Compositions and methods for increasing fetal hemoglobin and treating sickle cell disease
By targeting CUL3 and SPOP with inhibitors, HbF expression is upregulated in erythroid cells, addressing the inadequacies of current treatments for SCD and β-thalassemia, enhancing HbF production and mitigating disease symptoms.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- FULCRUM THERAPEUTICS INC
- Filing Date
- 2024-08-08
- Publication Date
- 2026-05-26
Smart Images

Figure 0007866009000065 
Figure 0007866009000066 
Figure 0007866009000067
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications [1] This application is a U.S. Provisional Application No. 62 / 769,7 filed on November 20, 2018. We claim the interests and priority therefor of Article 96, the contents of which are incorporated herein by reference in their entirety.
[0002] Statement regarding sequence listings [2] Sequence listings relating to this application are provided in text format instead of paper copies, The sequence listing named "FULC-033JPD1_SL.xml" Incorporated herein by reference 。
[0003] Areas of disclosure [3] This disclosure relates to fetal hemoglobin (hemoglobin γ (HBγ)) in erythroid cells. The present disclosure relates to targets, compositions, and methods for inducing HbF expression. The present disclosure further relates to methods for treating patients suffering from diseases associated with blood cell disorders such as sickle cell disease (SCD) or β-thalassemia, including those in which elevated expression of HbF protein can compensate for mutated or defective hemoglobin β (HBB) genes, mutated or defective HBB proteins, or changes in HBB protein levels. [Background technology]
[0004] background [4] Hemoglobin is an important protein involved in oxygen transport throughout the body of vertebrates. Hemoglobin is found in red blood cells and consists of two α subunits and two β-like subunits. The composition of hemoglobin is developmentally regulated, and the human genome codes for multiple versions of these proteins, which are expressed during different developmental stages (Blobel et al, Exp Hematol 2015; Stamatoyannopoulos G, Exp Hematol 2005). Generally, fetal hemoglobin (HbF) consists of two subunits of hemoglobin γ (HBγ) and two subunits of hemoglobin α (HBα), while adult hemoglobin (HbA) consists of two subunits of hemoglobin β (HBβ) and two subunits of HBα. Thus, the β-like subunit (HBγ), which is used during the fetal period of development, switches to hemoglobin β (HBβ) after birth.
[0005] [5] The developmental regulation of β-like subunit expression has been the focus of vigorous research for decades. The five human β-like subunits are located on chromosome 11, and their genomic locations correspond to their temporal expression patterns. Distal clusters of enhancer elements called locus regulatory regions (LCRs) regulate the expression pattern at the β-globin locus, where several transcription factors, including GATA1, GATA2, KLF1, KLF2, MYB, and TALI, bind to specific locations within the LCR at specific times in development. The five human β-like subunits are epsilon (HBE1;ε), gamma G (HBG2;γ), gamma A (HBG1;γ), delta (HBD;δ), and beta (HBB;β). The HBE1 gene is expressed during embryonic development, the HBG1 and HBG2 genes are expressed during fetal development, and the HBD and HBB genes are expressed in adulthood. The HBG1 and HBG2 genes encode the same protein except for a single amino acid change of 136 residues (HBG1=gly; HBG2=ala). Red blood cell disorders such as sickle cell disease (SCD) and β-thalassemia are caused by changes in the hemoglobin β (HBβ) subunit gene. It is caused by...
[0006] [6] SCD affects millions of people worldwide and is the most common genetic blood disorder in the United States. It is a disorder (70,000-80,000 Americans). SCD is more common in African Americans, with an estimated incidence of 1 in 500. SCD is an autosomal recessive genetic disorder caused by a single homozygous mutation in both copies of the HBB gene (E6V), resulting in a mutant hemoglobin protein called HbS (https: / / ghr.nlm.nih.gov / condition / sickle-cell-disease). Under deoxygenated conditions, HbS Protein polymerizes, which leads to abnormal red blood cell morphology. This abnormal morphology can lead to multiple pathological conditions, including vascular occlusion, pain crisis, pulmonary hypertension, organ damage, and stroke.
[0007] [7] Beta-thalassemia is caused by a mutation in the HBB gene, which affects hemoglobin It leads to decreased production (https: / / ghr.nlm.nih.gov / condition / beta-thalassemia). Mutations in the HBB gene typically reduce the production of adult beta-globin protein, resulting in low levels of adult hemoglobin (HbA). This leads to a shortage of red blood cells and insufficient oxygen distribution throughout the body. Patients with beta-thalassemia may experience weakness and fatigue and are at risk of developing abnormal blood clots. Thousands of infants are born with beta-thalassemia each year, and symptoms are typically detected within the first two years of life.
[0008] [8] Fetal hemoglobin upregulation is due to mutant HbS in SCD. Identifying factors that regulate fetal hemoglobin expression can be a useful target for the treatment of SCD and β-thalassemia, as they can compensate for the lack of HbA in the protein or β-thalassemia. Since β-like globin expression is developmentally regulated, and the decrease in the fetal orthologue (γ) occurs immediately after birth, coinciding with the increase in the adult orthologue (β), it is hypothesized that maintaining the expression of anti-sickling γ orthologue may be therapeutically beneficial in both children and adults. Hemoglobin γ (HBγ), the fetal orthologue of HBβ, can reverse disease-related pathophysiology in these disorders by forming a complex with the necessary hemoglobin α subunit (Paikari and Sheehan, Br J Haematol 2018; Lettre and Bauer, Lancet 2016). Fetal hemoglobin protein expression can reverse the pathophysiology of SCD through the inhibition of HbS polymerization and morphologically defective erythrocytes. Functionally, upregulation of either the HBG1 or HBG2 gene can compensate for mutated or defective adult HBβ. Based on clinical and preclinical studies, upregulation of hemoglobin γ (HBγ) is associated with compounds including palmolidomide and hydroxyurea, as well as EHMT1 / EHMT2 and This is a proposed mechanism for targets including LSD1 (Moutouh-de Parseval et al. J Clin Invest 2008; Letvin et al. NEJM 1984; Renneville et al. Blood 2015; Shi et al.). Nature Med 2015). [Overview of the project] [Problems that the invention aims to solve]
[0009] [9] Elevated expression of HbF protein is due to mutation or defect in hemoglobin β (HBβ) Given the severity of hematological cytological disorders such as sickle cell disease (SCD) and β-thalassemia, including those for which genetic compensation can be achieved, and the lack of effective treatments, there is a clear need for new treatment methods for these disorders. This disclosure satisfies this need by providing novel therapeutic agents and methods for increasing HbF to treat these disorders. [Means for solving the problem]
[0010] Summary of the Invention
[10] This disclosure is in part the fetal hemoglobin in erythroid cells (hemoglobin This disclosure is based on the identification of novel targets for inducing γ(HBγ) or HbF) expression. The disclosure further relates to methods for treating patients suffering from diseases associated with hematological cytotoxicity, such as sickle cell disease (SCD) or β-thalassemia.
[0011]
[11] In one embodiment, the present disclosure provides a method for increasing the expression of fetal hemoglobin (HbF) in cells, comprising contacting the cells with an inhibitor of a target protein or protein complex that functions to modulate HbF expression. In some embodiments, HbF includes hemoglobin gamma and hemoglobin alpha. In some embodiments, hemoglobin gamma includes hemoglobin gamma G1 (HBG1) and / or hemoglobin gamma G2 (HBG2). In certain embodiments, the target protein or protein complex modulates HbF expression via molecular signaling pathways listed in Table 5. In certain embodiments, the molecular signaling pathway is selected from the group consisting of glucagon signaling pathways, carbon metabolism, oxytocin signaling, glycolysis, gluconeogenesis, endocrine resistance, gonadotropin-releasing hormone (GnRH) signaling, oocyte meiosis, fatty acid breakdown, and modulation of inflammatory mediators of transient receptor potential (TRP) channels. In certain embodiments, the target protein is CUL3. In certain embodiments, the target protein is SPOP. In certain embodiments, the target protein is selected from those listed in Tables 1, 2, 3, 4, 5, 6, or 7. In certain embodiments, the hit shows concentrated expression in whole blood against other tissues and cell types. In certain embodiments, the target protein (or hit) is expressed in late erythroid cells or is listed in Table 7. In some embodiments, the target protein is permanently or transiently associated with a multiprotein complex that regulates HbF expression. In some embodiments, the multiprotein complex is selected from those listed in Tables 3 or 4, and the target is selected from those listed in Tables 3 or 4. In certain embodiments, CUL3 is permanently or transiently associated with the multiprotein complex.In certain embodiments, the multiprotein complex is selected from D(4) dopamine receptor (DRD4)-Kelch-like protein 12(KLH12)-CUL3, ubiquitin E3 ligase, coiled-coil domain-containing protein 22(CCDC22)-COMM domain-containing protein 8(COMMD8)-CUL3, or karin-related NEDD8 dissociated protein (CAND1)-CUL3-E3 ubiquitin protein ligase RBX1(RBX). In certain embodiments, SPOP is permanently or transiently associated with the multiprotein complex. In certain embodiments, the multiprotein complex is a ubiquitin E3 ligase complex. In certain embodiments, the inhibitor targets a nucleotide sequence encoding a target protein or protein complex, thereby inhibiting or preventing the expression of the target protein or protein complex. In some embodiments, the nucleotide sequence encoding the target protein or protein complex is DNA or RNA. In certain embodiments, the nucleotide sequence comprises or consists of a nucleic acid encoding CUL3 and optionally encoding the amino acid sequence of SEQ ID NO: 108. In certain embodiments, the nucleotide sequence comprises or consists of a nucleic acid encoding SPOP and optionally encoding the amino acid sequence of SEQ ID NO: 109. In some embodiments, the inhibitor is selected from the group consisting of small molecules, nucleic acids, polypeptides, and nucleoprotein complexes that bind to the polynucleotide sequence encoding the target protein, such as the target protein or the gene or rtiRNA encoding the target protein. It should be understood that the inhibitor or target protein may inhibit the target protein by directly inhibiting the target protein, for example by binding to the target protein, or by inhibiting the expression of the target protein, for example by binding to the polynucleotide encoding the target protein. In some embodiments, the nucleic acid is selected from DNA, RNA, shRNA, siRNA, microRNA, gRNA, and antisense oligonucleotides. In certain embodiments, the polypeptide is selected from proteins, peptides, protein mimes, peptide mimes, antibodies or functional fragments thereof, and antibody-drug conjugates or functional fragments thereof.In a particular embodiment, the nuclear protein complex is a. a) a first sequence comprising a guide RNA (gRNA) that specifically binds to a target sequence, wherein the target sequence is a ribonucleoprotein complex (RNP) comprising a second sequence encoding a CRISPR-Cas protein, wherein the CRISPR-Cas protein is a ribonucleoprotein complex (RNP) comprising the second sequence comprising DNA nuclease activity. In certain embodiments, the cells are blood cells, e.g., red blood cells. In certain embodiments, the contact of cells is performed in vitro, in vivo, ex vivo, or in situ.
[0012]
[12] In a related embodiment, the Disclosure provides a pharmaceutical composition for increasing fetal hemoglobin (HbF) expression, comprising an inhibitor of a target protein or protein complex that functions to regulate HbF expression, and a diluent, an excipient and a carrier, the pharmaceutical composition being formulated for delivery to a patient in need. In certain embodiments, the inhibitor is a small molecule, a nucleic acid, e.g., DNA, RNA, shRNA, siRNA, microRNA, gRNA or antisense oligonucleotide or a polypeptide, e.g., a protein, a peptide, a protein mimetic, a peptide mimetic, an antibody or a functional fragment thereof, or an antibody-drug conjugate or a functional fragment thereof. In some embodiments, the small molecule inhibitor targets CUL3. In some embodiments, the CUL3 small molecule inhibitor is selected from MLN4924, suramin or DI-591. In some embodiments, the polypeptide specifically binds to a regulator of HbF expression. In certain embodiments, the inhibitor is a ribonucleoprotein (RNP) complex comprising a) a first sequence containing a guide RNA (gRNA) that specifically binds to a target sequence, the target sequence being a first sequence containing a regulator of HbF expression, and b) a second sequence encoding a CRISPR-Cas protein, the CRISPR-Cas protein being a ribonucleoprotein (RNP) complex comprising a second sequence containing DNA nuclease activity. In certain embodiments, the gRNA binds to the gene encoding the regulator of HbF expression. In certain embodiments, the target sequence is listed in Table 1, 3-4 or 6-7. In some embodiments, the gRNA comprises one or a fragment thereof of any of the targets or sequences in Table 2, or an antisense sequence of the target sequence or fragment thereof. In some embodiments, the target sequence is CUL3. In some embodiments, the target sequence is SPOP. In some embodiments, the gRNA comprises one of the sequences disclosed in Table 2. In some embodiments, the gRNA binds to a gene encoding CUL3 and optionally comprises or consists of GAGCATCTCAAACACAACGA (SEQ ID NO: 94), CGAGATCAAGTTGTACGTTA (SEQ ID NO: 95), or TCATCTACGGCAAACTCTAT (SEQ ID NO: 96).In some embodiments, the gRNA binds to the gene encoding SPOP and optionally comprises or consists of TAACTTTAGCTTTTGCCGGG (SEQ ID NO: 91), CGGGCATATAGGTTTGTGCA (SEQ ID NO: 92), or GTTTGCGAGTAAACCCCAAA (SEQ ID NO: 93). In certain embodiments, the first sequence comprising the gRNA comprises a sequence encoding a promoter capable of expressing the gRNA in a eukaryotic cell. In some embodiments, the second sequence comprising the CRISPR-Cas protein comprises a sequence capable of expressing the CRISPR-Cas protein in a eukaryotic cell, such as a mammalian cell, such as a blood cell, such as a red blood cell. In some embodiments, the composition is delivered via a vector, such as a viral vector such as AAV.
[0013]
[13] In another related embodiment, the disclosure provides a method of treating a disease or disorder associated with a defect in hemoglobin protein activity or expression, the method comprising providing to a subject in need thereof a composition disclosed herein. In some embodiments, the disease or disorder is a blood disorder, such as sickle cell anemia, beta thalassemia, beta-intermedia thalassemia, beta thalassemia major, beta thalassemia minor, and Cooley anemia. In some embodiments, the hemoglobin protein is selected from hemoglobin-alpha and hemoglobin-beta. In certain embodiments, the defect in hemoglobin protein activity or expression results from a mutation, substitution, deletion, insertion, frameshift, inversion, or translocation in the nucleotide sequence encoding the hemoglobin protein. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Brief Description of the Drawings [Figure 1]
[14] Schematic diagram detailing the CRISPR pool screening sample collection process. Samples were collected after puromycin selection (1), before FACS sorting (2), and after sorting for HbF high cells (3). [Figure 2]
[15] FACS sorting plots from CRISPR screening using library #1 are provided. FAC plots are shown for HUDEP2 cells with control gGFP (dark gray) and CRISPR library #1 (light gray). The left panel plots HbF (X axis) and β-actin (Y axis) levels for each event, with line 'L' indicating the HbF threshold for HbF-high cells. The right panel shows the same data in a one-dimensional plot showing HbF levels (X axis) and events (Y axis), with line 'C' indicating the HbF threshold for HbF-high cells. Any cells exceeding the HbF threshold were collected in the HbF-high population. [Figure 3]
[16] FACS sorting plots from CRISPR screening using library #2 are provided. FAC plots are shown for HUDEP2 cells with control sgGFP (dark gray) and CRISPR library #2 (light gray). The left panel plots HbF (X axis) and β-actin (Y axis) levels for each event, with line 'L' indicating the HbF threshold for HbF-high cells. The right panel shows the same data in a one-dimensional plot showing HbF levels (X axis) and events (Y axis), with line 'C' indicating the HbF threshold for HbF-high cells. Any cells exceeding the HbF threshold were collected in the HbF-high population. [Figure 4A]
[17] CRISPR screening data: A detailed list of all bioinformatics analyses performed on genomic alignment (left panel), hit quantification (center panel), and hit prioritization (right panel) is provided. [Figure 4B]
[18] A series of plots showing the distribution of guide abundances in different samples across two different screening libraries (Library #1, left; Library #2, right). Arrows indicate peaks for the number of guides with a given abundance level at input, after selection, and after HbF+ve (HbF-positive screening population). [Figure 4C]
[19] This plot shows the distribution of z-score differences across samples for Library #1. Squares indicate hits that promote differentiation, and triangles indicate hits that hinder differentiation. [Figure 5A]
[20] This is a heatmap showing all genes that have two or more enriched gRNAs in the initial library #1 screening data. [Figure 5B]
[21] This plot shows in detail the overlap between library #1 and library #2. The triangles correspond to genes that were called hits in both screening libraries. [Figure 5C]
[22] An exemplary graph showing Z-score (y-axis) versus UBE2H locus (x-axis), which shows that four of the ten designed guide RNAs have a Z-score greater than 2.5. [Figure 6]
[23] A chart detailing the hit count for each of the distinct biological complexes shown. Complex membership information was obtained from the CORUM database. [Figure 7A]
[24] This is a heatmap showing the z-scores of CRISPR hits enriched in whole blood (32 out of 307 hits show highly enriched expression in whole blood for other tissues and cell types; data source: GTEx). The 32 hits showing highly enriched expression in whole blood are listed in Table 7. [Figure 7B]
[25] This is a heatmap showing hits with a "late erythrocyte" expression pattern (data source: DMAP). Hits with a "late erythrocyte" expression pattern include CUL3, SAP130, PRPS1, NAP1L4, GCLC, CUL4A, GCDH, NEK1, HIRA, MST1, SPOP, GOLGA5, AUH, MAST3, CDKN1B, UBR2, MAP4K4, TAF10, HDGF, YWHAE, AMD1, EID1, HIF1AN, CDK8, DCK, FXR2, UQCRC1, TESK2, ADCK2, USP21, CAMK2D, FGFR1, PHC2, UBE2H, BPGM, SIRT2, S1RT3, NFYC, and CPT2. [Figure 7C]
[26] A hierarchical differentiation tree of UBE2H exhibiting an exemplary “late erythroid” expression pattern. [Figure 8A]
[27] A series of images showing HbF levels determined by HbF immunocytochemistry (ICC) using loss of function based on CRISPR Cas9-RNP. The Cas9-RNP complex was electroporated into proliferating CD34+ cells. The cells were then differentiated into erythrocytes for 7 days, and HbF levels were quantified using HbF ICC. Percentage F cells (top row) and mean HbF intensity (bottom row) were quantified for negative control, sgBCL11A, sgSPOP, and sgCUL3. [Figure 8B]
[28] A series of graphs showing HbF levels determined by HbF ICC using shRNA-based loss of function. Percent F cells were quantified for each shRNA construct, negative control, shBCL11A, shSPOP, and shCUL3. [Figure 8C]
[28] A series of graphs showing HbF levels determined by HbF ICC using shRNA-based loss of function. Mean HbF intensity was quantified for each shRNA construct, for negative control, shBCL11A, shSPOP, and shCUL3. [Figure 8D]
[28] A series of graphs showing HbF levels determined by HbF ICC using shRNA-based loss of function. Percent F cells were quantified for each shRNA construct, negative control, shBCL11A, shSPOP, and shCUL3. [Figure 8E]
[28] A series of graphs showing HbF levels determined by HbF ICC using shRNA-based loss of function. Mean HbF intensity was quantified for each shRNA construct, for negative control, shBCL11A, shSPOP, and shCUL3. [Modes for carrying out the invention]
[0015] Detailed description of the invention
[29] The present invention relates to targets, compositions and methods for increasing fetal hemoglobin (HbF) in erythroid cells, for example, by increasing the expression of hemoglobin gamma (HBγ). This can be done through upregulation of hemoglobin gamma mRNA levels (e.g., HBG1 or HBG2) and / or upregulation of fetal hemoglobin protein (HBγ) levels, resulting in an increase in HbF. The targets, compositions or methods may be used alone or in combination with other agents that upregulate HbF or target symptoms of SCD or β-thalassemia (including, but not limited to, vascular occlusion and anemia).
[0016] Abbreviation
[30] As used herein and in the appended claims, the singular "one (a) ", "an", and "that" include multiple references unless the context specifically indicates otherwise.
[0017]
[31] As used herein, the term “and / or” is used in this disclosure either “and” or “or” unless otherwise indicated.
[0018]
[32] Throughout this specification, unless the context specifically requires otherwise, variations of the word “comprise” or “comprises” or “contains” shall be used in reference to the elements described, This suggests that it includes integers, elements, or groups of integers, but it is understood that it does not exclude any other elements, integers, or groups of elements or integers.
[0019]
[33] As used in this application, the terms “about” and “approximately” are used interchangeably. Any numbers used in this application, with or without “about / approximately,” are intended to encompass any normal variation recognized by a person skilled in the art relating to the subject. In certain embodiments, the terms “approximately” or “about” refer to a range of values that, unless otherwise noted or evident from the context (except where such numbers exceed 100% of a possible value), fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, and 1% in either direction (greater than or less than) the referenced value.
[0020]
[34] “Administration” as used herein means introducing a drug or composition into a target or bringing a drug or composition into contact with cells and / or tissues.
[0021] Method and composition
[35] In one embodiment, the present disclosure provides a method for increasing the amount of fetal hemoglobin (HbF) in cells. In certain embodiments, the method comprises increasing the expression of one or more components of HbF in cells. In certain embodiments, the components of HbF are hemoglobin γ (HBγ), for example, human hemoglobin subunit gamma-1 (HBG1) or human hemoglobin subunit gamma-2 (HBG2). In certain embodiments, the components of fetal hemoglobin are hemoglobin α (HBα), for example, human hemoglobin subunit alpha-1 (HBA1) or human hemoglobin subunit alpha-2 (HBA2). In certain embodiments, the expression of both HBγ and HBα is increased.
[0022]
[36] In certain embodiments, fetal hemoglobin comprises human hemoglobin subunit gamma-1 (HBG1) having the protein sequence described in the NCBI reference sequence: NP_000550.2 and shown below. [ka]
[0023]
[37] In certain embodiments, the HBG1 protein is encoded by the polynucleotide sequence described in the NCBI reference sequence:NM_000559.2 and shown below. [ka]
[0024]
[38] In certain embodiments, fetal hemoglobin comprises human hemoglobin subunit gamma-2 (HBG2) having the protein sequence described in the NCBI reference sequence: NP_000175.1 and shown below. [ka]
[0025]
[39] In certain embodiments, the HBG2 protein is encoded by the NCBI reference sequence:NM_000184.2, NCBI reference sequence:NM_000184.3, or by the polynucleotide sequence shown below. [ka]
[0026]
[40] In certain embodiments, fetal hemoglobin comprises human hemoglobin subunit alpha-1 (HBA1) having the protein sequence described in the NCBI reference sequence: NP_000549.1 and shown below. [ka]
[0027]
[41] In certain embodiments, the HBA1 protein is encoded by the NCBI reference sequence:NM_000558.4, NCBI reference sequence:NM_000558.5, or by the polynucleotide sequence shown below. [ka]
[0028]
[42] In certain embodiments, fetal hemoglobin comprises human hemoglobin subunit alpha-2 (HBA2) having the protein sequence described in the NCBI reference sequence: NP_000508.1 and shown below. [ka]
[0029]
[43] In certain embodiments, the HBA2 protein is encoded by the NCBI reference sequence:NM_000517.4, NCBI reference sequence:NM_000517.6, or by the polynucleotide sequence shown below. [ka]
[0030]
[44] In certain embodiments, fetal hemoglobin comprises two HBG1 and / or HBG2 proteins and two HBA1 and / or HBA2 proteins.
[0031]
[45] The methods disclosed herein may be carried out in vitro or in vivo.
[0032]
[46] The methods disclosed herein include contacting cells with an inhibitor of a target gene, mRNA, or protein disclosed herein (which may be collectively referred to as “targets”), wherein inhibition of the target results in an increase in the amount of fetal hemoglobin in cells, e.g., the erythrocyte lineage or erythrocytes. In certain embodiments, inhibition of the target results in an increase in the amount of HBG1 or HBG2 in cells. In certain embodiments, an amount of the inhibitor effective in resulting in an increase in the levels of Hbγ and / or HbF is used. In certain embodiments, the method includes contacting tissue, organ, or organism, e.g., mammal, with the inhibitor. In certain embodiments, one or more inhibitors, each targeting the same or different targets, may be used.
[0033]
[47] In certain embodiments, the target gene, mRNA, or protein is karin 3 (CUL3). CUL3 is a core component of a group of E3 ubiquitin ligase protein complexes that regulate the ubiquitination of target proteins leading to proteasomal degradation. In some embodiments, the CUL3-E3 ubiquitin ligase complexes regulate a number of cellular processes responsible for protein transport, stress response, cell cycle regulation, signal transduction, protein quality control, transcription, and DNA replication.
[0034]
[48] In one embodiment, the present disclosure provides a method for increasing the amount of fetal hemoglobin (HbF) in cells by inhibiting or regulating the expression of CUL3.
[0035]
[49] In certain embodiments, CUL3 comprises the following protein sequence: [ka]
[0036]
[50] In certain embodiments, the target gene, mRNA, or protein is a speckle-type POZ protein (SPOP). In certain embodiments, the SPOP is associated with a plurality of E3 ubiquitin ligase complexes.
[0037]
[51] In one embodiment, the present disclosure provides a method for increasing the amount of fetal hemoglobin (HbF) in cells by inhibiting or regulating the expression of SPOP.
[0038]
[52] In a particular embodiment, SPOP comprises the following protein sequence: [ka]
[0039]
[53] The term “inhibitor” can refer to any agent that inhibits the expression or activity of a target gene, mRNA and / or protein in a cell, tissue, organ or subject. The expression level or activity of a target mRNA and / or protein in a cell can be reduced by a variety of means, including, but not limited to, reducing the total amount of the target protein or inhibiting the activity of one or more of the target proteins. In various embodiments, an inhibitor may inhibit the expression of a target gene, target mRNA or target protein, and / or an inhibitor may inhibit the biological activity of a target protein. In certain embodiments, the biological activity is kinase activity. For example, an inhibitor may competitively bind to the ATP binding site of a kinase and inhibit its kinase activity, or an inhibitor may allosterically block kinase activity. In certain embodiments, an inhibitor may cause increased degradation of the target protein. In certain embodiments, an inhibitor may inhibit any of the target genes or proteins identified in Table 1, Table 2, Table 6, Table 7, Table 8 or Table 9, or any component or subunit of any of the complexes identified in Table 3 or Table 4, or a pathway identified in Table 5. Methods for determining the expression level or activity of a target gene or polypeptide are known in the art and include, for example, RT-PCR and FACS.
[0040]
[54] In certain embodiments, the inhibitor directly inhibits the expression or activity of a target gene, mRNA, or protein; for example, the inhibitor may directly bind to a target gene, mRNA, or protein. In some embodiments, the inhibitor indirectly inhibits the expression or activity of a target gene, mRNA, or protein; for example, the inhibitor may bind to a protein that mediates the expression of a target gene, mRNA, or protein (such as a transcription factor) and inhibit it, or the inhibitor may bind to another protein involved in the activity of the target protein (such as another protein present in a complex with the target protein) and inhibit the expression of that activity.
[0041]
[55] In certain embodiments, the inhibitor inhibits SPOP or a protein complex to which SPOP is permanently or transiently associated. In certain embodiments, the protein complex is a SPOP-associated E3 ubiquitin ligase complex. In certain embodiments, the complex comprises core histone macro-H2A.1 (H2AFY), SPOP and CUL3; DNA damage binding protein 1 (DDB1), DNA damage binding protein 2 (DDB2), karin-4A (CUL4A), karin-4B (CUL4B) and E3 ubiquitin protein ligase RBX1 (RBX); or Polycomb complex protein BMI-1 (BMI1), SPOP and CUL3; SPOP, death domain-associated protein 6 (DAXX) and CUL3; core histone macro-H2A.1 (H2AFY), SPOP and CUL3; or BMI1, SPOP and CUL3. In certain embodiments, the inhibitor inhibits one or more components of any of these complexes. In some embodiments, the inhibitor inhibits SPOP expression, while in other embodiments, the inhibitor inhibits SPOP activity.
[0042]
[56] In certain embodiments, the inhibitor inhibits CUL3 or a protein complex to which CUL3 is permanently or transiently associated. In certain embodiments, the protein complex is a CUL3-associated E3 ubiquitin ligase complex. In certain embodiments, the CUL3-associated protein complex is D(4) dopamine receptor (DRD4)-Kelch-like protein 12 (KLH12)-CUL3. In certain embodiments, the CUL3-associated protein complex is a coiled-coil domain-containing protein 22 (CCDC22)-COMM domain-containing protein 8 (COMMD8)-CUL3 complex. In certain embodiments, the CUL3-associated protein complex is karin-associated NEDD8 dissociation protein (CAND1)-CUL3-E3 ubiquitin protein ligase RBX1 (RBX1). In some embodiments, the complex includes SPOP, death domain-associated protein 6 (DAXX) and CUL3; core histone macro-H2A.1 (H2AFY), SPOP and CUL3; DNA damage binding protein 1 (DDB1), DNA damage binding protein 1 (DDB2), karin-4A (CUL4A), karin-4B (CUL4B) and E3 ubiquitin-protein ligase RBX1 (RBX1); Polycomb complex protein BMI-1 (BMI1), SPOP and CUL3; COP9 signalosome complex subunit 1 (CSN1), COP9 signalosome complex subunit 8 (CSN8), Sequence ID 110 The complex includes hairy / enhancer-of-split (HRT1) associated with YRPW motif protein 1, S-phase kinase-related protein 1 (SKP1), S-phase kinase-related protein 2 (SKP2), karin-1 (CUL1), karin-2 (CUL2), and karin-3; CUL3, Kelch-like protein 3 (KLHL3), and serine / threonine-protein kinase WNK4 (WNK4); CUL3, KLHL3, and serine / threonine-protein kinase WNK1 (WNK1); CUL3 and KLHL3. In certain embodiments, the inhibitor inhibits one or more components of these complexes. In some embodiments, the inhibitor inhibits the expression of CUL3, while in other embodiments, the inhibitor inhibits the activity of CUL3.
[0043]
[57] In one embodiment, a method for increasing the amount of fetal hemoglobin in a cell, tissue, organ or subject comprises contacting the cell, tissue, organ or subject with a drug that results in a decrease in the amount of one or more target genes, mRNA or proteins in the cell. In a particular embodiment, the drug inhibits the expression or activity of one or more target genes, mRNA or polypeptides in the cell or tissue. In a particular embodiment, the drug causes an increase in the degradation of one or more target genes, mRNA or polypeptides. In a particular embodiment, the cell or tissue is contacted with an amount of the drug effective in reducing the expression or activity of one or more target genes, mRNA or polypeptides in the cell or tissue. In a particular embodiment, the cell or tissue is contacted with an amount of the drug effective in reducing the amount of active target proteins in the cell or tissue. In a particular embodiment, the cell is a hematopoietic cell, e.g., a red blood cell. In a particular embodiment, the cell is a finally differentiated cell, e.g., a finally differentiated red blood cell.
[0044]
[58] In any particular embodiment of the methods disclosed herein, the cells include one or more mutations associated with hematological cytotoxicity, e.g., SCD or β-thalassemia. In any particular embodiment of the methods disclosed herein, the cells have a reduced amount of functionally active HbA compared to control cells, e.g., non-disease cells. In a particular embodiment, the cells are associated with hematological cytotoxicity, e.g., SCD or β-thalassemia. For example, the cells may be derived from or obtained from cells or tissues of a subject diagnosed with hematological cytotoxicity. In a particular embodiment, the method is performed on a subject diagnosed with hematological cytotoxicity, e.g., SCD or β-thalassemia. The methods disclosed herein may be performed in vitro or in vivo.
[0045]
[59] In a related embodiment, the Disclosure relates to the treatment or prevention of a hematological cellular disorder or impairment associated with a reduced amount of functionally active HbA (or total HbA) in a person who needs it. A method for performing the procedure, comprising providing a drug to the target that inhibits the expression or activity of one or more target proteins in the target or specific cells or tissues of the target, the procedure being performed on the target or one or more cells or tissues of the target, for example, hematopoietic cells, for example, erythrocytes The method includes a method that results in an increase in the amount of HbF in red blood cells. In certain embodiments, the agent is present in a pharmaceutical composition. In some embodiments, the subject is provided with one or more (e.g., two, three, or more) agents that inhibit the expression or activity of one or more target proteins in the subject or specific cells or tissues of the subject. In some embodiments, two or more agents inhibit the same target or target complex disclosed herein, while in other embodiments, two or more agents inhibit different targets or target complexes disclosed herein. In certain embodiments, the cells are finally differentiated, for example, finally differentiated red blood cells. In some embodiments, the agent inhibits the expression or activity of one or more target proteins. In certain embodiments, the agent induces the degradation of one or more target proteins. In certain embodiments, the agent inhibits the activity of one or more target proteins. In certain embodiments of any of the methods, the inhibitor reduces the expression of one or more target genes, mRNA, or proteins in the cells or tissues of the subject, for example, hematopoietic cells, for example, red blood cells. In certain embodiments, the inhibitor inhibits any of the target genes or proteins identified in Tables 1, 2, 6, 7, 8, or 9, or any component or subunit of any of the complexes identified in Tables 3 or 4, or a pathway identified in Table 5.
[0046]
[60] In certain embodiments of the treatment methods disclosed herein, the blood disorder or disorder is selected from sickle cell disease, β-thalassemia, β-thalassemia trait or β-thalassemia minor, intermediate thalassemia, thalassemia major, or Cooley's anemia.
[0047]
[61] In any particular embodiment of the methods described herein, the pharmaceutical composition is provided to the subject parenterally.
[0048]
[62] Inhibitors and / or other agents and compositions described herein (e.g., inhibitors) may be formulated in any form suitable for a desired route of administration (e.g., parenteral or oral administration). In some embodiments, contact of the agent or composition with cells and / or tissues is a result of administering or providing the agent or composition to a target. In some embodiments, the agent or composition (e.g., inhibitor) is administered at least 1, 2, 3, 4, 5, 10, 15, 20 times or more. In some embodiments of combination therapy, the administration of the first agent or composition is followed by, overlaps with, or concurrent with the administration of the second agent or composition. The first and second agents or compositions may be the same or different. In some embodiments, the first and second agents or compositions are administered by the same agent and / or at the same geographical location. In some embodiments, the first and second agents or compositions are administered by different agents and / or at different geographical locations. In some embodiments, the multiple agents described herein are administered as a single composition.
[0049]
[63] A variety of administration methods may be used in conjunction with the inhibitors by the methods disclosed herein. For example, the inhibitors may be administered locally, orally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, transrectally, intraorally, transnasally, intraliposomally, by inhalation, intravaginally, intraocularly, via local delivery (e.g., by catheter or stent), subcutaneously, intrafatally, intra-articularly, intrathecally, transmucosally, intrapulmonaryly, or parenterally, by injection, for example, subcutaneously, intradermally, intramuscularly, intra-arterially, intracardiacly, intrathecally, intraspinally, intracardiacly, intrathecally, intraspinally, intracapsularly, intraorbitally, intraorbitally, intraperitoneally, intratracheally, subepidermally, intra-articularly, and intrasternally; or by implantation of a depot or reservoir, for example, subcutaneously or intramuscularly or concurrently.
[0050]
[64] The term “subject” includes animals (e.g., mammals, pigs, fish, birds, insects, etc.). In some embodiments, the subject is a mammal, in particular a primate, in particular a human. In some embodiments, the subject is livestock such as cattle, sheep, goats, cows, and pigs; poultry such as chickens, ducks, geese, and turkeys; and domesticated animals such as dogs and cats. In some embodiments (e.g., particularly in relation to research), the subject is a rodent (e.g., mouse, rat, hamster), a rabbit, a primate, or a pig such as an inbred pig. The terms “subject” and “patient” are used interchangeably herein.
[0051]
[65] A “tissue” is a collection of similar cells of the same origin that work together to perform a specific function.
[0052]
[66] The methods disclosed herein may be carried out using any agent capable of inhibiting the expression or activity of a target gene, mRNA, or protein, such as an inhibitor of a gene, mRNA, or protein, complex, or pathway disclosed herein, for example, in any of Tables 1 to 9.
[0053]
[67] In certain embodiments, the methods disclosed herein result in, for example, a decrease in the expression level or activity of a target gene, mRNA, or protein in one or more cells or tissues (e.g., within the subject) compared to the expression level or activity in a control cell or tissue that has not been in contact with the inhibitor, or to a reference level. "Decrease" means a decrease of, for example, at least 5%, for example, at least 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, or 100% compared to a reference level. A decrease also means a decrease of, for example, at least 1-fold, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, or 1000-fold or more compared to the level of a reference or control cell or tissue.
[0054]
[68] In certain embodiments, the methods disclosed herein result in, for example, an increase in the amount of HbF or HBγ in one or more cells or tissues (e.g., within the subject) compared to the expression level or activation level or reference level in control cells or tissues that have not been in contact with the inhibitor. In certain embodiments, the methods disclosed herein result in, for example, an increase in the expression of hemoglobin gamma (e.g., HBG1 or HBG2) in one or more cells or tissues (e.g., within the subject) compared to the expression level or reference level in control cells or tissues that have not been in contact with the inhibitor. "Increase" means an increase of, for example, at least 5%, for example, at least 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, or 100%, or at least 2, 3, 5, 10, 20, 50, 100, 500, or 1000 times compared to the level in a reference cell or tissue.
[0055]
[69] The methods described herein may be carried out using any type of inhibitor that results in a reduction in the amount or level of a target gene, mRNA or protein in cells or tissues, for example, the cells or tissue of interest. In certain embodiments, the inhibitor causes, for example, a reduction in the active target protein, a reduction in the total target protein, a reduction in the target mRNA level and / or a reduction in the target protein activity in cells or tissues that have come into contact with the inhibitor. In certain embodiments, the reduction is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to the level or reference level in cells or tissues of the same type that have not come into contact with the inhibitor. Methods for measuring the total protein or mRNA level or activity in cells are known in the Art. In certain embodiments, the inhibitor inhibits or reduces the activity or expression of a target protein, such as mRNA and / or protein expression. In specific embodiments, the inhibitor causes increased degradation of the target protein, resulting in a lower amount of the target protein in cells or tissues.
[0056]
[70] Inhibitors that can be used to carry out the disclosed methods include, but are not limited to, agents that inhibit, reduce, or decrease the expression or activity of a biomolecule, such as a target gene, mRNA, or protein. In certain embodiments, the inhibitor may cause increased degradation of the biomolecule. In certain embodiments, the inhibitor may inhibit the biomolecule by competitive, non-competitive, or non-competitive means. Exemplary inhibitors include, but are not limited to, nucleic acids, DNA, RNA, gRNA, shRNA, siRNA, modified mRNA (mRNA), microRNA (miRNA), proteins, protein mimes, peptides, peptide mimes, antibodies, small molecules, organic small molecules, inorganic molecules, chemicals, enzymes, analogs that mimic the binding sites of receptors or other proteins (e.g., those involved in signal transduction), therapeutic agents, pharmaceutical compositions, drugs, and combinations thereof. In some embodiments, the inhibitor may be a nucleic acid molecule, such as, but not limited to, siRNA, that reduces the amount of a functional protein in a cell. Thus, any compound or agent said to be “can inhibit” a particular target protein includes any type of inhibitor.
[0057]
[71] In certain embodiments, the inhibitor comprises a nucleic acid that binds to a target gene or mRNA. Thus, the nucleic acid inhibitor may comprise a sequence complementary to the target polynucleotide sequence or region thereof or its antisense. In certain embodiments, the nucleic acid inhibitor comprises at least 8, at least 10, at least 12, at least 14, at least 16, at least 20, at least 24, or at least 30 nucleotide sequences corresponding to or complementary to the target polynucleotide sequence or its antisense.
[0058]
[72] In certain embodiments, the nucleic acid inhibitor is an RNA interfering or antisense RNA agent, or a part or mimetic thereof, or a morpholino, which reduces the expression of a target gene when administered to cells. Typically, the nucleic acid inhibitor comprises at least a part of the target nucleic acid molecule or its ortholog, or at least a part of the complementary strand of the target nucleic acid molecule. In some embodiments, the expression of the target gene is reduced by at least about 10%, at least about 25%, at least about 50%, at least about 75%, or further by 90–100%.
[0059]
[73] A “complementary” nucleic acid sequence is a nucleic acid sequence that can hybridize with another nucleic acid sequence composed of complementary nucleotide base pairs. To “hybridize” means that, under appropriate stringency conditions, the pairs of complementary nucleotide bases form a double-stranded molecule (for example, adenine (A) base-pairs with thymine (T) in DNA, and similarly, guanine (G) base-pairs with cytosine (C)). (See, for example, Wahl, GM and SL Berger (1987) Methods Enzymol. 152: 399; Kimmel, AR (1987) Methods Enzymol. 152: 507).
[0060]
[74] “Antisense” refers to a nucleic acid sequence complementary to a nucleic acid sequence, regardless of length. In certain embodiments, antisense RNA refers to a single-stranded RNA molecule that can be introduced into an individual cell, tissue or subject and result in a reduction of the expression of a target gene by a mechanism independent of the endogenous gene silencing pathway. Antisense nucleic acids may include a modified backbone, e.g., phosphorothioates, phosphorodithioates or others known in the art, or may include non-natural nucleoside bonds. Antisense nucleic acids may include, for example, locked nucleic acids (LNAs).
[0061]
[75] As used herein, “RNA interference” refers to the use of agents that reduce the expression of a target gene by degrading the target mRNA via an endogenous gene silencing pathway (e.g., Dicer and RNA-induced silencing complex (RISC)). RNA interference can be achieved using a variety of agents, including shRNA and siRNA. “Short hairpin RNA” or “shRNA” refers to a double-stranded artificial RNA molecule with a hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). ShRNA expression in cells is typically achieved by plasmid delivery or via viral or bacterial vectors. ShRNA is a favorable mediator of RNAi in that it has a relatively low rate of degradation and turnover. Small interfering RNAs (siRNAs) are a class of double-stranded RNA molecules, usually 20-25 base pairs long, similar to miRNAs, that function within the RNA interference (RNAi) pathway. They interfere with the expression of specific genes with complementary nucleotide sequences by degrading mRNA after transcription and interfering with translation. In certain embodiments, siRNA is 18, 19, 20, 21, 22, 23, or 24 nucleotides long and has a two-base overhang at its 3' end. siRNA can be introduced into individual cells and / or culture systems to result in the degradation of a target mRNA sequence. As used herein, “morpholino” refers to a modified nucleic acid oligomer in which standard nucleic acid bases are bound to a morpholine ring and linked via phosphorodiamidate bonds. Like siRNA and shRNA, morpholino binds to complementary mRNA sequences. However, morpholino does not target complementary mRNA sequences for degradation, but rather functions through steric inhibition of mRNA translation and alteration of mRNA splicing.
[0062]
[76] In certain embodiments, the nucleic acid inhibitor is a messenger RNA that can be introduced into a cell, where the nucleic acid inhibitor encodes a polypeptide inhibitor of a target disclosed herein. In certain embodiments, the mRNA is modified, for example, by incorporating one or more modified nucleosides, to increase its stability or decrease its immunogenicity. Suitable modifications are known in the art.
[0063]
[77] In certain embodiments, the inhibitor comprises an expression cassette encoding a polynucleotide or polypeptide inhibitor of a target disclosed herein. In certain embodiments, the expression cassette is present in a gene therapy vector, such as a viral gene therapy vector. A variety of gene therapy vectors, including viral gene therapy vectors, are known in the art, such as AAV-based gene therapy vectors.
[0064]
[78] In some embodiments, the inhibitor is a polypeptide inhibitor. In certain embodiments, the polypeptide inhibitor binds to a target polypeptide and thus inhibits its activity, for example, kinase activity. Examples of polypeptide inhibitors include any type of polypeptide (e.g., peptides and proteins), such as antibodies and fragments thereof.
[0065]
[79] “Antibody” is an immunoglobulin (Ig) molecule that can specifically bind to a target such as a carbohydrate, polynucleotide, lipid, or polypeptide via at least one epitope recognition site located in the variable region of the immunoglobulin Ig molecule. As used herein, the term encompasses not only intact polyclonal or monoclonal antibodies but also their fragments, e.g., dAb, Fab, Fab', F(ab')2, Fv, single-stranded (scFv), their synthetic variants, naturally occurring variants, fusion proteins containing an antibody moiety having an antigen-binding fragment of the required specificity, chimeric antibodies, nanobodies, and any other modified configurations of immunoglobulin molecules containing an antigen-binding site or fragment of the required specificity.
[0066]
[80] “Fragment” means a portion of a polypeptide or nucleic acid molecule. This portion preferably comprises at least 10%, 20%, 30%, or 40% of the total length of the reference nucleic acid molecule or polypeptide. , 50%, 60%, 70%, 80%, or 90%. The fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids. A “functional fragment” of an antibody is a fragment that maintains one or more activities of the antibody, for example, a functional fragment binds to the same epitope and / or has the biological activity of the antibody. In certain embodiments, the functional fragment contains six CDRs present in the antibody.
[0067]
[81] In certain embodiments, the inhibitor induces the degradation of a target polypeptide. For example, the inhibitor includes a proteolytic chimera (PROTAC) that induces selective intracellular proteolysis of a target protein. The PROTAC comprises a functional domain which may be a covalently bound protein-binding molecule, one of which can bind to an E3 ubiquitin ligase and the other can bind to the target protein that is to be degraded. Once the E3 ligase is recruited to the target protein, ubiquitination and subsequent proteasome degradation of the target protein occur. In certain embodiments, the inhibitor is a PROTAC that targets any of the targets disclosed herein.
[0068]
[82] In certain embodiments, the inhibitor is a small molecule inhibitor or a stereoisomer, enantiomer, diastereomer, isotope enrichment, prodrug or pharmaceutically acceptable salt thereof. In certain embodiments, the small molecule inhibitor of a target protein or protein complex that functions to regulate HbF expression targets SPOP. In certain embodiments, the small molecule inhibitor of a target protein or protein complex that functions to regulate HbF expression targets CUL3. In certain embodiments, the CUL3 inhibitor is MLN4924 (CAS number: 905579-51-3), suramin (CAS number: 145-63-1), or DI-591 (CAS number: 2245887-38-9).
[0069]
[83] In certain embodiments, the inhibitor comprises one or more components of a gene editing system. As used herein, the term “gene editing system” means a protein, nucleic acid, or combination thereof that, when introduced into a cell, can modify a target locus of an endogenous DNA sequence. Numerous gene editing systems suitable for use in the methods of the present invention are known in the art and include, but are not limited to, zinc finger nuclease systems, TALEN systems, and CRISPR / Cas systems.
[0070]
[84] In some embodiments, the gene editing system used in the methods described herein is a CRISPR (clustered and regularly arranged short palindromic sequence repeat) / Cas (CRISPR-related) nuclease system, which is an engineered nuclease system based on a bacterial system that may be used for mammalian genome engineering. Generally, this system comprises a CRISPR-related endonuclease (e.g., Cas endonuclease) and a guide RNA (gRNA). The gRNA consists of two parts: a CRISPR-RNA (crRNA) specific to the target genomic DNA sequence and a transactivating RNA (tracrRNA) that facilitates the binding of the endonuclease to the DNA at the target insertion site. In some embodiments, the crRNA and tracrRNA may be present in the same RNA oligonucleotide and are called a single guide RNA (sgRNA). In some embodiments, the crRNA and tracrRNA may exist as separate RNA oligonucleotides. In such embodiments, the gRNA consists of a crRNA oligonucleotide and a tracrRNA oligonucleotide that associate to form a crRNA:tracrRNA double helix. As used herein, the terms “guide RNA” or “gRNA” refer to a combination of tracrRNA and crRNA, existing as either sgRNA or crRNA:tracrRNA double helix.
[0071]
[85] In some embodiments, the CRISPR / Cas system is controlled by the Cas protein This includes crRNA and tracrRNA. In some embodiments, crRNA and tracrRNA are combined as a double-stranded RNA molecule to form gRNA. In some embodiments, the crRNA:tracrRNA double helix is formed in vitro before introduction into cells. In some embodiments, crRNA and tracrRNA are introduced into cells as separate RNA molecules, and then the crRNA:tracrRNA double helix is formed in the cell. In some embodiments, polynucleotides encoding crRNA and tracrRNA are provided. In such embodiments, polynucleotides encoding crRNA and tracrRNA are introduced into cells, and then the crRNA and tracrRNA molecules are transcribed in the cell. In some embodiments, crRNA and tracrRNA are encoded by a single polynucleotide. In some embodiments, crRNA and tracrRNA are encoded by separate polynucleotides.
[0072]
[86] In some embodiments, the Cas endonuclease is directed to the target insertion site by sequence specificity of the crRNA portion of the gRNA, which may contain a protospacer motif (PAM) sequence near the target insertion site. A variety of PAM sequences suitable for use with specific endonucleases (e.g., Cas9 endonuclease) are known in the art (see, e.g., Nat Methods. 2013 Nov; 10(11):1116-1121 and Sci Rep. 2014; 4: 5405).
[0073]
[87] The specificity of the gRNA to a target locus is mediated by the crRNA sequence, which comprises a sequence of about 20 nucleotides that is complementary to the DNA sequence at the target locus (e.g., complementary to the target DNA sequence). In some embodiments, the crRNA sequence used in the method of the present invention is at least 90% complementary to the DNA sequence at the target locus. In some embodiments, the crRNA sequence used in the method of the present invention is at least 95%, 96%, 97%, 98%, or 99% complementary to the DNA sequence at the target locus. In some embodiments, the crRNA sequence used in the method of the present invention is 100% complementary to the DNA sequence at the target locus. In some embodiments, the crRNA sequences described herein are designed to minimize off-target binding by using algorithms known in the art (e.g., Cas-OFF finders) to identify target sequences specific to a particular target locus or target gene.
[0074]
[88] In some embodiments, the endonuclease is a Cas protein or orthologue. In some embodiments, the endonuclease is a Cas9 protein. In some embodiments, the Cas9 protein is a Streptococcus pyogenes protein (e.g., SpCas9), a Staphylococcus aureus protein (e.g., SaCas9), or a Neisseria meningitide. It is derived from Neisseria meningitides (NmeCas9). In some embodiments, the Cas endonuclease is a Cas9 protein or Cas9 orthologue, selected from the group consisting of SpCas9, SpCas9-HF1, SpCas9-HF2, SpCas9-HF3, SpCas9-HF4, SaCas9, FnCpf, FnCas9, eSpCas9, and NmeCas9. In some embodiments, the endonuclease is derived from C2C1, C2C3, Cpf1 (also called Cas12a), Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1 The group is selected from Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, and Csf4. In some embodiments, Cas9 is a Cas9 nickase mutant. A Cas9 nickase mutant is a single catalytic activity domain. Contains only the HNH domain or the RuvC domain.
[0075]
[89] In certain embodiments, the Disclosure includes compositions comprising inhibitors of targets disclosed herein, such as pharmaceutical compositions, comprising any of the various classes of inhibitors described herein. The Invention encompasses pharmaceutical compositions comprising inhibitors and pharmaceutically acceptable carriers, diluents, or excipients. Any inert excipients commonly used as carriers or diluents, such as sugars, polyalcohols, soluble polymers, salts, and lipids, may be used in the compositions of the Invention. Sugars and polyalcohols that may be used include, but are not limited to, lactose, sucrose, mannitol, and sorbitol. Examples of soluble polymers that may be used are polyoxyethylene, poloxamer, polyvinylpyrrolidone, and dextran. Useful salts include, but are not limited to, sodium chloride, magnesium chloride, and calcium chloride. Lipids that may be used include, but are not limited to, fatty acids, glycerol fatty acid esters, glycolipids, and phospholipids.
[0076]
[90] In addition, the pharmaceutical composition may contain binders (e.g., acacia, corn starch, gelatin, carbomer, ethylcellulose, guar gum, hydroxypropylcellulose, hydroxypropylmethylcellulose, povidone), disintegrants (e.g., corn starch, potato starch, alginic acid, silicon dioxide, croscarmellose sodium, crospovidone, guar gum, sodium starch glycolate, Primogel), buffers of various pH and ionic strengths (e.g., tris-HCl, acetate, phosphate), additives such as albumin or gelatin to prevent absorption to the surface, detergents (e.g., Tween 20, Tween 80, Plutonic) F68 (bile salt), protease inhibitors, surfactants (e.g., sodium lauryl sulfate), osmotic enhancers, solubilizers (e.g., glycerol, polyethyleneglycerol, cyclodextrin), fluidizers (e.g., colloidal silicon dioxide), antioxidants (e.g., ascorbic acid, sodium metabisulfite, butylated hydroxyanisole), stabilizers (e.g., hydroxypropyl cellulose, hydroxypropyl methylcellulose), viscosity enhancers (e.g., carbomer, colloidal silicon dioxide, ethylcellulose, guar gum), sweeteners (e.g., sucrose, aspartame, citric acid), flavorings (e.g., peppermint, methyl salicylate, or orange flavoring), preservatives The following may further be included: (e.g., thimerosal, benzyl alcohol, parabens), lubricants (e.g., stearic acid, magnesium stearate, polyethylene glycol, sodium lauryl sulfate), flow aids (e.g., colloidal silicon dioxide), plasticizers (e.g., diethyl phthalate, triethyl citrate), emulsifiers (e.g., carbomer, hydroxypropyl cellulose, sodium lauryl sulfate, methylcellulose, hydroxyethylcellulose, sodium carboxymethylcellulose), polymer coatings (e.g., poloxamer or poloxamine), coating and film-forming agents (e.g., ethylcellulose, acrylate, polymethacrylate) and / or auxiliary agents.
[0077]
[91] In one embodiment, the pharmaceutical composition is prepared using a carrier that protects the inhibitor from rapid elimination from the body, such as a controlled-release formulation including an implant and a microencapsulation delivery system. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoester and polylactic acid can be used. Methods for preparing such formulations are obvious to those skilled in the art. The materials may also be commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposome suspension Liposomes (including those targeted to infected cells using monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared, for example, according to methods known to those skilled in the art, as described in U.S. Patent No. 4,522,811.
[0078]
[92] In addition, the present invention relates to pharmaceutical compositions comprising inhibitors in any solid or liquid physical form. This includes, for example, inhibitors may be in crystalline or amorphous form and may have any particle size. The particles may be micronized or aggregated and may be in granular form, powder, oil, oily suspension or any other physical form of solid or liquid.
[0079]
[93] If the inhibitor exhibits insufficient solubility, methods for solubilizing the compound may be used. Such methods are known in the art and include ethanol, propylene glycol, polyethylene glycol (PEG) 300, PEG 400, DMA (10-30%), DMSO (10-20%), NMP (10-20%), surfactants, e.g., polysorbate 80, polysorbate 20 (1-10%), cremophor EL, cremophor RH40, cremophor RH60 (5-10%), Pluronic F68 / Poloxamer 188 (20-50%), Solutol HS15 (20-50%), vitamin E TPGS and da-tocopheryl PEG 1000. pH adjustment and salt formation using a cosolvent such as succinate (20-50%) and complex formation with HP β-CD and SBE β-CD (10-40%), as well as advanced approaches such as micelle and polymer addition, nanoparticle suspension and liposome formation, are included but not limited to these.
[0080]
[94] Inhibitors may also be administered in sustained-release formulations or concurrently. Inhibitors may be in gaseous, liquid, semi-liquid, or solid form, formulated in a manner suitable for the route of administration used. For oral administration, suitable solid oral formulations include tablets, capsules, pills, granules, pellets, sachets, and effervescent agents, powders, etc. Suitable liquid oral formulations include solutions, suspensions, dispersions, syrups, emulsions, oils, etc. For parenteral administration, reconstitution of lyophilized powder is typically used.
[0081]
[95] Appropriate doses of inhibitors for use in treating the diseases or disorders described herein can be determined by those skilled in the art. Generally, therapeutic doses are determined through dose-finding studies in humans, based on preliminary evidence obtained from animal studies. The dose should be sufficient to produce the desired therapeutic benefit without causing undesirable side effects. Modes of administration, dosage forms and appropriate pharmaceutical excipients can also be readily used and modified by those skilled in the art. All variations and modifications are envisioned within the scope of this patent application.
[0082]
[96] In certain embodiments, the disclosure includes a unit dosage form of a pharmaceutical composition comprising an agent that inhibits the expression or activity of a target polypeptide (or results in a decrease in the level of a target protein) and a pharmaceutically acceptable carrier, diluent or excipient, the unit dosage form being effective in increasing the expression of hemoglobin gamma in one or more tissues in a subject to which the unit dosage form is administered.
[0083]
[97] In certain embodiments, the unit dosage form comprises an effective amount, effective concentration and / or inhibitory concentration of an inhibitor for treating a hematological cell disorder or disorder, such as one related to a mutant or abnormal hemoglobin beta (including any of the diseases or disorders disclosed herein, such as SCD or β-thalassemia).
[0084]
[98] A “pharmaceutical composition” includes a composition of one or more inhibitors and one or more pharmaceutically acceptable carriers, excipients or diluents disclosed herein.
[0085]
[99] "Pharmacologically acceptable" is used herein to mean a compound, material, composition and / or dosage form that is suitable for use in contact with human and animal tissues, within the bounds of sound medical judgment, in proportion to a reasonable benefit-to-risk ratio, without excessive toxicity, irritation, allergic reaction or other problem or complication.
[0086]
[0100] "Pharmacologically acceptable carriers" include carriers that are acceptable for use in humans and / or livestock. This includes, but is not limited to, any auxiliaries, carriers, excipients, fluidizers, sweeteners, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents, surfactants and / or emulsifiers approved by the U.S. Food and Drug Administration. Examples of pharmaceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives, e.g., sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; tragacanth; malt; gelatin; talc; cocoa butter, waxes, animal and vegetable fats, paraffin, silicone, bentonite, silicic acid, zinc oxide; oils, e.g., peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, e.g., propylene glycol; polyols, e.g., glycerin, sorbitol, mannitol, and polyethylene glycol; esters, e.g., ethyl oleate and ethyl laurate; agar; buffers, e.g., magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogenic substance-free distilled water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer; and any other suitable substances used in pharmaceutical formulations. Any conventional medium and / or agent is intended for use in therapeutic compositions, except insofar as it is incompatible with the agent of this disclosure. Supplementary active ingredients may also be incorporated into the composition.
[0087]
[0101] As used herein, “effective dose” refers to a specific effect, such as on cells, tissues, organs, or This refers to the amount of drug effective in achieving an increase in the level of fetal hemoglobin (or hemoglobin gamma) in the subject. In certain embodiments, the increase is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% compared to the pre-treatment or untreated amount. In relation to the therapeutic treatment of the subject, the effective dose may be, for example, an amount effective or sufficient to reduce one or more disease symptoms in the subject, for example, a subject having sickle cell disease.
[0088]
[0102] As used herein, "effective concentration" refers to the concentration necessary to produce a specific physiological effect. This refers to the minimum concentration (mass / volume) of the required drug and / or composition. As used herein, effective concentration typically refers to the concentration of a drug required to increase, activate and / or enhance a particular physiological effect.
[0089]
[0103] "Inhibitory concentration" refers to the amount of drug needed to inhibit a specific physiological effect. This is the minimum concentration (mass / volume). As used herein, inhibitory concentration typically refers to the concentration of an agent required to reduce, inhibit, and / or suppress a particular physiological effect.
[0090]
[0104] In some embodiments, the drug or compound described herein is approximately 1 mg The drug or compound may be administered in doses ranging from approximately 300 mg / kg to about 300 mg / kg. In another embodiment, the drug or compound described herein may be administered in doses ranging from approximately 1 mg / kg to about 20 mg / kg. For example, the drug or compound may be administered to a subject in doses ranging from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mg / kg or within any of these ranges, for example, approximately 10 mg / kg to about 15 mg / kg, approximately 6 mg / kg to about 12 mg / kg, etc. In another embodiment, the drug or compound described herein is administered in doses of ≤15 mg / kg. For example, the drug or compound may be administered at 15 mg / kg / day for 7 days, totaling 105 mg / kg / week. For example, the compound may be administered at 10 mg / kg twice daily for 7 days, totaling 140 mg / kg / week.
[0091]
[0105] In many embodiments, the dosages described herein are single doses, daily doses. This can refer to a quantity or a weekly dose. In one embodiment, the drug or compound may be administered once a day. In another embodiment, the compound may be administered twice a day. In some embodiments... In some embodiments, the drug or compound may be administered three times a day. In some embodiments, the compound may be administered four times a day. In some embodiments, the drug or compound described herein may be administered one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelfth, thirteenth, thirteenth, fifteenth, fifteenth, sixteenth, seventeenth, eighteenth, nineteenth, twenty-oneth, twenty-twoth, twenty-three or twenty-four times a week. In other embodiments, the compound is administered once every two weeks.
[0092]
[0106] In some embodiments, the agents or compounds described herein are administered orally. In some embodiments, the agents or compounds described herein may be administered orally once daily at a dose of ≤15 mg / kg.
[0093]
[0107] The actual dosage used will depend on the patient's needs and the severity of the condition being treated. This may vary. Determining the appropriate dosing regimen for a particular situation is within the scope of the art. For convenience, the total daily dose may be divided and administered in installments throughout the day as needed.
[0094]
[0108] Dosage regimens using the disclosed compounds may vary depending on the patient's type, species, age, and weight. The choice is made according to a variety of factors, including sex and medical condition; severity of the condition being treated; route of administration; patient's renal or hepatic function; and the specific disclosed compound to be used. A physician or veterinarian skilled in the art can easily determine and prescribe the effective dose of the drug necessary to prevent, counteract, or halt the progression of the condition.
[0095]
[0109] The amount and frequency of administration of the compound of the present invention and / or its pharmaceutically acceptable salt are The treatment is adjusted according to the judgment of the attending clinician, taking into account factors such as the patient's age, condition, size, and the severity of the symptoms being treated. [Examples]
[0096] Example 1 Target identification method
[0110] Figure 1 shows the factors that upregulate HbF protein in the red blood cell lineage. As illustrated in the diagram, identification was performed using a pooled CR1SPR screening approach. HUDEP2 cells, a erythroid precursor model derived from CD34+ cells isolated from human umbilical cord blood, were used as a cell model to study HbF reactivation because they express HBB / HBβ globin, which is a dominant β-like globin.
[0097]
[0111] A pool of CRISPR gRNAs is delivered via lentiviral delivery with an MOI of approximately 0.1. The CRISPR construct was introduced into growing HUDEP2 cells via [a specific method]. Depending on the library construction, this was either a one-vector system (a vector encoding both gRNA and Cas9) or a two-vector system (a vector encoding gRNA). In the case of the two-vector system, the lentiviral pool was delivered to HUDEP2 cells constitutively expressing the Cas9 protein. One day after lentiviral transduction, cells were grown in HUDEP2 growth medium containing 500 ng / ml puromycin (StemSpan SFEM, StemCell Technologies; 50 ng / ml SCF; 3 IU / ml erythropoietin; luM dexamethasone; lug / ml doxycycline) to select cells that had received the CRISPR construct. Selection in growth medium + puromycin was performed for two days. Next, the selected cells were grown in growth medium for a further 7 days, and then transferred to HUDEP2 differentiation medium (Iscove's modified Dulbecco's medium; 1% L-glutamine; 2% penicillin / streptomycin; 330 ug / ml holohuman transferrin; 2 IU / ml heparin; 10 ug / ml recombinant human insulin; 3 IU / ml erythropoietin; 100 ng / ml SCF; 4% fetal bovine serum) for 10 days.
[0098]
[0112] Using HbF fluorescence-activated cell selection (FAC) assay (Invitrogen, HFH01) Cells with elevated HbF levels were isolated. HbF-high cells were selected using HUDEP2 cells transduced with a negative control gRNA (sgGFP) as a gate threshold. Cells were also collected after 3 days of puromycin selection (post-selection samples) and before FAC sorting (FAC input samples) and used for downstream analysis to identify hits.
[0099]
[0113] Genomic DNA is extracted from HbF-rich isolated cells, selected samples, and FAC input samples. gRNAs were isolated. gRNAs present in genomic DNA were amplified using nested PCR amplification. A second round of PCR amplification was performed, incorporating an Illumina sequencing adapter into the sample. Illumina sequencing was performed to quantify the gRNAs present in each sample. The gRNAs were identified using conserved identifiers and subsequently mapped to the human reference genome to identify gRNA target genes, providing a relationship between target genes and the genetic disruption resulting in HbF upregulation.
[0100]
[0114] The screening results are shown in Figure 2 (CRISPR Library #1) and Figure 3 (C The RISPR library is shown in Figure 2). In each figure, the left panel plots the levels of HbF (X-axis) and β-actin (Y-axis) for each event, with the line "L" indicating the HbF threshold for HbF-high cells. The right panel shows the same data in a one-dimensional plot of HbF levels (X-axis) and events (Y-axis), with the line "C" indicating the HbF threshold for HbF-high cells. Any cells exceeding the HbF threshold were collected in the HbF-high population. In both Figures 2 and 3, the darker shaded cells on the left side of each panel are HUDEP2 cells transduced with control sgGFP, and the lighter shaded cells on the right side of each panel are HUDEP2 cells transduced with the CRISPR library.
[0101] Example 2 A computational method for identifying GRNAs that upregulate HBF.
[0115] Using Illumina sequencing, the selected sample, FAC input sample, and HbF The gRNA libraries in the high sample were sequenced. Each read was 5' or 3'. ‘ We searched for conserved identifiers in any region, and only reads containing conserved identifiers were retained. 20 bp gRNA sequences between conserved identifiers were extracted from the retained reads and mapped to the human genome (hg19). A single retained read using a given gRNA represented one count for that gRNA in each sample. The counts were converted to RPM (reads per million) to normalize the sequencing depth and enable comparisons across different gRNA libraries. The RPM of gRNAs was calculated as follows:
number
[0102] Method 1: A Z-score-based approach in high HbF samples:
[0116] This approach involves gRNA in HbF samples. rpm Based on the distribution of values The Z-score was calculated. More formally, the Z-score was calculated using the following formula.
number
[0103] In the above formula, gRNA HbF+ This is the Z score in HbF+ samples, and gRNA rpm,Hbf+ μ is an abundance quantity.Hbf+, and σ Hbf+ are the mean and standard deviation of gRNA in the HbF+ sample rpm,Hbf+ . Similarly, for all guides, the Z-scores of the input (gRNA input ) and post-selection (gRNA post-selected ) samples were calculated. gRNAs that had a negative impact on cell health or proliferation were identified by performing gRNA dropout analysis. More formally, in this dropout analysis, all guides with |gRNA input - gRNA post-selected | ≧ 1 were removed. All remaining gRNAs with gRNA HbF+ > 3 were considered to be enriched in the HbF+ sample. Using this approach, a total of 174 hits containing at least one enriched gRNA were identified.
[0104] Method 2: Approach based on the Z-score difference between HbF high and FAC input:
[0117] In this approach, the same dropout analysis as (performed in Method 1) was performed . All gRNAs with gRNA HbF+ - gRNA input > 2.5 were considered to be enriched in the HbF+ sample. Using this approach, a total of 307 hits containing at least one enriched gRNA were identified. These are provided in Table 1.
[0105]
Table 1
[0106]
Table 2
[0107]
Table 3
[0108]
Table 4
[0109] [Table 5]
[0110] [Table 6]
[0111] [Table 7]
[0112] [Table 8]
[0113] Method 3: An approach based on multiplier changes at high HbF and FACs inputs:
[0118] This approach uses multiples of the RPM value to determine dropout and hit. I made the call. More formally,
number
number
[0114] Number of gRNA hits per gene:
[0119] In this approach, enriched gRNAs were identified using Method 2. Genes containing one enriched gRNA were considered hits. Using this approach, 39 hits were identified. These are listed in Figure 5A. A list of hits and associated gRNAs is summarized in Table 2.
[0115] [Table 9]
[0116] [Table 10]
[0117] [Table 11]
[0118] Example 3 Bioinformatics analysis of target gene hits that upregulate HBF
[0120] Using multiple bioinformatics analyses, HbF protein levels were determined. We identified specific pathways, complexes, and tissue-specific expression patterns that were enriched in higher-level targets that were intentionally upregulated.
[0119] Protein complex analysis:
[0121] Identification of a protein complex with multiple targets that upregulate HbF To do this, the higher targets identified by the above method are compared with existing protein complex annotations (CORUM protein complex annotations (Giurgiu M et al, Nucleic Acids Research)) and The complexes were overlapped. This analysis identified several complexes with multiple targets. Figure 6 shows these complexes and the number of targets identified as components of each complex. Tables 3 and 4 show the overlapping complex annotations and the targets identified using methods 2 and 3.
[0120] [Table 12]
[0121] Table 13
[0122] Table 14
[0123] Table 15
[0124] Table 16
[0125] Table 17
[0126] Table 18
[0127] Table 19
[0128] Table 20
[0129] Table 21
[0130] Table 22
[0131] Table 23
[0132] Table 24
[0133] Table 25
[0134] Table 26
[0135] Table 27
[0136] Table 28
[0137] Table 29
[0138] Table 30
[0139] Table 31
[0140] Table 32
[0141] Table 33
[0142] Molecular pathway analysis: To identify higher molecular pathways enriched by multiple targets, the higher targets were overlapped with KEGG pathway maps using the clusterProfiler R package. Table 5 shows the higher-level paths derived from established hits.
[0143] [Table 34]
[0144] [Table 35]
[0145] [Table 36]
[0146] [Table 37]
[0147] Consistency between two different CRISPR libraries:
[0122] In order to obtain higher reliability for the identified target, different sets of genes and A further CRISPR library (Library #2) containing the corresponding gRNA was used. Only HbF+ and FACs input samples were sequenced in Library #2. Hits in Library #2 were identified using Method 2 (cutoff changed to 1.0) without dropout filtering. A total of 209 hits were identified using this approach (Figure 6B). Several common hits were identified in both libraries (Figure 5B and Table 6).
[0148] [Table 38]
[0149] Hit expression specificity in blood tissues and red blood cell lineages:
[0123] The hits identified using Method 2 are found in blood tissue associated with SCD. Prioritization was based on gene expression. This was done using GTEx gene expression data from 15,598 samples across 31 different tissues (The GTEx Consortium, Nature Genetics). The mean Z-score was calculated to identify genes with high blood-specific expression. The blood Z-score for each hit was calculated as follows:
number
[0150]
[0124] In the above formula, Z g,blood This is the average of the gene "g" in blood tissue. This is the average Z score, and g i This is the expression of gene "g" in sample "i", and μ g This represents the average expression of the gene "g" across all samples, and σ g This is the standard deviation of the gene "g" across all samples. If the sum is greater than 1, then Z g,blood Thirty-two hits possessing this characteristic were identified (Figure 7A and Table 7).
[0151] [Table 39]
[0152] [Table 40]
[0153] [Table 41]
[0154]
[0125] Blood tissue is heterogeneous, has many different cell types, and not all are related to SCD. To focus on the erythroid lineage that is primarily affected in SCD, hits were overlapped with lineage-specific modules identified by the DMAP project (Novershtem et al, Cell). Many hits expressed in precursor and late erythroid lineages were identified (Table 8) (Figures 7B and 7C).
[0155]
Table 42
[0156]
Table 43
[0157]
Table 44
[0158]
[0126] Table 9 provides a list of various components of the complexes and pathways identified herein as targets for increasing HbF expression. Any of these can be targeted according to any of the methods disclosed herein.
[0159]
Table 45
[0160]
Table 46
[0161]
Table 47
[0162] Example 4 SPOP and CUL3 Gene Validation in Primary CD34+ Cells
[0127] SPOP and CUL3 are HU as regulators of fetal hemoglobin expression Identified using pooled CRISPR screening in the DEP2 model. To further investigate the roles of SPOP and CUL3 in fetal hemoglobin regulation, primary CD34+ cells from healthy donors were used along with genetic perturbation approaches via CRISPR Cas9 and shRNA. The effect on HbF levels was studied in differentiated CD34+ cells using HbF immunocytochemistry (ICC) (Figure 8A).
[0163]
[0128] HbF levels were determined by HbF ICC using loss-of-function based on CRISPR Cas9-RNP . The Cas9-RNP complex was electroporated into proliferating CD34+ cells. The cells were then differentiated into the erythroid lineage for 7 days, and HbF levels were quantified using HbF ICC. Non-target guide RNA was used as a negative control, and guide RNA targeting BCL11A was used as a positive control in this experimental design. Genetic perturbation of SPOP and CUL3 using either CRISPR-Cas9 or shRNA increased HbF levels as measured by the percentage of F cells or the mean HbF level per cell within the population of differentiated erythroid cells. For the CRISPR Cas9-RNA method via electroporation, the gRNAs used for SPOP were TAACTTTAGCTTTTGCCGGG (SEQ ID NO: 91), CGGGCATATAGGTTTGUGCA (SEQ ID NO: 92), GTTTGCGAGTAAACCCCAAA (SEQ ID NO: 93), and the gRNAs used for CUL3 were GAGCATCTCAAACACAACGA (SEQ ID NO: 94), CGAGATCAAGTTGTACGTTA (SEQ ID NO: 95), TCATCTACGGCAAACTCTAT (SEQ ID NO: 96). Cas9-gRNA complexes were made independently, and three complexes per target were pooled for the cell assay. The shRNAs used for SPOP were [ka] The shRNA used for CUL3 was [ka] The HbF ICC allows for the quantification of one percent F cell and HbF intensity per cell. F cells are erythroid cells in which the detectable level of HbF exceeds a specified threshold, and percent F cells are defined as the percentage of cells in a cell population defined as F cells. Percent F cells and mean HbF intensity cells were quantified for negative controls, sgBCL11A, sgSPOP, and sgCUL3. HbF levels were determined by HbF ICC using shRNA-based loss of function. ShRNA vectors were electroporated into proliferating CD34+ cells. The cells were then differentiated into erythroid lineages for 7 days, and HbF levels were quantified using ICC. Percent F cells (Figures 8B and 8D) and mean HbF intensity (Figures 8C and 8E) were quantified for individual shRNA constructs, for negative controls, shBCL11A, shSPOP, and shCUL3.
[0164] method cell culture
[0129] Human mobile peripheral blood primary CD34+ cells, IMDM, 100 ng / mL hS CD34+ Phase I medium, consisting of CF, 5 ng / mL IL-3, 3 IU / mL EPO, 250 ug / mL transferrin, 2.5% normal human serum, 1% pen / strep, 10 ng / mL heparin, and 10 ug / mL insulin, was cultured from thawing at a rate of 100,000 live cells / mL in a culture flask. On day 3 after thawing, cells were replenished by adding an additional 1X culture volume of CD34+ Phase I medium. After 5 days of growth, primary CD34+ cells were transfected with RNP complexes.
[0165] Preparation of Cas9-gRNA RNPs and nucleofection
[0130] Resuspend the lyophilized crRNA and tracrRNA using TE buffer. crRNA and tracrRNA were added to annealing buffer and annealed in a thermocycler. Multiple sgrRNAs for each gene were pooled in microcentrifuge tubes. Each sgRNA was mixed with TrueCut Cas9v2 and incubated for 10 minutes to generate RNP complexes. After counting, 144,000 CD34+ cells were added to a transfection cuvette and combined with the transfection solution (P3, RNP complex, glycerol). The cells were transfected using an Amaxa Nucleofector and then transferred to a 12-well plate containing 1 ml of pre-warmed Phase I medium.
[0166] In vitro differentiation
[0131] The day after transfection, supplement the cells with an additional 0.5 mL of Phase 1 medium. On day 5 post-transfection, cells differentiated towards the erythroid lineage by complete medium change to CD34+ Phase II medium consisting of IMDM, 100 ng / mL hSCF, 5 ng / mL IL-3, 3 IU / mL EPO, 250 ug / mL transferrin, 2.5% normal human serum, 1% pen / strep, 10 ng / mL heparin, and 10 ug / mL insulin. Two days after switching to Phase II medium, the cells were centrifuged and 1 mL of Phase II medium was replaced with fresh Phase II medium. Two days later, the cells were harvested for HbF analysis by ICC.
[0167] HbFICC protocol
[0132] To collect CD34+ cells, 40 μL from each well is poured into 384 wells. The cells were transferred in a double-row plate and the plate was centrifuged. First, the plate was washed with 25 μL of PBS. Then, the plate was fixed with 25 μL of 4% paraformaldehyde at room temperature for 10 minutes. Next, the cells were washed three times with 25 μL of PBS. Then, the cells were mixed with IX PBS, 1% bovine serum albumin, 10% fetal bovine serum, 0.3 M glycine and 0.1% Cells were permeabilized and blocked in 25 μL of Perm / Block buffer consisting of tween-20 at room temperature for 1 hour. The cells were then washed three times with 25 μL of 0.1% tween in PBS. After washing, the cells were incubated overnight at 4°C with 25 μL of HbF-488 primary antibody (ThermoFisher MHFHO1-4) diluted 1:40 in 0.1% tween and Hoescht diluted 1:2000 in 0.1% tween. The following day, the cells were washed three times again in 25 μL of PBS with 0.1% tween and foil-sealed for imaging on ThermoFisher CellInsight CX7. did.
[0168]
[0133] Next, the plate is placed on the CX7 at 10x magnification and scanned, per well Nine images were obtained. Next, the software algorithm identified the nuclei and calculated the total number of nuclei using Hoechst staining on channel 1. After the nuclei were identified, the algorithm The average nuclear intensity of HbF staining on channel 2 was calculated.
[0169] References An international effort to cure a global health problem: A report on the 19th Hemoglobin Switching Conference. Blobel GA, Bodine D, Brand M, Crispino J, de Bruijn MF, Nathan D, Papayannopoulou T, Porcher C, Strouboulis J, Zon L, Higgs DR, Stamatoyannopoulos G, Engel JD. Exp Hematol. 2015 Oct;43(10):821-37. doi: 10.1016 / j.exphem.2015.06.008. Epub 2015 Jul 2. Review. PMID:26143582 Control of globin gene expression during development and ervthroid differentiation· Stamatoyannopoulos G. Exp Hematol. 2005 Mar;33(3):259-71. Review. PMID: 15730849 Fetal haemoglobin induction in sickle cell disease. Paikari A, Sheehan VA. Br J Haematol. 2018 Jan; 180(2): 189-200. doi: 10.1111 / bjh.15021. Epub 2017 Nov 16. Review. PMID: 29143315 Fetal haemoglobin in sickle-cell disease: from genetic epidemiology to new therapeutic strategies. Lettre G, Bauer DE. Lancet. 2016 Jun 18;387(10037):2554-64. doi: 10.1016 / 80140-6736(15)01341-0. Review. PMID: 27353686 Locus control regions. Li Q, Peterson KR, Fang X, Stamatoyannopoulos G. Blood. 2002 Nov l;100(9):3077-86. Review. PMID: 12384402 Pomalidomide and lenalidomide regulate ervthropoiesis and fetal hemoglobin production in human CD34+ cells. Moutouh-de Parseval LA, Veihelle D, Glezer E, Jensen-Pergakes K, Ferguson GD, Corral LG, Morris CL, Muller G, Brady H, Chan K. J Clin Invest. 2008 Jan;118(l):248-58. PMID: 18064299 Augmentation of fetal-hemoglobin production in anemic monkeys bv hvdroxvurea. Letvin NL, Linch DC, Beardsley GP, McIntyre KW, Nathan DG. N Engl J Med. 1984 Apr 5;310(14):869-73. PMID: 619967 EHMT1 and EHMT2 inhibition induces fetal hemoglobin expression. Renneville A, Van Galen P, Canver MC, McConkey M, Krill-Burger JM, Dorfman DM, Holson EB, Bernstein BE, Oikin SH, Bauer DE, Ebert BL. Blood. 2015 Oct 15;126(16): 1930-9. doi: 10.1182 / blood-2015-06-649087. Epub 2015 Aug 28. PMID: 26320100 Lvsine-specific demethvlase 1 is a therapeutic target for fetal hemoglobin induction. Shi L, Cui S, Engel JD, Tanabe O. Nat Med. 2013 Mar;19(3):291-4. doi: 10.1038 / hm.3101. Epub 2013 Feb 17. PMID: 23416702 CORUM: the comprehensive resource of mammalian protein complexes-2009. Giurgiu M, Reinhaid J, Brauner B, Dunger-Kaltenbach I, Fobo G, Frishman G, Montrone C, Ruepp A Nucleic Acids Res. 2010 Jan;38(Database issue):D497-501. doi: 10.1093 / nar / gkp914. Epub 2009 Nov l. Pmid: 19884131 Densely interconnected transcriptional circuits control cell states in human hematopoiesis Novershtem N, Subramanian A, Lawton L.N, Raymond H. M, Haining N, McConkey M. E, Habib N, Yosef N, Chang C. Y, Shay T, Frampton C. M, Drake A. C. B, Leskov I, Nilsson B, Proffer F, Dombkowski D, Evans J. W, Liefeld R, Smutko J. S, Chen J, Friedman N, Young R. A, Golub T. R, Regev A, Ebert B. L. Cell. 2011 Jan 21;144(2):296-309. doi: 10.1016 / j.cell.2011.01.004. PMID: 21241896 The Genotype-Tissue Expression (GTEx) project The GTEx Consortium Nat Genet. 2013 Jun;45(6):580-5. doi: 10.1038 / ng.2653. PMID: 23715323
[0170] All publications and patent applications described herein are incorporated herein by reference in their entirety.
[0171] While the present invention has been described in relation to the specific embodiments described above, many alternative forms, modifications, and other variations will be apparent to those skilled in the art. All such alternative forms, modifications, and variations are intended to be included within the spirit and scope of the present invention.
Claims
1. An in vitro or ex vivo method for increasing the expression of fetal hemoglobin (HbF) in cells, comprising contacting cells with an inhibitor of a target protein, The aforementioned target protein is CUL3; and The aforementioned inhibitor is selected from the group consisting of small molecules, nucleic acids, and nuclear protein complexes. a) The small molecule is selected from the group consisting of MLN4924, suramin, and DI-591; b) The nucleic acid is, i) CGGGACTATATCCCAGGGCTTATTTGCTCGAGCCAATAAGCCCCTGGGAATATAGTCTTTTTTTG (Sequence No. 101) ii) CCGGCGTAAGAATAACAGTGGGTCTTCTCCGAGAAAGACCACTGTTTATTCTTACGTTTTTTG (Sequence No. 102), and iii) Selected from the group consisting of CCGGCGTGTGCCCAAATGGTTTTGAAAACTCGAGTTTTCAAAACCATTTGGGCACACAGTTTTTTG (Sequence No. 103); and c) The nuclear protein complex is i) A first sequence comprising a guide RNA (gRNA) that specifically binds to a target sequence, wherein the target sequence is A) GAGCATCTCAAAACAACGA (Sequence ID 94); B) CGAGATCAAGTGTACGTTA (SEQ ID NO: 95); and A first sequence comprising an HbF expression regulator selected from the group consisting of C) TCATCTACGGGCAAACTCTAT (SEQ ID NO: 96), and ii) A method comprising a ribonucleoprotein complex comprising a second sequence encoding a CRISPR-Cas protein, wherein the CRISPR-Cas protein comprises a second sequence having DNA nuclease activity.
2. The method according to claim 1, wherein the HbF comprises hemoglobin gamma and hemoglobin alpha.
3. The method according to claim 1 or 2, wherein the cells are blood cells.
4. The method according to claim 3, wherein the blood cells are red blood cells.
Citation Information
Patent Citations
Compositions and methods for hemoglobin production
WO2018140934A1