Oligonucleotides and methods of use thereof for treating neurological diseases

STMN2 oligonucleotides target cryptic exons to inhibit aberrant splicing, increasing functional STMN2 protein expression and mitigating the progression of ALS and FTD.

JP2026002847APending Publication Date: 2026-01-08QURALIS CORP
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2025133172
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-12-18
Filing Date
2025-08-08
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

There are no effective treatments to prevent or slow the progression of neurological diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), which are characterized by the degeneration of motor neurons and loss of functional stathmin 2 (STMN2) protein due to aberrant splicing caused by TDP-43 disruption.

Method used

The use of STMN2 oligonucleotides, specifically targeting cryptic exons in the STMN2 transcript, to inhibit aberrant splicing and promote the expression of functional STMN2 protein.

Benefits of technology

The STMN2 oligonucleotides effectively increase the expression of functional STMN2 protein, restoring neuronal function and potentially slowing the progression of ALS and FTD.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026002847000001_ABST
    Figure 2026002847000001_ABST
Patent Text Reader

Abstract

To provide antisense oligonucleotide sequences and methods of using the same for treating neurological diseases.SOLUTION: Provided is an oligonucleotide comprising linked nucleosides having a sequence of at least 19 contiguous nucleobases, wherein the sequence of nucleobases comprises a portion of at least 10 contiguous nucleobases that is at least 90% complementary to an equal length portion of nucleobases contained at a specified position of a specified sequence.SELECTED DRAWING: Figure 1A
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] cross reference This application is a continuation of U.S. Provisional Patent Application No. 62 / 856,264, filed June 3, 2019; U.S. Provisional Patent Application No. 62 / 914,252, filed October 11, 2019; and Claims benefit of and priority to U.S. Provisional Patent Application No. 62 / 949,817, filed December 18, 2018 The entire disclosures of each of which are hereby incorporated by reference in their entirety for any purpose. To be incorporated.

[0002] Array List This application has been submitted electronically in ASCII format and is hereby incorporated by reference. The above A created on May 29, 2020 contains a sequence listing incorporated in its entirety. The copy of SCII is QRL-002WO _ It is named L.txt and its size is 378 ,978 bytes.

[0003] The present application provides an inhibitor of STMN2 transcripts containing cryptic exons (STMN2). N2 antisense oligonucleotide sequences), and for treating neurological diseases This relates to the method. [Background technology]

[0004] Motor neuron disease affects motor neurons (neurons that control voluntary muscle movements via the brain). Motor neuron diseases are a class of neurological disorders that cause degeneration and death of the nervous system. It can be either autosomal or hereditary, and can also be caused by upper motor neuron and / or lower motor neuron Motor neuron diseases include amyotrophic lateral sclerosis, Gynecologic bulbar palsy, pseudobulbar palsy, primary lateral sclerosis, progressive muscular atrophy, spinal muscular atrophy, and Post-polio syndrome is one example.

[0005] Amyotrophic lateral sclerosis (ALS) affects approximately 15,000 people in the United States. ALS is a group of motor neuron diseases that affect the upper and lower motor neurons. It is characterized by loss of control of voluntary muscles and death. Death is accompanied by muscle spasms and atrophy. Early symptoms of ALS include painful muscle spasms, muscle cramps, muscle weakness, and weakness (e.g., affecting the arms, legs, neck, or diaphragm), slurred nasal voice, and difficulty chewing Difficulty chewing or swallowing; Motor difficulties, such as those required for speaking, eating, and breathing Loss of strength and control eventually occurs. Disease progression may include weight loss, malnutrition, Anxiety and depression may accompany the condition, and pneumonia, painful muscle spasms, neuropathy, and possibly Most individuals diagnosed with ALS experience an increased risk of dementia when symptoms first appear. Death from respiratory failure occurs within five years of receiving treatment. There is no treatment.

[0006] ALS occurs in individuals of any age, but is most prevalent in individuals aged 55-75. ALS is also common, with a slightly higher incidence in men. ALS can occur as either sporadic or familial. Sporadic ALS appears to occur randomly and the total number of cases of ALS Familial ALS accounts for over 90% of cases. Familial ALS accounts for 5-10% of all cases of ALS.

[0007] FTD is caused by the loss of neurons in the frontal and temporal lobes of the brain. FTD refers to a spectrum of progressive neurodegenerative disorders that can cause behavioral and personality changes, FTD is characterized by behavioral and language impairments. vFTD), semantic primary progressive aphasia (svPPA), and non-fluent primary progressive aphasia ALS with FTD may be associated with ALS symptoms such as muscle weakness. along with decreased speech, atrophy, fasciculations, spasticity, muteness (dysarthria), and difficulty swallowing (dysphagia). Individuals with FTD may die within 5-10 years. While ALS with FTD is usually fatal, it can occur within 2-3 years after disease symptoms first appear. often causing death.

[0008] Like ALS, there is no known cure for FTD or ALS with FTD. There are no known treatments that can prevent or slow the progression of the disease.

[0009] Therefore, neurological diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, Plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head injury, spinal cord injury, cortical base Basilar degeneration (CBD), etc., and / or neuropathy, e.g., chemotherapy-induced neuropathy The goal is to identify compounds that can prevent, ameliorate, and treat diseases such as rheumatoid arthropathy. There is an urgent need.

[0010] Transactive response DNA-binding protein 43, an RNA-binding protein (TDP-43) is a fundamental RNAi protein involved in RNA transcription, splicing, and transport. TDP-43 is involved in the A processing activity of TDP-43 itself through binding to the 3' untranslated region. It regulates thousands of pre-messenger RNA / mRNA targets, including autoregulation of mRNAs in G It binds with high affinity to U-rich sequences. Decreased DP-43 levels led to the depletion of over 1,500 RNAs, including long intron-containing transcripts. Altered splicing or expression levels of . Melamed et al., Nat Neurosci. (2019) , 22(2):180-190.

[0011] In affected neurons, in most cases of ALS and in patients with FTD, Cytoplasmic accumulation of TDP-43 and nuclear attrition have been reported in approximately 45% of cases. See Lamed et al., Nat Neurosci. (2019), 22(2):180-190. In addition, TDP- 43 has been shown to regulate the expression of the neuronal outgrowth-related factor stathmin 2. See Melamed (2019); see also Klim et al., Nat Neurosci. (2019), 22(2):167-179 TDP-43 disruption results in a premature (p) transcriptional disruption in intron 1 of stathmin 2 pre-mRNA. remature) polyadenylation and aberrant splicing are promoted, resulting in the formation of mRNA Truncation and loss of functional STMN2 protein have been shown to occur. See Melamed (2019). STMN2 is required for normal motor neuron proliferation and repair. Encodes essential proteins. See Melamed (2019); see also Klim (2019).

[0012] The stathmin 2 gene contains five constitutive exons (Refseq ID: NM_0011 99214.1) and the proposed alternative exons between exons 4 and 5. See Melamed (2019); see also Klim (2019). TDP-4 Loss or mutation of 3 induces a novel spliced ​​exon, This exon maps within intron 1. See Melamed (2019); Klim (2019 See also: This novel exon (referred to as "exon 2a" or "cryptic exon") ) occurs when TDP-43 is depleted or when endogenous TDP-43 has the N352 mutation. It appears in the STMN2 pre-mRNA when the nucleosomes are ligated to the STMN2 domain. See Melamed (2019); Klim (2019) ) Cryptic exons within the STMN2 pre-mRNA are involved in the premature polyadenylation of the pre-mRNA. See Melamed (2019); Klim (20 See also 19). This prematurely polyadenylated RNA contains 227 nucleotides, and its predicted 16 amino acid translation product is located within exon 1. It starts at the normal AUG codon and extends 11 codons into the cryptic exon See Melamed (2019); see also Klim (2019).

[0013] The present invention provides a method for treating a neurological disease or disorder using STMN2 containing a cryptic exon. Inhibitors of the transcript are provided. Summary of the Invention [Means for solving the problem]

[0014] Oligonucleotide inhibitors are described herein. In various embodiments, the oligo Nucleotides are used to treat neurological diseases, including motor neuron disease and / or neuropathy. Transcripts are targeted to treat diseases such as PD, ALS, It can be used to treat FTD and ALS associated with FTD. The oligonucleotide inhibitor is an antisense oligonucleotide. In this condition, oligonucleotide inhibitors target the stathmin 2 (STMN2) transcript. In some embodiments, the STMN2 transcript contains a cryptic exon, e.g., a sequence similar to that in SEQ ID NO: 447. The present invention includes cryptic exons having the sequences specified below.

[0015] SEQ ID NO: 944 or a 19 to 50 consecutive nucleic acid base portion of SEQ ID NO: 944, At least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98%, 99%, or 100%) to equal-length portions of transcripts with identity and at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 9 6%, 97%, 98%, 99%, or 100%) complementary to at least 19 sequences A compound comprising an oligonucleotide containing linked nucleosides having a sequence of consecutive nucleobases. and at least one nucleoside bond of the linked nucleoside is a non-natural bond. Further disclosed herein are compounds of SEQ ID NO: 944, or the 19th consecutive sequence of SEQ ID NO: 944. At least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity For equal length portions of transcripts having at least 90% (e.g., 90%, 91%, 92%) %, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary and a nucleic acid sequence comprising linked nucleosides having a sequence of at least 19 consecutive nucleic acid bases. A oligonucleotide, wherein at least one nucleoside bond of the linked nucleosides is Further disclosed herein are oligonucleotides with non-natural linkages.

[0016] In various embodiments, the nucleobase sequences are SEQ ID NOs: 1-446, 894-91 8, any one of SEQ ID NOs: 945 to 1390, or SEQ ID NOs: 1392 to 1432, etc. and at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%) %, 96%, 97%, 98%, 99%, or 100%) of identity In various embodiments, the sequence of nucleobases comprises a portion of at least 10 consecutive nucleobases. Nos. 1 to 446, SEQ ID NOs. 894 to 918, SEQ ID NOs. 945 to 1390, or SEQ ID NOs. 1392 to 1432 and at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 1 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 containing a portion of 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases nothing.

[0017] In various embodiments, the nucleobase sequences are selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 1 44, 146, 150, 169, 170, 171, 172, 173, 177, 181, 1 85, 197, 203, 209, 215, 237, 244, 249, 252, 380, 3 85, 390, 395, 400, 975, 980, 985, 999, 1088, 1090 , 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125 , 1129, 1141, 1147, 1153, 1159, 1181, 1188, 1193 , 1196, 1324, 1329, 1334, 1339, or 1344 and at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of identity. a portion of at least 10 consecutive nucleobases, wherein at least one of the linked nucleosides In various embodiments, the sequence of nucleobases is Column numbers 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 17 1, 172, 173, 177, 181, 185, 197, 203, 209, 215, 23 7, 244, 249, 252, 380, 385, 390, 395, 400, 975, 98 0, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 1344 and at least 90% (e.g., 9 0%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or or 100%) that share at least 11, 12, 13, 14, 15, 16, A portion of 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases Includes minutes.

[0018] An oligonucleotide containing linked nucleosides having a sequence of at least 19 consecutive nucleic acid bases. A compound comprising leutide, wherein the sequence of nucleic acid bases is SEQ ID NO: 894 to 918 or the sequence For any one equal length portion of numbers 1392 to 1432, at least 90% (e.g. , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% (or 100%) identity to a portion of at least 10 consecutive nucleobases Further disclosed herein are compounds having a sequence of at least 19 consecutive nucleobases. an oligonucleotide comprising linked nucleosides, the sequence of nucleobases of which is SEQ ID NO: For any one of the equal length portions of SEQ ID NOs: 894 to 918 or 1392 to 1432, At least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98%, 99%, or 100%) of identity. Further disclosed herein are oligonucleotides that include portions of consecutive nucleobases. In an embodiment, the sequence of the nucleobases is SEQ ID NO: 894-918 or SEQ ID NO: 1392-1 For any one of 432, at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity Share at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, or 25 consecutive nucleobases.

[0019] An oligonucleotide containing linked nucleosides having a sequence of at least 19 consecutive nucleic acid bases. A compound comprising ribonucleotide, the nucleic acid base sequence of which is selected from positions 121 to 14 of SEQ ID NO: 944. 4, 144-168, 146-170, 150-170, 150-172, 150-17 0, 150-172, 150-174, 169-193, 169-189, 169-19 1, 170-190, 170-192, 171-191, 171-193, 172-19 2, 172-194, 170-194, 171-195, 172-196, 173-19 7, 185-209, 197-221, 237-261, 249-273, 252-27 6, or 276 to 300, for an isometric portion of the nucleic acid bases At least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 9 at least 10 consecutive nucleobases that are complementary to each other (7%, 98%, 99%, or 100%) Further disclosed herein are compounds comprising a portion of the group. Oligonucleotides containing linked nucleosides having a sequence of nucleobases having a sequence of bases The nucleic acid base sequence is at positions 121 to 144, 144 to 168 of SEQ ID NO: 944, 146~170, 150~170, 150~172, 150~174, 169~193, 169-189, 169-191, 170-190, 170-192, 171-191, 171-193, 172-192, 172-194, 170-194, 171-195, 172-196, 173-197, 185-209, 197-221, 237-261, Nucleic acids included in any one of 249 to 273, 252 to 276, or 276 to 300 At least 90% (e.g., 90%, 91%, 92%, 93%) of the base salt isometric portion , 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary, Oligonucleotides comprising a portion of at least 10 consecutive nucleobases are further defined herein. It will be disclosed.

[0020] In various embodiments, the portion of the nucleobase sequence is located at positions 121-14 of SEQ ID NO:944. 4, 144-168, 146-170, 150-170, 150-172, 150-17 4, 169-193, 169-189, 169-191, 170-190, 170-19 2, 171-191, 171-193, 172-192, 172-194, 170-19 4, 171-195, 172-196, 173-197, 185-209, 197-22 1, 237-261, 249-273, 252-276, or 276-300 or 100% complementary to an isometric portion of the nucleobases contained in one of the nucleic acids. A portion of the nucleic acid base sequence is located at positions 144 to 164, 144 to 166 of SEQ ID NO: 944. , 145-167, 146-166, 146-168, 147-165, or 148- 100% complementary to an isometric stretch of nucleobases contained in any one of 168. In various embodiments, the portion of the nucleobase sequence is from positions 173 to 191 of SEQ ID NO: 944, 173~193, 173~195, 173~197, 175~195, 175~197, The isometric portion of the nucleic acid bases in either 177-197 or 179-197 It is 100% complementary to

[0021] In various embodiments, the portion of the nucleobase sequence is from positions 185 to 20 of SEQ ID NO:944. 5, 187-209, 189-209, 185-207, 197-217, 197-21 9, or 100 for the equal length portion of the nucleic acid bases contained in any one of 191 to 209 In various embodiments, the portion of the nucleobase sequence is % complementary to position 944 of SEQ ID NO: 944. Place 237~255, 237~257, 237~259, 239~259, 239~261 , 241–261, 237–257, 249–269, 249–271, 252–272 , 252-274, or 243-261 In various embodiments, the nucleobase sequence is 100% complementary to SEQ ID NO: 94 4 positions 121-144, 144-168, 146-170, 150-170, 150- 172, 150-174, 169-193, 169-189, 169-191, 170- 190, 170-192, 171-191, 171-193, 172-192, 172- 194, 170-194, 171-195, 172-196, 173-197, 185- 209, 197-221, 237-261, 249-273, 252-276, or 2 At least one nucleic acid complementary to an isometric portion of the nucleic acid bases contained in any one of 76 to 300 At least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 2 In various embodiments, the nucleobases include a portion of 3, 24, or 25 consecutive nucleobases. The sequence is represented by positions 144 to 164, 144 to 166, 145 to 167, and 146 of SEQ ID NO: 944. 46-166, 146-168, 147-165, 148-168, 173-191, 1 73~193, 173~195, 173~197, 175~195, 175~197, 1 77-197, 179-197, 185-205, 185-207, 197-217, 1 97-219, 187-209, 189-209, 191-209, 237-255, 2 37-257, 237-259, 239-259, 239-261, 241-261, 2 37~257, 249~269, 249~271, 252~272, 252~274, or 243 to 261 , at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 2 It comprises a portion of 2, 23, 24, or 25 consecutive nucleobases.

[0022] In various embodiments, the oligonucleotides are 19 and 40 nucleotides in length. In various embodiments, the oligonucleotide is a phosphodiester bond, a phospho Thioate bond, alkyl phosphate bond, alkyl phosphonate bond, 3-methoxy Dipropylphosphonate bond, phosphorodithioate bond, phosphotriester bond, alkyl phosphonate bond, amino alkyl phosphotriester bond, alkylene phosphonate thiatolate bond, phosphinate bond, phosphoramidate bond, phosphoramidothiate bond, Phosphorodiamidates (e.g., phosphorodiamidate morpholinos (PMOs)), 3' amino ribose, or 5' aminoribose) linkage, aminoalkylphosphoramidate thiophosphoramidate bond, thionoalkylphosphonate bond, thionoalkyl phosphotriester bond, thiophosphate bond, selenophosphate bond, and boron a phosphate bond, or any combination(s) thereof In various embodiments, the oligonucleotide comprises at least one nucleoside bond. At least two, three, or four internucleoside linkages are phosphodiester internucleoside In various embodiments, the oligonucleotide has at least 2, 3, or 4 It contains two modified internucleoside linkages.

[0023] In various embodiments, each of the modified internucleoside linkages of the oligonucleotide is a phosphorothioate bond, a phosphoramidate bond, a phosphoramidothioate bond, In various embodiments, the oligonucleotides are independently selected from the group consisting of phosphorodiamidates. are phosphorothioate linkages. , phosphorothioate internucleoside linkages can be used in either the Rp configuration or the Sp configuration. In various embodiments, the oligonucleotide is one of , at least one modified nucleobase. In various embodiments, at least one modified The nucleobases are 5-methylcytosine, pseudouridine, or 5-methoxyuridine. be.

[0024] In various embodiments, the oligonucleotide comprises at least one modified sugar moiety. In various embodiments, the modified sugar moiety is 2'-OMe (2'-OCH3 or 2'-O- methyl) modified sugar moiety, bicyclic sugar moiety, 2'-O-(2-methoxyethyl)(2'-O( CH2)2OCH3(2'MOE)), 2'-deoxy-2'-fluoronucleoside, 2'-Fluoro-β-D-arabinonucleoside, Locked Nucleic Acid (LNA), Constrained Ethyl 2'-4'-bridged nucleic acids (cEt), S-cEt, hexitol nucleic acids (HNA), and It is one of the tricyclic analogs (e.g., tcDNA).

[0025] In various embodiments, the oligonucleotide comprises a phosphodiester nucleic acid at the 5' end. Three linked nucleosides linked through internucleoside bonds, and at the 3' end Three linked nucleosides linked through phosphodiester internucleoside linkages In various embodiments, the oligonucleotide comprises a phosphorothioate nucleoside. One or more 2'-O-(2-methoxyethyl) nucleotides linked through interlinkages In some embodiments, the STMN2 antisense oligonucleotides of the present invention comprise All cytosine nucleosides in the nucleoside family contain modified sugar moieties, including 2'-MOE, and all All nucleosides contain the modified nucleobase 5-methylcytosine, and all nucleosides The interosidic linkages are phosphorothioate linkages. The nucleotides are linked at the 5' end through phosphorothioate internucleoside linkages. Three linked nucleosides and a phosphorothioate internucleoside at the 3' end In various embodiments, the oligonucleotide comprises three linked nucleosides joined through a bond. A nucleotide consists of five nucleotides joined through phosphodiester internucleoside bonds. In various embodiments, each of the five linked nucleosides is , 2'-O-(2-methoxyethyl) (2'MOE) nucleosides. In this state, each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methionine). hydroxyethyl (2'MOE) nucleoside.

[0026] In various embodiments, the oligonucleotide is a sequence encoding a full-length STMN2 transcript or a STMN 2 At least 30%, 40%, 50%, 60%, 70%, 80% or In various embodiments, the oligonucleotide comprises a full-length STMN2 exhibit at least a 100% increase in transcript or STMN2 protein. In this embodiment, the oligonucleotide is a sequence encoding the full-length STMN2 transcript or the STMN2 protein. In various embodiments, the oligonucleotide exhibits an increase of at least 200%. exhibits at least a 300% increase in long STMN2 transcript or STMN2 protein. In various embodiments, the oligonucleotide is a full-length STMN2 transcript or a STMN2 In various embodiments, the full-length STMN exhibits at least a 400% increase in protein. Increased expression of TDP43 protein was achieved using TDP43 antisense oligonucleotides. The level of STMN2 in the IL-16 / IL-2 gene is measured relative to the level of the full-length STMN2 protein in the IL-16 / IL-2 gene. In embodiments, the oligonucleotides are selected from the full-length STMN2 transcript or the STMN2 protein. of quality, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, In various embodiments, the oligonucleotides exhibit 90% or 100% rescue. The cryptic exons were present in at least 50%, 60%, 70%, or It presents an 80% or 90% reduction.

[0027] One or more of the oligonucleotides described above, or pharmaceutically acceptable salts thereof Further disclosed herein is a pharmaceutical composition comprising a salt of Treating neurological disorders and / or neuropathy in patients in need thereof A method for placing any of the oligonucleotides described above. or a pharmaceutically acceptable salt thereof, or the above-mentioned pharmaceutical composition to a patient. Further disclosed herein are methods that include the step of:

[0028] In various embodiments, the neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia, FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease , brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head injury, spinal cord injury, and and corticobasal degeneration (CBD). Neuropathy is a chemotherapy-induced neuropathy.

[0029] A method for restoring axonal outgrowth and / or regeneration of neurons, comprising: Any of the above-mentioned oligonucleotides or pharmaceutically acceptable salts thereof or a pharmaceutical composition as described above. Further disclosed are methods for increasing or promoting the expression and / or function of STMN2 in neurons. The method of promoting, stabilizing, or maintaining the growth of cells comprises administering to the cells one of the oligonucleotides described above. Any of the oligonucleotides or pharmaceutically acceptable salts thereof, or the above-mentioned pharmaceutical agents Further disclosed herein are methods that include exposing to the composition. In this study, neurons were identified as being in need of treatment for neurological disorders and / or neuropathy. In various embodiments, the neurological disease is amyotrophic lateral sclerosis (AMLS). (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP) , head trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, the neuropathy is chemotherapy-induced neuropathy.

[0030] In various embodiments, the exposing step is in vivo or ex vivo. In various embodiments, the exposing step is carried out using the STMN disclosed herein. 2 oligonucleotide (STMN2 AON) or a pharmaceutical composition thereof to a patient in need thereof In various embodiments, the method comprises administering an STMN2 oligonucleotide to a patient suffering from the disease. or the pharmaceutical compositions thereof, can be administered topically, parenterally (e.g., subcutaneously, intramuscularly, intradermally, intraduodenal, or or intravenous), intralesional, intrathecal, intracisternal, oral, rectal, buccal, sublingual, intravaginal, intrapulmonary, In various embodiments, the STMN2 receptor is administered intraductally, intranasally, transdermally, or intraduodenally. The oligonucleotide or pharmaceutical composition thereof is administered orally. An effective amount of an STMN2 oligonucleotide or a pharmaceutical composition thereof is administered intrathecally or intracisternally. It is given.

[0031] In various embodiments, the patient is a human. In various embodiments, the pharmaceutical composition is administered topically, intrathecal, intracisternal, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous), Intralesional, oral, intrapulmonary, intratracheal, intranasal, transdermal, intrarectal, buccal, sublingual, intravaginal, or intravenous Suitable for intravenous administration.

[0032] S as described above in the manufacture of a medicament for treating a neurological disease or neuropathy. Use of TMN2 oligonucleotides or pharmaceutically acceptable salts thereof, or pharmaceutical compositions In various embodiments, the neurological condition is a muscle atrophy syndrome. ALS, frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy ( Selected from the group consisting of PSP), head trauma, spinal cord injury, and corticobasal degeneration (CBD) In various embodiments, the neuropathy is chemotherapy-induced neuropathy. do.

[0033] Methods of treating neurological disorders or neuropathy in patients in need thereof a therapeutically effective amount of the STMN2 oligonucleotide or a pharmaceutically acceptable salt thereof and administering the compound, a salt thereof, or a pharmaceutical composition thereof to a patient in need thereof. Methods are further disclosed herein. In various embodiments, the neurological disease is muscle atrophy. ALS, frontotemporal dementia (FTD), Alzheimer's disease (AD), Kinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal degeneration (CBD). In various embodiments, the neuropathy is chemotherapy-induced neuropathy. In various embodiments, the pharmaceutical compositions are administered topically, parenterally (e.g., subcutaneously, intramuscularly, intradermally). intravenous, intralesional, oral, pulmonary, rectal, buccal, sublingual, vaginal, or intravenous In various embodiments, the drug is administered intraductally, intranasally, intracisternally, intrathecally, transdermally, or intraduodenally. In some embodiments, the pharmaceutical composition is administered intrathecally or intracisternally. STMN2 oligonucleotides or pharmaceutical compositions thereof are administered intrathecally or intracisternally. In various embodiments, the patient is a human.

[0034] STMN2 for use as a pharmaceutical in the treatment of neurological diseases or neuropathy Further disclosed herein are oligonucleotides or pharmaceutically acceptable salts thereof. In certain embodiments, the present disclosure provides a method for treating a neurological disease or neuropathy. SUMMARY OF THE INVENTION

[0003] The present invention provides an STMN2 oligonucleotide or a pharmaceutically acceptable salt thereof for use in In various embodiments, the neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal Dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease Brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head injury, spinal cord injury, and corticobasal degeneration (CBD). Neuropathy is a chemotherapy-induced neuropathy.

[0035] SEQ ID NOs: 1 to 446, 894 to 918, 945 to 1390, or A linked nucleoside having any one of the nucleic acid base sequences of sequence numbers 1392 to 1432 or a pharmaceutically acceptable salt thereof, is further described herein. in which the oligonucleotides are phosphodiester-linked, phosphorothioate-linked, phosphate bond, alkyl phosphate bond, alkyl phosphonate bond, 3-methoxypropyl phosphonate bond, phosphorodithioate bond, phosphotriester bond, methylphosphonate bond, phosphonate bond, aminoalkylphosphotriester bond, alkylene phosphonate bond, Phosphinate bond, phosphoramidate bond, phosphoramidothiate bond, phosphoro Diamidate bond, aminoalkylphosphoramidate bond, thiophosphoramidate bond In this case, thionoalkylphosphonate bond, thionoalkylphosphotriester bond, thiophosphatidyl From the group consisting of phosphate bonds, selenophosphate bonds, and boranophosphate bonds and / or a linked nucleoside bond selected from At least one nucleoside of the nucleoside is a 2'-O-(2-methoxyethyl) nucleoside. 2'-O-Methoxyethyl Ribonucleoside (2'-MOE) Nucleosides, 2'-deoxy-2'-fluoronucleosides, 2'-fluoro-β- D-arabinonucleosides, locked nucleic acids (LNA), constrained methoxyethyl (cMOE) , constrained ethyl (cET), and peptide nucleic acid (PNA). will be replaced by the component.

[0036] In various embodiments, at least one internucleoside linkage of the oligonucleotide is In various embodiments, the oligonucleotide has a 5'-terminus that is a phosphorothioate bond. Three types of nucleoside linked through phosphodiester internucleoside linkages in and linked at the 3' end through a phosphodiester internucleoside bond In various embodiments, the oligonucleotide comprises three linked nucleosides. One or more 2'-O- linked through a phosphorothioate internucleoside linkage (2-methoxyethyl)nucleosides. In various embodiments, the oligonucleotide is a five-linked nucleoside complex linked through phosphodiester internucleoside linkages. In various embodiments, each of the five linked nucleosides comprises a 2'-O-( 2-methoxyethyl (2'MOE) nucleosides. Each of the linked nucleosides of the nucleotide is 2'-O-(2-methoxyethyl) ( In various embodiments, all of the 2'MOE nucleosides of the oligonucleotide are The internucleoside linkages are phosphorothioate linkages, and optionally the oligonucleotide Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE ) nucleoside.

[0037] Any of the oligonucleotides described above or a pharmaceutically acceptable Further disclosed herein is a pharmaceutical composition comprising the compound of formula (I) or (II) above, a salt thereof, and a pharmaceutically acceptable excipient. The translation of functional STMN2 in cells or human patients with neurological diseases or disorders Expression of translationally competent STMN2 mRNA and / or STMN2 protein have the ability to increase, restore, or stabilize activity and / or function, and or levels that increase, restore, or stabilize activity and / or function, It is sufficient to use the oligonucleotide as a medicine to treat a disease or disorder. The STMN2 oligonucleotide or a pharmaceutically acceptable salt thereof is further described herein. In various embodiments, the oligonucleotide has one or more chiral centers. and / or double bonds. In various embodiments, the oligonucleotides may be geometrically isomeric. Exists as stereoisomers selected from diastereomers, enantiomers, and diastereomers .

[0038] Treating neurological disorders and / or neuropathy in patients in need thereof The method comprises administering a therapeutically effective amount of an STMN2 oligonucleotide or a pharmaceutically acceptable salt thereof to a subject. or the above-mentioned pharmaceutical composition to a patient in need thereof, Riluzole (Rilutek), Edaravone (Radicava) for treating diseases , rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics Diabetic drugs, cholinesterase inhibitors, memantine, benzodiazepine anti-anxiety drugs, AMX0 035 (ELYBRIO), ZILUCOPLAN (RA101495), Dual AO Intrathecal agents (e.g., BIIB067, BIIB078), BIIB100, levodo dopamine agonists (e.g., ropinirole, pramipexole, rotigo) Chin), medroxyprogesterone, KCNQ2 / KCNQ3 opener, anticonvulsant, and a second therapeutic agent selected from a psychostimulant, and / or therapy (e.g., breeze combined with care (chosen from among nursing care, physical therapy, occupational therapy, speech therapy, and nutritional support) Further disclosed herein are methods comprising administering

[0039] In various embodiments, the neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia, FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease , brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head injury, spinal cord injury, and and corticobasal degeneration (CBD). Neuropathy is a chemotherapy-induced neuropathy. [Brief explanation of the drawings]

[0040] [Figure 1A]Figure 1A is a schematic depiction of portions of the STMN2 transcript and STMN2 antisense oligonucleotides designed to target specific portions of the STMN2 transcript. In Figure 1A, the solid line represents the tested STMN2 AONs that increased STMN2-FL mRNA expression by more than 50% compared to TDP43 AON treatment alone. The dotted line represents the tested STMN2 AONs that increased STMN2-FL (full-length) mRNA by less than 50% compared to TDP43 AON treatment alone. [Figure 1B] Figure 1B is another schematic depiction of portions of the STMN2 transcript in SY5Y cells and STMN2 antisense oligonucleotides designed to target specific portions of the STMN2 transcript. In Figure 1B, the solid line represents the tested STMN2 AONs that increased STMN2-FL mRNA expression by more than 50% compared to TDP43 AON treatment alone. The dotted line represents the tested STMN2 AONs that increased STMN2-FL (full-length) mRNA by less than 50% compared to TDP43 AON treatment alone. [Figure 1C] Figure 1C is another schematic depiction of STMN2 antisense oligonucleotides designed to target portions of the STMN2 transcript in human motor neurons and specific portions of the STMN2 transcript. In Figure 1C, the solid line represents the tested STMN2 AONs that increased STMN2-FL mRNA expression by more than 50% compared to TDP43 AON treatment alone. The dotted line represents the tested STMN2 AONs that increased STMN2-FL (full-length) mRNA by less than 50% compared to TDP43 AON treatment alone. [Figure 2] Figure 2 is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense and the restoration of full-length STMN2 transcripts in the presence of six different STMN2 antisense oligonucleotides (QSN-36, QSN-55, QSN-177, QSN-203, QSN-244, and QSN-395). [Figure 3]Figure 3 is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and the reduction in mRNA levels of STMN2 transcripts with cryptic exons in the presence of six different STMN2 antisense oligonucleotides (QSN-173, QSN-181, QSN-197, QSN-215, QSN-385, and QSN-400). [Figure 4] Figure 4 is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense, as well as the restoration of full-length STMN2 transcripts in the presence of six different STMN2 antisense oligonucleotides (QSN-173, QSN-181, QSN-197, QSN-215, QSN-385, and QSN-400). [Figure 5A] Figure 5A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and the reduction in mRNA levels of STMN2 transcripts with cryptic exons in the presence of six different STMN2 antisense oligonucleotides (QSN-185, QSN-209, QSN-237, QSN-252, QSN-380, and QSN-390). [Figure 5B] Figure 5B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the restoration of full-length STMN2 transcripts in the presence of six different STMN2 antisense oligonucleotides (QSN-185, QSN-209, QSN-237, QSN-252, QSN-380, and QSN-390). [Figure 6]Figure 6A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and the reduction of the mRNA levels of STMN2 transcripts with cryptic exons in the presence of two different STMN2 antisense oligonucleotides (QSN-144 and QSN-237) over two duplicate experiments. Figure 6B is a bar graph showing the results of RT-qPCR analysis of the full-length STMN2 mRNA levels in the presence of TDP43 antisense and the restoration of the full-length STMN2 transcript in the presence of two different STMN2 antisense oligonucleotides (QSN-144 and QSN-237) over two duplicate experiments. [Figure 7] Figure 7A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and the reduction of the mRNA level of STMN2 transcripts with cryptic exons in the presence of five different STMN2 antisense oligonucleotides (QSN-36, QSN-173, QSN-177, QSN-181, and QSN-185). Figure 7B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the restoration of full-length STMN2 transcripts in the presence of five different STMN2 antisense oligonucleotides (QSN-36, QSN-173, QSN-177, QSN-181, and QSN-185). [Figure 8]Figure 8A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and the reduction of the mRNA level of STMN2 transcripts with cryptic exons in the presence of five different STMN2 antisense oligonucleotides (QSN-197, QSN-203, QSN-237, QSN-380, and QSN-395). Figure 8B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and the restoration of full-length STMN2 transcripts in the presence of five different STMN2 antisense oligonucleotides (QSN-197, QSN-203, QSN-237, QSN-380, and QSN-395). [Figure 9] Figure 9A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, as well as the reduction of the mRNA levels of STMN2 transcripts with cryptic exons in the presence of three different STMN2 antisense oligonucleotides (QSN-144, QSN-173, and QSN-237). Figure 9B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, as well as the restoration of full-length STMN2 transcripts in the presence of three different STMN2 antisense oligonucleotides (QSN-144, QSN-173, and QSN-237). [Figure 10]Figure 10A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons across different dosages of QSN-181 STMN2 antisense oligonucleotide. Figure 10B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different dosages of QSN-181 STMN2 antisense oligonucleotide. [Figure 11] Figure 11A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons across different dosages of QSN-185 STMN2 antisense oligonucleotide. Figure 11B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different dosages of QSN-185 STMN2 antisense oligonucleotide. [Figure 12] Figure 12A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons across different dosages of QSN-197 STMN2 antisense oligonucleotide. Figure 12B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different dosages of QSN-197 STMN2 antisense oligonucleotide. [Figure 13]Figure 13A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons across different dosages of QSN-144 STMN2 antisense oligonucleotide. Figure 13B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts across different dosages of QSN-144 STMN2 antisense oligonucleotide. [Figure 14] Figure 14A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcript with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcript with hidden exons across different dosages of QSN-173 STMN2 antisense oligonucleotide. Figure 14B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcript across different dosages of QSN-173 STMN2 antisense oligonucleotide. [Figure 15] Figure 15A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcript with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcript with hidden exons across different dosages of QSN-237 STMN2 antisense oligonucleotide. Figure 15B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcript across different dosages of QSN-237 STMN2 antisense oligonucleotide. [Figure 16]Figure 16 is a protein blot and a quantified bar graph showing normalized amounts of STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts for two different STMN2 antisense oligonucleotides (QSN-173 and QSN237). [Figure 17] Figure 17A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons using different variants of QSN-237 STMN2 antisense oligonucleotide. Figure 17B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts using different variants of QSN-237 STMN2 antisense oligonucleotide. [Figure 18] Figure 18A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons using different variants of QSN-185 STMN2 antisense oligonucleotide. Figure 18B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different variants of QSN-185 STMN2 antisense oligonucleotide. [Figure 19]Figure 19A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcript with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcript with hidden exons using different variants of QSN-173 STMN2 antisense oligonucleotide. Figure 19B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcript using different variants of QSN-173 STMN2 antisense oligonucleotide. [Figure 20] Figure 20A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons using different variants of QSN-237 STMN2 antisense oligonucleotide. Figure 20B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts using different variants of QSN-237 STMN2 antisense oligonucleotide. [Figure 21] Figure 21A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons using different variants of QSN-173 STMN2 antisense oligonucleotide. Figure 21B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts using different variants of QSN-173 STMN2 antisense oligonucleotide. [Figure 22]Figure 22A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons using different variants of QSN-144 STMN2 antisense oligonucleotide. Figure 22B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts using different variants of QSN-144 STMN2 antisense oligonucleotide. [Figure 23] FIG. 23 shows a dose-response curve demonstrating the increasing restoration of full-length STMN2 transcript with increasing concentrations of STMN2 AON. [Figure 24A] FIG. 24A shows a Western blot assay demonstrating a qualitative increase in full-length STMN2 protein in response to higher concentrations of STMN2 AON. [Figure 24B] FIG. 24B shows the quantified levels of full-length STMN2 protein normalized to GAPDH in response to different concentrations of STMN2 AON. [Figure 25] Figure 25A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons using different QSN-144 STMN2 AONs and AON variants. Figure 25B is a bar graph showing the results of RT-qPCR analysis of the TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-144 STMN2 AONs and AON variants. [Figure 26]Figure 26A is a bar graph showing the results of RT-qPCR analysis of the mRNA level of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA level of STMN2 transcripts with hidden exons using different QSN-173 STMN2 AONs and AON variants. Figure 26B is a bar graph showing the results of RT-qPCR analysis of the TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-173 STMN2 AONs and AON variants. [Figure 27] Figure 27A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons using different QSN-185 STMN2 AONs and AON variants. Figure 27B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-185 STMN2 AONs and AON variants. [Figure 28] Figure 28A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons using different QSN-237 STMN2 AONs and AON variants. Figure 28B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the recovery of full-length STMN2 transcripts using different QSN-237 STMN2 AONs and AON variants. [Figure 29]Figure 29A is a bar graph showing the results of RT-qPCR analysis of the mRNA levels of STMN2 transcripts with hidden exons in the presence of TDP43 siRNA and TDP43 antisense, and the reduction of the mRNA levels of STMN2 transcripts with hidden exons using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). Figure 29B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the restoration of full-length STMN2 transcripts using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). [Figure 30] FIG. 30 is a bar graph showing reversal of cryptic exon induction in human motor neurons using QSN-237 STMN2 antisense oligonucleotide, even when considering increased proteasome inhibition. [Figure 31A] Figure 31A shows a bar graph depicting the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons and STMN2 full-length mRNA levels, demonstrating reduction of mRNA levels of STMN2 transcripts with cryptic exons and restoration of full-length STMN2 transcripts using different STMN2 AONs and AON variants. [Figure 31B] Figure 31B shows a bar graph depicting the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons and STMN2 full-length mRNA levels, demonstrating the reduction of mRNA levels of STMN2 transcripts with cryptic exons and the restoration of full-length STMN2 transcripts using different STMN2 AONs and AON variants. [Figure 32] FIG. 32 is a bar graph showing the results of Western blot analysis of STMN2 protein levels, demonstrating the restoration of full-length STMN2 protein using different STMN2 AONs and AON variants. [Figure 33A]Figure 33A is a bar graph showing the results of RT-qPCR analysis of mRNA expression of STMN2 transcripts with cryptic exons in human motor neurons, demonstrating reduction in mRNA levels of STMN2 transcripts with cryptic exons using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). [Figure 33B] Figure 33B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the recovery of full-length STMN2 transcripts using different STMN2 AONs (QSN-31, QSN-41, and QSN-46). [Figure 34A] Figure 34A is a bar graph showing the results of RT-qPCR analysis of mRNA expression of STMN2 transcripts with cryptic exons in human motor neurons, demonstrating reduction of mRNA levels of STMN2 transcripts with cryptic exons using different STMN2 AONs (QSN-146, QSN-150, and QSN-169). [Figure 34B] Figure 34B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the recovery of full-length STMN2 transcripts using different STMN2 AONs (QSN-146, QSN-150, and QSN-169). [Figure 34C] Figure 34C is a bar graph showing the results of RT-qPCR analysis of mRNA expression of STMN2 transcripts with cryptic exons in human motor neurons, demonstrating reduction in mRNA levels of STMN2 transcripts with cryptic exons using different STMN2 AONs (QSN-170, QSN-171, and QSN-172). [Figure 34D] Figure 34D is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the recovery of full-length STMN2 transcripts using different STMN2 AONs (QSN-170, QSN-171, and QSN-172). [Figure 34E]Figure 34E is a bar graph showing the results of RT-qPCR analysis of mRNA expression of STMN2 transcripts with cryptic exons in human motor neurons, demonstrating the reduction of mRNA levels of STMN2 transcripts with cryptic exons using a different STMN2 AON (QSN-249). [Figure 34F] Figure 34F is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels, demonstrating the restoration of full-length STMN2 transcripts using a different STMN2 AON (QSN-249). DETAILED DESCRIPTION OF THE INVENTION

[0041] The properties and other details of the present disclosure will now be more particularly described. Certain terms employed in the examples and appended claims are summarized here. These definitions should be read in light of the remainder of the disclosure and understood by one of ordinary skill in the art. Unless otherwise defined, all techniques used herein Technical and scientific terms have the same meaning as commonly understood by one of ordinary skill in the art.

[0042] The terms "treat," "treatment," "treating," and the like refer to the desired pharmacological and "A physiological effect" is used herein to generally mean to obtain a physiological effect. The effect may be a partial or complete cure of the disease and / or side effects attributable to the disease. The term "treatment" as used herein refers to the treatment of a mammal, especially It covers all treatments of diseases in humans and (a) inhibiting the disease, i.e. (b) preventing the disease from increasing in severity or extent; (c) alleviating the disease; (c) causing partial or total improvement of the disease; or Preventing the onset of the disease, i.e., treating the symptoms of the disease or treating the disease. The goal of this study is to prevent the disease from relapsing into an active state after treatment.

[0043] "Preventing" includes any clinical symptom, complication, or condition, disorder, disease, or condition. is thought to be suffering from or susceptible to, but has a condition, disorder, disease, or In subjects who have not yet experienced or exhibited clinical or subclinical symptoms of the condition delaying the onset of biochemical manifestations of a manifesting condition, disorder, disease, or condition. "Preventing" includes preventing a clinical condition, complication, or disease in or on a subject. prophylactically treating the biochemical manifestations of a condition, disorder, disease, or state occurring in Preventing a condition, disorder, disease, or state in or occurring in a subject, including This includes treating the patient with

[0044] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" is used herein When used in a pharmaceutical composition, any and all solvents, dispersion media, coatings, etc., compatible with pharmaceutical administration may be used. The terms "antioxidant," "anti-inflammatory agent," "anti-inflammatory drug ... The use of such media and agents is well known in the art. Other active compounds that provide additional or enhancing therapeutic functions may also be included.

[0045] The term "pharmaceutical composition," as used herein, refers to a composition containing one or more pharmaceutically acceptable carriers. at least one biologically active compound, e.g., formulated with an acceptable excipient; The present invention relates to a method for treating STMN2 comprising administering to a subject an antisense oligonucleotide (AON) as disclosed herein. It refers to a composition containing

[0046] "Individual," "patient," or "subject" are used interchangeably and refer to a mammal, preferably a or mice, rats, other rodents, rabbits, dogs, cats, pigs, cows, sheep, The present invention includes any animal, including a mammal, a human, or a non-human primate, most preferably a human. The compounds can be administered to mammals, such as humans, but also to other mammals, e.g. Animals requiring veterinary treatment, such as domestic animals (e.g., dogs, cats, etc.), livestock (e.g., cattle, sheep, pigs, horses, etc.), and laboratory animals (e.g., rats, mice, guinea pigs, etc.). In some embodiments, the method of the present invention can be administered to animals (e.g., non-human primates, non-human primates, etc.). The mammal to be treated preferably has a gene encoding a gene encoding a medicament for the regulation of STMN2 expression and / or activity. It is a desirable mammal.

[0047] The terms "STMN2 oligonucleotide," "STMN2 antisense oligonucleotide," "STMN2 AON" refers to a compound that inhibits the activity of full-length STMN2, e.g., a full-length STMN2 AON. Expression of MN2, e.g., full-length STMN2 mRNA and / or full-length STMN2 protein It refers to an oligonucleotide that has the ability to increase, restore, or stabilize the expression of a protein. Generally, STMN2 oligonucleotides target STMN2 transcripts containing cryptic exons. Targeting STMN2 reduces the level of mature STMN2 transcripts containing cryptic exons. ALS, FTD, ALS with FTD, or another neurological or motor disorder A patient suffering from a rheumatoid arthritis is one who has been diagnosed with the disease or who exhibits symptoms of the disease. Patients may have ALS, FTD, ALS with FTD, or another neurological disorder. Patients with motor neuron disease or MD have a history of the disease and / or or recover from disease symptoms or experience complete or partial improvement, after which the disease or Patients may experience a complete or partial recurrence of disease symptoms. ALS, FTD, FTD ALS with other neurological or motor neuron diseases or conditions Patients undergoing treatment are those who harbor a genetic mutation associated with the manifestation of a disease or condition. For example, patients with ALS have SOD1, C9orf72, and ataxin 2. (ATXN2), charged multivesicular body protein 2B (CHMP2B), dynactin 1 (DC TN1), human epidermal growth factor receptor 4 (ERBB4), FIG4 phosphoinositide 5-phosphoinositide phospholipase (FIG4), NIMA-related kinase 1 (NEK1), heterogeneous nuclear ribonucleic acid (HRI) Neurofilament heavy chain (NEFH), periphery PRPH, TAR DNA-binding protein 43 (TDP43 or TARDBP) , Fused in Sarcoma (FUS), Ubiquilin-2 (U BQLN2), kinesin family member 5A (KIF5A), valosin-containing protein Calcium (VCP), Arsine (ALS2), Senataxin (SETX), Sigma Non-opioid Intracellular receptor 1 (SIGMAR1), survival of motor neurons 1, telomere SMN1, spastic paraplegia 11, autosomal recessive (SPG11), transient receptor potential cati On-channel subfamily M member 7 (TRPM7), vesicle-associated membrane protein related Protein B / C (VAPB), angiogenin (ANG), profilin-1 (PFN 1), Matrin-3 (MATR3), coiled-coil-helix-coiled-coil Rix domain-containing 10 (CHCHD10), tubulin, alpha 4A (TUBA 4A), TBK1, C21orf2, sequestosome-1 (SQSTM1, ubiquitin binding protein p62), and / or optineurin (OP Patients may have a genetic mutation in either TN, but especially those with a sudden mutation The mutation is associated with ALS or a higher risk of developing ALS.

[0048] ALS, FTD, ALS with FTD, or another neurological or motor neuron disease Patients at risk for the disease should be advised of a family history of the disease or a genetic predisposition to the disease. patients with a genetic mutation associated with a high disease risk, or These may include patients who have been exposed to environmental factors that increase the risk of disease. For example, if the patient has SO D1, C9orf72, ATXN2, CHMP2B, DCTN1, ERBB4, FIG4 , HNRNPA1, NEFH, PRPH, NEK1, TDP43, FUS, UBQLN2 , KIF5A, VCP, ALS2, SETX, SIGMAR1, SMN1, SPG11, TRPM7, VAPB, ANG, PFN1, MATR3, CHCHD10, TUBA4A , TBK1, SQSTM1, C21orf2, and / or OPTN-encoding genes If either of the children has a mutation, especially if the mutation is ALS or hyperALS If the risk of developing ALS is high, the patient may be at risk. Patients exposed to the drug may have ALS, FTD, ALS with FTD, or another neurological disorder. diagnosed with a disease or condition that has a high co-morbidity with motor neuron disease This may also include patients with a family history of ALS, FTD, and bulbar manifestations of ALS. Patients with dementia are significantly associated with higher odds of developing dementia (Trojsi, F., et al. (2017) “Comorbidity of dementia with amyotrophic lateral sclerosis (ALS): See “Insights from a large multicenter Italian cohort” J ​​Neurol 264: 2224-31 ).

[0049] As used herein, "STMN2" (also known as superior cervical ganglion 10 protein) (presumably a neuron-associated protein), stathmin-like 2, SCGN10, SCG10, neuron proliferation-associated protein Neuron-specific growth-associated protein, or protein SCG10 (superior cervical ganglion N EAR neuron-specific 10) is identified by Entrez gene ID number 11075 The gene or gene product (e.g., the protein or m RNA transcripts (including pre-mRNA), and their allelic variants, as well as human An ortholog refers to an ortholog found in a species other than the human (e.g., a non-human primate or mouse).

[0050] As used herein, the term "therapeutically effective amount" refers to the amount of a therapeutically effective dose administered by a researcher, veterinarian, physician, or other clinical the biological or medical properties of tissues, systems, animals, or humans that are the subject of medical investigation This means the amount of a target inhibitor of STMN2 transcript containing the cryptic exon that elicits a targeted response. The inhibitors of STMN2 transcripts containing cryptic exons of the present invention are useful in treating a disease, condition, disorder, or state. condition, e.g., ALS, FTD, ALS with FTD, or another motor neuron disease or neurological disease or condition. Alternatively, a therapeutically effective amount of an inhibitor of STMN2 transcripts containing cryptic exons may be administered at a dose of 100 mg / mL or more. the amount required to achieve a therapeutic and / or prophylactic effect of, for example, exercise neuroleptics and preventing or reducing symptoms associated with diseases associated with decreased STMN2 activity in humans. The amount of damage caused, etc.

[0051] The phrase "oligonucleotides targeting the STMN2 transcript" refers to oligonucleotides targeting the STMN2 transcript. In various embodiments, the oligonucleotide is an oligonucleotide that binds to S Table 1 shows exemplary regions of the TMN2 transcript. , the region of the branch points (e.g., branch points 1, 2, and 3), the 3' splice The ESE acceptor region, ESE binding region, TDP43 binding site, cryptic exon, and In various embodiments, the oligonucleotide represents a sequence corresponding to the cryptic exon A region. It binds to a region of the STMN2 transcript that contains the seon, which is located at the branch point ( For example, branch points 1, 2, and 3), 3' splice acceptor region, ES The E-binding region, TDP43-binding site, cryptic exon, and polyA region all contain Located upstream or downstream within 75 acid-base bonds.

[0052] The term "pharmaceutically acceptable salt(s)" as used herein refers to the salt(s) of the present composition. The present invention relates to an inhibitor of STMN2 transcripts containing cryptic exons, and The present composition refers to a salt of a basic group or a base group. The inhibitors are basic in nature and form a wide variety of salts with a variety of inorganic and organic acids. To prepare pharmaceutically acceptable acid addition salts of such basic compounds, Acids that can be used to prepare the compound include non-toxic acid addition salts, i.e., malates, oxalates, chlorides, etc. , bromide, iodide, nitrate, sulfate, hydrogen sulfate, phosphate, acid phosphate, isonicotinic acid Sodium phosphate, acetate, lactate, salicylate, citrate, tartrate, oleate, thiamin Nitrate, pantothenate, bitartrate, ascorbate, succinate, maleate Salt, gentisinate, fumarate, gluconate, glucuronic acid, saccharin Carboxylate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate phosphate, benzenesulfonate, p-toluenesulfonate, and pamoate salts (i.e. , 1,1'-methylene-bis-(2-hydroxy-3-naphthoic acid)) salts, Acids that form salts containing pharmacologically acceptable anions, including but not limited to: The inhibitor of STMN2 transcripts containing cryptic exons contained in the composition inhibits the amino moiety. This moiety can form pharmaceutically acceptable salts with various amino acids in addition to the acids mentioned above. The compounds contained in the present composition, which are acidic in nature, are suitable for use in a variety of pharmacologically acceptable forms. They can form base salts with ions. Examples of such salts include alkali metal or Salts of alkaline earth metals, especially calcium, magnesium, sodium, and lithium Pharmaceutically acceptable salts of the present disclosure include, for example, salts of SEQ ID NOs: 1 to 446, Sequence numbers 894 to 918, sequence numbers 945 to 1390, or sequence numbers 1392 to 1432 and a pharmaceutically acceptable salt of an STMN2 AON comprising a nucleobase sequence of any one of .

[0053] The disclosed inhibitors of STMN2 transcripts containing cryptic exons may comprise one or more chiral mediators. may contain centers, groups, bonds, and / or double bonds, and therefore stereoisomers , for example, as geometric isomers, enantiomers, or diastereomers. "Stereoisomers," as used herein, include any geometric isomer, enantiomer, or diastereomers. These compounds are composed of stereogenic atoms, For example, the configuration of substituents surrounding a stereogenic carbon, phosphorus, or sulfur atom Depending on the regulation, the symbol "R" or "S" (or "Rp" or "Sp") In some embodiments, one or more bonds of the compound may be designated as Rp or Sp configuration (e.g., one or more phosphorothioates The linkages have either an Rp or Sp configuration. The configuration can be independent of the other phosphorothioate linkage (e.g., One phosphorothioate bond has the Rp configuration and the second phosphorothioate bond has the Rp configuration. The present invention provides these compounds. and mixtures thereof, encompassing various stereoisomers. Stereoisomers include enantiomers. Mixtures of enantiomers or diastereomers. Although the structure may be designated "(±)" in the nomenclature, those skilled in the art will recognize that the structure is chiral. It is recognized that the present invention may implicitly suggest the presence of a hidden exon in the STMN2 transcript. The individual stereoisomers of the inhibitors contain asymmetric or stereogenic centers. by synthesis from commercially available starting materials or by preparation of racemic mixtures followed by subsequent synthesis by those skilled in the art. These methods can be used to separate enantiomers. The mixture is coupled to a chiral auxiliary and the resulting product is obtained by recrystallization or chromatography. The resulting mixture of diastereomers is separated, and the optically pure product is liberated from the auxiliary. (2) salt formation using optically active resolving agents, or (3) chiral chromatography. This is exemplified by the direct separation of a mixture of optical enantiomers on a rough column. The isomeric mixture can be separated by well-known methods, such as chiral phase gas chromatography, chiral phase supercritical fluid chromatography, etc. Fluid chromatography, chiral-phase simulated moving bed chromatography, chiral-phase high-performance liquid chromatography chiral chromatography, crystallizing the compound as a chiral salt complex, or A compound can be separated into its stereoisomeric components, for example by crystallizing it in a solvent The stereoisomers can be obtained stereomerically pure by well-known asymmetric synthesis methods. They may also be obtained from simple intermediates, reagents, and catalysts.

[0054] The inhibitors of STMN2 transcripts containing cryptic exons disclosed herein are pharmaceutically acceptable. It exists in solvated as well as unsolvated forms with acceptable solvents such as water, ethanol, etc. and the present invention is intended to encompass both solvated and unsolvated forms. Illustrated.

[0055] The present disclosure provides a method for determining whether one or more atoms have an atomic mass or molecular mass that is found abundantly in nature. The atomic mass or mass number of the element is replaced by an atom having a different atomic mass or mass number than that specified in the specification. isotopically labeled compounds of the present invention that are identical to those cited in the document (i.e., The present invention also encompasses isotope-labeled inhibitors of STMN2 transcripts containing cryptic exons. Examples of isotopes that can be incorporated into compounds include hydrogen, carbon, nitrogen, oxygen, phosphorus, and fluorine. , and isotopes of chlorine, e.g. 2 H, 3 H, 11 C. 13 C. 14 C. 15 N, 18 O. 17 O. 31 P, 32 P, 33 P, 35 S, 18 F, and 36 Cl etc. are listed respectively. can be.

[0056] Certain isotopically labeled compounds of the present disclosure (e.g., 3 H and 14 Labeled with C These compounds (as defined above) are useful in compound and / or substrate tissue distribution assays. Tritium labeling (i.e. 3 H) and carbon-14 (i.e. 14 C) Isotopes are prepared and They are particularly preferred due to their ease in detection and detection. bodies, such as deuterium (i.e. 2 H) or the like, which can lead to increased metabolic stability (e.g., appropriate therapeutic benefit due to increased half-life in vivo or reduced dosage requirements can provide the above advantages and may therefore be considered preferable in some circumstances. do.

[0057] As used herein, "2'-O-(2-methoxyethyl)" (2'-MOE and and 2'-O(CH2)2OCH3, and similarly MOE) refers to the 2'-O of the furanose ring. 2'-O-(2-methoxyethyl) refers to the O-methoxyethyl modification at this position. In the disclosure, "2'-O-methoxyethyl" is used interchangeably. The sugar moiety in the modified nucleoside is a modified sugar.

[0058] As used herein, "2'-MOE nucleosides" (2'-O-(2-methoxyphenyl)-2'-methyl-2'-oxo ... (Diethyl)nucleosides (also referred to as diethyl nucleosides) refer to nucleosides containing a 2'-MOE modified sugar moiety. means.

[0059] As used herein, a "2'-substituted nucleoside" refers to a nucleoside that is 2' of the furanose ring. In certain embodiments, the term "nucleoside" refers to a nucleoside containing a substituent other than H or OH at the 2-position. In some embodiments, 2' substituted nucleosides include nucleosides having bicyclic sugar modifications.

[0060] As used herein, "5-methylcytosine" (5-MeC) refers to a cytosine that has a methyl group. It refers to a cytosine modified by linking it to the 5-position. C) is a modified nucleobase.

[0061] As used herein, a "bicyclic sugar" refers to a sugar modified by bridging two atoms. It refers to the lanose ring. Bicyclic sugars are modified sugars.

[0062] As used herein, a "bicyclic nucleoside" (also BNA) is a nucleoside that is a nucleoside with a bridge ( sugar moiety containing a sugar ring (which links two carbon atoms of the sugar ring, thereby forming a bicyclic ring system) In certain embodiments, the bridge is between the 4'-carbon and the 2'-carbon of the sugar ring. '-bonds with carbon.

[0063] As used herein, a "cap structure" or "terminal cap portion" means refers to chemical modifications incorporated at either end of an antisense compound.

[0064] As used herein, "cEt" or "constrained ethyl" refers to a group having a 4'-carbon and a 2' -carbon linkage (having the formula 4'-CH(CH3)-O-2') means a bicyclic nucleoside having a moiety.

[0065] As used herein, "constrained ethyl nucleosides" (also referred to as cEt nucleosides) 2) refers to a nucleoside containing a bicyclic sugar moiety containing a 4'-CH(CH3)-O-2' bridge means.

[0066] As used herein, an "internucleoside linkage" refers to a linkage between adjacent nucleoside residues in an oligonucleotide. In some embodiments, as used herein, a covalent bond between adjacent nucleosides is used. In this case, "non-natural linkage" refers to "modified internucleoside linkage."

[0067] As used herein, "contiguous" in the context of oligonucleotides means adjacent to one another. Refers to immediately adjacent nucleosides, nucleobases, sugar moieties, or internucleoside linkages. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

[0068] As used herein, "locked nucleic acid" or "LNA" or "LNA nucleotide" A "nucleoside" is a nucleoside that links two carbon atoms between the 4' and 2' positions of the nucleoside sugar unit. , thereby forming a bicyclic sugar bridge (e.g., methylene, ethylene, aminooxy, or or oximino bridge). Examples of such bicyclic sugars are A) α-L-methyleneoxy(4'-CH2-O-2')LNA, (B) β-D-methyl Ethyleneoxy(4'-CH2-O-2')LNA, (C) Ethyleneoxy(4'-(CH 2) 2-O-2') LNA, (D) aminooxy (4'-CH2-ON(R)-2') LNA, and (E)oxyamino (4'-CH2-N(R)-O-2') LNA. Examples include, but are not limited to:

[0069] As used herein, an LNA compound refers to a compound having at least one nucleotide between the 4' and 2' sugar positions. and each of the bridges is -[C(R1)(R2)] n -, -C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C( =O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O) x -and- N(R1)-, independently containing 1 or 2 to 4 linking groups independently selected from where x is 0, 1, or 2; n is 1, 2, 3, or 4; R1 and Each R2 is independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1~C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Arke Nil, C2~C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Ants C5-C 20Aryl, heterocyclic radicals, substituted heterocyclic radicals C5-C7 alicyclic radicals, substituted heteroaryls, heteroaryls, substituted heteroaryls, C5-C7 alicyclic radicals, halogens, OJ1, NJ1, J2, SJ1, N3, COOJ 1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)- J1), or sulfoxyl (S(=O)-J1); and Each of these is independently H, C1 to C 12 Alkyl, substituted C1-C 12 Alkyl, C 2~C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, Substituted C2~C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 a Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted Heterocyclic radicals, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkane Examples of compounds that may be used include, but are not limited to, compounds that are hydroxyl, hydroxypropyl, or protecting groups.

[0070] An example of a 4'-2' bridge group that fits the definition of LNA is a group of the formula: -[C(R1)(R2)] n -, -[C(R1)(R2)] n -O-, -C(R1R2)-N(R1)-O- or -C(R1R2)-ON(R1)- Additionally, other bridging groups that fall within the definition of LNA include 4'-CH2-2', ... '-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'- (CH2)2-O-2', 4'-CH2-ON(R1)-2', and 4'-CH2- N(R1)-O-2'-bridge, provided that each of R1 and R2 is independently H, protecting group, or C1-C 12 It is alkyl.

[0071] Included in the definition of LNA according to the present invention are the 2'-hydroxyl groups of the ribosyl sugar ring. The group is attached to the 4' carbon atom of the sugar ring, thereby forming a bridge to form a bicyclic sugar moiety. The bridge is a methylene ( The term methyleneoxy(4'-CH2-O-2')LNA is used. Furthermore, in the case of a bicyclic sugar moiety having an ethylene bridging group at this position, In this case, the term ethyleneoxy(4'-CH2CH2-O-2')LNA is used. α-L-methyleneoxy, an isomer of ethyleneoxy (4'-CH2-O-2')LNA (4'-CH2-O-2') also falls within the definition of LNA as used herein. .

[0072] As used herein, a "hotspot region" refers to a region that is involved in the splicing of a target nucleic acid. a range of nucleobases on a target nucleic acid that are amenable to oligomeric compound-mediated modulation is.

[0073] As used herein, "hybridization" refers to the process by which complementary oligonucleotides are bonded to one another. It refers to the pairing or annealing of peptides and / or nucleic acids. Although not the most common mechanism of hybridization, hydrogen bonding ( Watson-Crick, Hoogsteen, or reverse Hoogsteen interactions between complementary nucleobases The bond is related to the hydroxyl group (which may be a hydrogen bond of the hydroxyl group type).

[0074] As used herein, "increasing the amount of activity" refers to increasing the amount of activity in an untreated or control sample. Compared to the transcript expression or activity in the control sample, the expression of more transcripts, full-length mature mRNA, and more accurate splicing and / or protein expression It refers to higher activity.

[0075] As used herein, a "mismatch" or "non-complementary nucleobase" refers to a mismatch between a first The nucleobases of a nucleic acid are capable of pairing with the corresponding nucleobases of a second or target nucleic acid. This refers to cases where this is not possible.

[0076] As used herein, "linked nucleosides" refers to nucleosides in a contiguous sequence. nucleosides linked through interosidic bonds (i.e., linked nucleosides) There are no additional nucleosides between the nucleosides.

[0077] As used herein, a "modified internucleoside linkage" refers to a naturally occurring Refers to the substitution of or any change from an internucleoside bond (e.g., phosphodiesterase A "phosphorothioate bond" is a bond between phosphodiester nucleosides. A modified internucleoside in which one of the non-bridging oxygen atoms of the internucleoside bond is replaced with a sulfur atom. It is a bond.

[0078] As used herein, "modified nucleobase" refers to adenine, cytosine, guanine, Modified nucleobases include any nucleobase other than thiamin, thymidine, or uracil. Examples include 5-methylcytosine, pseudouridine, or 5-methoxyuridine. "Unmodified nucleobases" refer to the purine bases adenine (A) and guanine (G), as well as The pyrimidine bases thymine (T), cytosine (C), and uracil (U) are meant.

[0079] As used herein, a "modified nucleoside" refers to a nucleoside that contains a modified sugar moiety and / or means a nucleoside independently having a modified nucleobase. Modified nucleobases are those that can pair with any of the unmodified nucleobases of the same class. Abasic nucleosides include abasic nucleosides, which lack a nucleobase.

[0080] As used herein, a "modified oligonucleotide" refers to an oligonucleotide that contains at least one modification. Oligonucleotides containing modified internucleoside linkages, modified sugars, and / or modified nucleobases It means Ochido.

[0081] As used herein, an "modified sugar" or "modified sugar moiety" refers to a modified furano The sugar moiety, or the nucleobase, may be linked to another group, e.g., an internucleoside linkage, a conjugate group, or a non-furanosyl moiety that can be attached to a terminal group or the like within an oligonucleotide. means a modified sugar moiety having the moiety:

[0082] As used herein, "monomer" means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides. and whether naturally occurring or modified.

[0083] As used herein, a "motif" refers to an unmodified and unaltered portion of a motif within an antisense compound. and modified nucleoside patterns.

[0084] As used herein, a "natural sugar moiety" refers to a sugar moiety that is present in DNA (2'-H) or RNA. (2'-OH) refers to the sugar moiety found in

[0085] As used herein, a "naturally occurring internucleoside linkage" refers to a 3' and 5' It means a phosphodiester bond with

[0086] As used herein, "non-complementary nucleobases" refer to nucleobases that do not form hydrogen bonds with each other. , refers to a pair of nucleobases that would not otherwise be available for hybridization.

[0087] As used herein, "nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids. Double-stranded nucleic acids, small interfering ribonucleic acid (siRNA), short hairpin RNA (shRNA), and Examples of RNAi include, but are not limited to, RNAi proteins and microRNAs (miRNAs).

[0088] As used herein, a "nucleobase" is a base that can pair with a base of another nucleic acid. means a heterocyclic moiety capable of being substituted or unsubstituted.

[0089] As used herein, "nucleobase complementarity" refers to the ability of a nucleic acid to base pair with another nucleic acid. For example, in DNA, adenine (A) is linked to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, a complementary nucleobase is a nucleobase of its target nucleic acid. refers to the nucleobases of an antisense compound that can base pair with The nucleic acid base at a specific position in the compound is related to the nucleic acid base at a specific position in the target nucleic acid. If hydrogen bonding is possible, the position of hydrogen bonding between the oligonucleotide and the target nucleic acid are considered to be complementary in the nucleic acid base pair.

[0090] As used herein, "nucleobase sequence" means the order of consecutive nucleobases. and is independent of any sugar, linkage, and / or nucleobase modifications.

[0091] As used herein, "nucleoside" means a nucleobase linked to a sugar The term "nucleoside" includes nucleosides that independently have modified sugar moieties and / or modified nucleobases. Also included are "modified nucleosides" that

[0092] As used herein, a "nucleoside mimetic" refers to a nucleoside mimetic that replaces a sugar or a sugar and a base. and a structure used to bond at one or more positions of the oligomeric compound. For example, nucleoside mimetics may include morpholino, cyclohexene, nyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, Nucleotide mimetics include those that have non-furanose sugar units, such as those that replace nucleosides. and oligomeric compounds, such as peptide nucleic acids, or morpholinos (-N(H)-C(=O)-O-) Sugar substitutes include: It overlaps with the slightly broader term nucleoside mimetic, but The tetrahydropyridine rings presented herein are intended to represent substitutions on the tetrahydropyridine ring only. The pyranyl ring is a type of sugar substitute in which the furanose sugar group is replaced by a tetrahydropyranyl ring system. Examples are illustrated. A "mimetic" is a compound that mimics the sugar, nucleobase, and / or internucleoside linkages. Mimetics generally refer to groups substituted with a sugar or sugar-internucleoside linkage. Instead of a combination, the nucleobases are used to hybridize to a selected target. It is maintained for the purpose of

[0093] As used herein, a "nucleotide" refers to a nucleotide that is covalently bonded to the sugar portion of a nucleoside. It refers to a nucleoside having a phosphate group attached thereto.

[0094] As used herein, an "oligomeric compound" or "oligomer" refers to a nucleic acid molecule. A bound monomeric sequence capable of hybridizing to at least one region of the molecule. It means a polymer of bis(2-amino-2-methyl-1,2-dioxadiene) units.

[0095] As used herein, an "oligonucleotide" refers to a polymer of linked nucleosides. Each of these may be modified or unmodified independently of the other. That's fine.

[0096] Modification A nucleoside is a base-sugar combination. The nucleobase (also known as the base) of a nucleoside The sugar moiety of the nucleoside is usually a heterocyclic base moiety. A nucleoside further contains a phosphate group covalently linked to the pentofuranosyl sugar moiety. In the case of nucleosides, the phosphate group is attached to the 2', 3', or 5' hydroxyl moiety of the sugar. Oligonucleotides are those in which adjacent nucleosides are covalently linked to each other. The oligonucleotide is formed by forming a linear polymer oligonucleotide. In the nucleotide structure, the phosphate groups form the internucleoside linkages of the oligonucleotide. It is commonly cited as

[0097] Modifications to antisense compounds can be made to the internucleoside linkage, sugar moiety, or nucleobase. Modified antisense compounds contain substitutions or alterations to the amino acid sequence of the target molecule. Enhanced intracellular uptake, increased affinity for nucleic acid targets, and improved stability in the presence of nucleases These are often preferred over native forms for reasons such as increased cleavage or inhibitory activity.

[0098] The shortened or truncated antisense oligonucleotides are directed against their target nucleic acids. Chemically modified nucleosides may also be employed to increase binding affinity. Therefore, shorter antisense molecules having such chemically modified nucleosides can be produced. Comparable results can often be obtained using a mixture of

[0099] Modified internucleoside linkages The naturally occurring internucleoside linkages in RNA and DNA are 3' and 5' phosphodiesters. ester bond. One or more modified, i.e., non-naturally occurring, nucleosides Antisense compounds with intercidal linkages may have desirable properties, such as enhanced cellular uptake, For reasons such as increased affinity for target nucleic acids and improved stability in the presence of nucleases, are more frequently selected than antisense compounds with naturally occurring internucleoside linkages. can be.

[0100] Oligonucleotides with modified internucleoside linkages contain nucleosides that retain a phosphorus atom. This includes internucleoside linkages, as well as internucleoside linkages that do not contain a phosphorus atom. The internucleoside bond is phosphodiester, phosphotriester, methylphosphonate. Phosphoramidates, phosphoramidates, and phosphorothioates, but Not limited to, methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known.

[0101] In certain embodiments, the antisense compound targeted to an STMN2 nucleic acid comprises one or more In certain embodiments, the modified nucleoside linkage is The intersidic linkages are interspersed throughout the antisense compound. The modified internucleoside linkage is a phosphorothioate linkage. Each internucleoside linkage in the antisense compound is a phosphorothioate internucleoside linkage. In certain embodiments, antisense compounds targeted to STMN2 nucleic acids include at least at least one phosphodiester bond and at least one phosphorothioate bond include.

[0102] Modified sugar moieties Antisense compounds optionally contain one or more nucleosides with modified sugar groups. Such sugar-modified nucleosides can be used in antisense compounds. nuclease stability, increased binding affinity, or some other beneficial effect on In certain embodiments, the nucleoside may be chemically modified to confer beneficial biological properties. Examples of chemically modified ribofuranose ring moieties include non- Limited addition of substituents (including 5' and 2' substituents), forming bicyclic nucleic acids (BNAs) Bridging of non-geminal ring atoms to form ribosyl ring oxygen atoms with S, N(R), or C( R1) (R2) (R, R1, and R2 are each independently H, C1-C 12 alkyl, or protecting groups), and combinations thereof. Examples of chemically modified sugars 2'-F-5'-methyl substituted nucleosides (other disclosed 5',2'- Regarding bis-substituted nucleosides, see PCT international application published on August 21, 2008. 2008 / 101157), or further substitution at the 2' position Substitution of the ribosyl ring oxygen atom with S or CF2 (published June 16, 2005) See U.S. Patent Application Publication No. 2005-0130923, filed on Oct. 1, 2005, or alternatively , 5' substitution of BNA (PCT International Application No. 2007 / 010622, published November 22, 2007) No. 134181 (where LNA is substituted with, for example, a 5'-methyl or 5'-vinyl group) (see below for examples of the 'replaced' ...

[0103] Examples of nucleosides having modified sugar moieties include, but are not limited to, 5'-vinyl, 5'-methyl (R or 5), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2' -OCH2CH2F, and nucleosides containing 2'-O(CH2)2OCH3 substituents Substituents at the 2' position include allyl, amino, azido, thio, O-allyl, O- C1~C 10 Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2) 2-ON(R m )(R n ), O-CH2-C(=O)-N(R m )(R n ), and O -CH2-C(=O)-N(R1)-(CH2)2-N(Rm )(R n )-(However, R l , R m , and R n each independently represents H or a substituted or unsubstituted C C 10 It may also be selected from the group consisting of alkyl.

[0104] Additional examples of modified sugar moieties include 2'-OMe modified sugar moieties, bicyclic sugar moieties, 2'-O -(2-Methoxyethyl) (2'MOE), 2'-deoxy-2'-fluoronucleosides 2'-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained enzyme 2'-4'-bridged nucleotide (cEt) (4'-CH(CH3)-O-2'), S-constrained Ethyl (S-cEt) 2'-4'-bridged nucleic acid, 4'-CH2-O-CH2-2',4' -CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("Restraint MOE" or "cMOE"), hexitol nucleic acid (HNA), and tricyclic analogs (e.g., tcDNA).

[0105] As used herein, a "bicyclic nucleoside" refers to a modified form that contains a bicyclic sugar moiety. Examples of bicyclic nucleosides include, but are not limited to, 4' and 2' ribonucleotides. Nucleosides containing a bridge between the silyl ring atoms are also included. The antisense compounds presented herein may contain one or more 4' to 2' bridges. Bicyclic nucleosides are included. Such 4' and 2' bridged bicyclic nucleosides are Examples include the formula: 4'-(CH2)-O-2'(LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2'(ENA); 4'-CH(CH3)-O-2', and 4 '-CH(CH2OCH3)-O-2' (and its analogs, published July 15, 2008) See U.S. Pat. No. 7,399,845; 4'-C(CH3)(CH3)- O-2' (and its analogs, International Application Publication No. 2009 / 0 ... See Brochure No. 06478); 4'-CH2-N(OCH3)-2' (and Analog, International Application Publication No. 2008 / 150729, published December 11, 2008 See fret); 4'-CH2-ON(CH3)-2' (Published on September 2, 2004 See U.S. Patent Application Publication No. 2004-0171570; 4'-CH2-N(R )-O-2' (where R is H), C1~C 12 Alkyl, or protecting group (2008 See U.S. Patent No. 7,427,672, issued September 23, 2003; 4'-CH2-C (H)(CH3)-2'(Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134 and 4'-CH2-C-(=CH2)-2' (and its analogs, 200 (See International Application Publication No. 2008 / 154401, published December 8, 2008) This includes, but is not limited to, one of the following:

[0106] Further reports relating to bicyclic nucleosides can also be found in the published literature (e.g. For example, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron , 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 9 7, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. So c., 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent No. 6,268,490; Specification No. 6,525,191; Specification No. 6,670,461; Specification No. 6,770,7 Specification No. 48; Specification No. 6,794,499; Specification No. 7,034,133; Specification No. 7,034,133; Specification No. 7,053,207; Specification No. 7,399,845; Specification No. 7,547,6 84; and 7,696,345; U.S. Patent Publication No. 2008-00 39618; 2009-0012281; U.S. Patent Serial No. Specification No. 60 / 989,574; Specification No. 61 / 026,995; Specification No. 61 / 026 ,998 specification; 61 / 056,564 specification; 61 / 086,231 specification Specifications; Patent No. 61 / 097,787; and Patent No. 61 / 099,844; PCT International Application Publication No. 1994 / 014226; International Publication No. 2004 / 1 International Publication No. 06356; International Publication No. 2005 / 021570; International Publication International Publication No. 2007 / 134181; International Publication No. 2008 / 150729 FRET; WO 2008 / 154401; and WO 200 (See brochure No. 9 / 006478). Each of the above bicyclic nucleosides may be, for example, For example, one or more isomeric ribofuranoses, including α-L-ribofuranose and β-D-ribofuranose. can be prepared to have the same biochemical sugar configuration (WO 99 / 14 PCT International Application PCT / See brochure DK No. 98 / 00393).

[0107] In certain embodiments, the bicyclic sugar moiety of a BNA nucleoside can be any of a variety of sugars, including, but not limited to, pentacyclic nucleosides. and compounds having at least one bridge between the 4' and 2' positions of the dihydrofuranosyl sugar moiety. provided that such bridges are not -[C(R a )(R b )] n -, -C(R a )=C (R b )-, -C(R a )=N-, -C(=O)-, -C(=NR a )-, -C(=S) -, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-Independent independently containing 1 or 2-4 linking groups selected from the following: however: x is 0, 1, or 2; n is 1, 2, 3, or 4; R a and R b each independently represents H, a protecting group, hydroxyl, C1-C 12 a Rutile, substituted C1-C 12 Alkyl, C2-C12 Alkenyl, substituted C2 C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5 ~C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic radicals, substituted heterocyclic radicals Cyclic radicals, heteroaryls, substituted heteroaryls, C5-C7 alicyclic radicals Substituted C5-C7 alicyclic radicals, halogens, OJ1, NJ1J2, SJ1, N 3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S (=O)2-J1), or sulfoxyl (S(=O)-J1); and Each of J1 and J2 is independently H, C1 to C 12 Alkyl, substituted C1 ~C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2 ~C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5~C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic Radicals, substituted heterocyclic radicals, C1-C 12 Aminoalkyl, substituted C1 ~C 12 aminoalkyl, or a protecting group.

[0108] In certain embodiments, the bridge of the bicyclic sugar moiety is —[C(R a )(R b )] n -,- [-[C(R a )(R b )] n -O-, -C(R aR b )-N(R)-O-, or -C (R a R b )-ON(R)-. In certain embodiments, the bridge is 4'-CH2 -2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2 ', 4'-(CH2)2-O-2', 4'-CH2-ON(R)-2', and 4'- CH2-N(R)-O-2', where each R is independently H, a protecting group, or C1- C 12 alkyl, and each R a and R b are independently H, a protecting group, a hydroxyl, C 1~C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2~C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Al Quinyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radicals, Substituted heterocyclic radicals, heteroaryl, substituted heteroaryl, C5-C7 Alicyclic radicals, substituted C5-C7 alicyclic radicals, halogens, OJ1, NJ1J2 , SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1).

[0109] In certain embodiments, the bicyclic nucleosides are For example, a nucleoside containing a 4'-2' methylene-oxy bridge is It can be in the α-L or β-D configuration. In fact, α-L-methyleneoxy (4'-CH2-O-2') BNAs have antisense activity. The antisense oligonucleotides shown in Fig. 1 are incorporated into c Acids Research, 2003, 21, 6365-6372).

[0110] In certain embodiments, the bicyclic nucleoside is α-L-methyleneoxy(4' -CH2-O-2')BNA, β-D-methyleneoxy(4'-CH2-O-2')BN A, ethyleneoxy (4'-(CH2)2-O-2) BNA, aminooxy (4'-CH 2-ON(R)-2')BNA, oxyamino (4'-CH2-N(R)-O-2') BNA, methyl(methyleneoxy) (4'-CH(CH3)-O-2')BNA, methyl Methylene-amino (4'-CH2-N(R )-2')BNA, methyl carbocyclic (4'-CH2-CH(CH3)-2')BNA, and and propylene carbocyclic (4'-(CH2)3-2') BNA, but Not limited to these.

[0111] The present disclosure provides, in some embodiments, a method for treating a neurological disease (e.g., ALS, FTD, or FTD to treat, ameliorate, or prevent diseases such as, but not limited to, ALS accompanied by or a neurological disease, condition, or disorder (e.g., ALS, FTD, or characterized by symptoms associated with ALS or FTD, including, but not limited to: and providing methods for treating, ameliorating, or preventing disorders that can be caused by cryptic exons. Pharmaceutically acceptable compositions comprising one or more inhibitors of STMN2 transcripts, e.g. The present invention also includes a method for administering a pharmaceutically acceptable formulation to a patient. Inhibitors of the transcripts may inhibit STMN2 activity, e.g., STMN2 activity, and / or STMN 2. Levels of expression, e.g., levels of STMN2 mRNA and / or protein expression It can be increased, repaired, or stabilized.

[0112] The present disclosure is formulated with one or more pharmaceutically or cosmetically acceptable excipients. and inhibitors of STMN2 transcripts containing cryptic exons as disclosed herein. Pharmaceutical compositions are also provided. Such formulations may be administered orally, sublingually, intratracheally, intranasally, transdermally, or pulmonary. intravenous, intrathecal, intracisternal, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) ), or formulations suitable for intralesional, transmucosal (e.g., buccal, intravaginal, and intrarectal) administration; Alternatively, compositions suitable for topical application, for example to the skin and / or mucous membranes, For example, gels, pastes, waxes, creams, sprays, liquids, foams, lotions, As part of a composition in the form of an ointment, topical solution, transdermal patch, powder, vapor, or tincture These include formulations suitable for topical use in any given case. However, the most suitable mode of administration will depend on the extent and severity of the condition being treated and the extent to which the cryptic exon is hidden. The nature of the specific STMN2 transcript inhibitor used will depend on:

[0113] The present disclosure provides inhibitors of STMN2 transcripts containing cryptic exons, or pharmaceutically acceptable Salts thereof (e.g., SEQ ID NOs: 1 to 446, 894 to 918, 945 to 13 90, or STMN2 comprising the nucleic acid base sequence of any one of SEQ ID NOs: 1392 to 1432 Pharmaceutical compositions containing the AONs are also provided.

[0114] The present disclosure relates to the use of the compound of the present invention, which is formulated with one or more pharmaceutically acceptable excipients. Inhibitors of STMN2 transcripts containing cryptic exons, such as those disclosed in 1 to 446, SEQ ID NOs: 894 to 918, SEQ ID NOs: 945 to 1390, or SEQ ID NO: 13 A method comprising the use of a pharmaceutical composition containing any one of STMN2 AONs 92 to 1432. Representative compositions presented herein include those that contain cryptic exons, as described above. and one or more pharmaceutically acceptable excipients. The compositions include oral, sublingual, intratracheal, intranasal, transdermal, intrapulmonary, intrathecal, and intracisternal formulations. , parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous), or intralesional; Formulations suitable for transmucosal (e.g., buccal, intravaginal, and intrarectal) administration or topical use are available. In any given case, the most suitable form of administration will depend on the clinical symptoms, The comorbidity or condition, disorder, disease, or condition being sought to be prevented in the subject biochemical indications of; and / or the specific compounds and / or compositions used Depends on the nature.

[0115] Inhibitors of STMN2 transcripts containing cryptic exons In certain embodiments, STMN2 levels (e.g., STMN2 mRNA or total long STMN2 protein level) and / or activity (e.g., biological activity, e.g., S STMN2 activity) is expressed in STMN2 gene products containing cryptic exons (e.g., STMN2 pre- mRNA) can be increased, restored, or stabilized using compounds or compositions that target the do.

[0116] In some embodiments, the inhibitor of an STMN2 transcript containing a cryptic exon is Inhibitors of STMN2 based on STMN2 (e.g., STMN2 shRNA, STMN2 siRN A, STMN2 PNA, STMN2 LNA, 2'-O-methyl (2'OMe)STM N2 antisense oligonucleotide (AON), 2'-O-(2-methoxyethyl) ( 2'MOE) STMN2 AON, or STMN2 morpholino oligomers (e.g., morpholino (PMO)), or a composition containing such a compound. In some embodiments, the inhibitor of STMN2 may be, but is not limited to, , 2'OMe (e.g., STMN2 AONs containing one or more 2'OMe-modified sugars) ), MOE (e.g., containing one or more MOE-modified sugars (e.g., 2'-MOE) STMN2 AON), PNA (e.g., one or more N-(2-aminoethyl)-glycine units, or repeating units in place of the sugar-phosphate backbone STMN2 AONs containing carbonyl methylene bonds as nucleotides), LNAs (e.g., contains multiple locked riboses and 2'-deoxynucleotides or 2'OMe STMN2 AONs, which may be a mixture of nucleotides, c-ETs (e.g., one or STMN2 AONs containing multiple cET sugars), cMOEs (e.g., one or more cM STMN2 AONs containing OE sugars), morpholino oligomers (e.g., one or more STMN2 AON containing PMO-containing backbone), deoxy-2'-fluoronucleosides (e.g., ST containing one or more 2'-fluoro-β-D-arabinonucleosides) MN2 AON), ENA (e.g., STMN2 containing one or more ENA-modified sugars) AON), HNA (e.g., STMN2 AO containing one or more HNA-modified sugars) N), or tcDNA (e.g., STMN containing one or more tcDNA modified sugars 2 AON). In this study, the STMN2 AON was found to contain one or more phosphorothioate linkages, phosphodiesterase linkages, and ester bond, phosphotriester bond, methylphosphonate bond, phosphoramidate bond In this case, phosphorodiamidate morpholino (PMO) bond ("morpholino bond"), peptide Nucleic acid (PNA) bonds, or phosphorothioate bonds, phosphodiester bonds, phosphonate bonds ester bond, methylphosphonate bond, phosphoramidate bond, phosphorodiamide bond PMO (morpholino) linkages, and PNA linkages, including any combination of In some embodiments, the STMN2 AON comprises one or more phosphorothioate bond, phosphodiester bond, or phosphorothioate and phosphodiester bond Includes combinations.

[0117] STMN2 antisense therapeutic agent Antisense therapeutics target STMN2 mRNA or STMN2 transcripts (e.g., cryptic endonucleases). Nucleic acid-based compounds that can be used to modulate STMN2 pre-mRNA (containing chthonin) Antisense therapeutics are a class of drugs that bind to single- or double-stranded deoxyribonucleic acid ( DNA-based, ribonucleic acid (RNA)-based, or chemical analogs of DNA / RNA Generally, antisense therapeutics can be a combination of antisense therapeutics and pre-mRNA. or mRNA transcribed from a given gene to promote binding between the or pre-mRNA sequence. In certain embodiments, the antisense therapeutic is directed against mRNA or pre-mRNA. A, thereby inhibiting protein translation and the progression of pre-mRNA to mature mRNA. altering splicing (e.g., altering the splicing activity of the relevant protein, e.g., splicing activator) by preventing the binding of target proteins and / or by causing destruction of mRNA. In certain embodiments, antisense therapeutic nucleobases act by inducing The sequence is complementary to a portion of the sense sequence of the targeted gene or mRNA. In certain embodiments, the STMN2 antisense therapeutics described herein are An oligonucleotide containing an oligonucleotide sequence complementary to the RNA sense or a portion thereof In certain embodiments, the STs described herein are nucleotide-based compounds. MN2 antisense therapeutics may be nucleotide chemical analog-based compounds. Synthetic oligonucleotides as therapeutic agents have broad applications across multiple modalities. These applications include ribozymes, small molecule inhibitors, and Interfering RNA (siRNA), microRNA, aptamer, non-coding RNA, sp These include lysing modulation, targeting toxic repeats, gene editing, and immune modulation. The STMN2 oligonucleotides (STMN2 AONs) of the present disclosure are Targeting a transcript (e.g., STMN2 pre-mRNA (e.g., SEQ ID NO: 944)) This prevents abnormal splicing or mis-splicing.

[0118] Antisense oligonucleotides (AONs) are oligonucleotides that are complementary to a target RNA sequence. A specific embodiment of the present invention is a short oligonucleotide-based sequence containing a nucleotide sequence. In some forms, AONs may be 8 to 50 nucleotides in length, e.g., 8, 10, 15, or 20 nucleotides in length. , 20, 25, 30, 35, 40, 45, or 45 nucleotides. In certain embodiments, the AON is 25 nucleotides in length. AONs are chemically modified nucleosides (e.g., 2'-O-methylated nucleosides). nucleosides, or 2'-O-(2-methoxyethyl) nucleosides (2'-O-methoxyethyl) ribonucleosides (2'-MOE)), as well as modified internucleoside linkages (e.g. , phosphorothioate linkages). In certain embodiments, The STMN2 AON is an oligonucleotide complementary to the STMN2 RNA sequence. In certain embodiments, the STMN2 AON described herein comprises the sequence Chemically modified nucleosides and modified internucleoside linkages (e.g., phosphorothioates) may contain ethoxylated bonds).

[0119] Peptide nucleic acids (PNAs) are artificially synthesized molecules with structures that mimic DNA or RNA. PNA is a short polymer of N-(2-amino)- In certain embodiments, the compound comprises a backbone composed of repeating (aminoethyl)-glycine units. Therefore, the STMN2 PNA described herein has high specificity with the STMN2 RNA sequence. It can be used as an antisense therapeutic agent that binds selectively and also inhibits STMN2 levels (e.g. , STMN2 mRNA or protein levels) and / or activity (e.g., biological In some embodiments, the present invention increases, restores, and / or stabilizes a target protein (e.g., STMN2 activity).

[0120] Locked nucleic acids (LNAs) are nucleic acids that contain one or more modified RNA nucleotides (ribose moieties). (wherein the amino acid is modified with an extra bridge linking the 2' oxygen and 4' carbon) LNAs have a higher T than similar oligonucleotide sequences. In certain embodiments, the STMNs described herein are believed to have m. 2 LNA binds to the STMN2 RNA sequence with high specificity and also binds to the STMN2 pre- Suppresses premature polyadenylation of mRNA, as well as the levels of STMN2 (e.g., STM N2 mRNA or protein levels) and / or activity (e.g., biological activity Antisense therapy that increases, restores, and / or stabilizes STMN2 activity (e.g., STMN2 activity). It can be used as a medicine.

[0121] Morpholino oligomers are composed of methylene mol- icrates linked through phosphorodiamidate groups. It is an oligonucleotide compound containing DNA bases linked to a holin ring backbone. In one embodiment, the morpholino oligomer of the invention targets a specific STMN2 pre-mRNA of interest. A sequence, thereby inhibiting premature polyadenylation of pre-mRNA. and STMN2 levels (e.g., STMN2 mRNA or protein levels) and and / or increase, restore, and / or activity (e.g., biological activity, e.g., STMN2 activity). In certain embodiments, the compounds described herein may be designed to stabilize and / or stabilize the The STMN2 morpholino oligomer binds to the STMN2 pre-mRNA sequence with high specificity. It also inhibits premature polyadenylation of STMN2 pre-mRNA and inhibits STMN 2 levels (e.g., STMN2 mRNA or protein levels) and / or activity Increase, restore, and / or stabilize (e.g., biological activity, e.g., STMN2 activity) In certain embodiments, the compounds described herein can be used as antisense therapeutic agents that activate the The described STMN2 morpholino oligomers bind to the STMN2 pre-mRNA sequence. , altering the splicing of STMN2 pre-mRNA and the expression of the STMN2 gene For this purpose, as well as the levels of STMN2 (e.g., STMN2 mRNA or protein levels), level) and / or activity (e.g., biological activity, e.g., STMN2 activity), It can also be used to repair and / or stabilize.

[0122] In some embodiments, the STMN2 antisense therapeutic agent is a 2'OMe (e.g., 1 STMN2 AONs containing one or more 2'OMe-modified sugars), MOEs (e.g., one or STMN2 AONs containing multiple MOE-modified sugars (e.g., 2'-MOE), P N-(2-aminoethyl)-N ... (methyl)-glycine units, or carbonylmethyl as repeating units instead of the sugar-phosphate backbone. STMN2 AONs containing lentrin bonds), LNAs (e.g., one or more locked ribonucleotides) and a mixture of 2'-deoxynucleotides or 2'OMe nucleotides STMN2 AONs, which may be STMN2 AONs, c-ETs (e.g., containing one or more cET sugars), STMN2 AON), cMOE (e.g., STMN containing one or more cMOE sugars) 2 AONs), morpholino oligomers (e.g., containing a backbone containing one or more PMOs), STMN2 AON), deoxy-2'-fluoronucleosides (e.g., one or STMN2 AON containing multiple 2'-fluoro-β-D-arabinonucleosides), E NA (e.g., STMN2 AONs containing one or more ENA-modified sugars), HNA ( For example, an STMN2 AON containing one or more HNA-modified sugars, or a tcDN A (e.g., an STMN2 AON containing one or more tcDNA-modified sugars) In some embodiments, the TMN2 AON can include one or more TMN2 AONs. or multiple phosphorothioate bonds, phosphodiester bonds, phosphotriester bonds, Methylphosphonate bond, phosphoramidate bond, morpholino bond, PNA bond, or are phosphorothioate bonds, phosphodiester bonds, phosphotriester bonds, and methylphosphatase bonds. Any of sulfonate, phosphoramidate, morpholino, and PNA bonds In some embodiments, the STMN2 AON comprises one or more phospho- thioate bond, phosphodiester bond, or phosphorothioate bond and phospho It contains a combination of diester bonds.

[0123] STMN2 antisense oligonucleotide In certain embodiments, as disclosed herein, STMN2 antisense oligonucleotides are A nucleotide is a sequence of 5 to 100 nucleotides in length, e.g., 10 to 40 nucleotides in length. Nucleotides, e.g., 14-40 nucleotides in length, 10-30 nucleotides in length nucleotides, e.g., 14 to 30 nucleotides in length, e.g., 14 to 25 or 15 ~22 nucleotides, or lengths of 18, 19, 20, 21, 22, 23, 24, It may be an oligonucleotide sequence of 25 nucleotides or less. In embodiments, the AON is 25 nucleotides in length. The STMN2 antisense oligonucleotides (AONs) described herein are intended to inhibit the activity of STMN 2 transcript (e.g., pre-mRNA), a portion of the STMN2 transcript, or the STMN2 gene It is a synthetic short oligonucleotide sequence that is complementary to the target sequence.

[0124] In some embodiments, the STMN2 AON is an STMN2 transcript containing cryptic exons ( For example, 80%, 85%, 90%, 95%, or 1% for STMN2 pre-mRNA. In some embodiments, the STMN2 antisense oligonucleotide comprises a sequence of nucleobases that are 0.001% complementary to each other. The nucleobase sequence of the oligonucleotide is located in a portion of the STMN2 transcript containing the cryptic exon. 80%, 85%, 90%, 95%, or 100% for equal length portions of the nucleobases present % complementary, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, or 25 consecutive nucleobases. parameters, such as dissociation constant, melting temperature (Tm), etc., or other criteria, such as Measurement of changes in protein or RNA expression levels, or STMN2 activity or This can be assessed through other assays that measure expression.

[0125] In some embodiments, the STMN2 AON may comprise a non-duplexed oligonucleotide. In some embodiments, the STMN2 AON comprises a first oligonucleotide that encodes an STMN2 protein. a sequence of nucleobases that is perfectly or nearly perfectly complementary to the mRNA sequence, the oligonucleotide is complementary to the sequence of nucleobases of the first oligonucleotide It may comprise a duplex consisting of two oligonucleotides containing an acid-base sequence.

[0126] In some embodiments, the STMN2 AON is an STMN2 gene of one or more species. It can target STMN2 pre-mRNA containing cryptic exons, which is generated from For example, the STMN2 AON is a gene encoding the STMN2 gene of a mammal, such as a human (i.e., The hidden exons of the STMN2 gene in Homo sapiens In certain embodiments, the target may be the STMN2 pre-mRNA, which contains the STMN 2 AON targets human STMN2 pre-mRNA containing cryptic exons. In an embodiment, the STMN2 AON is an STMN2 gene or STM2 gene containing cryptic exons. A nucleobase sequence that is complementary to the nucleobase sequence of N2 pre-mRNA or a portion thereof. Contains columns.

[0127] The STMN2 AONs described herein comprise the oligonucleotides listed in Table 1 below. Antisense oligonucleotides containing the nucleotide sequence:

[0128] [Table 1-1]

[0129] [Table 1-2]

[0130] Table 1-3

[0131] Table 1-4

[0132] Table 1-5

[0133] Table 1-6

[0134] Table 1-7

[0135] Table 1-8

[0136] Table 1-9

[0137] Table 1-10

[0138] Table 1-11

[0139] Table 1-12

[0140] Table 1-13

[0141] Table 1-14

[0142] Table 1-15

[0143] Table 1-16

[0144] Table 1-17

[0145] Table 1-18

[0146] Table 1-19

[0147] Table 1-20

[0148] Table 1-21

[0149] Table 1-22

[0150] Table 1-23

[0151] [Table 1-24]

[0152] * At least one nucleoside bond in the nucleic acid base sequence is a phosphorothioate bond, alkylphosphate bond, phosphorodithioate bond, phosphotriester bond, alkyl propylphosphonate bond, 3-methoxypropylphosphonate bond, methylphosphonate bond , aminoalkylphosphotriester bond, alkylenephosphonate bond, phosphine Thiothioate bond, phosphoramidate bond, phosphoramidothiate bond, phosphorodiamidate (e.g., phosphorodiamidate morpholino (PMO), 3' amino ribose, or 5 (including aminoribose) bonds, aminoalkylphosphoramidate bonds, thiophosphoric acid bonds Amidate bond, thionoalkylphosphonate bond, thionoalkylphosphotriester bond, thiophosphate bond, selenophosphate bond, and boranophosphate bond is selected from.

[0153] Table 2 below identifies additional STMN2 AON sequences:

[0154] [Table 2-1]

[0155] [Table 2-2]

[0156] [Table 2-3]

[0157] [Table 2-4]

[0158] [Table 2-5]

[0159] [Table 2-6]

[0160] [Table 2-7]

[0161] [Table 2-8]

[0162] [Table 2-9]

[0163] [Table 2-10]

[0164] [Table 2-11]

[0165] [Table 2-12]

[0166] Table 3 below identifies representative STMN2 AON sequences:

[0167] [Table 3-1]

[0168] [Table 3-2]

[0169] In some embodiments, the STMN2 AON oligonucleotides listed in Table 3 are All internucleoside linkages of the oligonucleotides are phosphorothioate linkages. Each of the linked nucleosides of the thiol is 2'-O-(2-methoxyethyl) (2'-M OE) nucleosides, and each "C" is replaced with 5-MeC. For example, some In this embodiment, the QSN-31 STMN2 AON (SEQ ID NO: 31) oligonucleotide All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the nucleotides is 2'-O-(2-methoxyethyl)(2'- It is a 5-MeC (MeOE) nucleoside, and each "C" is replaced with 5-MeC. In the form of QSN-36 STMN2 AON (SEQ ID NO: 36) oligonucleotides, All internucleoside linkages are phosphorothioate linkages, and the oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE ) nucleoside, and each "C" is replaced with 5-MeC. All of the QSN-55 STMN2 AON (SEQ ID NO: 55) oligonucleotides The internucleoside bond is a phosphorothioate bond, and the oligonucleotide bond Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, Q is a cyclohexylamino group, and each "C" is replaced with 5-MeC. All nucleotides of the SN-144 STMN2 AON (SEQ ID NO: 144) oligonucleotide The internucleotide bond is a phosphorothioate bond, and the bond type of the oligonucleotide is Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, the QS N-173 STMN2 AON (SEQ ID NO: 173) oligonucleotide The internucleotide bond is a phosphorothioate bond, and the oligonucleotide bond type is Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, the QSN -177 STMN2 AON (SEQ ID NO: 177) oligonucleotide The interosidic linkage is a phosphorothioate linkage, and the linked nucleotides of the oligonucleotide Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. and each "C" is replaced with 5-MeC. All nucleotides of the 181 STMN2 AON (SEQ ID NO: 181) oligonucleotide The internucleotide bond is phosphorothioate, and the oligonucleotide has a linked nucleosin Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. and each "C" is replaced with 5-MeC. All internucleoside sequences of the STMN2 AON (SEQ ID NO: 185) oligonucleotide The linkage is a phosphorothioate linkage, and the linked nucleosides of the oligonucleotide each of which is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside and each "C" is replaced with 5-MeC. All internucleoside bonds of the STMN2 AON (SEQ ID NO: 197) oligonucleotide In the case of oligonucleotides, the linkage is phosphorothioate. each is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, QSN-203 S All internucleoside linkages of the TMN2 AON (SEQ ID NO: 203) oligonucleotide The nucleoside bond of the oligonucleotide is a phosphorothioate bond. Each is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, In some embodiments, each "C" is replaced with 5-MeC. All internucleoside linkages of the MN2 AON (SEQ ID NO: 209) oligonucleotide are , phosphorothioate bond, and that of the linked nucleosides of oligonucleotides They are 2'-O-(2-methoxyethyl) (2'-MOE) nucleosides, and In some embodiments, each "C" is replaced with 5-MeC. All internucleoside linkages of the N2 AON (SEQ ID NO: 215) oligonucleotide are The phosphorothioate bond is also a which is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and Each "C" is replaced with 5-MeC. In some embodiments, QSN-237 STMN 2 All internucleoside linkages of the AON (SEQ ID NO: 237) oligonucleotide are The phosphorothioate bond is also a nucleoside bond of the oligonucleotide. is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is substituted with 5-MeC. In some embodiments, QSN-244 STMN2 All internucleoside linkages of the AON (SEQ ID NO: 244) oligonucleotide are The linkage is a holothioate linkage, and each of the linked nucleosides of the oligonucleotide is , 2'-O-(2-methoxyethyl) (2'-MOE) nucleosides, and each In some embodiments, QSN-252 STMN2 is substituted with 5-MeC. All internucleoside linkages of the AON (SEQ ID NO: 252) oligonucleotide are phospho The oligonucleotide is a thiolate bond, and each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxyethyl) (2'-MOE) nucleosides, and each "C " is replaced with 5-MeC. In some embodiments, QSN-380 STMN2 A All internucleoside linkages of the ON (SEQ ID NO: 380) oligonucleotide are phosphorothioate. The thioate bond is used, and each of the linked nucleosides of the oligonucleotide is 2' -O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is In some embodiments, the QSN-385 STMN2 AON is substituted with 5-MeC. (SEQ ID NO: 385) All internucleoside linkages of the oligonucleotide are phosphorothioate. and each of the linked nucleosides of the oligonucleotide is a 2'- O-(2-methoxyethyl) (2'-MOE) nucleosides, and each "C" is 5 In some embodiments, the QSN-390 STMN2 AON( SEQ ID NO: 390) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl)(2'-MOE) nucleosides, and each "C" is 5- In some embodiments, the QSN-395 STMN2 AON (sequence number 1011111) is substituted with MeC. Column 395) All internucleoside linkages of the oligonucleotide are phosphorothioates. Each of the linked nucleosides of the oligonucleotide is a 2'-O- (2-methoxyethyl) (2'-MOE) nucleosides, and each "C" is a 5-M eC. In some embodiments, the QSN-400 STMN2 AON (sequence No. 400) All internucleoside linkages of the oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-Methoxyethyl) (2'-MOE) nucleosides, and each "C" is a 5-Me In some embodiments, the QSN-169 STMN2 AON (SEQ ID NO: 1) is substituted with C. No. 169) All internucleoside linkages of the oligonucleotide are phosphorothioate bonds. and each of the linked nucleosides of the oligonucleotide is 2'-O-(2 -methoxyethyl) (2'-MOE) nucleoside, and each "C" is 5-MeC In some embodiments, the QSN-170 STMN2 AON (SEQ ID NO: 170) All internucleoside linkages in the oligonucleotide are phosphorothioate linkages. and each of the linked nucleosides of the oligonucleotide is 2'-O-(2- methoxyethyl (2'-MOE) nucleoside, and each "C" is 5-MeC In some embodiments, the QSN-171 STMN2 AON (SEQ ID NO: 1) 71) All internucleoside linkages in the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methyl- 2'-MeC) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, the QSN-172 STMN2 AON (SEQ ID NO: 17) 2) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methionine). 2'-MeOxyethyl (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In some embodiments, the QSN-249 STMN2 AON (SEQ ID NO: 249) ) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy). dimethylethyl (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. are.

[0170] In some embodiments, the STMN2 AON oligonucleotides listed in Table 3 are All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the nucleotides is 2'-O-(2-methoxyethyl)(2'- MOE) nucleosides, and some or all of the "C"s are replaced with 5-MeC For example, in some embodiments, the QSN-31 STMN2 AON (SEQ ID NO: 3) 1) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methionine). hydroxyethyl) (2'-MOE) nucleosides, and some or all of the "C" In some embodiments, the QSN-36 STMN2 AON is not substituted with 5-MeC. (SEQ ID NO: 36) All internucleoside linkages of the oligonucleotide are phosphorothioated. Each of the linked nucleosides of the oligonucleotide is a 2'-O In some embodiments, the nucleoside is a -(2-methoxyethyl) (2'-MOE) nucleoside. QSN-55 STMN2 AON (SEQ ID NO: 55) oligonucleotide The internucleotide bond is a phosphorothioate bond, and the oligonucleotide bond type is Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. and some or none of the "C"s are replaced with 5-MeC. In embodiments, the QSN-144 STMN2 AON (SEQ ID NO: 144) oligonucleotide All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the nucleotides is 2'-O-(2-methoxyethyl)(2'- MOE) nucleosides, and some or all of the "C"s are replaced with 5-MeC In some embodiments, the QSN-173 STMN2 AON (SEQ ID NO: 173) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages, Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy ethyl) (2'-MOE) nucleosides, and some or all of the "C"s are 5- In some embodiments, the QSN-177 STMN2 AON ( SEQ ID NO: 177) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl) (2'-MOE) nucleoside, and part of "C" In some embodiments, QSN-181 ST All internucleoside linkages of the MN2 AON (SEQ ID NO: 181) oligonucleotide are , phosphorothioate bond, and that of the linked nucleosides of oligonucleotides They are 2'-O-(2-methoxyethyl) (2'-MOE) nucleosides, and In some embodiments, some or none of the "C"s are replaced with 5-MeC. N-185 STMN2 AON (SEQ ID NO: 185) oligonucleotide The internucleotide bond is a phosphorothioate bond, and the oligonucleotide bond type is Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. and some or none of the "C"s are replaced with 5-MeC. In embodiments, the QSN-197 STMN2 AON (SEQ ID NO: 197) oligonucleotide All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the nucleotides is 2'-O-(2-methoxyethyl)(2'- MOE) nucleosides, and some or all of the "C"s are replaced with 5-MeC In some embodiments, the QSN-203 STMN2 AON (SEQ ID NO: 203) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages, Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy ethyl) (2'-MOE) nucleosides, and some or all of the "C"s are 5- In some embodiments, the QSN-209 STMN2 AON ( SEQ ID NO: 209) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl) (2'-MOE) nucleoside, and part of "C" In some embodiments, QSN-215 ST All internucleoside linkages of the MN2 AON (SEQ ID NO: 215) oligonucleotide are , phosphorothioate bond, and that of the linked nucleosides of oligonucleotides They are 2'-O-(2-methoxyethyl) (2'-MOE) nucleosides, and In some embodiments, some or none of the "C"s are replaced with 5-MeC. N-237 STMN2 AON (SEQ ID NO: 237) oligonucleotide The internucleotide bond is a phosphorothioate bond, and the oligonucleotide bond type is Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. and some or none of the "C"s are replaced with 5-MeC. In embodiments, the QSN-244 STMN2 AON (SEQ ID NO: 244) oligonucleotide All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the nucleotides is 2'-O-(2-methoxyethyl)(2'- MOE) nucleosides, and some or all of the "C"s are replaced with 5-MeC In some embodiments, the QSN-252 STMN2 AON (SEQ ID NO: 252) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages, Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy ethyl) (2'-MOE) nucleosides, and some or all of the "C"s are 5- In some embodiments, the QSN-380 STMN2 AON ( SEQ ID NO: 380) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl) (2'-MOE) nucleoside, and part of "C" In some embodiments, QSN-385 ST All internucleoside linkages of the MN2 AON (SEQ ID NO: 385) oligonucleotide are , phosphorothioate bond, and that of the linked nucleosides of oligonucleotides They are 2'-O-(2-methoxyethyl) (2'-MOE) nucleosides, and In some embodiments, some or none of the "C"s are replaced with 5-MeC. N-390 STMN2 AON (SEQ ID NO: 390) oligonucleotide The internucleotide bond is a phosphorothioate bond, and the oligonucleotide bond type is Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. and some or none of the "C"s are replaced with 5-MeC. In embodiments, the QSN-395 STMN2 AON (SEQ ID NO: 395) oligonucleotide All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the nucleotides is 2'-O-(2-methoxyethyl)(2'- MOE) nucleosides, and some or all of the "C"s are replaced with 5-MeC In some embodiments, the QSN-400 STMN2 AON (SEQ ID NO: 400) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages, Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy ethyl) (2'-MOE) nucleosides, and some or all of the "C"s are 5- In some embodiments, the QSN-169 STMN2 AON ( SEQ ID NO: 169) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl) (2'-MOE) nucleoside, and part of "C" In some embodiments, QSN-170 ST All internucleoside linkages of the MN2 AON (SEQ ID NO: 170) oligonucleotide are , phosphorothioate bond, and that of the linked nucleosides of oligonucleotides They are 2'-O-(2-methoxyethyl) (2'-MOE) nucleosides, and In some embodiments, some or none of the "C"s are replaced with 5-MeC. N-171 STMN2 AON (SEQ ID NO: 171) oligonucleotide The internucleotide bond is a phosphorothioate bond, and the oligonucleotide bond type is Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. and some or none of the "C"s are replaced with 5-MeC. In embodiments, the QSN-172 STMN2 AON (SEQ ID NO: 172) oligonucleotide All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the nucleotides is 2'-O-(2-methoxyethyl)(2'- MOE) nucleosides, and some or all of the "C"s are replaced with 5-MeC In some embodiments, the QSN-249 STMN2 AON (SEQ ID NO: 249) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages, Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy ethyl) (2'-MOE) nucleosides, and some or all of the "C"s are 5- It is not replaced by MeC.

[0171] Table 4 below identifies additional representative STMN2 AON sequences:

[0172] [Table 4]

[0173] Full-length STMN2 transcript As described herein, the present disclosure provides a method for the expression of full-length STMN2 transcripts in cells. A method for repairing STMN2 comprising exposing a cell to an inhibitor of STMN2 transcripts containing cryptic exons. or contacting the cell with an inhibitor of STMN2 transcripts containing cryptic exons. Such inhibitors sterically block the splicing machinery. binds to the STMN2 pre-mRNA, sterically mimicking TDP43 binding and / or Suppresses premature polyadenylation of STMN2 and increases the level of full-length STMN2 transcripts , and / or can be stabilized.

[0174] In various embodiments, the full-length STMN2 transcript is identified below as SEQ ID NO: 1433. The sequence includes the sequence having the accession number NM_001199214.2.

[0175] [ka]

[0176] In various embodiments, the full-length STMN2 protein is shown below as SEQ ID NO: 1434. The amino acid sequence identified has accession number NP_001186143.1.

[0177] [ka]

[0178] In various embodiments, the full-length STMN2 transcript is identified below as SEQ ID NO: 1435. The sequence includes the sequence having accession number NM_007029.4.

[0179] [ka]

[0180] In various embodiments, the full-length STMN2 protein is shown below as SEQ ID NO: 1436. The amino acid sequence identified has accession number NP_008960.2.

[0181] [ka]

[0182] In various embodiments, the full-length STMN2 transcript is identified below as SEQ ID NO: 1437. The sequence includes the sequence having accession number XM_005251142.2.

[0183] [ka]

[0184] In various embodiments, the full-length STMN2 protein is shown below as SEQ ID NO: 1438. The amino acid sequence identified has accession number XP_005251199.

[0185] [ka]

[0186] STMN2 transcripts with cryptic exons In one embodiment, the STMN2 transcript with cryptic exons is identified as SEQ ID NO: 944. The sequences may include sequences presented in the

[0187] [ka]

[0188] In one embodiment, the STMN2 transcript having cryptic exons is a pre-mRNA ST In one embodiment, the STMN2 transcript has a cryptic exon. may comprise the sequence presented as SEQ ID NO: 1391.

[0189] [ka]

[0190]

change

[0191]

change

[0192]

change

[0193]

change

[0194]

change

[0195]

change

[0196]

change

[0197]

change

[0198]

change

[0199]

change

[0200]

change

[0201] [ka]

[0202] [ka]

[0203] [ka]

[0204] [ka]

[0205] [ka]

[0206] [ka]

[0207] [ka]

[0208] [ka]

[0209] The STMN2 cryptic exon sequence within the STMN2 transcript is presented as SEQ ID NO: 447. do.

[0210] [ka]

[0211] In various embodiments, the STMN2 transcript with cryptic exons is SEQ ID NO: 944 and 945. In various embodiments, the STMN has a cryptic exon. 2 transcripts were at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 210%, 220%, 230%, 240%, 250%, 260%, Share 5%, 96%, 97%, 98%, 99%, or 100% identity.

[0212] STMN2 antisense oligonucleotides targeting several parts of the STMN2 transcript Chido In various embodiments, the STMN2 AON disclosed herein contains a cryptic exon. Targets several specific portions of the STMN2 transcript, including SEQ ID NO: 944 shown above. describes an example of an STMN2 transcript that contains a cryptic exon. The STMN2 transcript containing the cryptic exon has at least the nucleobase sequence of SEQ ID NO:944. may share 80%, 85%, 90%, 95%, or 100% identity.

[0213] In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript. The specific portion of the STMN2 transcript has a length of 10 nucleobases. In this embodiment, the STMN2 AON targets a specific portion of the STMN2 transcript and inhibits the STMN2 transcription factor. The specific portion of the N2 transcript is nucleobases 11, 12, 13, 14, 15, 16, 17, and 18 , 19, 20, 21, 22, 23, 24, or 25 minutes in length.

[0214] In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript. The specific portion of the STMN2 transcript is located at positions 121 to 144 of SEQ ID NO: 944. ~168, 146~170, 150~170, 150~172, 150~174, 169 ~193, 169~189, 169~191, 170~190, 170~192, 171 ~191, 171~193, 172~192, 172~194, 170~194, 171 ~195, 172~196, 173~197, 185~209, 197~221, 237 Contains one of ~261, 249~273, 252~276, or 276~300 In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript. The specific portion of the STMN2 transcript is the sequence from positions 144 to 164 of SEQ ID NO: 944. 4~166, 145~167, 146~166, 146~168, 147~165, and In some embodiments, the STMN2 AON comprises any one of 148 to 168. A specific portion of the STMN2 transcript is targeted, and the specific portion of the STMN2 transcript is No. 944 positions 173-191, 173-193, 173-195, 173-197, 1 One of 75-195, 175-197, 177-197, or 179-197 In some embodiments, the STMN2 AON comprises a specific portion of the STMN2 transcript. The specific portion of the STMN2 transcript targeted is position 185-205 of SEQ ID NO: 944, 187-209, 189-209, 185-207, 197-217, 197-219, or any one of 191 to 209. In some embodiments, the STMN2 AON The specific portion of the STMN2 transcript is targeted to the sequence. Column number 944: positions 237-255, 237-257, 237-259, 239-259 , 239-261, 241-261, 237-257, 249-269, 249-271 , 252-272, 252-274, or 243-261.

[0215] In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript. The specific portion of the STMN2 transcript is located at positions 121 to 144 of SEQ ID NO: 944. ~168, 146~170, 150~170, 150~172, 150~174, 169 ~193, 169~189, 169~191, 170~190, 170~192, 171 ~191, 171~193, 172~192, 172~194, 170~194, 171 ~195, 172~196, 173~197, 185~209, 197~221, 237 From one of ~261, 249~273, 252~276, or 276~300 In some embodiments, the STMN2 AON targets a specific portion of the STMN2 transcript. The specific portion of the STMN2 transcript is located at positions 144 to 164 of SEQ ID NO: 944. 44~166, 145~167, 146~166, 146~168, 147~165, or any one of 148 to 168. In some embodiments, the STMN2 AON The specific portion of the STMN2 transcript is targeted to the sequence. Column number 944: positions 173-191, 173-193, 173-195, 173-197 , 175-195, 175-197, 177-197, or 179-197 In some embodiments, the STMN2 AON comprises a specific The specific portion of the STMN2 transcript is located at positions 185-244 of SEQ ID NO: 944. 05, 187-209, 189-209, 185-207, 197-217, 197-2 19, or any one of 191 to 209. In some embodiments, STMN2 The AON targets a specific portion of the STMN2 transcript and The amino acid sequence is shown in SEQ ID NO: 944 at positions 237-255, 237-257, 237-259, and 239. ~259, 239~261, 241~261, 237~257, 249~269, 249 From one of ~271, 252~272, 252~274, or 243~261 become.

[0216] In various embodiments, the STMN2 AON comprises positions 144-164 of SEQ ID NO:944; 144-166, 145-167, 146-166, 146-168, 147-165, 148-168, 173-191, 173-193, 173-195, 173-197, 175~195, 175~197, 177~197, 179~197, 185~205, 185-207, 197-217, 197-219, 187-209, 189-209, 191-209, 237-255, 237-257, 237-259, 239-259, 239-261, 241-261, 237-257, 249-269, 249-271, Nucleic acids contained in any one of 252 to 272, 252 to 274, or 243 to 261 Contains a portion of at least 10 consecutive nucleobases that is complementary to an isometric stretch of bases In various embodiments, the STMN2 AON comprises the sequence of nucleobases of SEQ ID NO: 944. Position 144~164, 144~166, 145~167, 146~166, 146~16 8, 147-165, 148-168, 173-191, 173-193, 173-19 5, 173-197, 175-195, 175-197, 177-197, 179-19 7, 185-205, 185-207, 197-217, 197-219, 187-20 9, 189-209, 191-209, 237-255, 237-257, 237-25 9, 239-259, 239-261, 241-261, 237-257, 249-26 9, 249-271, 252-272, 252-274, or 243-261 or one of the nucleic acid sequences complementary to an isometric portion of at least 11, 12, or 1 3, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 The nucleic acid sequence includes a portion of the nucleic acid sequence of consecutive nucleic acid bases.

[0217] In various embodiments, the oligonucleotide is directed to SEQ ID NO: 944 or to SEQ ID NO: At least 90% identity (e.g., 19 to 50 consecutive nucleobases) to No. 944 For example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 % or 100% identity) to an equivalent length portion of the transcript For example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to a sequence of at least 19 consecutive nucleobases nucleosides, provided that at least one of the nucleosides of the linked nucleosides The hydroxyl bond is a non-natural bond. In various embodiments, the oligonucleotide has the structure of SEQ ID NO:9 44 or a portion of 19 to 50 consecutive nucleobases of SEQ ID NO: 944 At least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 9 for equal-length portions of transcripts with identity of 7%, 98%, 99%, or 100%). At least 90% complementary (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) A bound nucleobase having a sequence of 0, 21, 22, 23, 24, or 25 consecutive nucleobases. nucleosides, provided that at least one nucleoside bond of the linked nucleosides is non-natural It is a natural bond.

[0218] In various embodiments, the oligonucleotides are selected from the group consisting of SEQ ID NOs: 1-446, 894- 918, SEQ ID NOs: 945 to 1390, or any one of SEQ ID NOs: 1392 to 1432 at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) at least 19 consecutive nucleobases, including a portion of at least 10 consecutive nucleobases In various embodiments, the oligonucleotide comprises linked nucleosides having the sequence , SEQ ID NOs: 1 to 446, 894 to 918, 945 to 1390, or At least 90% identity (e.g., 1392-1432) with the same length of any one of the sequences For example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 9 9%, or 100% identity) , 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleoside salts A linked nucleoside having a sequence of at least 19 consecutive nucleobases, including a portion of the base Includes.

[0219] In various embodiments, the oligonucleotide is selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55 , 144, 146, 150, 169, 170, 171, 172, 173, 177, 181 , 185, 197, 203, 209, 215, 237, 244, 249, 252, 380 , 385, 390, 395, 400, 975, 980, 985, 999, 1088, 10 90, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 11 25, 1129, 1141, 1147, 1153, 1159, 1181, 1188, 11 93, 1196, 1324, 1329, 1334, 1339, or 1344 A sequence with at least 90% identity (e.g., 90%, 91%, 92%, 93%) 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) at least 19 consecutive nucleic acid sequences comprising a portion of at least 10 consecutive nucleic acid bases It includes linked nucleosides having a sequence of bases, provided that at least one of the linked nucleosides Another nucleoside linkage is a non-natural linkage. The codes are SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 17 0, 171, 172, 173, 177, 181, 185, 197, 203, 209, 21 5, 237, 244, 249, 252, 380, 385, 390, 395, 400, 97 5, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1 115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1 153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1 At least 90% identical to one of the equal lengths of 334, 1339, or 1344 Unity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 9 8%, 99%, or 100% identity) 4, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 reams A linked nucleotide having a sequence of at least 19 consecutive nucleobases, including a portion of the consecutive nucleobases. nucleosides, provided that at least one nucleoside bond of the linked nucleoside is non- It is a natural bond.

[0220] In various embodiments, the oligonucleotide comprises a sequence of at least 19 consecutive nucleobases and wherein the nucleic acid base sequence is any of SEQ ID NOs: 894-9. 18 or any one of the equal length portions of SEQ ID NOs: 1392 to 1432, 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, At least 10 consecutive sequences that share 97%, 98%, 99%, or 100% identity In various embodiments, the oligonucleotide comprises at least 20 nucleobases. , 21, 22, 23, 24, or 25 consecutive nucleic acid bases. The nucleic acid sequence is SEQ ID NO: 894 to 918 or SEQ ID NO: 13. At least 90% identity (e.g., 92 to 1432) to any one of the isotopic portions , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% , or 100% identity) .

[0221] In various embodiments, the oligonucleotide comprises a sequence of at least 19 consecutive nucleobases and wherein the nucleic acid base sequence is any of SEQ ID NOs: 894-9. 18 or any one of the equal length portions of SEQ ID NOs: 1392 to 1432, 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) In various embodiments, the oligonucleotide comprises at least two nucleobases. A bound nucleobase having a sequence of 0, 21, 22, 23, 24, or 25 consecutive nucleobases. oside, provided that the sequence of the nucleic acid bases is SEQ ID NO: 894 to 918 or SEQ ID NO: 1 At least 90% identity (e.g., For example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 100% or 100% identity) nothing.

[0222] In various embodiments, the oligonucleotide comprises a sequence of at least 19 consecutive nucleobases and the nucleic acid base sequence is SEQ ID NO: 894 to 918 or is at least 90% identical to any one portion of SEQ ID NOs: 1392 to 1432 Sex (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 99%, or 100% identity) , 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive Contains a portion of a nucleic acid base.

[0223] In various embodiments, the sequence of nucleobases is from positions 121 to 144, 14 4~168, 146~170, 150~170, 150~172, 150~174, 16 9-193, 169-189, 169-191, 170-190, 170-192, 17 1-191, 171-193, 172-192, 172-194, 170-194, 17 1-195, 172-196, 173-197, 185-209, 197-221, 23 7-261, 249-273, 252-276, or 276-300 At least 90% complementary (e.g., 90%, 9 1%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 10 0% complementary), comprising a portion of at least 10 contiguous nucleobases. The nucleic acid base sequence is SEQ ID NO: 944, positions 121 to 144, 144 to 168, and 146 to 168. 170, 150-170, 150-172, 150-174, 169-193, 169- 189, 169-191, 170-190, 170-192, 171-191, 171- 193, 172~192, 172~194, 170~194, 171~195, 172~ 196, 173-197, 185-209, 197-221, 237-261, 249- Nucleic acid bases contained in any one of 273, 252-276, or 276-300, etc. at least 90% complementary (e.g., 90%, 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary), At least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 2 It comprises a portion of 3, 24, or 25 consecutive nucleobases.

[0224] In various embodiments, the sequence of nucleobases is from positions 121 to 144, 14 4~168, 146~170, 150~170, 150~172, 150~174, 16 9-193, 169-189, 169-191, 170-190, 170-192, 17 1-191, 171-193, 172-192, 172-194, 170-194, 17 1-195, 172-196, 173-197, 185-209, 197-221, 23 7-261, 249-273, 252-276, or 276-300 At least 90% complementary (e.g., 90%, 9 1%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 10 0% complementary), comprising a portion of at least 10 contiguous nucleobases. The nucleic acid base sequence is SEQ ID NO: 944, positions 121 to 144, 144 to 168, and 146 to 168. 170, 150-170, 150-172, 150-174, 169-193, 169- 189, 169-191, 170-190, 170-192, 171-191, 171- 193, 172~192, 172~194, 170~194, 171~195, 172~ 196, 173-197, 185-209, 197-221, 237-261, 249- Nucleic acid bases contained in any one of 273, 252-276, or 276-300, etc. at least 90% complementary (e.g., 90%, 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary), At least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 2 It comprises a portion of 3, 24, or 25 consecutive nucleobases.

[0225] In various embodiments, the portion of the nucleobase sequence is located at positions 121-14 of SEQ ID NO:944. 4, 144-168, 146-170, 150-170, 150-172, 150-17 4, 169-193, 169-189, 169-191, 170-190, 170-19 2, 171-191, 171-193, 172-192, 172-194, 170-19 4, 171-195, 172-196, 173-197, 185-209, 197-22 1, 237-261, 249-273, 252-276, or 276-300 or 100% complementary to an isometric portion of the nucleobases contained in one of the nucleic acids. A portion of the nucleic acid base sequence is located at positions 144 to 164, 144 to 166 of SEQ ID NO: 944. , 145-167, 146-166, 146-168, 147-165, or 148- 100% complementary to an isometric stretch of nucleobases contained in any one of 168. In various embodiments, the portion of the nucleobase sequence is from positions 173 to 191 of SEQ ID NO: 944, 173~193, 173~195, 173~197, 175~195, 175~197, The isometric portion of the nucleic acid bases in either 177-197 or 179-197 In various embodiments, a portion of the sequence of nucleobases is 100% complementary to SEQ ID NO: No. 944 positions 185-205, 187-209, 189-209, 185-207, 1 Nucleic acid salts contained in any one of 97-217, 197-219, or 191-209 In various embodiments, the nucleic acid is 100% complementary to the equivalent length of the base. The portion is located at positions 237-255, 237-257, 237-259, and 234 of SEQ ID NO: 944. 9-259, 239-261, 241-261, 237-257, 249-269, 24 9-271, 252-272, 252-274, or 243-261 It is 100% complementary to an isometric portion of the nucleobases involved.

[0226] STMN2 antisense oligonucleotide variants In various embodiments, the STMN2 AON is hereinafter referred to as an STMN2 AON variant. The STMN2 AON variants are 5-1 in length. 00 nucleotides in length, e.g., 10-40 nucleotides in length, e.g., 14- 40 nucleotides, 10-30 nucleotides in length, e.g., 14-30 nucleotides, e.g., 16-28 nucleotides in length, e.g., 19-23 nucleotides in length nucleotides, e.g., 21 to 23 nucleotides in length, e.g., or 18 nucleotides in length, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 The STMN2 AON variant can be an oligonucleotide sequence of nucleotides of , an oligonucleotide complementary to a portion of the STMN2 pre-mRNA sequence or the STMN2 gene sequence The nucleic acid sequence may be a oligonucleotide sequence.

[0227] In various embodiments, the STMN2 AON variant is selected from the group consisting of SEQ ID NOs: 1-446 or SEQ ID NOs: 1-446. A corresponding nucleic acid sequence containing a nucleic acid base sequence selected from any one of sequence numbers 945 to 1390. It represents a modified version of the STMN2 AON. The AON variant is any one of SEQ ID NOs: 1 to 446 or SEQ ID NOs: 945 to 1390. A nucleic acid sequence representative of a truncated version of the nucleobase sequence of the STMN2 AON, selected from As an example, the STMN2 AON is a 25-mer (e.g., 2 5 nucleotides), the variant (e.g., STMN2 variant) Shorter versions of the 5mer STMN2 AON (e.g., 15mer, 16mer) , 17mer, 18mer, 19mer, 20mer, 21mer, 22mer, 23m In one embodiment, the STMN2 AON barrier may comprise a 24-mer or a 25-mer. The sequence of nucleic acid bases of a given compound is determined by the sequence of 1, 2, 3, 4, 5, or 6 nucleotides in the sequence STMN. 2) AON nucleobase sequences are removed from either or both of the 3' and 5' ends. The STMN2 AON differs from the corresponding nucleobase sequence in that it contains one In this embodiment, the corresponding STMN2 AON variant has two nucleotides at the end of ST The 25-mer contained in the MN2 AON has been removed from either the 3' or 5' end. In one embodiment, the corresponding STMN2 AON variant may comprise a 23-mer. are derived from the 3' and 5' ends of the 25mer contained in the STMN2 AON. In one embodiment, the corresponding The STMN2 AON variants that are involved in this process are located in the 3' region of the 25mer in the STMN2 AON. It contains a 21-mer with two nucleotides removed from each of the terminal and 5' terminal ends. In one embodiment, the corresponding STMN2 AON variant is Four nucleotides are removed from the 3' or 5' end of the 25-mer contained in the ON. In one embodiment, the corresponding STMN2 AON barrier The components are the 3' and 5' ends of the 25-mer in the STMN2 AON. In one embodiment, the nucleotide sequence may comprise a 19-mer having three nucleotides removed from The corresponding STMN2 AON variant is a 25-mer variant included in the STMN2 AON. May include a 19-mer with 6 nucleotides removed from the 3' or 5' end .

[0228] Examples of STMN2 AON variant sequences are shown in Table 3 below. An example of a variant is between an STMN2 AON variant and the corresponding STMN2 AON. Each is associated with an identifier that describes the difference between the two. For example, STMN2 AON The variant comprises SEQ ID NO: 894 and has the identifier: QSN-144-1 / 5-1 / 3 This first part of the identifier "QSN-144" is identified using the STMN2 A The ON variant comprises a modification of the QSN-144 STMN2 AON, including SEQ ID NO: 144. It also indicates that it is a version. It also includes the numeric indicator "1 / 5-1 / 3". The second portion of the QSN-144 STMN2 AON is 5' to the nucleobase sequence contained in the QSN-144 STMN2 AON. One nucleotide has been removed from each of the terminal and 3' termini (e.g., the sequence One nucleotide has been removed from each of the 3' and 5' ends of number 144. To provide another example, the STMN2 AON variant is No. 895 and identified as QSN-144-2 / 3. The ON variant is a modified version of the QSN-144 STMN2 AON. The index "2 / 3" indicates that two nucleotides are present in the nucleic acid of QSN-144 STMN2 AON. The sequence of bases is removed from the 3' end of the sequence (e.g., 2 bases from the 3' end of SEQ ID NO: 144). This indicates that the hydroxyl group has been removed.

[0229] In some embodiments, the STMN2 AON variant is in that one or more internucleoside linkages are phosphodiester bonds In such an embodiment, the STMN2 AO The length of the N variant can be the same as the corresponding STMN2 AON (e.g., 25 nucleotides in length). In some embodiments, phosphodiester internucleosides The bond can link 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides. Attach.

[0230] In some embodiments, the phosphodiester internucleoside linkage is at the 3' or 5' terminus. Attaches nucleotides located at one or both ends, e.g., the 3' or 5' 2, 3, 4, 5, 6, 7, 8, 9, or 10 consecutive nucleotides at one or both ends The nucleotides are linked via phosphodiester internucleoside linkages.

[0231] In some embodiments, the phosphodiester internucleoside linkages are positioned within the sequence of nucleobases. For example, the 25mer STMN2 AON variant Within the nucleotide sequence, consecutive nucleotides between positions 6 and 15 share phosphodiester internucleoside linkages. In some embodiments, the linkage can be through positions 7-15, 8-14, or Any one of 9 to 13 consecutive nucleotides is a phosphodiester nucleoside Connected through inter-connections.

[0232] Table 5 below identifies variants of the STMN2 AON sequence:

[0233] [Table 5-1]

[0234] [Table 5-2]

[0235] Table 6 below identifies additional variants of the STMN2 AON sequence:

[0236] [Table 6-1]

[0237] [Table 6-2]

[0238] Performance of STMN2 antisense oligonucleotides and variants In general, STMN2 AON and STMN2 AON variants are translated and functional. STM having the ability to produce a functional STMN2 protein (e.g., full-length STMN2). Aiming to increase, restore, rescue, or stabilize N2 mRNA expression levels As an alternative, STMN2 transcripts containing hidden exons can be targeted. In terms of morphology, STMN2 AON and STMN2 AON variants are similar to full-length STMN 2. May exhibit at least a 60%, 70%, 80%, or 90% increase in protein In various embodiments, STMN2 AON and STMN2 AON variants is at least 100%, 200%, 300%, or 40% of the full-length STMN2 protein In some embodiments, the full-length STMN2 protein may exhibit a 0.001% increase. Percent increase achieved using TDP43 antisense oligonucleotides , an increase in the level of full-length STMN2 protein compared to a decrease in the level of full-length STMN2 protein. For example, TD P43 antisense oligonucleotides deplete the full-length STMN2 protein, followed by full-length STM using STMN2 AON or STMN2 AON variants It can be used to increase N2 protein.

[0239] In some embodiments, the STMN2 AON and STMN2 AON variants are In various embodiments, the level of STMN2 transcripts containing the exon is reduced. MN2 AON and STMN2 AON variants are STMN2 with cryptic exons 2 At least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97% of the transcripts In some embodiments, the hidden extract may exhibit a 98% or 99% reduction. The percentage reduction in TDP43 levels using TDP43 antisense oligonucleotides This is a reduction in the level of cryptic exons achieved relative to the increased levels achieved. For example, TDP43 Antisense oligonucleotides increase cryptic exon levels and subsequently STMN 2 AON or STMN2 AON variants to reduce cryptic exon levels It can be used to

[0240] In some embodiments, the STMN2 AON and STMN2 AON variants are At least 10%, 20%, 30%, 40%, 50%, 6% of the full-length STMN2 protein Rescue can be 0%, 70%, 80%, 90%, or 100%. In some embodiments, the percentage of rescue of full-length STMN2 is determined by the TDP43 antisense fragment. The IL-14A- and IL-14B-dependent ... 2 Negative control (e.g., no depletion or treatment) after treatment with AON variants full-length STM in comparison to cells that were not treated with STM or treated with vehicle solution Refers to the percentage of N2.

[0241] In some embodiments, the STMN2 AON and AON variants are selected from the group consisting of full-length STMN In some embodiments, the STMN2 AON exhibits 50% to 100% rescue of STMN2. and AON variants exhibit 60%–100% rescue of full-length STMN2. In some embodiments, the STMN2 AON and AON variants are selected from the group consisting of full-length STMN In some embodiments, the STMN2 AON exhibits 70% to 100% rescue of STMN2. and AON variants exhibit 80%–100% rescue of full-length STMN2. In some embodiments, the STMN2 AON and AON variants are selected from the group consisting of full-length STMN In some embodiments, the STMN2 AON exhibits 90% to 100% rescue of STMN2. and AON variants exhibit 60%–90% rescue of full-length STMN2. In some embodiments, the STMN2 AON and AON variants are selected from the group consisting of full-length STMN2 In some embodiments, the STMN2 AON and The AON variants exhibit 60%-80% rescue of full-length STMN2.

[0242] In certain embodiments, the QSN-31 STMN2 AON (SEQ ID NO: 31) is a full-length In certain embodiments, QSN-31 exhibits 50-80% rescue of STMN2. STMN2 AON (SEQ ID NO: 31) rescues 60-90% of full-length STMN2 In certain embodiments, the QSN-31 STMN2 AON (SEQ ID NO: 31) exhibits In some embodiments, QS All nucleosides of the N-31 STMN2 AON (SEQ ID NO: 31) oligonucleotide The internucleotide bond is a phosphorothioate bond, and the oligonucleotide is a linked nucleoside. Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. and each "C" is replaced with 5-MeC.

[0243] In certain embodiments, the QSN-36 STMN2 AON (SEQ ID NO: 36) is a full-length In certain embodiments, QSN-36 exhibits 50-80% rescue of STMN2. STMN2 AON (SEQ ID NO: 36) rescues 60-90% of full-length STMN2 In certain embodiments, the QSN-36 STMN2 AON (SEQ ID NO: 36) exhibits In some embodiments, QS All nucleosides of the N-36 STMN2 AON (SEQ ID NO: 36) oligonucleotide The inter-side bond is a phosphorothioate bond, and the linked nucleotides of the oligonucleotide Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, the QSN-36 STMN2 AON (SEQ ID NO: 36) oligonucleotide is All internucleoside linkages of the nucleotides are phosphorothioate linkages, and Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxyethyl) 2'-MeC) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC .

[0244] In certain embodiments, the QSN-41 STMN2 AON (SEQ ID NO: 41) is a full-length In certain embodiments, QSN-41 exhibits 50-80% rescue of STMN2. STMN2 AON (SEQ ID NO: 41) rescues 60-90% of full-length STMN2 In certain embodiments, the QSN-41 STMN2 AON (SEQ ID NO: 41) exhibits In some embodiments, QS All nucleotides of the N-41 STMN2 AON (SEQ ID NO: 41) oligonucleotide The internucleotide bond is a phosphorothioate bond, and the oligonucleotide is a linked nucleoside. Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. and each "C" is replaced with 5-MeC.

[0245] In certain embodiments, the QSN-46 STMN2 AON (SEQ ID NO: 46) is a full-length In certain embodiments, QSN-46 exhibits 50-80% rescue of STMN2. STMN2 AON (SEQ ID NO: 46) rescues 60-90% of full-length STMN2 In certain embodiments, the QSN-46 STMN2 AON (SEQ ID NO: 46) exhibits In some embodiments, QS All nucleotides of the N-46 STMN2 AON (SEQ ID NO: 46) oligonucleotide The internucleotide bond is a phosphorothioate bond, and the oligonucleotide is a linked nucleoside. Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. and each "C" is replaced with 5-MeC.

[0246] In certain embodiments, the QSN-55 STMN2 AON (SEQ ID NO: 55) is a full-length In certain embodiments, QSN-55 exhibits 50-80% rescue of STMN2. STMN2 AON (SEQ ID NO: 55) rescues 60-90% of full-length STMN2 In certain embodiments, the QSN-55 STMN2 AON (SEQ ID NO: 55) exhibits In some embodiments, QS All nucleosides of the N-55 STMN2 AON (SEQ ID NO: 55) oligonucleotide The inter-side bond is a phosphorothioate bond, and the linked nucleotides of the oligonucleotide Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In some embodiments, the QSN-55 STMN2 AON (SEQ ID NO: 55) oligonucleotide is All internucleoside linkages of the nucleotides are phosphorothioate linkages, and Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxyethyl) 2'-MeC) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC .

[0247] In certain embodiments, the QSN-144 STMN2 AON (SEQ ID NO: 144) is In certain embodiments, QSN-1 exhibits 50-80% rescue of full-length STMN2. 44 STMN2 AON (SEQ ID NO: 144) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-144 STMN2 AON (SEQ ID NO: 1) exhibits skew. No. 144) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-144 STMN2 AON (SEQ ID NO: 144) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MO E) nucleosides. In some embodiments, the QSN-144 STMN2 AON ( SEQ ID NO: 144) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl)(2'-MOE) nucleosides, and each "C" is 5- It is replaced by MeC.

[0248] In certain embodiments, the QSN-146 STMN2 AON (SEQ ID NO: 146) is In certain embodiments, QSN-1 exhibits 50-80% rescue of full-length STMN2. 46 STMN2 AON (SEQ ID NO: 146) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-146 STMN2 AON (SEQ ID NO: 1) exhibits skew. No. 146) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-146 STMN2 AON (SEQ ID NO: 146) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and the oligonucleotide Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE) It is a nucleoside, and each "C" is replaced with 5-MeC.

[0249] In certain embodiments, the QSN-150 STMN2 AON (SEQ ID NO: 150) is In certain embodiments, QSN-1 exhibits 50-80% rescue of full-length STMN2. 50 STMN2 AON (SEQ ID NO: 150) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-150 STMN2 AON (SEQ ID NO: 1) exhibits skew. No. 150) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-150 STMN2 AON (SEQ ID NO: 150) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and the oligonucleotide Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE) It is a nucleoside, and each "C" is replaced with 5-MeC.

[0250] In certain embodiments, the QSN-169 STMN2 AON (SEQ ID NO: 169) is In certain embodiments, QSN-1 exhibits 50-80% rescue of full-length STMN2. 69 STMN2 AON (SEQ ID NO: 169) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-169 STMN2 AON (SEQ ID NO: 1) exhibits skew. No. 169) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-169 STMN2 AON (SEQ ID NO: 169) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and the oligonucleotide Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE) It is a nucleoside, and each "C" is replaced with 5-MeC.

[0251] In certain embodiments, the QSN-170 STMN2 AON (SEQ ID NO: 170) is In certain embodiments, QSN-1 exhibits 50-80% rescue of full-length STMN2. 70 STMN2 AON (SEQ ID NO: 170) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-170 STMN2 AON (SEQ ID NO: No. 170) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-170 STMN2 AON (SEQ ID NO: 170) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and the oligonucleotide Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE) It is a nucleoside, and each "C" is replaced with 5-MeC.

[0252] In certain embodiments, the QSN-171 STMN2 AON (SEQ ID NO: 171) is In certain embodiments, QSN-1 exhibits 50-80% rescue of full-length STMN2. 71 STMN2 AON (SEQ ID NO: 171) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-171 STMN2 AON (SEQ ID NO: No. 171) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-171 STMN2 AON (SEQ ID NO: 171) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and the oligonucleotide Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE) It is a nucleoside, and each "C" is replaced with 5-MeC.

[0253] In certain embodiments, the QSN-172 STMN2 AON (SEQ ID NO: 172) is In certain embodiments, QSN-1 exhibits 50-80% rescue of full-length STMN2. 72 STMN2 AON (SEQ ID NO: 172) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-172 STMN2 AON (SEQ ID NO: 1) exhibits skew. No. 172) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-172 STMN2 AON (SEQ ID NO: 172) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and the oligonucleotide Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE) It is a nucleoside, and each "C" is replaced with 5-MeC.

[0254] In certain embodiments, the QSN-173 STMN2 AON (SEQ ID NO: 173) is In certain embodiments, QSN-1 exhibits 50-80% rescue of full-length STMN2. 73 STMN2 AON (SEQ ID NO: 173) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-173 STMN2 AON (SEQ ID NO: 1) exhibits skew. No. 173) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-173 STMN2 AON (SEQ ID NO: 173) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MO E) nucleoside. In some embodiments, the QSN-173 STMN2 AON ( SEQ ID NO: 173) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl)(2'-MOE) nucleosides, and each "C" is 5- It is replaced by MeC.

[0255] In certain embodiments, the QSN-177 STMN2 AON (SEQ ID NO: 177) is In certain embodiments, QSN-1 exhibits 50-80% rescue of full-length STMN2. 77 STMN2 AON (SEQ ID NO: 177) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-177 STMN2 AON (SEQ ID NO: 1) exhibits skew. No. 177) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-177 STMN2 AON (SEQ ID NO: 177) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MO E) nucleoside. In some embodiments, the QSN-177 STMN2 AON ( SEQ ID NO: 177) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl)(2'-MOE) nucleosides, and each "C" is 5- In a specific embodiment, the QSN-181 STMN2 AON (sequence Column 181) shows 50-80% rescue of full-length STMN2. In its morphology, the QSN-181 STMN2 AON (SEQ ID NO: 181) is a full-length STMN In certain embodiments, QSN-181 STM exhibits 60-90% rescue. N2 AON (SEQ ID NO: 181) rescued 70-100% of full-length STMN2. In some embodiments, the QSN-181 STMN2 AON (SEQ ID NO: 181) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages, Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy In some embodiments, QSN-181 is a 2'-MOE nucleoside. All internucleoside bonds of the STMN2 AON (SEQ ID NO: 181) oligonucleotide In the case of oligonucleotides, the linkage is phosphorothioate. each is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, And each "C" is replaced with 5-MeC.

[0256] In certain embodiments, the QSN-185 STMN2 AON (SEQ ID NO: 185) is In certain embodiments, QSN-1 exhibits 50-80% rescue of full-length STMN2. 85 STMN2 AON (SEQ ID NO: 185) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-185 STMN2 AON (SEQ ID NO: 1) exhibits skew. No. 185) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-185 STMN2 AON (SEQ ID NO: 185) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MO E) A nucleoside, and each "C" is replaced with 5-MeC. So, all of the QSN-185 STMN2 AON (SEQ ID NO: 185) oligonucleotides All internucleoside linkages are phosphorothioate linkages, and the oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE ) nucleoside. In certain embodiments, the QSN-197 STMN2 AON (sequence Column 197) exhibits 50-80% rescue of full-length STMN2. In its morphology, the QSN-197 STMN2 AON (SEQ ID NO: 197) is a full-length STMN In certain embodiments, QSN-197 STM exhibits 60-90% rescue. N2 AON (SEQ ID NO: 197) rescued 70-100% of full-length STMN2. In some embodiments, the QSN-197 STMN2 AON (SEQ ID NO: 197) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages, Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy In some embodiments, QSN-197 is a 2'-MOE nucleoside. All internucleoside bonds of the STMN2 AON (SEQ ID NO: 197) oligonucleotide In the case of oligonucleotides, the linkage is phosphorothioate. each is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, And each "C" is replaced with 5-MeC.

[0257] In certain embodiments, the QSN-203 STMN2 AON (SEQ ID NO: 203) is In certain embodiments, QSN-2 exhibits 50-80% rescue of full-length STMN2. 03 STMN2 AON (SEQ ID NO: 203) has 60-90% of the full-length STMN2 In certain embodiments, the QSN-203 STMN2 AON (SEQ ID NO: 1) exhibits skew. No. 203) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-203 STMN2 AON (SEQ ID NO: 203) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MO E) nucleoside. In some embodiments, the QSN-203 STMN2 AON ( SEQ ID NO: 203) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl)(2'-MOE) nucleosides, and each "C" is 5- In certain embodiments, the QSN-209 STMN2 AON (sequence number 10010001) is substituted with MeC. Column 209) shows 50-80% rescue of full-length STMN2. In its morphology, the QSN-209 STMN2 AON (SEQ ID NO: 209) is a full-length STMN In some embodiments, QSN-209 STM exhibits 60-90% rescue of 2. All internucleoside linkages of the N2 AON (SEQ ID NO: 209) oligonucleotide are The phosphorothioate bond is also a It is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. In embodiments, the QSN-209 STMN2 AON (SEQ ID NO: 209) is a full-length ST In some embodiments, QSN-209 exhibits 70-100% rescue of MN2. All internucleoside bonds of the STMN2 AON (SEQ ID NO: 209) oligonucleotide In the case of oligonucleotides, the linkage is phosphorothioate. each is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, And each "C" is replaced with 5-MeC.

[0258] In certain embodiments, the QSN-215 STMN2 AON (SEQ ID NO: 215) is In certain embodiments, QSN-2 exhibits 50-80% rescue of full-length STMN2. 15 STMN2 AON (SEQ ID NO: 215) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-215 STMN2 AON (SEQ ID NO: No. 215) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-215 STMN2 AON (SEQ ID NO: 215) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MO E) nucleoside. In some embodiments, the QSN-215 STMN2 AON ( SEQ ID NO: 215) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl)(2'-MOE) nucleosides, and each "C" is 5- In certain embodiments, the QSN-237 STMN2 AON (sequence number 10111111) is substituted with MeC. Column 237) exhibits 50-80% rescue of full-length STMN2. In its guise, the QSN-237 STMN2 AON (SEQ ID NO: 237) is a full-length STMN In certain embodiments, QSN-237 STM exhibits 60-90% rescue. N2 AON (SEQ ID NO: 237) rescued 70-100% of full-length STMN2. In some embodiments, the QSN-237 STMN2 AON (SEQ ID NO: 237) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages, Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy In some embodiments, QSN-237 is a 2'-MOE nucleoside. All internucleoside bonds of the STMN2 AON (SEQ ID NO: 237) oligonucleotide In the case of oligonucleotides, the linkage is phosphorothioate. each is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, And each "C" is replaced with 5-MeC.

[0259] In certain embodiments, the QSN-244 STMN2 AON (SEQ ID NO: 244) is In certain embodiments, QSN-2 exhibits 50-80% rescue of full-length STMN2. 44 STMN2 AON (SEQ ID NO: 244) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-244 STMN2 AON (SEQ ID NO: 1) exhibits skew. No. 244) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-244 STMN2 AON (SEQ ID NO: 244) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MO E) nucleoside. In some embodiments, the QSN-244 STMN2 AON ( SEQ ID NO: 244) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl)(2'-MOE) nucleosides, and each "C" is 5- It is replaced by MeC.

[0260] In certain embodiments, the QSN-249 STMN2 AON (SEQ ID NO: 249) is In certain embodiments, QSN-2 exhibits 50-80% rescue of full-length STMN2. 49 STMN2 AON (SEQ ID NO: 249) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-249 STMN2 AON (SEQ ID NO: No. 249) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-249 STMN2 AON (SEQ ID NO: 249) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and the oligonucleotide Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE) It is a nucleoside, and each "C" is replaced with 5-MeC.

[0261] In certain embodiments, the QSN-252 STMN2 AON (SEQ ID NO: 252) is In certain embodiments, QSN-2 exhibits 50-80% rescue of full-length STMN2. 52 STMN2 AON (SEQ ID NO: 252) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-252 STMN2 AON (SEQ ID NO: No. 252) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-252 STMN2 AON (SEQ ID NO: 252) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MO E) nucleoside. In some embodiments, the QSN-252 STMN2 AON ( SEQ ID NO: 252) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl)(2'-MOE) nucleosides, and each "C" is 5- It is replaced by MeC.

[0262] In certain embodiments, the QSN-380 STMN2 AON (SEQ ID NO: 380) is In certain embodiments, QSN-3 exhibits 50-80% rescue of full-length STMN2. 80 STMN2 AON (SEQ ID NO: 380) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-380 STMN2 AON (SEQ ID NO: No. 380) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-380 STMN2 AON (SEQ ID NO: 380) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MO E) nucleosides. In some embodiments, the QSN-380 STMN2 AON ( SEQ ID NO: 380) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl)(2'-MOE) nucleosides, and each "C" is 5- In certain embodiments, the QSN-385 STMN2 AON (sequence number 10010001) is substituted with MeC. (Column 385) exhibits 50-80% rescue of full-length STMN2. In its morphology, the QSN-385 STMN2 AON (SEQ ID NO: 385) is a full-length STMN In certain embodiments, QSN-385 STM exhibits 60-90% rescue of 2. N2 AON (SEQ ID NO: 385) rescued 70-100% of full-length STMN2. In some embodiments, the QSN-385 STMN2 AON (SEQ ID NO: 385) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages, Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy In some embodiments, QSN-385 is a 2'-MOE nucleoside. All internucleoside bonds of the STMN2 AON (SEQ ID NO: 385) oligonucleotide In the case of oligonucleotides, the linkage is phosphorothioate. each is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, And each "C" is replaced with 5-MeC.

[0263] In certain embodiments, the QSN-390 STMN2 AON (SEQ ID NO: 390) is In certain embodiments, QSN-3 exhibits 50-80% rescue of full-length STMN2. 90 STMN2 AON (SEQ ID NO: 390) has 60-90% of the full-length STMN2. In certain embodiments, the QSN-390 STMN2 AON (SEQ ID NO: No. 390) exhibits 70-100% rescue of full-length STMN2. In this embodiment, the QSN-390 STMN2 AON (SEQ ID NO: 390) oligonucleotide All internucleoside linkages are phosphorothioate linkages, and oligonucleotides Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MO E) nucleosides. In some embodiments, the QSN-390 STMN2 AON ( SEQ ID NO: 390) All internucleoside linkages of the oligonucleotide are phosphorothioate. Each of the linked nucleosides of the oligonucleotide is a 2'-O -(2-methoxyethyl)(2'-MOE) nucleosides, and each "C" is 5- In certain embodiments, the QSN-395 STMN2 AON (sequence (Column 395) exhibits 50-80% rescue of full-length STMN2. In its morphology, the QSN-395 STMN2 AON (SEQ ID NO: 395) is a full-length STMN In certain embodiments, QSN-395 STM exhibits 60-90% rescue. N2 AON (SEQ ID NO: 395) rescued 70-100% of full-length STMN2. In some embodiments, the QSN-395 STMN2 AON (SEQ ID NO: 395) All internucleoside linkages of the oligonucleotide are phosphorothioate linkages, Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methoxy In some embodiments, QSN-395 is a 2'-MOE nucleoside. All internucleoside bonds of the STMN2 AON (SEQ ID NO: 395) oligonucleotide In the case of oligonucleotides, the linkage is phosphorothioate. each is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC. In certain embodiments, QSN-400 S TMN2 AON (SEQ ID NO: 400) rescues 50-80% of full-length STMN2 In certain embodiments, the QSN-400 STMN2 AON (SEQ ID NO: 400) ) exhibits 60-90% rescue of full-length STMN2. In certain embodiments, Q SN-400 STMN2 AON (SEQ ID NO: 400) is a 70-100% clone of full-length STMN2. In some embodiments, QSN-400 STMN2 AO exhibits 0.00% rescue. All internucleoside linkages of the N (SEQ ID NO: 400) oligonucleotide are phosphorothioates. The oligonucleotide has a 2' hydroxylate bond and each of the linked nucleosides of the oligonucleotide has a 2' hydroxylate bond. In some embodiments, the nucleoside is an -O-(2-methoxyethyl) (2'-MOE) nucleoside. All of the QSN-400 STMN2 AON (SEQ ID NO: 400) oligonucleotides All internucleoside linkages are phosphorothioate linkages, and the oligonucleotide Each of the linked nucleosides is 2'-O-(2-methoxyethyl) (2'-MOE) It is a nucleoside, and each "C" is replaced with 5-MeC.

[0264] In certain embodiments, QSN-144-1 / 5-1 / 3 (SEQ ID NO: 894) is a full-length In certain embodiments, QSN-14 exhibits 30-100% rescue of STMN2. 4-1 / 5-1 / 3 (SEQ ID NO: 894) rescues 40-80% of full-length STMN2. In a specific embodiment, QSN-144-1 / 5-1 / 3 (SEQ ID NO: 894) exhibits 50-60% rescue of full-length STMN2. N-144-2 / 3 (SEQ ID NO: 895) is 30-100% reskin of full-length STMN2. In certain embodiments, QSN-144-2 / 3 (SEQ ID NO: 895) exhibits a complete In certain embodiments, QSN-1 exhibits 40-80% rescue of full-length STMN2. 44-2 / 3 (SEQ ID NO: 895) exhibited 50-60% rescue of full-length STMN2. In some embodiments, the QSN-144-2 / 3 STMN2 AON (SEQ ID NO: 8) 95) All internucleoside linkages in the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the oligonucleotide is 2'-O-(2-methyl- It is a 2'-molybdenum-2-ol (2'-MOE) nucleoside.

[0265] In certain embodiments, QSN-144-2 / 5 (SEQ ID NO: 896) is a full-length STMN In certain embodiments, QSN-144-2 / 5 (SEQ ID NO: 896) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-144-2 / 5 (SEQ ID NO: 896) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-144-2 / 5 (sequence number No. 896) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0266] In certain embodiments, QSN-144-2 / 5-2 / 3 (SEQ ID NO: 897) is a full-length In certain embodiments, QSN-14 exhibits 30-100% rescue of STMN2. 4-2 / 5-2 / 3 (SEQ ID NO: 897) rescues 40-80% of full-length STMN2. In a specific embodiment, QSN-144-2 / 5-2 / 3 (SEQ ID NO: 897) In some embodiments, QS exhibits 50-60% rescue of full-length STMN2. N-144-2 / 5-2 / 3 STMN2 AON (SEQ ID NO: 897) oligonucleotide All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Each of the linked nucleosides of the nucleotides is 2'-O-(2-methoxyethyl)(2'- MOE) nucleosides.

[0267] In certain embodiments, QSN-144-3 / 5-3 / 3 (SEQ ID NO: 898) is a full-length In certain embodiments, QSN-14 exhibits 30-100% rescue of STMN2. 4-3 / 5-3 / 3 (SEQ ID NO: 898) rescues 40-80% of full-length STMN2. In a specific embodiment, QSN-144-3 / 5-3 / 3 (SEQ ID NO: 898) In some embodiments, QS exhibits 50-60% rescue of full-length STMN2. All nucleotides of the N-144-3 / 5-3 / 3 (SEQ ID NO: 898) oligonucleotide The inter-side bond is a phosphorothioate bond, and the linked nucleotides of the oligonucleotide Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. is.

[0268] In certain embodiments, QSN-144-4 / 3 (SEQ ID NO: 899) is a full-length STMN In certain embodiments, QSN-144-4 / 3 (SEQ ID NO: 899) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-144-4 / 3 (SEQ ID NO: 899) is a 5'-nucleotide analog of full-length STMN2. In some embodiments, QSN-144-4 / 3 ST All internucleoside linkages of the MN2 AON (SEQ ID NO: 899) oligonucleotide are , phosphorothioate bond, and that of the linked nucleosides of oligonucleotides They are 2'-O-(2-methoxyethyl) (2'-MOE) nucleosides.

[0269] In certain embodiments, QSN-144-4 / 5 (SEQ ID NO: 900) is a full-length STMN In certain embodiments, QSN-144-4 / 5 (SEQ ID NO: 900) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-144-4 / 5 (SEQ ID NO: 900) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-144-4 / 5 (sequence number 144-4 / 5) exhibits 0-60% rescue. No. 900) All internucleoside linkages of the oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0270] In certain embodiments, QSN-173-2 / 3 (SEQ ID NO: 901) is a full-length STMN In certain embodiments, QSN-173-2 / 3 (SEQ ID NO: 901) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-173-2 / 3 (SEQ ID NO: 901) is a 5'-nucleotide analog of full-length STMN2. In some embodiments, QSN-173-2 / 3 ST exhibits 0-60% rescue. All internucleoside linkages of the MN2 AON (SEQ ID NO: 901) oligonucleotide are , phosphorothioate bond, and that of the linked nucleosides of oligonucleotides They are 2'-O-(2-methoxyethyl) (2'-MOE) nucleosides.

[0271] In certain embodiments, QSN-173-2 / 5 (SEQ ID NO: 902) is a full-length STMN In certain embodiments, QSN-173-2 / 5 (SEQ ID NO: 902) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-173-2 / 5 (SEQ ID NO: 902) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-173-2 / 5 (sequence number No. 902) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0272] In certain embodiments, QSN-173-2 / 5-2 / 3 (SEQ ID NO: 903) is a full-length In certain embodiments, QSN-17 exhibits 30-100% rescue of STMN2. 3-2 / 5-2 / 3 (SEQ ID NO: 903) rescues 40-80% of full-length STMN2. In a specific embodiment, QSN-173-2 / 5-2 / 3 (SEQ ID NO: 903) In some embodiments, QS exhibits 50-60% rescue of full-length STMN2. All nucleotides of the N-173-2 / 5-2 / 3 (SEQ ID NO: 903) oligonucleotide The inter-side bond is a phosphorothioate bond, and the linked nucleotides of the oligonucleotide Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. is.

[0273] In certain embodiments, QSN-173-4 / 3 (SEQ ID NO: 904) is a full-length STMN In certain embodiments, QSN-173-4 / 3 (SEQ ID NO: 904) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-173-4 / 3 (SEQ ID NO: 904) is a 5'-nucleotide analog of full-length STMN2. In some embodiments, QSN-173-4 / 3 (sequence number No. 904) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0274] In certain embodiments, QSN-173-4 / 5 (SEQ ID NO: 905) is a full-length STMN In certain embodiments, QSN-173-4 / 5 (SEQ ID NO: 905) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-173-4 / 5 (SEQ ID NO: 905) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-173-4 / 5 (sequence number No. 905) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0275] In certain embodiments, QSN-173-6 / 3 (SEQ ID NO: 906) is a full-length STMN In certain embodiments, QSN-173-6 / 3 (SEQ ID NO: 906) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-173-6 / 3 (SEQ ID NO: 906) is a 5'-nucleotide analog of full-length STMN2. In some embodiments, QSN-173-6 / 3 (sequence number No. 906) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0276] In certain embodiments, QSN-173-6 / 5 (SEQ ID NO: 907) is a full-length STMN In certain embodiments, QSN-173-6 / 5 (SEQ ID NO: 907) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-173-6 / 5 (SEQ ID NO: 907) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-173-6 / 5 (sequence number No. 907) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0277] In certain embodiments, QSN-185-2 / 5 (SEQ ID NO: 908) is a full-length STMN In certain embodiments, QSN-185-2 / 5 (SEQ ID NO: 908) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-185-2 / 5 (SEQ ID NO: 908) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-185-2 / 5 (sequence number 161616) exhibits 0-60% rescue. No. 908) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0278] In certain embodiments, QSN-185-4 / 3 (SEQ ID NO: 909) is a full-length STMN In certain embodiments, QSN-185-4 / 3 (SEQ ID NO: 909) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-185-4 / 3 (SEQ ID NO: 909) is a 5'-nucleotide analog of full-length STMN2. In some embodiments, QSN-185-4 / 3 (sequence number 1616161) exhibits 0-60% rescue. No. 909) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0279] In certain embodiments, QSN-185-4 / 5 (SEQ ID NO: 910) is a full-length STMN In certain embodiments, QSN-185-4 / 5 (SEQ ID NO: 910) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-185-4 / 5 (SEQ ID NO: 910) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-185-4 / 5 (sequence number 161616) exhibits 0-60% rescue. No. 910) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0280] In certain embodiments, QSN-185-6 / 5 (SEQ ID NO: 911) is a full-length STMN In certain embodiments, QSN-185-6 / 5 (SEQ ID NO: 911) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-185-6 / 5 (SEQ ID NO: 911) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-185-6 / 5 (sequence number No. 911) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0281] In certain embodiments, QSN-237-2 / 3 (SEQ ID NO: 912) is a full-length STMN In certain embodiments, QSN-237-2 / 3 (SEQ ID NO: 912) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-237-2 / 3 (SEQ ID NO: 912) is a 5'-nucleotide analog of full-length STMN2. In some embodiments, QSN-237-2 / 3 (sequence number 101111111) exhibits 0-60% rescue. No. 912) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0282] In certain embodiments, QSN-237-2 / 5 (SEQ ID NO: 913) is a full-length STMN In certain embodiments, QSN-237-2 / 5 (SEQ ID NO: 913) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-237-2 / 5 (SEQ ID NO: 913) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-237-2 / 5 (sequence number No. 913) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0283] In certain embodiments, QSN-237-2 / 5-2 / 3 (SEQ ID NO: 914) is a full-length In another embodiment, QSN-237 exhibits 30-100% rescue of STMN2. -2 / 5-2 / 3 (SEQ ID NO: 914) rescues 40-80% of full-length STMN2 In certain embodiments, QSN-237-2 / 5-2 / 3 (SEQ ID NO: 914) exhibits In some embodiments, QSN All nucleotides of the -237-2 / 5-2 / 3 (SEQ ID NO: 914) oligonucleotide The internucleoside bond is a phosphorothioate bond, and the internucleoside bond of the oligonucleotide is a Each of the nucleosides is a 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside. be.

[0284] In certain embodiments, QSN-237-4 / 3 (SEQ ID NO: 915) is a full-length STMN In certain embodiments, QSN-237-4 / 3 (SEQ ID NO: 915) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-237-4 / 3 (SEQ ID NO: 915) is a 5'-nucleotide analog of full-length STMN2. In some embodiments, QSN-237-4 / 3 (sequence number 16161616) exhibits 0-60% rescue. No. 915) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0285] In certain embodiments, QSN-237-4 / 5 (SEQ ID NO: 916) is a full-length STMN In certain embodiments, QSN-237-4 / 5 (SEQ ID NO: 916) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-237-4 / 5 (SEQ ID NO: 916) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-237-4 / 5 (sequence no. 1) exhibits 0-60% rescue. No. 916) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0286] In certain embodiments, QSN-237-6 / 3 (SEQ ID NO: 917) is a full-length STMN In certain embodiments, QSN-237-6 / 3 (SEQ ID NO: 917) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-237-6 / 3 (SEQ ID NO: 917) is a 5'-nucleotide analog of full-length STMN2. In some embodiments, QSN-237-6 / 3 (sequence number 6111111) exhibits 0-60% rescue. No. 917) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0287] In certain embodiments, QSN-237-6 / 5 (SEQ ID NO: 918) is a full-length STMN In certain embodiments, QSN-237-6 / 5 (SEQ ID NO: 918) exhibits 40-80% rescue of full-length STMN2. In this embodiment, QSN-237-6 / 5 (SEQ ID NO: 918) is the 5' amino acid sequence of full-length STMN2. In some embodiments, QSN-237-6 / 5 (sequence number No. 918) All internucleoside linkages of an oligonucleotide are phosphorothioate. linkage, and each of the linked nucleosides of the oligonucleotide is 2'-O-( 2-methoxyethyl (2'-MOE) nucleoside.

[0288] In certain embodiments, QSN-173-po3 (SEQ ID NO: 1417) is a full-length STM In certain embodiments, QSN-173-p o3 (SEQ ID NO: 1417) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-173-po3 (SEQ ID NO: 1417) is a full-length STMN In a specific embodiment, QSN-173-po5 exhibits 50-60% rescue of 2. (SEQ ID NO: 1418) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-173-po5 (SEQ ID NO: 1418) is a full-length STMN2 In a specific embodiment, QSN-173-po5( SEQ ID NO: 1418) exhibits 50-60% rescue of full-length STMN2.

[0289] In certain embodiments, QSN-144-po3 (SEQ ID NO: 1419) is a full-length STM In a specific embodiment, QSN-144-p o3 (SEQ ID NO: 1419) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-144-po3 (SEQ ID NO: 1419) is a full-length STMN In a specific embodiment, QSN-144-po5 exhibits 50-60% rescue of 2. (SEQ ID NO: 1420) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-144-po5 (SEQ ID NO: 1420) is a full-length STMN2 In a specific embodiment, QSN-144-po5( SEQ ID NO: 1420) exhibits 50-60% rescue of full-length STMN2.

[0290] In certain embodiments, QSN-185-po3 (SEQ ID NO: 1421) is a full-length STM In a specific embodiment, QSN-185-p o3 (SEQ ID NO: 1421) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-185-po3 (SEQ ID NO: 1421) is a full-length STMN In a specific embodiment, QSN-185-po5 exhibits 50-60% rescue of 2. (SEQ ID NO: 1422) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-185-po5 (SEQ ID NO: 1422) is a full-length STMN2 In a specific embodiment, QSN-185-po5( SEQ ID NO: 1422) exhibits 50-60% rescue of full-length STMN2.

[0291] In certain embodiments, QSN-237-po3 (SEQ ID NO: 1423) is a full-length STM In a specific embodiment, QSN-237-p o3 (SEQ ID NO: 1423) exhibits 40-80% rescue of full-length STMN2. In certain embodiments, QSN-237-po3 (SEQ ID NO: 1423) is a full-length STMN In a specific embodiment, QSN-237-po5 exhibits 50-60% rescue of 2. (SEQ ID NO: 1424) exhibits 30-100% rescue of full-length STMN2. In certain embodiments, QSN-237-po5 (SEQ ID NO: 1424) is a full-length STMN2 In a specific embodiment, QSN-237-po5( SEQ ID NO: 1424) exhibits 50-60% rescue of full-length STMN2.

[0292] Additional chemically modified STMN2 antisense oligonucleotides The STMN2 AONs described herein contain modified ribonucleosides and modified derivatives. It may include chemically modified nucleosides, including oxyribonucleosides. Modified nucleosides include uracil, uracine, uridine, 2'-O -(2-methoxyethyl) variants, e.g., 2'-O-(2-methoxyethyl)guanosine 2'-O-(2-methoxyethyl) adenosine, 2'-O-(2-methoxyethyl) cytosine, and 2'-O-(2-methoxyethyl)thymidine, except that In certain embodiments, the present invention is not limited to a mixed modality, e.g., STMN. 2. Combination of peptide nucleic acid (PNA) and STMN2 locked nucleic acid (LNA). Chemically Modified nucleosides include locked nucleic acids (LNA), 2'-MOE, 2'-O-methyl 2'-fluoro, and 2'-fluoro-β-D-arabinonucleotides (FANA ), and fluorocyclohexenyl nucleic acid (F-CeNA) variants, with the proviso that Chemical compounds that may be included in the STMN2 AONs described herein include, but are not limited to: The modified nucleosides are based on the method of Johannes and Lucchino (2018) “Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs ” Nucleic Acids Ther. 28(3): 178-93; Rettig and Behlke (2012) "Progress toward in vivo use of siRNAs-II" Mol Ther 20:483-512; and Kh Vorova and Watts (2017) “The chemical evolution of oligonucle "Serpentine therapies of clinical utility" Nat Biotechnol., 35(3):238-48 No. 6,239,999, the contents of each of which are incorporated herein by reference.

[0293] The STMN2 AONs described herein have a 5' phosphate at the end of the oligonucleotide. and chemical modifications that promote stabilization of a phosphatase-resistant analog of the 5' phosphate. It promotes stabilization of the 5' phosphate at the end of the oligonucleotide, or Chemical modifications that are phosphonate-resistant analogs include 5'-methylphosphonate, 5'-methylphosphonate, 5'-Methylenephosphonate, 5'-Methylenephosphonate analogue, 5'-E-vinylphosphonate 5'-E-VP, 5'-phosphorothioate, and 5'-C-methyl analogs These include, but are not limited to, the 5' phosphate and 5' phosphorylation sites at the AON terminal. Chemical modifications that promote the stabilization of phosphatase-resistant analogs of acids are described by Khvorova and and Watts (2017) “The chemical evolution of oligonucleotide therapy” s of clinical utility” Nat Biotechnol., 35(3):238-48, and its contents is incorporated herein by reference.

[0294] In some embodiments described herein, the STMN2 AON described herein are chemically modified nucleosides, such as 2'O-methylribonucleosides, e.g. 2'O-methylcytidine, 2'O-methylguanosine, 2'O-methyluridine, and and / or 2'O-methyladenosine. N is a 5-methylpyrimidine, e.g., 5-methylcytosine, and / or 5-methylproline. Contains one or more chemically modified bases, including phosphorus, e.g., 5-methylguanine. Chemically modified bases include pseudouridine or 5' methoxyuridine. The STMN2 AONs described herein may further include the following chemically modified AONs: Selected nucleosides: 5-methyl-2'-O-methylcytidine, 5-methyl-2'-O-methyl thymidine, 5-methylcytidine, 5-methyluridine, and / or 5-methyl2 '-deoxycytidine.

[0295] The STMN2 AONs described herein comprise one or more oligonucleoside linkages. The STMs described herein may comprise a phosphate backbone with one or more phosphate linkages. N2 AONs may contain modified oligonucleotide backbones, provided that the sequence of nucleobases One or more of the nucleoside bonds may be a phosphorothioate bond, an alkyl phosphine bond, or ate bond, phosphorodithioate bond, phosphotriester bond, alkylphosphonate bond methylphosphonate bond, 3-methoxypropylphosphonate bond, methylphosphonate bond, aminoalkenyl alkylphosphotriester bond, alkylenephosphonate bond, phosphinate bond, phosphonate bond Phosphoramidate bond, phosphoramidothiate bond, phosphorodiamidate (e.g., Phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose (including phosphate) bond, aminoalkylphosphoramidate bond, thiophosphoramidate bond In this case, thionoalkylphosphonate bond, thionoalkylphosphotriester bond, thiophosphatidyl From the group consisting of phosphate bonds, selenophosphate bonds, and boranophosphate bonds In some embodiments of the STMN2 AONs described herein, the nucleic acid salt At least one internucleoside linkage in the group sequence is a phosphorothioate linkage. For example, in some embodiments of the STMN2 AONs described herein, the nucleobase sequence One, two, three, or more internucleoside linkages are phosphorothioate bonds. In a preferred embodiment of the STMN2 AON described herein, the nucleobase All internucleoside linkages in this sequence are phosphorothioate linkages. In some embodiments, SEQ ID NOs: 1 to 446, 894 to 918, and 945 to 1 390, or any of SEQ ID NOs: 1392 to 1432, In some embodiments, all of the nucleotide linkages are phosphorothioate linkages. SEQ ID NOs: 1 to 446, 894 to 918, 945 to 1390, or a sequence In any of the STMN2 AONs 1392 to 1432, the nucleotide bond One or more of the bonds is a phosphorothioate bond.

[0296] In some embodiments, the disclosed STMN2 AONs can be, for example, at the 5' or 3' end. at only one end, or at both the 5' and 3' ends, or in the oligonucleotide at least one modified nucleobase, e.g., 5-methylsulfonyl ... cysteine, and / or at least one methylphosphonate nucleotide, optionally In some embodiments, the STMN2 AON oligonucleotides of the present disclosure may All internucleoside bonds of the nucleotides are phosphorothioate bonds, and oligonucleotides are Each of the linked nucleosides of the dinucleotide is 2'-O-(2-methoxyethyl) (2'-MOE) nucleoside, and each "C" is replaced with 5-MeC.

[0297] Contemplated STMN2 AONs may optionally include at least one modified sugar. For example, the sugar moiety of at least one nucleotide constituting the oligonucleotide is 2' -OH group is OR, R, R'OR, SH, SR, NH2, NR2, N3, CN, F, Cl , Br, and I (wherein R is alkyl or aryl and R' is alkylene) The modified sugar moiety is ribose, which can be substituted with any one selected from the group consisting of: Examples of sugar moieties include 2'-OMe modified sugar moieties, bicyclic sugar moieties, 2'-O-(2-methoxyethoxy) 2'-deoxy-2'-fluoronucleoside (2'MOE), 2'-fluoro -β-D-arabinonucleosides, locked nucleic acids (LNA), constrained ethyl 2'-4' bridges hexitol nucleic acids (cEt), S-cEt, hexitol nucleic acids (HNA), and tricyclic analogs ( For example, tcDNA).

[0298] In some embodiments, the STMN2 AON comprises 2'OMe (e.g., one or more STMN2 AONs containing 2'OMe-modified sugars), MOEs (e.g., one or more M STMN2 AONs containing OE-modified sugars (e.g., 2'-MOE), PNAs (e.g., One or more N-(2-aminoethyl)-glycines linked by amide bonds unit, or contains a carbonyl methylene bond as a repeating unit instead of the sugar-phosphate backbone STMN2 AON), LNA (e.g., containing one or more locked riboses, and and ST, which can be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides. MN2 AON), c-ET (e.g., STMN2 AON containing one or more cET sugars) ON), cMOE (e.g., STMN2 AON containing one or more cMOE sugars), Morpholino oligomers (e.g., STMN2 containing a backbone containing one or more PMOs) AON), deoxy-2'-fluoronucleosides (e.g., one or more 2'-fluoro STMN2 AONs containing fluoro-β-D-arabinonucleosides), ENAs (e.g., STMN2 AONs containing one or more ENA-modified sugars), HNAs (e.g., one or more or multiple HNA-modified sugars), or tcDNA (e.g., In some embodiments, the cDNA comprises a STMN2 AON containing one or more modified sugars. In this study, the STMN2 AON was found to contain one or more phosphorothioate linkages, phosphodiesterase linkages, and ester bond, phosphotriester bond, methylphosphonate bond, phosphoramidate bond , morpholino bond, PNA bond, or phosphorothioate bond, phosphodiester bond In this case, phosphotriester bond, methylphosphonate bond, phosphoramidate bond, In some embodiments, the STMN2 AONs may contain one or more phosphorothioate, phosphodiester, or contains a combination of phosphorothioate and phosphodiester linkages.

[0299] Motor neuron disease Motor neuron disease is a disorder of the function of motor neurons, which coordinate voluntary muscle movements with the brain. Motor neuron diseases are a group of disorders characterized by loss of upper and / or It can affect lower motor neurons and can be sporadic or familial in origin. Neuronal diseases include amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease), progressive bulbar palsy, Paralysis, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, post-polio syndrome This includes ALS with frontotemporal dementia, and ALS with frontotemporal dementia.

[0300] Symptoms of motor neuron disease include muscle breakdown or weakness, muscle pain, spasms, and slurred speech. , difficulty swallowing, loss of muscle control, joint pain, stiffness in the limbs, difficulty breathing, drooling, and loss of muscle control Complete loss of muscle control, including breathing, swallowing, feeding, speaking, and limb movement These symptoms also include depression, memory loss, and difficulty planning. Difficulties with language, behavioral changes, and difficulty assessing spatial relationships and / or personality changes This may be accompanied by aging.

[0301] Motor neuron disease can be diagnosed by skilled clinicians, using a variety of tools and tests, e.g. For example, a neurologist may be involved in the evaluation and diagnosis of motor neuron disease. The risk of developing it can be assessed by blood and urine tests (e.g., the presence of creatine kinase). assay), magnetic resonance imaging (MRI), electromyography (EMG), neurotransmission Evaluate or use non-cardiac catheterization studies (NCS), spinal tap, lumbar puncture, and / or muscle biopsy. Motor neuron disease affects motor and sensory abilities, nerve function, hearing and speech. To assess changes in speech, vision, coordination and balance, mental status, and mood or behavior It can be diagnosed with the aid of a physical and / or neurological examination.

[0302] Amyotrophic lateral sclerosis ALS is a progressive motor neuron disease that disrupts signals to all voluntary muscles. ALS results in atrophy of both upper and lower motor neurons. Symptoms of ALS include weakness and wasting of bulbar muscles, generalized and bilateral loss of strength, spasticity, Muscle spasms, cramps, fasciculations, slurred speech, and difficulty breathing or loss of ability to breathe Some individuals with ALS also suffer from cognitive decline. The researchers identified TDP43-containing aggregates in the cytoplasm of motor neurons. It is characterized by protein and RNA aggregates.

[0303] ALS is most common in men over 40, but in women and children The risk of ALS is also increased by smoking, exposure to chemicals such as lead, and Most cases of ALS are sporadic, with Only about 10% of cases are familial. ALS is caused by sporadic or inherited gene mutations, High levels of glutamate, including protein mishandling. ALS Genetic mutations associated with the disease include the genes SOD1, C9orf72, TARDBP, FUS, ANG, ATXN2, CHCHD10, CHMP2B, DCTN1, ErbB4 , FIG4, HNRPA1, MATR3, NEFH, OPTN, PFN1, PRPH, S ETX, SIGMAR1, SMN1, SPG11, SQSTM1, TBK1, TRPM7 , including mutations in TUBA4A, UBQLN2, VAPB, and VCP.

[0304] frontotemporal dementia Frontotemporal dementia (FTD) is a form of dementia that affects the frontal and temporal lobes of the brain. It has an earlier average age of onset than Alzheimer's disease, 40 years old. Symptoms include extreme changes in behavior and personality, speech and language problems, and movement-related disorders. Symptoms include tremors, rigidity, muscle spasms, weakness, and difficulty swallowing. Subtypes of FTD include: Behavioral variability frontotemporal dementia (BVDE) is characterized by changes in personality and behavior. iant frontotemporal dementia;bvFTD), as well as language ability, speech, writing, and This includes primary progressive aphasia (PPA), which affects comprehension. FTD is caused by the accumulation of tau protein. (Pick bodies) and altered TDP43 function. Approximately 30% of FTD cases % are familial, meaning there are no known risk factors other than a family history of the disease. Associated with FTD The gene mutations that can be attributed are the genes C9orf72, progranulin (GRN), and micro Tubule-associated protein tau (MAPT), UBQLN2, VPC, CHMP2B, TARD BP, FUS, ITM2B, CHCHD10, SQSTM1, PSEN1, PSEN2, These include mutations in CTSF, CYP27A1, TBK1, and TBP.

[0305] Amyotrophic lateral sclerosis with frontotemporal dementia Amyotrophic lateral sclerosis with frontotemporal dementia (ALS with FTD) is a rare but common form of dementia characterized by FTD and ALS is a clinical syndrome that occurs in the same individual. Mutations in are the most common cause of familial forms of ALS and / or FTD Additionally, TBK1, VCP, SQSTMI, UBQLN2, and CHMP2B Mutations in the 2016 gene have also been associated with ALS with FTD. Symptoms of ALS with FTD include: In addition to dramatic personality changes, muscle weakness, muscle atrophy, fasciculations, spasticity, dysarthria, and swallowing problems These include damage to the spinal cord, motor neurons, and the frontal and temporal lobes of the brain. At the level, ALS with FTD has been associated with increased levels of cytoplasmic TDP-43 and / or FUS. TBK1 mutations are associated with ALS, FTD, and Associated with ALS with FTD.

[0306] Treatment method The present disclosure provides a method for treating a neurological disease (e.g., amyotrophic lateral sclerosis) in a patient in need thereof. (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP) , head trauma, spinal cord injury, corticobasal degeneration (CBD) and / or neuropathy, e.g. For example, treating chemotherapy-induced neuropathy, in which ST containing cryptic exons is administering a disclosed inhibitor of MN2 transcript, e.g., STMN2 AON, In some embodiments, it is envisioned in part to treat A method for treating a neurological disease, comprising administering the disclosed STMN2 AON. In some embodiments of the present disclosure, an effective amount of a hidden exogenous The disclosed inhibitors of STMN2 transcripts, including ribonucleotides, are useful for treating neurological disorders and and / or translated to produce functional STMN2 protein, thereby inhibiting STMN2 activity. STMN2 can increase, restore, or stabilize activity and / or function Administered to patients in need to increase, restore, or stabilize mRNA expression This may be done.

[0307] In some embodiments, treating a neurological disorder is a condition associated with a neurological disorder. ameliorating or reducing at least one symptom (e.g., in patients with ALS) (reducing muscle weakness in patients with neurological disorders (e.g. A method of treating a disease (e.g., ALS, FTD, or ALS with FTD) comprising administering a latent exon to a patient. and administering a disclosed inhibitor of STMN2 transcript, e.g., an STMN2 AON, containing an STMN2 AON. In some embodiments, a method is provided for treating a neurological disorder, e.g., a motor neuron. Methods for slowing the progression of chronic rheumatoid arthritis are provided.

[0308] Treating and reducing the risk of developing a neurological disease in a subject in need thereof A method for initiating or delaying the initiation of STMN2 transcripts containing cryptic exons, comprising: Methods comprising administering the disclosed inhibitors, e.g., STMN2 AONs, are described herein. The methods are provided in, for example, treating a subject at risk of developing a neurological disease. for example, administering to the subject an effective amount of the disclosed STMN2 AON. Neurological diseases that can be treated in this manner include motor neuron disease, ALS, FTD, ALS with FTD, progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, Includes spinal muscular atrophy, and post-polio syndrome.

[0309] Prevent or treat neurological diseases (e.g., PD, ALS, FTD, and ALS with FTD) Methods for treating or preventing the disease form part of the present disclosure. Such methods may be used to treat a patient in need thereof. Alternatively, the at-risk patient may be administered an STMN2 AON, such as an STMN2 AON disclosed herein. 2. The method may include administering a pharmaceutical preparation containing an AON. For example, the method may be used to treat a neurological disorder. A method of preventing or treating a patient in need thereof, comprising administering to a patient a STM disclosed herein. Methods are provided that include administering an N2 AON.

[0310] Patients treated using the above methods may have an inhibition of STMN2 transcripts containing cryptic exons. After administration of the agent, for example, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months or later The STMN2 protein is then translated to produce a functional STMN2 protein, thereby targeting the target cell (e.g., Increase, restore, or stabilize STMN2 activity and / or function in motor neurons At least about 5%, 10%, 20% of STMN2 mRNA expression can be increased , 30%, 40% or even 50% increase, recovery, or stabilization. Administering such inhibitors of STMN2 transcripts containing cryptic exons may be beneficial, e.g., in the treatment of at least This may be done on a daily or daily basis. The inhibitor may be administered orally. In some embodiments, the inhibitor is an STMN2 transcript containing a cryptic exon. Inhibitors of the compounds are administered intrathecally or intracisternally. For example, in the embodiments described herein, Inhibitors of STMN2 transcripts containing cryptic exons are administered intrathecally or intracisternally approximately every 3 months. The consequences of administering inhibitors of STMN2 transcripts containing cryptic exons as disclosed herein are as follows: The resulting delay or improvement in the clinical manifestation of neurological disease in patients is due to the presence of cryptic exons. and patients who do not receive an inhibitor of STMN2 transcript, such as those disclosed herein. Compared to at least, for example, 6 months, 1 year, 18 months or even 2 years or longer It may be a little.

[0311] Inhibitors of STMN2 transcripts containing cryptic exons of the present invention, e.g., STMN2 AONs, , can be used alone or in combination with each other, thereby Therefore, at least two inhibitors of the STMN2 transcript containing the cryptic exon of the present invention are combined in a single compound. They may be used together in a composition or as part of a treatment regimen. The oxides can be used alone or in combination with each other, Thereby, at least two STMN2 oligonucleotides are present in a single composition or and are used together as part of a treatment regimen. Inhibitors of the transcripts may also be used in combination with other drugs to treat neurological diseases or conditions. It may also be used.

[0312] Treatment and Evaluation A patient as described herein is at risk for, suffering from, or has a neurological disorder. It refers to any animal diagnosed with it, including mammals, primates, and humans. In certain embodiments, the patient is a non-human mammal, including, but not limited to, a mammal. For example, the patient may be a cat, dog, or horse. The patient is a human. The patient is an individual diagnosed as being at high risk for developing a neurological disease, Those diagnosed with a neurological disease, those with a history of a neurological disease, or those with a history of a neurological disease Symptoms or signs of a neurological disease, e.g., a neurological disease, e.g., amyotrophic lateral sclerosis (ALS) ), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD) , Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), extracranial trauma, spinal cord injury, corticobasal degeneration (CBD) and / or neuropathy, e.g. Patients were evaluated for any signs or symptoms associated with chemotherapy-induced neuropathy. It may also be an individual that has been

[0313] A "patient in need," as used herein, is a patient suffering from any symptom of a neurological disease. or manifestations of a neurological disorder, or a patient who may be suffering from any symptom or manifestation of a neurological disorder, or Any patient who may benefit from the methods of the present disclosure for treating a neurological disease. Patients in need include those diagnosed as being at risk of developing a neurological disease, Patients with a history of neurological disease or who have been previously treated for a neurological disease This may include persons.

[0314] "Effective amount," as used herein, refers to a compound that, when administered to a patient, reduces or alleviates the condition. A therapeutically effective amount refers to that amount of an agent sufficient to at least partially treat a patient's condition. The dosage will vary depending on the route of administration and the age, weight, etc. of the patient being treated. In one embodiment, an effective dose of the disclosed inhibitor of STMN2 transcripts containing cryptic exons is The amount of inhibitor of STMN2 transcripts containing cryptic exons required to treat a genetic disease wherein administration of the agent prevents a neurological disorder from occurring in the subject and Prevent progression (e.g., neurological symptoms such as muscle weakness, spasms, or fasciculations) prevent the onset or increase in severity of neurological disorders, or all associated an amount that alleviates or completely relieves symptoms, i.e., causes regression of the disease .

[0315] The effectiveness of treatment can be assessed by means of assessment of gross symptoms associated with neurological disease, histological assessment, and analytical, biochemical assays, imaging methods, e.g., magnetic resonance imaging, and The efficacy of treatment may be assessed by other known methods. For example, the efficacy of treatment may be assessed by measuring the level of a neurological disorder in a subject. Improvement of disease progression after administration of an inhibitor of STMN2 transcripts containing cryptic exons to cancer patients Ocular symptoms, such as muscle strength and control or gross pathology associated with neurological disease The present invention may also be evaluated by analyzing changes in other aspects of the

[0316] The effectiveness of treatment can also be assessed by, for example, tissue biopsy (e.g., brain, spinal cord, muscle, or motor neuron biopsy). by obtaining a vitreous tissue biopsy and assessing gross tissue or cell morphology or staining characteristics. The expression of proteins or RNA may be assessed at the tissue or cellular level. Biological assays may also be used to assess the effectiveness of treatment. Cytochemistry, immunohistochemistry, Western blotting, or Northern blotting or methods useful for assessing RNA levels, such as quantitative or semi-quantitative polymorphisms. PCR (e.g., digital PCR, dPCR, or d Neurological diseases can be detected in dissociated cells or non-dissociated tissues via PCR (ePCR, qPCR, etc.). The levels of proteins or gene products indicative of the disease may also be assessed. Spinal fluid, extracellular vesicles (e.g., exosome-like cerebrospinal fluid extracellular vesicles) rospinal fluid extracellular vesicles; "CSF exosomes"), e.g., Welton et al. al., (2017) “Cerebrospinal fluid extracellular vesicle enrichment for protein biomarker discovery in neurological disease; multiple sclerosis” J Extracell Ve sicles., 6(1):1-10; and Street et al., (2012) “Identification and proteomic p "Profiling of exosomes in human cerebrospinal fluid" J Transl. Med., 10:5) useful biomarkers found in urine, feces, lymph, blood, plasma, or serum. Neuromarkers (e.g., neurofilament light chain (NEFL), neurofilament heavy chain (NFH)) chain (NEFH), TDP-43 or p75 extracellular domain (p75 ECD The existence of The level of expression may be assessed to assess disease status and the effectiveness of treatment. The presence of useful biomarkers found in plasma and neuronal extracellular vesicles / exosomes The level of expression may be assessed. An additional measure of efficacy is the strength-duration constant (SDU). th duration time constant (SDTC), short-interval intracortical inhibition (SICI), muscle strength measurement, Accurate test of limb isometric strength (ATLIS) ), compound muscle action potential (bio), and ALSFRS-R. In an embodiment, the urinary neurotrophin receptor p75 extracellular domain (p75 ECD )teeth It is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) is related to C9ORF72. Predicting disease status and survival in patients with amyotrophic lateral sclerosis (c9ALS). Clinical CSF pNFH as an investigational prognostic biomarker for successful treatment of c9ALS Increase the possibility of development.

[0317] In assessing the effectiveness of treatment, appropriate controls should be selected to ensure a valid evaluation. For example, the administration of a disclosed inhibitor of STMN2 transcripts containing cryptic exons may be used to Symptoms assessed in patients with chronic diseases were compared before or during the course of treatment. In the same patient at an earlier time point or in another patient not diagnosed with neurological disease Alternatively, S containing cryptic exons can be compared for their symptoms in Results of biochemical or histological analysis of tissues following administration of the disclosed inhibitors of TMN2 transcripts from the same patient or from individuals not diagnosed with a neurological disease or from individuals with hidden endocrine disorders. The results were compared with those of tissue from the same patient before administration of an inhibitor of STMN2 transcripts, including chthonin. Additionally, blood samples after administration of an inhibitor of STMN2 transcripts containing cryptic exons may be Plasma, serum, cells, urine, lymph, spinal fluid, cerebrospinal fluid, or fecal samples are used to treat neurological disorders. Inhibitors of STMN2 transcripts from individuals not diagnosed with or containing cryptic exons In some embodiments, the hidden exon may be compared to an equivalent sample from the same patient prior to administration of the drug. Extracellular vesicles (e.g., CSF exosomes) following administration of an inhibitor of STMN2 transcripts containing ) from individuals not diagnosed with a neurological disease or STs containing cryptic exons Comparison may be made with extracellular vesicles from the same patient prior to administration of an inhibitor of MN2 transcript.

[0318] Validation of inhibition of STMN2 transcripts containing cryptic exons was performed by measuring the expression level of STMN2 or This may be determined by direct or indirect assessment of STMN2 protein activity. STMs containing cryptic exons can be identified using biochemical assays that measure RNA quality or RNA expression. Global inhibition of N2 transcripts may be assessed, for example, by Western blot. or measuring STMN2 protein levels in tissues to assess overall STMN2 levels. Alternatively, ST may be detected by Northern blot or quantitative polymerase chain reaction. MN2 mRNA levels were measured to assess the overall inhibition of STMN2 transcripts, including cryptic exons. The toxicity of the dissociated cells may also be determined via immunocytochemical or immunohistochemical methods. , non-dissociated tissue, extracellular vesicles (e.g., CSF exosomes), blood, serum, or fecal material Another test that is an indicator of STMN2 protein levels or STMN2 signaling activity in the Protein levels may also be assessed.

[0319] Modulation of splicing of STMN2 transcripts containing cryptic exons also contributes to the pathogenesis of STMN2. parameters, such as autophagy, endocytosis, protein aggregation, and plasma , spinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., CSF exosomes), blood, urine, lymph Useful biomarkers found in feces, feces, or tissues (e.g., neurofilament Neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), TDP-43, or p75 ECD ) to identify STMN2 transcripts containing cryptic exons. This may be assessed indirectly by assessing the efficacy of inhibition of transcripts containing cryptic exons. Inhibition of STMN2 transcripts also significantly increased the expression of parameters such as autophagy and endocytosis. levels of expression of cytosis, protein aggregation, and physiological biomarkers, e.g. It may be assessed indirectly, for example by measuring the compound muscle action potential (bio). Measurements included strength-duration time constant (SDTC), short-interval intracortical inhibition (SICI), muscle strength measurement, and quadruple Accurate Testing of Limb Isometric Strength (ATLIS), Compound Muscle Action Potential, and ALSFRS-R In certain embodiments, the urinary neurotrophin receptor p75 extracellular Domain(p75 ECD ) is a predictor of disease progression and prognosis in amyotrophic lateral sclerosis (ALS) The biomarker is phosphorylated neurofilament heavy chain (p) in cerebrospinal fluid (CSF). NFH predicts disease status and survival in patients with c9ALS. A prognostic balance for clinical trials. CSF pNFH as a biomarker may support the successful development of treatments for c9ALS. Increase the

[0320] In some embodiments, the present disclosure provides a method for detecting cryptic exons in cells of patients suffering from a neurological disease. corrects splicing of the STMN2 transcript, thereby producing the full-length STMN2 protein. The present invention provides a method for restoring STMN2 protein expression. The correction may be in any cell in which expression or activity of 2 occurs, including cells of the nervous system (central nervous system, Nervous system, peripheral nervous system, motor neurons, brain, brainstem, frontal lobe, temporal lobe, spinal cord), muscles and bones Cells of the musculoskeletal system include cells of the musculoskeletal system, spinal cord, and cerebrospinal fluid. Cells of the musculoskeletal system include skeletal muscle cells (e.g., muscle Motor neurons include upper motor neurons and lower motor neurons.

[0321] Pharmaceutical Compositions and Routes of Administration The present disclosure also provides pharmaceutical compositions comprising the disclosed inhibitors of STMN2 transcripts containing cryptic exons. In another aspect, the present disclosure provides a method for treating a neurological disease through administration of a composition comprising: A pharmaceutical composition for use in the treatment of neurological disorders is provided. Disclosed antisense oligonucleotides targeting STMN2 transcripts containing chthon and a pharmaceutically acceptable carrier. The term "pharmaceutical composition" refers to a pharmaceutical composition administered to a mammal, e.g., to treat a neurological disorder. , a specified amount of a therapeutic compound in a pharmaceutically acceptable carrier administered to a human, e.g., In some embodiments, a therapeutically effective amount of a therapeutic compound is used. and a pharmaceutically acceptable carrier. Pharmaceutical compositions are contemplated herein. In another aspect, the present disclosure provides a method for treating a neurological disease. The disclosed method for inhibiting STMN2 transcripts containing cryptic exons in the manufacture of a medicament for the treatment of The term "medicament" as used herein means a "pharmaceutical composition." has essentially the same meaning as the term

[0322] As used herein, a "pharmaceutically acceptable carrier" means a carrier that provides a reasonable benefit. excessive toxicity, irritation, allergic response, or other problems or complications commensurate with the benefit / risk ratio Buffers, carriers suitable for use in contact with human and animal tissues without complications, and excipients. A carrier must be compatible with the other ingredients of the formulation and must be acceptable to the recipient. It should be "acceptable" in the sense that it is not harmful to the body. Acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic solutions, and the like that are compatible with pharmaceutical administration. Such media and agents for pharmaceutically active substances include absorption delaying agents and absorption delaying agents. Uses are known in the art. In one embodiment, the pharmaceutical composition is administered orally. and an enteric coating suitable for controlling the site of absorption of the encapsulated material in the digestive system or intestine. For example, enteric coatings include ethyl acrylate-methacrylate copolymers. It may include a polymer.

[0323] In one embodiment, the disclosed inhibitors of STMN2 transcripts containing cryptic exons and Any of the pharmaceutical compositions may be administered by one or several routes, including: topical, intrathecal, intracisternal, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) intravenous), intralesional, oral, rectal, buccal, sublingual, intravaginal, intrapulmonary, intratracheal, intranasal, transdermal, or The term parenteral as used herein may include intravenous or intraduodenal routes. If necessary, subcutaneous injection, intrapancreatic administration, intravenous, intracisternal, intrathecal, intramuscular, intraperitoneal, or intrasternal injection or injection techniques, for example, the disclosed inhibition of STMN2 transcripts containing cryptic exons. The agent may be administered subcutaneously to a subject. In another example, an STMN2 transcript containing a cryptic exon is The disclosed inhibitors of may be orally administered to a subject. The disclosed inhibitors of TMN2 transcripts are administered parenterally to the nervous system or specific sites of the nervous system. Areas or cells (e.g., brain, brainstem, lower motor neurons, spinal cord, upper motor neurons) The present invention may also be used to directly administer the STMN2 transcript containing the cryptic exon. The inhibitor may be administered intrathecally or intracisternally.

[0324] In some embodiments, inhibitors of STMN2 transcripts containing cryptic exons, e.g., STMN 2 AONs can be encapsulated in nanoparticle coatings. Nanoparticle encapsulation prevents degradation of the AONs. It is believed that this prevents the formation of cytoplasmic globulins and enhances cellular uptake. For example, in some embodiments, Inhibitors of STMN2 transcripts containing the exon include cationic polymers, e.g., synthetic polymers. - (e.g., poly-L-lysine, polyamidoamine, poly(β-amino ester), and and polyethyleneimine) or naturally occurring polymers (e.g., chitosan and protanone). In some embodiments, the STM containing the cryptic exon is encapsulated in a coating of PEG-100. Inhibitors of N2 transcripts include lipids or lipid-like materials, e.g., cationic lipids, cationic lipids Encapsulated in a matrix-like material or an ionizable lipid that is positively charged only at acidic pH. For example, in some embodiments, inhibitors of STMN2 transcripts containing cryptic exons are hydrophobic a hydroxyl moiety, e.g., cholesterol and / or polyethylene glycol (PEG) lipids The compound is encapsulated in a lipid nanoparticle comprising:

[0325] In some embodiments, inhibitors of STMN2 transcripts containing cryptic exons, e.g., STM The N2 AON is conjugated to a bioactive ligand, e.g., In some embodiments, inhibitors of STMN2 transcripts containing cryptic exons, e.g., STMN2 AONs are composed of peptides, lipids, N-acetylgalactosamine (GalNAc), cholesterol, and role, vitamin E, antibodies, or cell-penetrating peptides (e.g., transcriptional transactivators It is conjugated to a tetracycline activator (TAT) and penetratin.

[0326] Pharmaceutical compositions containing the disclosed inhibitors of STMN2 transcripts containing cryptic exons, e.g. For example, those disclosed herein can be provided in dosage unit form and optionally The pharmaceutical composition may be prepared by any suitable method, including but not limited to, a method compatible with the intended route of administration. Useful formulations can be prepared by methods well known in the pharmaceutical arts. See, for example, Remington's Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990).

[0327] The pharmaceutical formulations are, in some embodiments, sterile. Sterilization can be achieved, for example, by filtration through sterile filtration membranes. If the composition is lyophilized, sterilizing by filtration may be accomplished by lyophilization and sterilization. It can be performed before or after the original.

[0328] Parenteral administration The pharmaceutical compositions of the present disclosure can be formulated for parenteral administration, e.g., intravenous, intracisternal It may be formulated for injection via intramuscular, subcutaneous, intrathecal, intralesional, or intraperitoneal routes. Aqueous compositions containing the disclosed inhibitors of STMN2 transcripts containing cryptic exons, e.g. For example, the preparation of an aqueous pharmaceutical composition will be known to those of skill in the art in light of the present disclosure. Such compositions may be prepared as injectables, either as liquid solutions or suspensions. A solid suitable for use in preparing a solution or suspension upon addition of liquid prior to injection. Formulations can also be prepared; the preparation can also be emulsified.

[0329] Suitable pharmaceutical forms for injectable use include sterile aqueous solutions or dispersions; saline solutions; Phosphate buffered saline, artificial cerebrospinal fluid, sesame oil, peanut oil or aqueous propylene glycol and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be microbially The product must be protected from the contaminating action of substances such as bacteria and fungi.

[0330] Solutions of the active compound as a free base or a pharmacologically acceptable salt may be prepared in a surfactant, e.g. For example, the dispersion may be prepared in water, suitably mixed with hydroxypropyl cellulose. Also in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils Additionally, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. Additionally, fatty acids such as oleic acid may be used in the preparation of injectable solutions. Injectable preparations may also be prepared in a non-toxic parenterally acceptable diluent or solvent, e.g., 1 Sterile injectable solution, suspension, or emulsion as a solution in 3-butanediol Among the acceptable vehicles and solvents that may be employed are water, lysine, sorbitan, sorbitan-based aqueous solutions, and the like. In one embodiment, the formulations include: The disclosed STMN2 antisense oligonucleotides were prepared in 1% (w / v) carboxylase. Contains sodium methylcellulose and 0.1% (v / v) TWEEN™ 80 Under ordinary conditions of storage and use, these preparations may be suspended in a carrier fluid, such as , contains a preservative to prevent the growth of microorganisms.

[0331] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions, may contain suitable dispersing or wetting agents. and suspending agents may be formulated in accordance with known techniques. Generally, dispersions are The various sterilized active ingredients can be added to a basic dispersion medium and other ingredients from those enumerated above. The sterile injections of the present disclosure are prepared by incorporating the desired ingredients into a sterile vehicle containing the desired other ingredients. The injection solution contains the disclosed STMN2 antisense oligonucleotide (e.g., a hidden exon). Inhibitors of STMN2 transcripts, including agonists, were added to the required volume of a suitable solvent as required. It is prepared by incorporating the above-listed ingredients with various other ingredients, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred method of preparation is vacuum injection. drying and freeze-drying technology, which extracts active ingredients from their previously sterile-filtered solutions. The injectable formulation may be prepared by, for example, adding a powder of the ingredients and any additional desired ingredients. Sterilization can be achieved by filtration through a filter.

[0332] The preparation of more or highly concentrated solutions for intramuscular injection is also contemplated. Therefore, the use of DMSO as a solvent is preferred, as this results in extremely rapid penetration. This results in high concentrations of STMN2 transcripts containing cryptic exons, and small inhibitors of these transcripts are disclosed. This is because the goods are delivered to the designated area.

[0333] Suitable preservatives for use in such solutions are benzalkonium chloride, benzalkonium chloride Suitable buffering agents include benzotriazol, benzotriazol, benzocaine ... Sufficient to maintain the pH between pH 6 and pH 8, e.g., about pH 7 to pH 7.5. In amounts: boric acid, sodium and potassium bicarbonate, sodium and potassium borate, charcoal sodium and potassium phosphate, sodium acetate, and sodium biphosphate Suitable tonicity agents include dextran 40, dextran 70, dextrose, and glycerin. , potassium chloride, propylene glycol, and sodium chloride, etc., and the chloride The sodium equivalent is within the range of 0.9 plus or minus 0.2%. The additives and stabilizers are sodium bisulfite, sodium metabisulfite, sodium thiosulfite, Suitable wetting and clarifying agents include polysorbate 80, Contains polysorbate 20, poloxamer 282 and tyloxapol. Good viscosity increase The agent is dextran 40, dextran 70, gelatin, glycerin, hydroxyethyl Cellulose, hydroxymethylpropyl cellulose, lanolin, methylcellulose, washer phosphorus, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, and Carboxymethyl cellulose and the like.

[0334] Oral administration In some embodiments, oral administration of the disclosed inhibitors of STMN2 transcripts containing cryptic exons is A composition suitable for delivery, for example, an inhibitor of STMN2 transcripts containing cryptic exons, For example, enteric coatings, e.g., gastroresistant coatings, may be used to allow delivery to the gastrointestinal tract of a patient. Tablets containing the compound are contemplated herein.

[0335] For example, disclosed inhibitors of STMN2 transcripts containing cryptic exons, e.g., STMN 2 antisense oligonucleotides, e.g., SEQ ID NOs: 1-446, SEQ ID NOs: 894-9 18, SEQ ID NOs: 945 to 1390, or SEQ ID NOs: 1392 to 1432 and a pharmaceutically acceptable excipient. A tablet for oral administration comprising (e.g., formed at least in part from) granules comprising Such tablets may be coated with an enteric coating. Contemplated tablets may contain pharmaceutically acceptable excipients, such as fillers, binders, disintegrants, and In addition to the above and / or lubricants, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, e.g. Intergreen, orange, xylitol, sorbitol, fructose, and maltose Todextrin, as well as flavoring agents, preservatives and / or antioxidants may be included.

[0336] In some embodiments, contemplated pharmaceutical formulations comprise an STMN2 transcript containing a cryptic exon. The disclosed inhibitors, e.g., STMN2 antisense oligonucleotides, e.g., Sequence numbers 1 to 446, sequence numbers 894 to 918, sequence numbers 945 to 1390, or sequence numbers STMN2 antisense oligonucleotides represented by any of Nos. 1392 to 1432 and pharmaceutically acceptable salts thereof, such as STMN2 antisense oligonucleotides. For example, SEQ ID NOs: 1 to 446, 894 to 918, and 945 to 1390 or an antisense oligonucleotide represented by any of SEQ ID NOs: 1392 to 1432 The granular phase comprises a granular phase containing methicone, a hydroxybenzoate, and a pharmaceutically acceptable filler. The disclosed inhibitors of STMN2 transcripts, including amines, and fillers, optionally with other excipients, They may be blended together and formed into granules. In some embodiments, the intragranular phase may be a wet Granulation may also be used to form the granules, for example, by adding a liquid (e.g., water) to the blended, The inhibitor compound of STMN2 transcript containing the exon is added to the filler and then combined is dried, milled and / or sieved to produce granules. Those skilled in the art will appreciate that other manufacturing methods may be used.

[0337] In some embodiments, contemplated formulations include an extragranular phase, which may comprise one or more and an intragranular phase to form the disclosed formulation. It may also be blended.

[0338] The disclosed formulations may include an intragranular phase that includes a filler. Exemplary fillers include cellulose. sugar, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol cellulose, sorbitol, microcrystalline cellulose, pectin, polyacrylates , dextrose, cellulose acetate, hydroxypropyl methylcellulose, partial alpha Others include, but are not limited to, cellulose, cellulose acetate, cellulose esters, cellulose gum ... Not limited to:

[0339] In some embodiments, the disclosed formulations comprise an intragranular phase and / or a component of the pharmaceutical formulation. The granular phase may include an extragranular phase that generally comprises a binder that may function to hold the particles together. Illustrative exemplary binders include: starch, sugar, cellulose or modified cellulose, e.g. Hydroxypropyl cellulose, lactose, pregelatinized corn starch, polyvinyl alcohol Nylpyrrolidone, Hydroxypropylcellulose, Hydroxypropylmethylcellulose , low-substituted hydroxypropyl cellulose, sodium carboxymethyl cellulose, methyl Others include cellulose, ethyl cellulose, sugar alcohols and combinations thereof These may include, but are not limited to:

[0340] For example, contemplated formulations comprising an intragranular and / or extragranular phase may include a disintegrant, hereinafter Examples include, but are not limited to, starch, cellulose, cross-linked polyvinylpyrrolidone, starch Sodium glycerin, sodium carboxymethylcellulose, alginate tes), cornstarch, croscarmellose sodium, cross-linked carboxymethyl cellulose cellulose, low-substituted hydroxypropyl cellulose, acacia, and combinations thereof. For example, the intragranular and / or extragranular phase may contain a disintegrant. Good too.

[0341] In some embodiments, contemplated formulations include those that disclose STMN2 transcripts containing cryptic exons. Inhibitors and mannitol, microcrystalline cellulose, hydroxypropyl methylcellulose and an excipient selected from sodium starch glycolate or a combination thereof. The granular inner phase contains the agent, as well as microcrystalline cellulose, sodium starch glycolate, and and magnesium stearate, or a mixture thereof. nothing.

[0342] In some embodiments, contemplated formulations may include a lubricant, e.g., the extragranular phase may include a lubricant. Lubricants may include talc, silica, fat, stearin, stearic acid malate, etc. Magnesium, calcium phosphate, silicon dioxide, calcium silicate, calcium phosphate Colloidal silicon dioxide, metal stearates, hydrogenated vegetable oil, partially hydrogenated vegetable oil, corn Starch, Sodium Benzoate, Polyethylene Glycol, Sodium Acetate, Stearyl Calcium phosphate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate , talc, and stearic acid.

[0343] In some embodiments, the pharmaceutical formulation comprises an enteric coating. The barrier for oral medications controls where the drug is absorbed along the digestive tract. Enteric coatings contain polymers that disintegrate at different rates depending on the pH. The enteric coating may be, for example, cellulose acetate phthalate, methyl acrylate, or the like. cellulose acetate succinate, hydroxypropyl methylcellulose Lactose phthalate, methyl methacrylate-methacrylic acid copolymer, ethyl acrylate Methacrylic acid copolymer, methacrylic acid copolymer type C, polyvinyl acetate phthalate, and cellulose acetate phthalate.

[0344] Exemplary enteric coatings include Opadry® AMB, Acryl-E ZE®, Eudragit® grades. The enteric coating accounts for about 5% to about 10% of the tablet by weight, or about 5% to about 20% of the tablet by weight. , 8% to about 15%, about 8% to about 20%, about 10% to about 20%, or about 12% to about 20%, For example, the enteric coating may comprise ethyl acrylate-methyl methacrylate. It may also contain acrylic acid copolymer.

[0345] For example, in contemplated embodiments, from about 0.5% to about 70% by weight, e.g., about 0.5% about 10%, or about 1% to about 20% of the disclosed STMN2 antisense oligonucleotides Tablets comprising or consisting essentially of otide or a pharmaceutically acceptable salt thereof are provided. Such tablets may contain, for example, about 0.5% to about 60% by weight of mannitol, e.g., heavy about 30% to about 50% mannitol by volume, for example, about 40% mannitol by weight; and and / or about 20% to about 40% by weight of microcrystalline cellulose, or about 10% to about 3% by weight of For example, the disclosed tablets may contain about 30% to 100% microcrystalline cellulose by weight. About 60%, e.g., about 45% to about 65%, or alternatively, about 5 to about 10% by weight. STMN2 antisense oligonucleotides, about 30% to about 50%, or alternatively about 5% to about 15% by weight of mannitol, about 5% to about 15% by weight of microcrystalline cellulose, about 0% to about 4%, or about 1% to about 7% hydroxypropyl methylcellulose, and containing sodium starch glycolate in an amount of about 0% to about 4%, e.g., about 2% to about 4% It may also contain an intragranular phase.

[0346] In another contemplated embodiment, the disclosed inhibition of STMN2 transcripts containing cryptic exons. The pharmaceutical tablet formulation for oral administration of the agent comprises an intragranular phase, the intragranular phase comprising the disclosed STMN2 AON or a pharmaceutically acceptable salt thereof (e.g., sodium salt), and a pharmaceutically acceptable salt thereof and the pharmaceutical tablet formulation may also include an extragranular phase, The granular phase may contain pharmaceutically acceptable excipients, such as disintegrants. The present invention may further comprise an ingredient selected from the group consisting of cellulose, magnesium stearate, and mixtures thereof. The pharmaceutical composition may also contain an enteric coating in an amount of about 12% to 20% by weight of the tablet. For example, a pharmaceutically acceptable tablet for oral use may contain 0.5% to 10% by weight of The disclosed STMN2 AON, for example, the disclosed STMN2 AON or a drug thereof a biologically acceptable salt, approximately 30% to 50% by weight of mannitol, approximately 10% to 30% by weight of microcrystalline cellulose, and an enteric coating containing ethyl acrylate-methacrylic acid copolymer It may also include routing.

[0347] In another example, a pharmaceutically acceptable tablet for oral use may contain from about 5 to about 10% by weight of The disclosed STMN2 AONs, e.g., the disclosed STMN2 AONs or pharmaceutical compositions thereof a commercially acceptable salt, about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, About 5% by weight of hydroxypropyl methylcellulose, and about 2% by weight of starch Granular inner phase containing sodium licorate; approximately 17% by weight of microcrystalline cellulose, approximately 2% by weight of % sodium starch glycolate, approximately 0.4% by weight magnesium stearate; and an enteric coating on the tablet comprising ethyl acrylate-methacrylic acid copolymer. The granular phase may comprise an extragranular phase containing

[0348] In some embodiments, the pharmaceutical composition comprises about 13%, or about 15%, 16%, 17% by weight. or an enteric coating, such as AcyrlEZE® ( See, for example, PCT Publication No. WO 2010 / 0548, which is incorporated herein by reference in its entirety. (See Brochure No. 26).

[0349] The rate at which the coating dissolves and the active ingredient is released is the dissolution rate. For example, a contemplated tablet may be prepared by stirring at 100 rpm in a phosphate buffer solution having a pH of 7.2. and 37°C in a USP / EP Type 2 apparatus (paddles). Approximately 50% to 100% of the inhibitors of STMN2 transcripts containing exons were detected in approximately 120 minutes to approximately 24 minutes. In another embodiment, the dissolution profile may be such that the release occurs after 0 minutes, e.g., after 180 minutes. The tablets envisaged are, for example, prepared by stirring at 100 rpm and 300°C in dilute HCl having a pH of 1.0. Hidden extract when tested in a USP / EP Type 2 apparatus (paddle) at 7°C Dissolution profile of inhibitors of STMN2 transcripts containing sucrose with virtually no release after 120 min Contemplated tablets may, in another embodiment, have a pH of, for example, 6.6. The samples were collected in a USP / EP Type 2 apparatus (Pad) at 100 rpm and 37°C in phosphate buffer. Approximately 10% of inhibitors of STMN2 transcripts containing cryptic exons were detected when tested in a cytoplasmic ... The compound may have a dissolution profile in which % to about 30%, or about 50% or less of the active ingredient is released after 30 minutes. stomach.

[0350] In some embodiments, the methods provided herein are for treating a disease disclosed herein. and further comprising administering at least one other agent for the treatment of the disorder. In one embodiment, other contemplated agents are co-administered (e.g., sequentially or simultaneously). may be given.

[0351] Dosage and frequency of administration The dosages or amounts set forth below may be administered in the presence of an oligonucleotide or its pharmaceutically acceptable salt. It refers to either of the salts.

[0352] In some embodiments, the formulation contains at least 1 μg, at least 5 μg, at least 10 μg μg, at least 20 μg, at least 30 μg, at least 40 μg, at least 50 μg, at least 60 μg, at least 70 μg, at least 80 μg, at least 90 μg, or at least 100 μg, of an inhibitor of STMN2 transcripts containing cryptic exons; For example, a dosage form containing an STMN2 antisense oligonucleotide is included. The formulations are available in 10 mg to 500 mg, 1 mg to 10 mg, 10 mg to 20 mg, and 2 0mg~30mg, 30mg~40mg, 40mg~50mg, 50mg~60mg, 6 0mg~70mg, 70mg~80mg, 80mg~90mg, 90mg~100mg, 100mg~150mg, 150mg~200mg, 200mg~250mg, 250m g~300mg, 300mg~350mg, 350mg~400mg, 400mg~45 0mg, 450mg~500mg, 500mg~600mg, 600mg~700mg, 700mg~800mg, 800mg~900mg, 900mg~1g, 1mg~50m g, 20 mg to 40 mg, or 1 mg to 500 mg of STMN2 antisense oligonucleotide Included are dosage forms containing nucleotides.

[0353] In some embodiments, the formulation comprises about 10 mg to about 500 mg of ST containing a cryptic exon. Medication comprising or consisting essentially of an inhibitor of MN2 transcript, e.g., STMN2 AON For example, about 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg , 40mg, 50mg, 60mg, 70mg, 80mg, 90mg, 100mg, 110 mg, 120mg, 130mg, 140mg, 150mg, 160mg, 170mg, 1 80mg, 190mg, 200mg, 250mg, 300mg, 350mg, 400mg , 450mg, 500mg, 600mg, 700mg, 800mg, 900mg, 1g, 1.5g, 2.0g, 2.5g, 3.0g, 3.5g, 4.0g, 4.5g, or 5. A formulation comprising the disclosed inhibitors of STMN2 transcripts containing cryptic exons is described herein. In some embodiments, the formulation is contemplated to be about 40 mg, 80 mg, or 16 mg. 0 mg of a disclosed inhibitor of STMN2 transcripts containing cryptic exons. In some embodiments, the preparation comprises at least 100 μg of an STMN2 transcript containing a cryptic exon. For example, the formulation may contain about 0.1 mg, 0.2 mg, 0.3mg, 0.4mg, 0.5mg, 1mg, 5mg, 10mg, 15mg, 20mg , 25 mg, or 30 mg of disclosed inhibition of STMN2 transcripts containing cryptic exons The amount administered may vary depending on variables, such as the type of disease or indication being treated. and extent, the patient's overall health and size, STMN2 transcripts including cryptic exons The initial dose depends on the in vivo potency of the inhibitor, the pharmaceutical formulation, and the route of administration. The dose is increased above the upper limit to rapidly achieve the desired blood or tissue level. Alternatively, the initial dosage may be less than optimal. The dosage may be increased gradually during the course of treatment. For example, it can be optimized in a conventional Phase I dose-escalation study. Dosing frequency can be determined by factors, e.g. For example, it can vary depending on the route of administration, dosage, and the disease being treated. Exemplary dosing frequencies are once daily, once weekly, and once every two weeks. Dosing is once daily for 7 days. In some embodiments, dosing is once every 4 weeks, once every 5 weeks, Once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, Once per week or once every 12 weeks. In some embodiments, dosing is once to three times a month. Once a month.

[0354] Combination therapy In various embodiments, the STMN2 AON as disclosed herein comprises one or The disclosed oligonucleotides and 1 The combination therapy of one or more additional therapies may, in some embodiments, be used to treat amyotrophic lateral sclerosis (ALS) or ALS. LS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (P D), Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, corticobasal degeneration (CBD) and / or neuropathy, e.g. It may be synergistic in the treatment of any chemotherapy-induced neuropathy.

[0355] Exemplary additional therapies include riluzole (Rilutek), edaravone (Radicavone), a), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, Antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AM X0035 (ELYBRIO), ZILUCOPLAN (RA101495), Dual AON intrathecal agents (e.g., BIIB067, BIIB078), BIIB100, vodopa / carbidopa, dopamine agonists (e.g., ropinirole, pramipexole, Tigotine), medroxyprogesterone, KCNQ2 / KCNQ3 opener, anticonvulsant Additional therapies include breathing care, physical therapy, and psychostimulants. In various embodiments, therapies may further include cognitive therapy, speech therapy, and nutritional support. The additional therapy can be a second antisense oligonucleotide. The second antisense oligonucleotide targets the STMN2 transcript (e.g., STMN2 pre- mRNA, mature STMN2 mRNA) to express full-length STMN2 protein The level may be modulated.

[0356] In various embodiments, the disclosed oligonucleotides and one or more additional therapeutic agents are The methods may be conjugated to one another and provided in conjugated form. Further description of conjugates involving the indicated oligonucleotides is provided below. In various embodiments, the disclosed oligonucleotides and one or more additional In various embodiments, the disclosed oligonucleotides and and one or more additional therapies are provided simultaneously. The oligonucleotide and one or more additional therapies are provided sequentially.

[0357] Conjugates In certain embodiments, an oligonucleotide (e.g., an STMN2 oligonucleotide) and optionally one or more conjugate groups and / or terminal groups. Oligomeric compounds are provided herein. The conjugate group may be one or more and a conjugate moiety linking the conjugate moiety to the oligonucleotide. The conjugate group may be either an oligonucleotide or a may be attached at both ends and / or at any internal location. In this embodiment, the conjugate group is a nucleoside of the oligonucleotide to be modified. In certain embodiments, either the oligonucleotide or The conjugate groups attached to both ends are terminal groups. In embodiments, the conjugate group or terminal group is at the 3' and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugate is attached at the 5' end. The carboxyl group (or terminal group) is attached at the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is an oligonucleotide. In certain embodiments, the conjugate is attached at the 5' end of the nucleotide. The methyl group is attached near the 5' end of the oligonucleotide.

[0358] Examples of terminal groups are conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified Nucleosides of the formula:

[0359] Conjugate Group In certain embodiments, the STMN2 AON comprises one or more conjugate groups. In certain embodiments, the conjugate group is covalently attached to the The present invention provides a method for modifying one or more properties of an oligonucleotide to be administered, the properties of which may include pharmacodynamics, drug Kinetics, stability, binding, absorption, tissue distribution, intracellular distribution, cellular uptake, charge and clearance In certain embodiments, the conjugate group is The circulation time of the oligonucleotide is modified (e.g., increased) so that the In certain embodiments, the conjugate group is , modifying the residence time of the oligonucleotide in the target organ (e.g., the brain) (e.g., residence time) time), and as a result, the increased residence time of the oligonucleotides increases their performance ( In certain embodiments, the conjugate group is (e.g., through the blood-brain barrier and / or brain parenchyma (via receptor-mediated transcytosis) In certain embodiments, the conjugate group This allows oligonucleotides to be targeted to specific organs (e.g., the brain). In certain embodiments, the conjugate group is a new group on the oligonucleotide to which it is attached. These confer specific properties, such as fluorophores, that allow for the detection of oligonucleotides. or reporter groups. Certain conjugate groups and conjugate moieties are have been previously described, e.g., cholesterol moieties (Letsinger et al., Proc. Natl. Ac ad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Ch em. Lett., 1994, 4, 1053-1060), thioethers, for example, hexyl-S-tritylthio All (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al. al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhau ser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, e.g., dodecane- Diol or undecyl residue (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111- 1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochim ie, 1993, 75, 49-54), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium l,2-di-O-hexadecyl-rac-glycero- 3-H-phosphonates (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene ethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973 ), or adamantane palmityl acetate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl- hydroxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923- 937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or Ga InNAc clusters (e.g., WO 2014 / 179620) do.

[0360] Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, and the like. Polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycol, thioesters ether, polyether, cholesterol, thiocholesterol, cholic acid moiety, phospholipid Folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone Non, adamantane, acridine, fluorescein, rhodamine, coumarin, fluoro In certain embodiments, the conjugate moiety includes a peptide, a lipid, and a dye. , N-acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid , pantothenic acid, polyethylene glycol, antibodies (e.g., for crossing the blood-brain barrier) antibodies, e.g., anti-transferrin receptor antibodies), or cell-penetrating peptides (e.g., transferrin receptor The transcriptional transactivator (TAT) and penetratin are selected from the group consisting of:

[0361] In certain embodiments, the conjugate moiety is an active drug substance, e.g., aspirin , warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, Ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarco Syn, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid , benzothiadiazide, chlorothiazide, diazepine, indomethacin Synths, barbiturates, cephalosporins, sulfa drugs, antidiabetic agents, Contains antibacterial or antibiotic agents.

[0362] Conjugate Linker The conjugate moiety is attached to the STMN2 AON through a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond. (i.e., the conjugate moiety is directly attached to the oligonucleotide through a single bond) In certain embodiments, the conjugate linker is a chain structure, a repeating oligomers of ethylene glycol, nucleoside, or amino acid units include.

[0363] In certain embodiments, the conjugate linker is an alkyl, amino, oxo, a Amides, disulfides, polyethylene glycols, ethers, thioethers, and hydroxides In certain such embodiments, the amino group is hydroxylamino. In the present study, the conjugate linker is a hydroxyl group selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises a group selected from the group consisting of alkyl, In certain embodiments, the conjugate comprises a group selected from an alkyl group and an amide group. The anchor comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. , the conjugate linker comprises at least one neutral linking group.

[0364] In certain embodiments, conjugate linkers comprising the conjugate linkers described above are used. The car is a bifunctional linking moiety, e.g., a conjugate group, which is attached to a parent compound, e.g., a It has been shown in the art that these compounds are useful for attaching to oligonucleotides provided herein. Generally, a bifunctional linking moiety contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to the conjugate. The functional groups used in the bifunctional linking moiety are selected to bond to the nucleotide group. Examples include electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety is an amino, hydro and selected from the group consisting of alkoxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl. It contains one or more groups.

[0365] Examples of conjugate linkers are pyrrolidine, 8-amino-3,6-dioxaoctane Acid (ADO), Succinimidyl 4-(N-maleimidomethyl)cyclohexane-l-carboxylate Contains carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA) Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1- C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2~C 10 A non-limiting list of preferred substituents includes, but is not limited to, alkynyl. The hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, Thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl Includes

[0366] In certain embodiments, the conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2 to 5 linker amino acids. In certain embodiments, the conjugate linker comprises three linkers. Contains nucleosides.

[0367] In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleoside is unmodified. The linker nucleoside is selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable heterocyclic base comprises an optionally protected heterocyclic base selected from the group consisting of: The available moieties are uracil, thymine, cytosine, 4-N-benzoylcytosine, and 5-methylcytosine. Cytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine is a nucleoside selected from guanine, 2-N-isobutyrylguanine, After the oligomeric compound reaches the target tissue, the linker nucleoside is released from the oligomeric compound. Thus, the linker nucleoside is typically , are linked to each other and to the remainder of the oligomeric compound through cleavable bonds. In this embodiment, such cleavable bond is a phosphodiester bond.

[0368] As used herein, linker nucleosides are not considered to be part of an oligonucleotide. Thus, an oligomeric compound may be formed by combining a specified number or range of linked nucleotides. The oligonucleotides comprised of nucleotides and / or complementary pairs designated to the reference nucleic acid. and the oligomeric compound also contains a conjugate containing a linker nucleoside. In embodiments, the conjugate groups include those linker nucleosides. The side is not counted in the length of the oligonucleotide, and is not used to calculate the length of the oligonucleotide relative to the reference nucleic acid. It is not used in determining percent complementarity of a nucleotide.

[0369] In certain embodiments, the conjugate group is cleaved from the STMN2 AON. For example, in certain circumstances, oligomers containing particular conjugate moieties may be desirable. Compounds are better taken up by certain cell types, but once an oligomeric compound is taken up, Once inserted, the conjugated group is cleaved, leaving the unconjugated or parent oligonucleotide. It is desirable to release the nucleotide. Therefore, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, the cleavable In certain embodiments, the cleavable moiety is at least In certain embodiments, the cleavable moiety is a group of atoms that contains at least one cleavable bond. The moiety includes a group of atoms having 1, 2, 3, 4, or more than 4 breakable bonds. In certain embodiments, the cleavable moiety is capable of transporting the protein to a cell or subcellular compartment, e.g., In certain embodiments, the cleavable The portion is selectively cleaved by endogenous enzymes, eg, nucleases.

[0370] In certain embodiments, the cleavable bond is an amide, ester, ether, phosphodiester, or One or both of the esters, phosphate esters, carbamates In certain embodiments, the cleavable The linkages are one or both of the esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In the present invention, the cleavable moiety is an oligonucleotide and a conjugate moiety or conjugates. The bond between the phosphate groups is phosphate.

[0371] In certain embodiments, the cleavable moiety comprises one or more linker nucleosides. In certain such embodiments, one or more Lincoln The cleosides are attached to each other and / or to the rest of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiesters. In certain embodiments, the cleavable moiety is a phosphate nucleoside bond. The internucleoside bond is attached to either the 3' or 5' terminal nucleoside of the oligonucleotide. and conjugated phosphorus by phosphate or phosphorothioate bonds. 2'-deoxynucleotides that are covalently attached to the remainder of the car or conjugate moiety In certain such embodiments, the cleavable moiety is a 2'-deoxy It is adenosine.

[0372] terminal group In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compounds contain a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates. 5'-phosphonates include, but are not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group is one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleoside is a desalted nucleoside. It is a base nucleoside.

[0373] Diagnostic methods The present disclosure also provides a method of diagnosing a patient with a neurological disease, comprising: Methods relying on detecting the level of STMN2 expression signals in multiple biological samples As used herein, the term "STMN2 expression signal" refers to any indication of STMN2 gene expression or activity of the gene or gene product. The STMN2 gene product can be RNA (e.g., mRNA), peptides, and The index of STMN2 gene expression that can be evaluated includes the STMN2 gene and protein. or the interaction of the STMN2 gene with chromatin state and cellular components that regulate gene expression. effect, expression level of STMN2 gene product (e.g., STMN2 transcript containing cryptic exons) expression level of STMN2 protein, or STMN2 RNA or This involves the interaction of proteins with transcriptional, translational, or post-translational processing machinery. Not limited to these.

[0374] Detection of STMN2 expression signals can be performed in vivo, in vitro, or ex vivo. In a preferred embodiment, the methods of the present disclosure are achieved through in vivo methods. The detection method may be carried out in vitro. The detection method may be carried out in the blood, serum, feces, tissue, brain spinal cord, or other tissue samples of a patient. This involves detection in cerebrospinal fluid, spinal cord, extracellular vesicles (e.g., CSF exosomes), or cells. Detection may be performed in whole tissue, tissue explants, cell cultures, dissociated cells, cell extracts, cells STMN containing cryptic exons in exovesicles (e.g., CSF exosomes) or body fluids This may be achieved by measuring the expression signals of two transcripts, and the body fluid may be blood, spinal fluid, Contemplated methods of detection include the detection of the STMN2 gene in the cerebrospinal fluid, urine, lymph, or serum. Assays that measure the level of expression of gene products, e.g., Western blotting, FAC S, ELISA, other quantitative binding assays, cell or tissue growth assays, Northern blot lot, quantitative or semi-quantitative polymerase chain reaction, dPCR, Simoa (registered trademark) Quanterix SR-X™ Ultra-Driven by Bead Technology Sensitive Biomarker Detection System, Medical Informatics imaging methods (e.g., MRI), or immunostaining methods (e.g., immunohistochemistry or immunocytochemistry).

[0375] Additional Embodiments SEQ ID NO: 1391 or SEQ ID NO: 944, or SEQ ID NO: 1391 or SEQ ID NO: Contains a sequence with at least 90% identity over 15-50 consecutive nucleobase segments of 944 Nucleic acid bases that are at least 90% complementary to at least 10 consecutive nucleic acid bases of a transcript containing the nucleic acid base A compound comprising an oligonucleotide comprising a sequence, wherein at least one of the nucleic acid base sequences Disclosed herein are compounds wherein the nucleoside linkage is a non-natural linkage. 1 or SEQ ID NO: 944, or 15 consecutive sequences of SEQ ID NO: 1391 or SEQ ID NO: 944 A minimum of 50 transcripts containing sequences with at least 90% identity over a 50-nucleobase stretch oligonucleotides containing nucleic acid base sequences that are at least 90% complementary to each other for 10 consecutive nucleic acid bases Nucleotides in which at least one nucleoside bond in the nucleic acid base sequence is a non-natural bond Additionally disclosed herein is an oligonucleotide, wherein:

[0376] In one embodiment, the oligonucleotides are selected from the group consisting of SEQ ID NOs: 1 to 446, SEQ ID NOs: 894 to 91, 8, any one of SEQ ID NOs: 945 to 1390, or SEQ ID NOs: 1392 to 1432, etc. A sequence of at least 10 consecutive nucleic acid bases that shares 90% identity with the long portion of the In this embodiment, the oligonucleotides are selected from the group consisting of SEQ ID NOs: 1 to 446, SEQ ID NOs: 894 to 918, The equal length portion of either row numbers 945 to 1390 or row numbers 1392 to 1432 At least consecutive 11, 12, 13, 14, 15 that share at least 90% identity with In one embodiment, the oligonucleotide comprises a 16, 17, or 20 nucleobase sequence. SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 1 71, 172, 173, 177, 181, 185, 197, 203, 209, 215, 2 37, 244, 249, 252, 380, 385, 390, 395, 400, 975, 9 80, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115 , 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153 , 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334 , 1339, or 1344, 1339, or 1344, one equal length part and a small part a nucleic acid sequence of at least 10 consecutive nucleic acid bases that share at least 90% identity; At least one nucleoside bond in the base sequence is a non-natural bond. The oligonucleotides are SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150 , 169, 170, 171, 172, 173, 177, 181, 185, 197, 203 , 209, 215, 237, 244, 249, 252, 380, 385, 390, 395 , 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113 , 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141 , 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324 , 1329, 1334, 1339, or 1344 and at least one equal length portion. At least 11, 12, 13, 14, 15, 16, or more consecutive sequences that share at least 90% identity or 17 nucleic acid base sequences.

[0377] SEQ ID NO: 944, or at least 90 for a 20 to 50 consecutive nucleobase portion thereof % identity to at least 10 consecutive nucleic acid base sequences of the transcript containing at least 90 % complementary nucleobase sequence, wherein at least Additionally described herein is an oligonucleotide in which one nucleoside bond is a non-natural bond. In one embodiment, the oligonucleotide is selected from the group consisting of SEQ ID NOs: 1 to 446 or SEQ ID NOs: At least one sequence that shares 90% identity with an equivalent length of any one of Nos. 894 to 918 In one embodiment, the oligonucleotide comprises a sequence of 10 nucleobases selected from the group consisting of SEQ ID NOs: 1 to 5. 446 or an isometric portion of any one of SEQ ID NOs: 894 to 918, and At least 11, 12, 13, 14, 15, 16, or 17 consecutive items that share a commonality In one embodiment, the oligonucleotide comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 31, 36, 4 1, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 1153, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 1334, 1339, or 13 44 at least consecutive sequences that share at least 90% identity with an isometric portion of any one of the 44 sequences. A nucleic acid sequence of 10 nucleotides, at least one nucleoside bond of which is non-natural In one embodiment, the oligonucleotide is a nucleotide sequence selected from the group consisting of SEQ ID NOs: 31, 36, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 6, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177 , 181, 185, 197, 203, 209, 215, 237, 244, 249, 252 , 380, 385, 390, 395, 400, 975, 980, 985, 999, 108 8, 1090, 1094, 1113, 1114, 1115, 1116, 1117, 112 1, 1125, 1129, 1141, 1147, 1153, 1159, 1181, 118 8, 1193, 1196, 1324, 1329, 1334, 1339, or 1344 At least 11 consecutive sequences that share at least 90% identity with any one equivalent sequence, It comprises a sequence of 12, 13, 14, 15, 16, or 17 nucleic acid bases.

[0378] At least 90% of SEQ ID NO: 447 or a 20 to 50 consecutive nucleobase portion thereof Ten consecutive nuclei of STMN2 transcripts containing cryptic exons containing identical nucleotide sequences Stathmin-2 (STMN) containing a nucleic acid sequence that is at least 90% complementary to the base sequence 2) an antisense oligonucleotide, wherein the antisense oligonucleotide is an antisense oligonucleotide having at least one nucleotide of a nucleotide sequence; The present invention provides an STMN2 antisense oligonucleotide having a non-natural nucleotide bond. The ten consecutive nucleobases of any one of SEQ ID NOs: 1 to 446 are further disclosed in the specification. stathmin-2 (ST) containing a nucleic acid sequence that shares at least 90% identity with the sequence MN2) an antisense oligonucleotide having at least one of the nucleotide sequences The STMN2 antisense oligonucleotide has a non-natural nucleoside bond. Additionally disclosed herein. In one embodiment, the nucleic acid sequence is any of SEQ ID NOs: 1-446. Any one of 11, 12, 13, 14, 15, 16, or 17 consecutive nucleic acid base sequences Share at least 90% identity.

[0379] SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 1090, 1094, 1113, 1114, 111 5, 1116, 1117, 1121, 1125, 1129, 1141, 1147, 115 3, 1159, 1181, 1188, 1193, 1196, 1324, 1329, 133 4, 1339, or 1344 and at least 10 consecutive nucleic acid base sequences Stathmin-2 (STMN2) antisense oligonucleotides containing nucleic acid sequences that share 90% identity a sequence of nucleotides, wherein at least one nucleoside bond of the nucleotide sequence STMN2 antisense oligonucleotides are additionally described herein, wherein the linkage is a non-natural linkage. In one embodiment, the nucleic acid sequence is SEQ ID NO: 31, 36, 41, 46, 55, 144, 146, 150, 169, 170, 171, 172, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 249, 252, 380, 385, 390, 395, 400, 975, 980, 985, 999, 1088, 109 0, 1094, 1113, 1114, 1115, 1116, 1117, 1121, 112 5, 1129, 1141, 1147, 1153, 1159, 1181, 1188, 119 3, 1196, 1324, 1329, 1334, 1339, or 1344 a sequence of at least 11, 12, 13, 14, 15, 16, or 17 consecutive nucleic acid bases also share 90% identity.

[0380] Modifications in general Certain compounds, compositions and methods described herein are provided in certain embodiments. Thus, although described with particularity, the following examples are illustrative of the compounds described herein. For illustrative purposes only and not intended to be limiting. Each of the cited references and GenBank accession numbers is incorporated herein by reference in its entirety. will be incorporated into

[0381] The sequence listing accompanying this application may be used in either "RNA" or "DNA" sequences, depending on the actual requirements. Each sequence is identified as either a nucleotide sequence or a nucleotide sequence, but the sequences may be modified with any combination of chemical modifications. Modified oligonucleotides may be used. Those skilled in the art will readily understand that a designation such as " is optional in certain cases. For example, oligonucleotides containing nucleosides containing a 2'-OH sugar moiety and a thymine base. is DNA with modified sugars (2'-OH instead of one 2'-H in DNA) or modified As RNA with a base (thymine (methylated uracil) instead of uracil in RNA) Thus, the sequences described herein, including but not limited to, those in the sequence listing, may be used interchangeably. The nucleic acid sequences provided herein may be any combination of natural or modified RNA and / or DNA. The term "nucleic acid" is intended to encompass nucleic acids containing modified nucleobases, including those having modified nucleobases. Further non-limiting examples include nucleic acids such as those having the nucleobase sequence "AT Oligomeric compounds having the formula "CGATCG" can be either modified or unmodified. However, the present invention encompasses any oligomeric compound having such a nucleobase sequence, which includes Such compounds containing RNA bases, e.g., those having the sequence "AUCGAUCG", and and some DNA bases and some RNA bases, e.g., "AUCGATCG." and oligomeric compounds having other modified nucleobases, e.g., "AT m CGAUCG ” ( m C indicates a cytosine base containing a methyl group at the 5-position) stomach.

[0382] Certain compounds (e.g., modified oligonucleotides) described herein may contain one or more It has multiple asymmetric centers and therefore can form enantiomers, diastereomers, and other stereoisomers. This gives rise to isomeric configurations, which can be either (R) or (S) with the sugar As α or β for anomers, etc., (D) or ( L) or in terms of absolute stereochemistry. Compounds provided herein that are shown or described as having This includes only compounds that are shown or described with undefined stereochemistry. The compounds provided herein are stereorandom in their structure unless otherwise specified. All such possible isomers, including stereorandom and optically pure forms, are Likewise, unless otherwise indicated, all tautomers of the compounds herein are included. Unless otherwise indicated, the compounds described herein also include the corresponding salt forms. It is intended to include forms.

[0383] The compounds described herein may be prepared by adding one or more atoms to the non-radioactive compound of the indicated element. Includes variations where an isotope or radioactive isotope has been substituted, e.g., hydrogen atom The compounds herein include 1 All possible weights for each of the H hydrogen atoms Isotopic substitutions encompassed by the compounds herein include: 1 H generation Instead2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N , 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36 In certain embodiments, non-radioactive isomers include, but are not limited to, S. The substitutions can provide oligomers with new properties that are beneficial for use as therapeutic or research tools. It may be added to the compound. [Example]

[0384] The present disclosure is further described by the following examples, which are provided for illustrative purposes only. and should not be construed as limiting the scope or content of the disclosure in any way. There is no.

[0385] [Example 1] Initial design and selection of STMN2 antisense oligonucleotides Design and test antisense oligonucleotides complementary to STMN2 RNA , which can act as an inhibitor of STMN2 transcripts containing cryptic exons Antisense oligonucleotides (AONs) were identified.

[0386] 1A-1C show portions of the STMN2 transcript and certain portions of the STMN2 transcript. 1 depicts STMN2 antisense oligonucleotides designed to target In addition, regions of the STMN2 transcript are identified as branch points (e.g., branch points 1, 2, and 3), the 3' splice acceptor region, the ESE binding region, and the TDP43 binding site. and a poly A region. The STMN2 antisense oligonucleotide Antisense oligonucleotides were identified according to their corresponding position in the STMN2 transcript. For example, Figure 1A shows the STMN2 transcript at positions 36-38, which includes branch point 1. 60. Similarly, a different STMN2 antisense oligonucleotide targeting The STMN2 antisense oligonucleotides target STMN2, including branchpoint 3. Other STMN2 antisense oligonucleotides target positions 144-178 of the STMN2 transcript. The octide may be any of the sequences disclosed above (e.g., SEQ ID NOs: 1-446, 894-918). , 945-1390, or 1392-1432).

[0387] Generally, the length of STMN2 antisense oligonucleotides is 25 nucleotides. However, various lengths (e.g., 23-mer, 21-mer, or 19-mer) are possible. Variants of STMN2 antisense oligonucleotides with r) were also designed. The unique STMN2 AONs and AON variants designed and developed for the study are listed below. Shown in Table 7 below.

[0388] [Table 7-1]

[0389] [Table 7-2]

[0390] [Table 7-3]

[0391] [Table 7-4]

[0392] [Table 7-5]

[0393] [Example 2] Methods for evaluating STMN2 antisense oligonucleotides STMN2 antisense oligonucleotides were administered to SY5Y cells and human motor neurons In particular, Examples 3, 4, and 5 below describe the ST expression in SY5Y cells. The results generated from the evaluation of MN2 antisense oligonucleotides are described below. Examples 6 and 7 show the expression of STMN2 antisense oligonucleotides in human motor neurons. The results generated from the evaluation of the chids are described.

[0394] STMN2 antisense oligonucleotides were evaluated in SY5Y cells. They were plated in 6-well or 96-well plates and grown to 80% confluency. Antisense oligonucleotides (AONs) against TDP43 were synthesized using RNAiMax (T Hermo Fisher Scientific, Waltham, MA, USA) to express the hidden exon, thereby producing full-length STMN2 (ST MN2-FL) product was prevented from being transcribed. The positive control was TDP43 siRNA alone ("siRNA TDP43"). and / or TDP43 AON alone ("AON TDP43" or "TDP 43 AON”). siRNA TDP43 was administered to Hor ON-TARGETplus Human TARD from izon / Dharmacon BP(23435) siRNA-SMARTpool(#L-012394-00-0 TARDBP (23435) siRNA was purchased as a separate product (SEQ ID NO: 005). : 1) Target sequence 1: GCUCAAGCAUGGAUUCUAA (SEQ ID NO: 1439) 2) Target sequence 2: CAAUCAAGGUAGUAAUAUG (SEQ ID NO: 1440) 3) Target sequence 3: GGGCUUCGCUACAGGAAUC (SEQ ID NO: 1441) 4) Target sequence 4: CAGGGUGGAUUUGGUAAUA (SEQ ID NO: 1442) It contains four individual siRNAs targeting

[0395] The TDP43 AON is a gapmer oligonucleotide with the following sequence and chemistry: Having: [ka] (* = phosphorothioate, underline = DNA, others = 2'MOE RNA; each "C" is 5 -MeC)

[0396] To evaluate the ability of STMN2 AONs to restore STMN2-FL, Antisense oligonucleotides against 2 were combined with TDP43 AONs in RNAiMax. After 96 hours, transcript levels (e.g., STMN2 full-length transcript, STMN2 transcripts with cryptic exons, or TDP43 transcripts) were analyzed using TaqMan. RT-qPCR was performed using Thermofisher TaqMatrix. n Gene Expression Assay Hs03929097_g1 RT-qPCR was performed to detect GAPDH using the following primer sequences: 1) Forward primer: 5'-CTCAGTGCCTTATTCAGTCTTCTC-3 ' (SEQ ID NO: 1444), 2) Reverse primer: 5'-TCTTCTGCCGAGT CCCATTT-3' (SEQ ID NO: 1445) and 3) Probe: 5'- / 56-FAM / TCAGCGTCTGCACATCCCTACAAT / 3BHQ_1 / -3' (SEQ ID NO. No. 1446) to detect STMN2 transcripts with cryptic exons. qPCR was performed using the following primer sequences: 1) Forward primer: 5'-CCAC GAACTTTAGCTTCTCCA-3' (SEQ ID NO: 1447), 2) reverse primer mer: 5'-GCCAATTGTTTCAGCACCTG-3' (SEQ ID NO: 1448), and 3) probe: 5' - / 56-FAM / ACTTTCTTCTTTCCTCTG CAGCCTCC / 3BHQ_1 / -3' (SEQ ID NO: 1449) was used to clone the full-length STMN RT-qPCR was performed to detect the two transcripts.

[0397] Applied Biosystems® 7500 Real-time RT-qPCR was performed on a PCR system. One cycle of reverse transcription was performed at 50°C. One cycle of RT inactivation / initial denaturation was performed at 95°C for 20 seconds. 45 cycles of amplification were performed at 95°C for 1 second followed by 60°C for 20 seconds.

[0398] STMN2-FL or STMN2 cryptic signal (Ct) versus GAPDH (ΔCt) To visualize quantitative changes (e.g., % increase in STMN-FL), normalized Normalized STMN2-FL signal was compared with vehicle (treatment with RNAiMax alone) , ΔΔCt). The relative amounts of transcript levels were calculated using the formula RQ=2 -ΔΔCt and used to compare treatment conditions to normal healthy levels (1.0). Please write:

[0399] The percent decrease in expression of STMN2 with cryptic exons was calculated as:

[0400]

number

[0401]

number

[0402] STMN2 antisense oligonucleotides also reduce the cryptic exon and The efficacy of increasing N2 full-length transcripts was evaluated in human motor neurons. Human motor neurons (Cellular Dynamics Interactions) nal) for RT-qPCR RNA quantification according to the manufacturer's instructions. 15 x 10 cells in a 6-well plate 3 Cells / well or Western blot protein determination 3 x 10 cells in a 6-well plate for quantification 5 Cells were plated at 1000 cells / well. TDP43 A was administered to neurons using a transposon (GeneTools, LLC.). Transfected with ON and / or STMN2 AON, or with endothelial cells alone. Neurons were treated with ribosomal transporters. Treatment conditions were analyzed in biological triplicates (qRT-PCR). ) or in duplicate (Western blot) wells. AONs are used here to assess human motor neurons. TDP43 AONs are The primer oligonucleotides have the following sequence and chemistry: [ka] (* = phosphorothioate, underline = DNA, others = 2'MOE RNA; each "C" is 5 -MeC)

[0403] After 72 hours, the antisense oligonucleotides and endoporters were washed away. After another 72 hours, the RNA was analyzed by RT-qPCR using 96 well plates. from a well plate or from a 6-well plate for Western blot. RNA was isolated, cDNA was generated, and the STMN2 cryptic exons, STMN 2. Multi-channel Analysis Using TaqMan Probes for Full-Length Transcript and Reference GAPDH Quantification A multiplex RT-qPCR assay was performed, as described above for SY5Y cells. GAPDH, STMN2 transcripts with cryptic exons, and full-length STMN2 Perform RT-qPCR on human motor neurons with primers to detect For protein quantification, the soluble portion of the protein collection was transformed. The proteins were purified, separated by SDS-PAGE, transferred to a polyvinylidene difluoride membrane, and APDH (Proteintech, 60004-1-1g), TDP-43 (Prot. eintech, 10782-2-AP), and Stathmin-2 (Thermo The antibody was probed with an antibody against the IgG1 gene (Fisher, PA5-23049).

[0404] In TDP43-silenced cells (e.g., SY5Y cells and human motor neurons) full-length STMN2 mRNA (i.e., the mRNA from which full-length STMN2 is translated) STMN2 antisense oligonucleotides were used for their ability to increase or restore STMN2 levels. In some cases, the ability to reduce STMN2 transcripts containing cryptic exons was examined. STMN2 antisense oligonucleotides were tested for potency as described further below. Quantified percentage increase / recovery of STMN2-FL and / or The percentage reduction of STMN2 transcripts with cryptic exons is compared with the control group (e.g., 50 STMN-FL and / or TDP43 AON-treated cells or are described relative to the level of STMN2 transcripts containing cryptic exons.

[0405] [Example 3] STMN2 antisense oligonucleotides inhibited the cytotoxicity of full-length STMN2 in SY5Y cells. restores STMN2 transcripts with cryptic exons Figure 1B and Figure 1C show targeting different regions of the STMN2 transcript with cryptic exons. Specifically, Figure 1B demonstrates the efficacy of the STMN2 AON in the expression of SY5Y cells. Figure 1C depicts the STMN2 AONs evaluated in human motor neurons. Figure 1 depicts STMN2 AONs evaluated in the AN. STMNs are represented by solid lines. 2 AONs increased ST by more than 50% compared to TDP43 AON treatment alone. The resulting cells had MN2-FL mRNA expression. Represented by the dotted line. STMN2 AON increased by less than 50% compared to TDP43 AON treatment alone This resulted in cells with intact STMN2-FL (full-length) mRNA.

[0406] Referring to Figure 2, when treated with 500 nM of TDP43 AON, TDP The 43 transcript was reduced by approximately 52%, and STMN2-FL was reduced by approximately 57%. Treatment with 500 nM of STMN2 AON increased TDP43 levels by 25% and Increased TMN-FL levels by 55% (rescued by 67%). SEQ ID NO: 177 Treatment with 50 nM and 500 nM of STMN2 AONs significantly increased STMN-FL levels. increased the number of patients by 58...

Claims

1. an isometric portion of the transcript having at least 90% identity to SEQ ID NO: 944, or At least 90% complementary to a 19-50 contiguous nucleobase portion of SEQ ID NO:944 an oligonucleotide comprising linked nucleosides having a sequence of at least 19 consecutive nucleic acid bases, A compound comprising a nucleotide, wherein at least one nucleoside of said linked nucleoside is A compound in which the silyl bond is a non-natural bond.

2. an isometric portion of the transcript having at least 90% identity to SEQ ID NO: 944, or At least 90% complementary to a 19-50 contiguous nucleobase portion of SEQ ID NO:944 an oligonucleotide comprising linked nucleosides having a sequence of at least 19 consecutive nucleic acid bases, A nucleotide, wherein at least one nucleoside bond of said linked nucleoside is non- Natural linkages, oligonucleotides.

3. The nucleic acid base sequences are SEQ ID NOs: 1 to 446, SEQ ID NOs: 894 to 918, SEQ ID NO: 94 5 to 1390, or an equal length portion of any one of SEQ ID NOs: 1392 to 1432 and (c) a portion of at least 10 consecutive nucleobases that share at least 90% identity with the nucleic acid sequence of claim 1.

3. The oligonucleotide according to 1 or 2.

4. The nucleic acid base sequences are SEQ ID NOs: 1 to 446, SEQ ID NOs: 894 to 918, SEQ ID NO: 94 5 to 1390, or an equal length portion of any one of SEQ ID NOs: 1392 to 1432 11, 12, 13, 14, 15, 16, 17, containing a portion of 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases. The oligonucleotide according to any one of claims 1 to 3.

5. The nucleic acid base sequences are selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 1 50、169、170、171、172、173、177、181、185、197、2 03、209、215、237、244、249、252、380、385、390、3 95、400、975、980、985、999、1088、1090、1094、11 13、1114、1115、1116、1117、1121、1125、1129、11 41、1147、1153、1159、1181、1188、1193、1196、13 24, 1329, 1334, 1339, or 1344 equal length parts and at least one a portion of at least 10 consecutive nucleobases that share at least 90% identity with the nucleic acid; The oligonucleotide according to any one of claims 1 to 3.

6. The nucleic acid base sequences are selected from the group consisting of SEQ ID NOs: 31, 36, 41, 46, 55, 144, 146, 1 50、169、170、171、172、173、177、181、185、197、2 03、209、215、237、244、249、252、380、385、390、3 95、400、975、980、985、999、1088、1090、1094、11 13、1114、1115、1116、1117、1121、1125、1129、11 41、1147、1153、1159、1181、1188、1193、1196、13 24, 1329, 1334, 1339, or 1344 equal length parts and at least one 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 7, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases The oligonucleotide according to any one of claims 1 to 5, comprising a portion thereof.

7. An oligonucleotide comprising linked nucleosides having a sequence of at least 19 consecutive nucleic acid bases. A compound comprising leutide, wherein the sequence of nucleobases is selected from the group consisting of SEQ ID NOs: 894-918 or At least 90% identical to an equivalent length portion of any one of SEQ ID NOs: 1392-1432 A compound comprising a portion of at least 10 consecutive nucleobases that share a common sex.

8. An oligonucleotide comprising linked nucleosides having a sequence of at least 19 consecutive nucleic acid bases. leotide, wherein the nucleobase sequence is selected from SEQ ID NOs: 894 to 918 or SEQ ID NO: 13 shares at least 90% identity with an equivalent length of any one of 92 to 1432 , an oligonucleotide comprising a portion of at least 10 consecutive nucleobases.

9. The nucleic acid base sequence is selected from the group consisting of SEQ ID NOs: 894 to 918 and SEQ ID NOs: 1392 to 1432. At least 11, 12, 1, or 2 share at least 90% identity with any one of 3, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 9. The oligonucleotide of claim 7 or 8, comprising a portion of consecutive nucleobases.

10. An oligonucleotide comprising linked nucleosides having a sequence of at least 19 consecutive nucleic acid bases. A compound comprising leutide, wherein the sequence of nucleobases is from position 121 to position 122 of SEQ ID NO:

944. 144、144~168、146~170、150~170、150~172、150~ 174、169~193、169~189、169~191、170~190、170~ 192、171~191、171~193、172~192、172~194、170~ 194、171~195、172~196、173~197、185~209、197~ 221, 237-261, 249-273, 252-276, or 276-300 At least one nucleic acid sequence that is at least 90% complementary to an isometric portion of the nucleic acid bases contained in one of the nucleic acid sequences. A compound comprising a portion of at least 10 consecutive nucleobases.

11. A linked nucleic acid having a sequence of nucleobases, the sequence having at least 19 consecutive nucleobases. an oligonucleotide comprising a nucleotide sequence of 3'-diaminobenzyl ... Positions 121-144, 144-168, 146-170, 150-170, 150-17 2、150~174、169~193、169~189、169~191、170~19 0、170~192、171~191、171~193、172~192、172~19 4、170~194、171~195、172~196、173~197、185~20 9, 197-221, 237-261, 249-273, 252-276, or 276 at least 90% complementary to an isometric portion of the nucleobases contained in any one of An oligonucleotide comprising a portion of at least 10 consecutive nucleobases,

12. A portion of the nucleic acid base sequence is located at positions 121 to 144, 144 to 16 of SEQ ID NO:944 8、146~170、150~170、150~172、150~174、169~19 3、169~189、169~191、170~190、170~192、171~19 1、171~193、172~192、172~194、170~194、171~19 5、172~196、173~197、185~209、197~221、237~26 1, 249-273, 252-276, or 276-300 12. The oligonucleotide of claim 10 or 11, which is 100% complementary to an isometric portion of the nucleic acid base. Gonucleotide.

13. A portion of the nucleic acid base sequence is located at positions 144 to 164, 144 to 164 of SEQ ID NO: 944 6, 145-167, 146-166, 146-168, 147-165, or 148 100% complementary to an isometric portion of the nucleobases contained in any one of The oligonucleotide of claim 12.

14. A portion of the nucleic acid base sequence is located at positions 173-191, 173-194 of SEQ ID NO:944 3、173~195、173~197、175~195、175~197、177~19 100 for an equal length portion of the nucleic acid bases contained in any one of 7, or 179 to 197 % complementary to the oligonucleotide of claim 12.

15. A portion of the nucleic acid base sequence is located at positions 185-205, 187-204 of SEQ ID NO: 944 9, 189-209, 185-207, 197-217, 197-219, or 191 100% complementary to an isometric portion of the nucleobases contained in any one of The oligonucleotide of claim 12.

16. A portion of the nucleic acid base sequence is located at positions 237-255, 237-254 of SEQ ID NO: 944 7、237~259、239~259、239~261、241~261、237~25 7, 249-269, 249-271, 252-272, 252-274, or 243 100% complementary to an isometric portion of the nucleobases contained in any one of The oligonucleotide of claim 12.

17. The sequence of the nucleobases is selected from positions 121 to 144, 144 to 168, 14 6~170、150~170、150~172、150~174、169~193、16 9~189、169~191、170~190、170~192、171~191、17 1~193、172~192、172~194、170~194、171~195、17 2~196、173~197、185~209、197~221、237~261、24 Nucleobases included in any one of 9 to 273, 252 to 276, or 276 to 300 complementary to at least 11, 12, 13, 14, 15, 16, 1 a portion of 7, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases The oligonucleotide of claim 10 or 11, comprising:

18. The sequence of the nucleobases is selected from positions 144 to 164, 144 to 166, 144 to 168, 144 to 169 ... 5~167、146~166、146~168、147~165、148~168、17 3~191、173~193、173~195、173~197、175~195、17 5~197、177~197、179~197、185~205、185~207、19 7~217、197~219、187~209、189~209、191~209、23 7~255、237~257、237~259、239~259、239~261、24 1~261、237~257、249~269、249~271、252~272、25 For an isometric portion of nucleic acid bases contained in either 2 to 274 or 243 to 261 and at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 10. The nucleic acid sequence of claim 1, comprising a portion of 20, 21, 22, 23, 24, or 25 consecutive nucleobases.

12. The oligonucleotide according to claim 0 or 11.

19. 19 and 40 nucleosides in length according to any one of claims 1 to 18. The oligonucleotides listed

20. Phosphodiester bond, phosphorothioate bond, alkyl phosphate bond, alkyl propyl phosphonate bond, 3-methoxypropyl phosphonate bond, phosphorodithioate bond In this case, phosphotriester bond, methylphosphonate bond, aminoalkylphosphotriester bond Terephthalate bond, alkylenephosphonate bond, phosphinate bond, phosphoramidate bond , phosphoramidothiate linkages, phosphorodiamidates (e.g., phosphorodiamidates morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkages; Aminoalkyl phosphoramidate bond, thiophosphoramidate bond, thionoalkyl Phosphonate bond, thionoalkylphosphotriester bond, thiophosphate bond, boranophosphate bonds, and boranophosphate bonds, or any combination thereof (multiple 1 to 1, which contain at least one nucleoside bond selected from the group consisting of 10. The oligonucleotide according to any one of claims 9.

21. At least 2, 3, or 4 internucleoside linkages of said oligonucleotide are The oligonucleotide according to any one of claims 1 to 20, wherein the internucleoside linkage is a phosphodiester internucleoside linkage. Gonucleotide.

22. 3. The method of claim 1, comprising at least 2, 3, or 4 modified internucleoside linkages.

10. The oligonucleotide of any one of claims 1 to 9.

23. Each of the modified internucleoside linkages of the oligonucleotide is a phosphoro Thioate bond, phosphoramidate bond, phosphoramidothiate bond, phosphorodia 23. The oligonucleotide of claim 22, wherein the linkages are independently selected from midate linkages.

24. All internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

24. The oligonucleotide of claim 22 or 23.

25. The phosphorothioate internucleoside linkages are in the Rp configuration or S 24. The oligonucleotide of claim 23, which is one of the following configurations: 。

26. The oligonucleotide according to any one of claims 1 to 25, comprising at least one modified nucleobase. Gonucleotide.

27. The at least one modified nucleobase is 5-methylcytosine, pseudouridine, or or 5-methoxyuridine.

28. The oligonucleotide of any one of claims 1 to 27, comprising at least one modified sugar moiety. nucleotide.

29. The modified sugar moiety may be a 2'-OMe modified sugar moiety, a bicyclic sugar moiety, a 2'-O-(2-methyl) 2'-deoxy-2'-fluoronucleoside (2'MOE), 2'-deoxy-2'-fluoronucleoside, 2'- Fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), constrained ethyl 2'- 4'-bridged nucleic acids (cEt), S-cEt, hexitol nucleic acids (HNA), and tricyclic 29. The modified oligonucleotide of claim 28, which is one of the analogs (e.g., tcDNA). oligonucleotides.

30. Three bonds linked through phosphodiester internucleoside linkages at the 5' end nucleosides, and at the 3' end through a phosphodiester internucleoside bond 24. The method according to claim 1, comprising three linked nucleosides linked by a linking moiety. oligonucleotides.

31. one or more 2'- O-(2-methoxyethyl) (2'-MOE) nucleosides, optionally All nucleosides within the oligonucleotide contain modified sugar moieties, including 2'-MOE. and optionally, all cytosine nucleosides in said oligonucleotide are modified. and further optionally, all nucleosides Any of claims 1 to 20 and 22 to 29, wherein the inter-bond bond is a phosphorothioate bond. The oligonucleotide according to any one of claims 1 to 4.

32. Three nucleotides linked at the 5' end through phosphorothioate internucleoside linkages linked nucleosides, and phosphorothioate internucleoside linkages at the 3'-terminus Claims 1 to 23 and 25 to 29, comprising three linked nucleosides linked through The oligonucleotide according to any one of claims 1 to 4.

33. Five linked nucleosides linked through phosphodiester internucleoside linkages 33. The oligonucleotide of claim 32, comprising:

34. Each of the five linked nucleosides is 2'-O-(2-methoxyethyl)(2 34. The oligonucleotide of claim 33, wherein the nucleoside is a '-MOE) nucleoside.

35. Each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxy) 35. The oligonucleotide of claim 33 or 34, which is a 2'-MOE) nucleoside. nucleotide.

36. At least 30%, 40%, or exhibiting a 50%, 60%, 70%, 80%, or 90% increase, and optionally, is compared to the level before the neurons were exposed to the oligonucleotide. The oligonucleotide according to any one of claims 1 to 35.

37. At least a 100% increase in full-length STMN2 transcript or STMN2 protein. and optionally, said increase is greater than the level of neurons prior to exposing said neurons to said oligonucleotide. The oligonucleotide of any one of claims 1 to 36, Punch.

38. At least a 200% increase in full-length STMN2 transcript or STMN2 protein. and optionally, said increase is greater than the level of neurons prior to exposing said neurons to said oligonucleotide. The oligonucleotide of any one of claims 1 to 37, which is in comparison with the level Punch.

39. At least a 300% increase in full-length STMN2 transcript or STMN2 protein. and optionally, said increase is greater than the level of neurons prior to exposing said neurons to said oligonucleotide. The oligonucleotide of any one of claims 1 to 38, which is in comparison with the level Punch.

40. At least a 400% increase in full-length STMN2 transcript or STMN2 protein. and optionally, said increase is greater than the level of neurons prior to exposing said neurons to said oligonucleotide. The oligonucleotide of any one of claims 1 to 39, which is in comparison with the level Punch.

41. The increase in the full-length STMN2 protein is due to the TDP43 antisense oligonucleotide. In comparison to the reduced levels of full-length STMN2 protein achieved using The oligonucleotide according to any one of claims 36 to 40, which is measured.

42. At least 10%, 20%, or 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue and optionally, said increase is greater than the level prior to exposing the neurons to the oligonucleotide. The oligonucleotide of any one of claims 1 to 35, which is in comparison with the level Punch.

43. At least 50%, 60%, 70%, 80%, or 90% of STMN2 transcripts have cryptic exons. %, or 90% reduction in the hydroxybenzoates of any one of claims 1 to 35 and 42. oligonucleotides.

44. One or more of the oligonucleotides according to any one of claims 1 to 43 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient. 。

45. Treating neurological disorders and / or neuropathy in patients in need thereof A method for producing an oligonucleotide or an oligonucleotide according to any one of claims 1 to 43.

45. A method of administering to a patient a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 44. A method including

46. The neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, Peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal ganglia degeneration 46. ​​The method of claim 45, wherein the active ingredient is selected from the group consisting of: CBD.

47. 46. ​​The method of claim 45, wherein the neuropathy is chemotherapy-induced neuropathy. method.

48. A method for restoring axonal outgrowth and / or regeneration of a motor neuron, comprising: The oligonucleotide or pharmaceutically acceptable salt thereof according to any one of claims 1 to 43 is an acceptable salt thereof, or the pharmaceutical composition of claim 44. 。

49. Increasing, promoting, or stabilizing STMN2 expression and / or function in neurons; or A method for maintaining neurons, comprising: treating the neurons with an oligonucleotide according to any one of claims 1 to 43.

45. A nucleotide or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 44. A method comprising exposing a substance to said substance.

50. The neuron is in need of treatment for a neurological disease and / or neuropathy.

50. The method of claim 48 or 49, wherein the neuron is a neuron in a patient.

51. The neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, Peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal ganglia degeneration 51. The method of claim 50, wherein the active ingredient is selected from the group consisting of: CBD.

52. 51. The method of claim 50, wherein the neuropathy is chemotherapy-induced neuropathy. Law.

53. 2. The method of claim 1, wherein the exposing step is performed in vivo or ex vivo.

53. The method of any one of claims 48 to 52.

54. The exposing step comprises exposing the oligonucleotide to a cryptic exon of SEQ ID NO:

447.

4. The method of claim 3, further comprising administering the method to a patient identified as having a transcript comprising the sequence.

53. The method of any one of claims 8 to 52.

55. The oligonucleotide is administered topically, parenterally, intrathecally, intracisternally, orally, rectally, bucally, or lingually. administered intravenously, intravaginally, intrapulmonary, intratracheally, intranasally, intralesionally, transdermally, or intraduodenally, Item 55. The method according to any one of Items 45 to 54.

56. 55. The method of claim 54, wherein the oligonucleotide is administered orally.

57. Claims 45-5, wherein the therapeutically effective amount of the oligonucleotide is administered intrathecally or intracisternally.

5. The method according to any one of claims 4 to 4.

58. 58. The method of claim 45, wherein the patient is a human. method.

59. The pharmaceutical composition may be administered topically, intrathecally, intracisternally, parenterally (e.g., subcutaneously, intramuscularly, intradermally, intravenous, intralesional, oral, intrapulmonary, intratracheal, intranasal, transdermal, intrarectal, buccal 45. The pharmaceutical composition of claim 44, suitable for sublingual, intravaginal, or intraduodenal administration.

60. In the manufacture of a medicament for treating a neurological disease or neuropathy, 43, or a pharmaceutically acceptable salt thereof, or the use of the pharmaceutical composition of claim 44.

61. The neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, Peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal ganglia degeneration 61. The use of claim 60, wherein the said compound is selected from the group consisting of: CBD.

62. 61. The method of claim 60, wherein the neuropathy is chemotherapy-induced neuropathy. For.

63. Methods of treating neurological disorders or neuropathy in patients in need thereof a therapeutically effective amount of an oligonucleotide according to any one of claims 1 to 43 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 44, Administering the compound to a patient suffering from the condition.

64. The neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, Peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal ganglia degeneration 64. The method of claim 63, wherein the medicament is selected from the group consisting of: CBD.

65. 64. The method of claim 63, wherein the neuropathy is chemotherapy-induced neuropathy. Law.

66. The oligonucleotide or the pharmaceutical composition is administered topically, parenterally (e.g., subcutaneously, intramuscularly) intralesional, oral, intrapulmonary, rectal, buccal, sublingual, vaginal 6. The method of claim 6, wherein the compound is administered intraluminally, intratracheally, intranasally, intracisternally, intrathecally, transdermally, or intraduodenally.

66. The method of any one of claims 3 to 65.

67. The oligonucleotide or the pharmaceutical composition is administered intrathecally or intracisternally.

66. The method of any one of claims 63 to 65.

68. A therapeutically effective amount of the oligonucleotide or the pharmaceutical composition is administered intrathecally or intracisternally.

68. The method of any one of claims 63 to 67, wherein the

69. 69. The method of any one of claims 63 to 68, wherein the patient is a human.

70. Claims for use as a medicine in the treatment of neurological diseases or neuropathy. Item 44. The oligonucleotide according to any one of Items 1 to 43, or a pharmaceutically acceptable salt thereof. 。

71. A compound according to claims 1 to 43 for use in the treatment of neurological diseases or neuropathy. The oligonucleotide according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof.

72. The neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, Peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal ganglia degeneration 72. The oligonucleotide used in claim 70 or 71 is selected from the group consisting of: Cleotide.

73. 70 or 71, wherein the neuropathy is chemotherapy-induced neuropathy. Oligonucleotides used in

74. SEQ ID NOs: 1 to 446, 894 to 918, 945 to 1390, or A linked nucleoside having any one of the nucleic acid base sequences of sequence numbers 1392 to 1432 or a pharmaceutically acceptable salt thereof, The oligonucleotides may be phosphodiester, phosphorothioate, or alkyl Phosphate bond, alkylphosphonate bond, 3-methoxypropylphosphonate bond , phosphorodithioate bond, phosphotriester bond, methylphosphonate bond, amino alkylphosphotriester bond, alkylenephosphonate bond, phosphinate bond , phosphoramidate bond, phosphoramidothiate bond, phosphorodiamidate bond, Aminoalkyl phosphoramidate bond, thiophosphoramidate bond, thionoalkyl Phosphonate bond, thionoalkylphosphotriester bond, thiophosphate bond, at least one bond selected from the group consisting of a boranophosphate bond, a boranophosphate bond, and a boranophosphate bond; each containing one nucleoside bond; and / or At least one nucleoside of the linked nucleosides is 2'-O-(2-methionine). 2'-O-Methoxyethyl) Nucleoside (2'-O-Methoxyethyl Ribonucleoside (2'-MOE )), 2'-O-methylnucleosides, 2'-deoxy-2'-fluoronucleosides, 2'-Fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), constrained methionine Consists of cMOE, cET, and peptide nucleic acid (PNA) replaced with a component selected from the group An oligonucleotide or a pharmaceutically acceptable salt thereof.

75. At least one internucleoside linkage of said oligonucleotide is a phosphorothioate.

75. The oligonucleotide of claim 74, wherein the linkage is a hydroxyl group.

76. Three bonds linked through phosphodiester internucleoside linkages at the 5' end nucleosides, and at the 3' end through a phosphodiester internucleoside bond 76. The oligonucleotide of claim 74 or 75, comprising three linked nucleosides linked by nucleotide.

77. one or more 2' linked through phosphorothioate internucleoside linkages 77. The method of claim 74, further comprising administering to a subject a compound selected from the group consisting of nucleosides, hydroxybenzoates ... The described oligonucleotide.

78. Five linked nucleosides linked through phosphodiester internucleoside linkages 76. The oligonucleotide of claim 74 or 75, comprising:

79. Each of the five linked nucleosides is 2'-O-(2-methoxyethyl)(2 79. The oligonucleotide of claim 78, wherein the nucleoside is a '-MOE) nucleoside.

80. Each of the linked nucleosides of the oligonucleotide is a 2'-O-(2-methoxy) 80. The method according to any one of claims 74 to 79, wherein the nucleoside is a 2'-MOE) nucleoside. The oligonucleotides listed.

81. All internucleoside linkages of the oligonucleotide are phosphorothioate linkages. and optionally each of the linked nucleosides of said oligonucleotide is 2'- O-(2-methoxyethyl) (2'-MOE) nucleosides, and further optionally the oligonucleotide comprises at least one 5-methylcytosine modified nucleobase; 76. The oligonucleotide of claim 74 or 75.

82. The oligonucleotide or pharmaceutically acceptable salt thereof according to any one of claims 73 to 81. and a pharmaceutically acceptable excipient.

83. Expression of functional STMN2 in cells or human patients affected by neurological diseases or disorders Expression of translationally competent STMN2 mRNA and / or STMN2 protein and the ability to increase, restore, or stabilize the activity and / or function of and / or levels that increase, restore, or stabilize activity and / or function. and the oligonucleotide is sufficient for use as a pharmaceutical for treating a chronic disease or disorder. The oligonucleotide or pharmaceutically acceptable salt thereof according to any one of claims 1 to 43, The salt is acceptable.

84. Any of claims 1 to 43, containing one or more chiral centers and / or double bonds. The oligonucleotide according to any one of claims 1 to 4.

85. As stereoisomers selected from geometric isomers, enantiomers, and diastereomers 85. The oligonucleotide of claim 84, wherein

86. Treating neurological disorders and / or neuropathy in patients in need thereof 44. A method for treating a patient with a steroid hormone, comprising administering to the patient a therapeutically effective amount of an oligonucleotide according to any one of claims 1 to 43.

45. A method for treating a patient with rheumatoid arthritis, comprising administering to a patient a therapeutically effective amount of rheumatoid arthritis or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 44, administering riluzole (Rilution®) to a patient in need thereof for the treatment of said neurological disease; ek), edaravone (Radicava), rivastigmine, donepezil, galantamine , selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine Benzodiazepine anti-anxiety drug, AMX0035 (ELYBRIO), ZILUCOPL AN (RA101495), dual AON intrathecal agents (e.g., BIIB067, B IIB078), BIIB100, levodopa / carbidopa, dopamine agonists (e.g., Ropinirole, Pramipexole, Rotigotine), Medroxyprogesterone, KCNQ a second therapeutic agent selected from a KCNQ3 opener, an anticonvulsant, and a psychostimulant; and / or therapy (e.g., breathing care, physical therapy, occupational therapy, speech therapy) , nutritional support).

87. The neurological disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, brachial plexus injury, Peripheral nerve injury, progressive supranuclear palsy (PSP), head trauma, spinal cord injury, and corticobasal ganglia degeneration 87. The method of claim 86, wherein the medicament is selected from the group consisting of: CBD.

88. 87. The method of claim 86, wherein the neuropathy is chemotherapy-induced neuropathy. Law.

89. The patient to be treated is treated with plasma, spinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., CSF exosomes), blood, urine, lymph, feces, or tissues, Neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), phosphorylated neurofilament Neurofilament heavy chain (pNFH), TDP-43, or p75 ECD The presence or The method according to claims 45 to 58, 63 to 69, and 89. The method according to any one of claims 86 to 88.

90. The patient to be treated has high levels of phosphorylated neurofilaments in the cerebrospinal fluid (CSF).

90. The method of claim 89, wherein the antibody is identified by measuring pNFH heavy chain.

91. pNFH in the patient's CSF is increased after the first dose and / or during treatment. Predicting disease status and survival in patients with F72-associated amyotrophic lateral sclerosis (c9ALS) 91. The method of claim 90, wherein the method is used to

Citation Information

Patent Citations

  • Antisense oligonucleotide for splicing control of myostatin

    JP2007104971A

  • Method for treating premature laminopathy using oligonucleotide analogs targeting human LMNA

    JP2015501817A

  • Compositions and methods for modulating tau expression

    JP2016513976A