the plasmodialial microorganisms. The resulting vector plasmid pSN1301-pUbi was transformed This is the backbone vector used for (3) Construction of pSN1301-pUbi::PvACR3 transformation vector:BamHI PCR upstream and downstream primers for the PvACR3 gene containing the KpnI and KpnI homologous recombination digestion junctions The nucleotide sequence of the ... the law of nature: Upstream primer: 5'-gtgttacttctgcagggatccatggagaa ctcaagcgcgg-3',SEQ ID NO.15, Downstream primer: 5'-gggaaattcgagctcggtaccctaaacag aaggccccttcctc-3',SEQ ID NO.16. After primer synthesis, the KOD high-fidelity enzyme was used to amplify PvACR3-19B as a template. PCR amplification was carried out using the same reaction system and procedure as in Example 1, and 1% agarose was added. Electrophoresis was performed using the All-in-One Gold Gel Recovery and Extraction Kit. The band of size b was collected and prepared. was double-digested with BamHI and KpnI, and the digested products were electrophoresed on 1% agarose gel. The large fragments are collected and prepared using the All-in-One Gold Gel Collection Kit. The pSN1301-pUbi fragment contains the PvACR3 gene and is cloned with BamHI and KpnI. The ramified homologous recombination product was double digested (the method was the same as in Example 2). The E. coli receptor Top10 was transformed by the cloning method, and monoclonal strains were selected and sequenced. The correctly sequenced monoclones were cultured in LB medium containing kanamycin. The medium was inoculated and cultured overnight at 37°C with shaking, and the plasmid was extracted using the Plasmid Mini Extraction Kit. The resulting recombinant plasmid was named pSN1301-pUbi::PvA CR3, and the recombinant plasmid profile is shown in Figure 9. The cloned pSN1301-pUbi::PvACR3 recombinant plasmid was purified by thermal excitation. Transformed into Agrobacterium rhizogenes EHA105 and treated with kanamycin and rifampin The plate containing the antibody is coated with the antibody, and positive monoclones are selected and stored. Comparative Example 2 Genetic transformation of pUbi::PvACR3 rice and identification of transgenosis-positive seedlings The method was the same as in Example 3, except for the following points: The positive monoclonal Agrobacterium selected in Comparative Example 1 was placed in the The identification results are shown in Figure 4. The PvACR3 gene was expressed in both the shoots and roots of rice. In addition, the expression of pUbi::PvACR3 in the roots of transgenic rice plants was The expression level of PvACR3 in pLsi::PvACR3 transgenic rice roots was It was significantly higher than the expression level of PvACR3. Comparative Example 3 Growth of pUbi::PvACR3 transgenic rice plants in arsenic-contaminated waters: The resulting T3 generation pUbi::PvACR3-positive transgenic plants were germinated for 3 days. After that, they were transferred to 1 / 2 Hoagland's nutrient solution containing 5 μM and 20 μM NaAsO2. The plants were hydroponically treated for 5 days. After 15 days, photographs were taken and the phenotypes were recorded. The results are shown in Figure 10. pUbi::PvACR3 transgenic rice showed significant growth inhibition in arsenic-containing waters was done. Comparative Example 4 Growth of pUbi::PvACR3 transgenic rice plants in arsenic-contaminated soil: The T3 generation positive transgenic plants obtained in Comparative Example 2 were transplanted into actual arsenic-contaminated soil. The test soil was collected from Xuzhou City, Jiangsu Province (pH 5 15, total arsenic content 38.51 mg / kg). Transgenic rice in the contaminated soil After two weeks of growth, the plants showed signs of withering due to poisoning (Figure 11). As can be seen from the results of Comparative Examples 2 to 4, the ubiquitous expression promoter pUbi was By overexpressing the vACR3 gene, large amounts of arsenic accumulate in rice, preventing arsenic levels from exceeding the standard value. In the case of soil with poor soil, obvious poisoning deaths were already observed at the seedling stage. The rice material constructed with the pUbi promoter driving the PvACR3 gene was It cannot be applied to the purification of polluted water bodies and soil. In this study, we selected the rice root-specific weak promoter pLsi1 to transduce the PvACR3 gene. The gene was expressed in rice, and under its action, arsenic absorbed by the rice roots was transported to the aboveground part. However, the expression level of the PvACR3 gene was higher than that of the strong promoter pUbi. The amount of arsenic accumulated in the aboveground part of rice and the biomass of rice plants are low, and the balance between accumulation and tolerance is achieved. The high arsenic accumulation engineered rice will reduce and purify soil heavy metals. It has the advantages of being economical, fast, simple and effective. . Although the present invention has been described in detail with reference to the above embodiments, these are merely some of the embodiments of the present invention. Not all embodiments are possible, but those skilled in the art will be able to implement other embodiments according to the present invention without creative work. All of these embodiments are within the scope of protection of the present invention. do.

[0008] [Sequence table] <st26sequencelisting dtdversion="V1_3" filename="高ヒ素蓄積性工学イネを作成する ための組換えベクターおよびヒ素汚染水域·土壌浄化への応用.xml" softwarename="WIPO Sequence" softwareversion="2.2.0" productiondate="2025-02-21"> <applicationidentification> <ipofficecode> JP< / ipofficecode> <applicationnumbertext / > <filingdate / > < / applicationidentification> <applicantfilereference> Institute of Soil Science, Chinese Academy of Sciences < / applicantfilereference> <earliestpriorityapplicationidentification> <ipofficecode> CN< / ipofficecode> <applicationnumbertext> 202410732604.9< / applicationnumbertext> <filingdate> 2024-06-07< / filingdate> < / earliestpriorityapplicationidentification> <applicantname languagecode="ja"> Nanjing Soil Institute, Chinese Academy of Sciences< / applicantname> <applicantnamelatin> Institute of Soil Science, Chinese Academy of Sciences < / applicantnamelatin> <inventiontitle languagecode="ja">Recombinant vectors for the generation of engineered rice with high arsenic accumulation Application to purification of water and soil contaminated with tar and arsenic< / inventiontitle> <sequencetotalquantity> 20< / sequencetotalquantity> <sequencedata sequenceidnumber="1"> <insdseq> <INSDSeq_length> 2500< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..2500< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q5"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> aagtaaaaccatggttatctgaatctaaacgatgcttcttcagagaatggttcagggcaccatatcaacttagcagata tcggatggtacacctgacctcaacatggggtgcttttgctactgcttgatcacagggtagggcctagcattatgccagga aatgtagttagattcatacacacaaaagtgattaacaagaactacactagtggcctgaggagcgcagacaaaagaagatc aataatcagcgaaggtaattatgccagcttctggatggatggtgcatctgtgattgattcactgatctgatcgctcactc gtcagctatcttggttccatgcctctcatgaaaagctaaggggttgcagagaagcgtggattttccctcttgtggcctgg cctcatgccaatgcgctagtctcatctcaggcagcacaagctgtcttttcatcctgtagatcgtgcaaaataagtgctg gttctaaacgtgccccagaaagcgctctctgtttgcacatgtgtgtatttagtggtatttttcagtaccaatatccattt attttcatttaatttgctttgctcgtaaagtagttcttgattctacatgtatacatctacaaagtattgatgagtgctca ttacagaaggcatctcaaatcaataaattatctgcatttttgcgaaagaaacctgattgaaacacctcgtgaacgaaata cctagcaaactctgtaaggcctgagattttcaccaagtcgagtggctgatctgcaacgagctgtaccgatcaaaatatgg gttctttcattctttgtgatgtgtgctgattttccaatcgaaaatcattgtggcaagattttgtcagggcatcgccgtcc acactctgctcccccaccggggatgcctaccaagggaagaagaggcgtcataactgccatacacttgtgctgtctacggc catcagagcattgaccatacgggcctacttcacagaacatgattgacctgtaaaaatcagcttcagactttgagttccga atcctgttgatttttcattgagtttaattaggagtaggtggcattgctcttcagatgatatgtcgatttctggcattgct ctttttaatacaaaggtgatgaaaattcagctgcctgaattggagttttgttttcctgaactgtagtatctgaactctgaa gacagttactgatagtggtagtacaagatagtactccctccgttttgaaatgtttgacgccgttgactttttatcacatg tttgatcattcgtcttattcaaaaaatttaagtaattattaattattttcctatcatttgattcattattaaatatattt ttatgtagacatataattttacatatctcacaaaagtttttgaataagacgaacagttaaacatgtgctaaaaagtcaac ggtgtcaaacatttcgaactggagggagtatcctacaggtacagtacggcaaaaaaagaaaaactgaatgtgagctaagc tcaatgagagaagctaggattgcaaattgctgaagtactccaactgacatgagatttttcaatagtagcaggtcagtttt gacagtgaccatccaagtgcaacgtcctctgctctgacattgcttagcattgctaaccgaagcatgcacactgcgtaata gagtggttaggataaccccttattgtaatgtcacctttgcaaatccttaactgctcggatatttcaatttggtcaccaga gatggcaatcctacaattgaaaatttgttcagttgccacggatccatcattaatctggcaatggcggcaacctctgacag ggacaatggcaaattcggccaatagtaaatttcggtacggtttatcctagttggcattggcacacatggttcgtctcttc tacgagtatagattatgaaaaatgtcaacttacaacaggtgacgaatttcgcaaaaaaaacgtattaacattcggcatgg aaaacgtacgtagaatgaccaaaaatatccatccctatagtatcatttctttcaggggagcccccaatctacaaaagaaa aagaatttgttcgtcacccatatatcggcgtcatgacctcgacgtcgcgctttatccaggcatatagtttacaacacctt gtgaattgaaaacccacaattatttcagtctaacagcagacagaggcaacgttgctctcgttgtcgttcacggggggatg acgcgcggttttatgccctcgacgagaatacaaaatcaagtatgcgtttctgtttctcggccaatgctgatccgacaacg tgtttgaacggattaaacaaaatctgaatccccgtcgaaaaattagaccagaaacaatgatcttatgctgattaattagg gctaatgagctatgcatgcaagcactgtacccagtggtgctccgacaagtaggcctgcctaatcaaaaggcagtgaggac tgtaactactagtacctgcc < / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="2"> <insdseq> <INSDSeq_length>1140< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..1140< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q4"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> atggagaactcaagcgcggagcggaagcagcaactggccctggacattgctgatgggaacgacccgtccgatgcggcaaa aaaccctgacggcagaactaaactgcaagggcttttcaagcagctttcgctgctcgatagatatctctatgtctggattt tcatagtcatggcagtgtccatcatctttgggtactatgtcaagggtgtgaagaaggcgttccaagtagcggagataaca tccgtttcactacccatcgcaattgggctgtgggtaatgatgtaccctgtcctatgcaaggtgcagtatgaaattctggg tggggtcttaaggcaagcagggtcactcaagacaatctcactgagtgttgtgctgaactgggtagtaggacccgcactca tgacaggtttagcgtgggcgaccctcccagatttgccagatttccgcactggtgtgatcctggttggcatagcacgatgc atagcgatggttctgatttggaatgatctcgcaaaaggagacgctgactattgcgccattctggtggccatcaattcgat tttgcagattatcctgtttactccggtggcactcttatacctcaaagtggtctcccgaggcaagggatttcatgtgagct catggacagtggcaaagagtgtgctccttttccttggggttccgcttgcggcaggtgttcttacacgactcatcttgatg aatgcttttgggcggaagtggtacgagtcgaagtttctgcgctttatcggaccttgggctctcattggtttgctgtacac catttttgtcatgttctcaattcaagctcatcagattgttgacaacatagggcatgtggtaagagttgcagtaccacttc ttctgtactttggcattcttttctttgggtcattgggcatatgtaggtggctgaaggtgccatacccattgatggtcaca caatgctttacggctgcgagcaacaatttcgagcttgcgattgcagttgcagttggtagctttggcattgattccacgca ggctcttgctgccacaattggccctcttattgaagtaccggtgctgttgctgttcgtatacatcgttggcttctttcaga ggaaggggccttctgtttag < / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="3"> <insdseq> <INSDSeq_length> 25< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..25< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q7"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> aagtaaaaccatggttattctgaat< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="4"> <insdseq> <INSDSeq_length>25< / INSDSeq_length> <INSDSeq_moltype>RNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..25< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q9"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>ggcaggtactagtagttacagtcct< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="5"> <insdseq> <INSDSeq_length> 22< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..22< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q11"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> atggagaactcaagcgcggagc< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="6"> <insdseq> <INSDSeq_length> 25< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..25< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q13"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> ctaaacagaaggccccttcctctga< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="7"> <insdseq> <INSDSeq_length> 35< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..35< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q15"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> aagcttaagtaaaaccatggttattctgaatctaa< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="8"> <insdseq> <INSDSeq_length>33< / INSDSeq_length> <INSDSeq_moltype>RNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..33< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q17"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>gtcgacggcaggtactagtagttacagtcctca< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="9"> <insdseq> <INSDSeq_length> 40< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..40< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q19"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gagaacacggggactctagaatggagaactcaagcgcgc< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="10"> <insdseq> <INSDSeq_length> 43< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..43< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q21"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gggaaattcgagctcggtaccctaaacagaaggccccttc< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="11"> <insdseq> <INSDSeq_length> 25< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..25< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q23"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> ctgcagtgcagcgtgacccggtcgt< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="12"> <insdseq> <INSDSeq_length> 25< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..25< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q25"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> ctgfrequencyxfrequency< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="13"> <insdseq> <INSDSeq_length> 25< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..25< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q27"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> aagcttctgcagtgcagcgtgaccc< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="14"> <insdseq> <INSDSeq_length> 31< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..31< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q29"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> ggatccctgcagagtaacaaaacag< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="15"> <insdseq> <INSDSeq_length>40< / INSDSeq_length> <INSDSeq_moltype>RNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..40< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q31"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>gtgttacttctgcagggatccatggagaactcaagcgcgg< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="16"> <insdseq> <INSDSeq_length> 43< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..43< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q33"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gggaaattcgagctcggtaccctaaacagaaggccccttc< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="17"> <insdseq> <INSDSeq_length> 25< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..25< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q35"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> atggaactcaagcgcggagcgga< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="18"> <insdseq> <INSDSeq_length> 25< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..25< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q37"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> ctaaacagaaggccccttcctctga< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="19"> <insdseq> <INSDSeq_length>20< / INSDSeq_length> <INSDSeq_moltype>RNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q39"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>gaagatcactgccttgctcc< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="20"> <insdseq> <INSDSeq_length>20< / INSDSeq_length> <INSDSeq_moltype>RNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q41"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>cgataacagctcctcttggc< / INSDSeq_sequence> < / insdseq> < / sequencedata> < / st26sequencelisting>

[0009]

Claims

1. A recombinant gene and a plant expression vector, wherein the recombinant gene is a pLsi1 promoter and The nucleotide sequence of the pLsi1 promoter is SEQ ID NO: The nucleotide sequence of the PvACR3 gene is shown in SEQ ID NO. The recombinant vector for producing engineered rice with high arsenic accumulation, which is shown in No. 2, Kutar.

2. 2. The method of claim 1, wherein the plant expression vector comprises a pSN1301 vector. The recombinant vector described above.

3. A primer set for constructing the recombinant vector according to claim 1 or 2, a first primer pair and a second primer pair, wherein the sequence of the first primer pair is SEQ ID NO: The sequence of the second primer pair is shown in SEQ ID NO. 7 and SEQ ID NO.

8. The process is characterized in that it is shown in SEQ ID NO. 9 and SEQ ID NO.

10. Rhymer set.

4. A method for constructing a recombinant vector according to claim 1 or 2, comprising: Using rice total DNA as a template, the first PCR amplification was performed to obtain the pLsi1 promoter. and A second PCR amplification was performed targeting the ciliate desert grass cDNA to obtain the PvACR3 gene. Steps and The pLsi1 promoter was inserted into the plant expression vector by double enzyme digestion, and pL obtaining a transformation vector containing the sil promoter; The PvACR3 gene was transformed into the pLsi1 fragment of the transformation vector by homologous recombination. a step of inserting the gene downstream of a promoter to obtain the recombinant vector; A method of construction comprising:

5. The primer pair for the first PCR amplification is the first primer in the primer set according to claim 3 . The primer set according to claim 3, wherein the primer pair for the second PCR amplification comprises a primer pair. The method of claim 4, further comprising a second primer pair in the

6. The recombinant vector according to claim 1 or 2, the primer set according to claim 3, or A recombinant vector constructed by the construction method according to claim 4 or 5, which is capable of accumulating high arsenic. Application in the creation of scientific rice.

7. A method for producing a transgenic rice plant comprising the recombinant vector of claim 1 or 2 and a transgenic recipient rice plant. , and engineered rice characterized by high arsenic accumulation.

8. The transgenic recipient rice variety includes Zhonghua11. The highly arsenic-accumulating engineered rice plant according to claim 7.

9. The recombinant vector according to claim 1 or 2, the primer set according to claim 3, or A recombinant vector constructed by the construction method according to claim 4 or 5, or a recombinant vector constructed by the construction method according to claim 7 or 8.

10. The use of the highly arsenic-accumulating engineered rice according to claim 8 in the remediation of arsenic-contaminated water and / or soil. application.

10. The arsenic-contaminated water area and / or soil based on the highly arsenic-accumulating engineered rice according to claim 7 or 8. A method for purifying soil, comprising: The engineered rice with high arsenic accumulation is planted in the water area and / or soil to be purified, and the rice is then threshed before the threshing stage. A purification method comprising the step of harvesting the above-ground plant parts of the plant.

Images