Nucleic acids, drug compositions and complexes, as well as methods for their preparation and use.

Modified siRNAs and drug compositions targeting kininogen gene expression in the liver provide a solution to suppress sepsis progression by effectively inhibiting KNG gene expression, addressing the need for effective sepsis treatment.

JP7872622B2Active Publication Date: 2026-06-10SUZHOU RIBO LIFE SCIENCE CO LTD

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
SUZHOU RIBO LIFE SCIENCE CO LTD
Filing Date
2024-12-16
Publication Date
2026-06-10

Smart Images

  • Figure 0007872622000074
    Figure 0007872622000074
  • Figure 0007872622000075
    Figure 0007872622000075
  • Figure 0007872622000076
    Figure 0007872622000076
Patent Text Reader

Abstract

To provide an siRNA and a pharmaceutical composition which inhibit kininogen (KNG) expression and thus can achieve the purpose of effectively inhibiting a life span of a pathogen so as to alleviate the progress of the septicemia and reverse the pathology.SOLUTION: The siRNA contains a sense strand and an antisense strand. Each nucleotide in the siRNA is independently a modified or unmodified nucleotide. Lengths of the sense strand and the antisense strand are the same or different, the length of the sense strand is 19-23 nucleotides, and the length of the antisense strand is 19-26 nucleotides. The sense strand contains a specific nucleotide sequence I. The antisense strand contains a specific nucleotide sequence II. The nucleotide sequence I and the nucleotide sequence II form a substantially reverse complementary or completely reverse complementary double-stranded region. The siRNA inhibits expression of a kininogen gene in hepatocytes.SELECTED DRAWING: Figure 3
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This disclosure relates to nucleic acids capable of suppressing kininogen gene expression, drug compositions containing nucleic acids, and siR This disclosure relates to NA complexes. This disclosure further relates to the nucleic acids, drug compositions and siRNA complexes. Regarding preparation methods and use. [Background technology]

[0002] Sepsis (also known as pyoderma) refers to a systemic inflammatory response syndrome caused by infection. Clinically, a bacterial or highly suspicious infectious focus has been confirmed. Sepsis is, Although caused by infection, once symptoms appear, their onset and progression follow their own pathological processes and laws. Therefore, it is essentially the body's response to infectious agents.

[0003] The kininogen (KNG) gene is expressed and activated high molecular weight kininogen Activated high molecular weight kini It generates nogen (HMWKa) and lipopolysaccharide (lipopol) on the surface of Gram-negative bacterial cells. It can bind to ysaccharide (LPS) and extend its half-life. By suppressing it, the lifespan of the pathogen is effectively reduced, mitigating the progression of sepsis and reversing the disease state. It can achieve the objective of treating sepsis and other diseases caused by pathogens. It is closely related to inflammation and is one of the key target points for treating sepsis. Small interfering RNAs (siRNAs) are... Based on a mechanism called RNA interference (RNAi) The purpose is to suppress or block the expression of the target gene of interest in a sequence-specific manner, with the aim of treating the disease. It can be achieved.

[0004] In the development of siRNA drugs that suppress KNG gene expression and treat sepsis, appropriate siRNA and its modifications, as well as effective delivery systems, are key technologies. [Overview of the project] [Problems that the invention aims to solve]

[0005] The inventors of this disclosure provide the following siRNAs and their modified sequences as provided by this disclosure. Having said siRNA, and the drug composition and siRNA complex containing said siRNA, KNG The siRNA complex can specifically suppress gene expression, and specifically targets the liver. This allows for the suppression of KNG gene expression in the liver, thereby enabling the treatment or prevention of sepsis. I unexpectedly discovered something I was capable of. [Means for solving the problem]

[0006] In some embodiments, the present disclosure relates to a first siR capable of suppressing KNG gene expression. Provides NA, which includes a sense strand and an antisense strand, and each of the siRNAs Each nucleotide is independently modified or unmodified, and the sense strand is The nucleotide sequence I is included, and the antisense strand is included, and the nucleotide Otid sequence I and nucleotide sequence II are inversely complementary in at least part to the double-stranded region. The nucleotide sequence I and the nucleotide sequence II form the following: i) to vi It is one of the arrays shown in ).

[0007] i) The nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 1 have different lengths. They are equal, with a nucleotide difference of 3 or less, and the nucleotide sequence II and sequence number 2 The nucleotide sequences shown are those with equal lengths and a difference of three or fewer nucleotides. 5'-AAAGUAACAACCAGUUUGZ1-3'(Sequence ID 1), 5'-Z2CAAACUGGUUGUUACUUU-3'(Sequence ID 2) However, Z1 is U and Z2 is A, and in the nucleotide sequence I, the position is Z1 The corresponding nucleotide Z3 is included, and the nucleotide sequence II has a position corresponding to Z2. The nucleotide Z4 is the first nucleotide at the 5' end of the antisense strand. It is creotide.

[0008] ii) The nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 61 are, The difference is equal, the nucleotide difference is 3 or less, and the nucleotide sequence II and the sequence number are equal. The nucleotide sequences shown in 62 are of equal length and have three or fewer nucleotide differences. can be, 5'-AUUGAACUUUCGAAUUACZ5-3' (Sequence ID 61), 5'-Z6GUAAUUCGAAAGUUCAAU-3'(Sequence ID 62) However, Z5 is C and Z6 is G, and in the aforementioned nucleotide sequence I, the position is Z5 The corresponding nucleotide Z7 is included, and the nucleotide sequence II has a position corresponding to Z6. The nucleotide Z8 is the first nucleotide at the 5' end of the antisense strand. It is creotide.

[0009] iii) The nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 121 are , the lengths are equal, the nucleotide difference is 3 or less, and the nucleotide sequence II and the sequence The nucleotide sequence shown as No. 122 has the same length and three nucleotide differences. as follows: 5’-UCGAAUUACCUACUCAAUZ9-3’ (SEQ ID NO: 121), 5’-ZAUUGAGUAGGUAAUUCGA-3’ (SEQ ID NO: 122) where Z9 is U, Z 10 is A, the nucleotide sequence I contains the nucleotide Z corresponding to the position of Z9 in the nucleotide sequence I, the nucleotide sequence II contains the nucleotide Z corresponding to the position of Z 11 in the nucleotide sequence II, Z 10 is the first nucleotide at the 5’ end of the antisense strand. 12 in the nucleotide sequence II, Z 12 is the first nucleotide at the 5’ end of the antisense strand. <unk><unk>iv) The nucleotide sequence I and the nucleotide sequence shown as SEQ ID NO: 181 have the same length and three or fewer nucleotide differences. The nucleotide sequence II and the nucleotide sequence shown as SEQ ID NO: 182 have the same length and three or fewer nucleotide differences. 5’-GAUAAUGCAUACAUCGAUZ -3’ (SEQ ID NO: 181), as follows: 5’-GAUAAUGCAUACAUCGAUZ 13 [-3’ (SEQ ID NO: 181), 5’-Z 14 AUCGAUGUAUGCAUUAUC-3’ (SEQ ID NO: 182) where Z 13 is A, Z 14 is U, the nucleotide sequence I contains the nucleotide Z corresponding to the position of Z 13 in the nucleotide sequence I, the nucleotide sequence II contains the nucleotide Z corresponding to the position of Z1 15 in the nucleotide sequence II, Z 4 in the nucleotide sequence II contains the nucleotide Z corresponding to the position of Z 16 in the nucleotide sequence II, Z 16 is the first nucleotide at the 5’ end of the antisense strand. ​

[0011] v) The nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 241 are, The difference is equal, the nucleotide difference is 3 or less, and the nucleotide sequence II and the sequence number are equal. The nucleotide sequences shown in 242 are of equal length and have three or fewer nucleotide differences. And, 5'-GAAUAACGCAACUUUCUAZ 17 -3' (Sequence ID 241), 5'-Z 18 UAGAAAGUUGCGUUAUUC-3' (Sequence ID 242) However, Z 17 is U, Z 18 is A, and in the nucleotide sequence I, position Z 17 Nucleotide Z corresponding to 19 It includes, and the nucleotide sequence II has position Z1 Nucleotide Z corresponding to 8 20 The above Z 20 This is the 5' end of the antisense chain. It is the first nucleotide at the end.

[0012] vi) The nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 301 are, The lengths are equal, the nucleotide difference is 3 or less, and the nucleotide sequence is the same as sequence number II. The nucleotide sequence shown in No. 302 is one in which the nucleotides are of equal length and have no more than three nucleotide differences. It is below, 5'-AACUUUCUAUUUCAAGAUZ 21 -3' (Sequence ID 301), 5'-Z 22 AUCUUGAAAUAGAAAGUU-3' (Sequence ID 302) However, Z 21 is U, Z 22 is A, and in the nucleotide sequence I, position Z 21 Nucleotide Z corresponding to23 It includes, and the nucleotide sequence II has position Z2 Nucleotide Z corresponding to 2 24 The above Z 24 This is the 5' end of the antisense chain. It is the first nucleotide at the end.

[0013] In some embodiments, the Disclosure relates to the siRNA and pharmaceutically acceptable The present invention provides a drug composition containing a carrier.

[0014] In some embodiments, this disclosure relates to the siRNA and said The present invention provides an siRNA complex containing a complex group that binds to the siRNA.

[0015] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or siRNA complex for the treatment of sepsis caused by abnormal expression of the KNG gene and / Alternatively, it may be used in the preparation of drugs for prophylactic purposes.

[0016] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or administering an effective dose of the siRNA complex to a subject suffering from sepsis. This includes providing methods for the treatment and / or prevention of sepsis.

[0017] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or bringing an effective amount of the siRNA complex into contact with the cell, This invention provides a method for suppressing the expression of the KNG gene.

[0018] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. The kit provides the and / or siRNA complex.

[0019] <Incorporation into this site by citation> All publications, patents, and patent applications referred to herein are subject to the respective publications, patents, or patents. To the same extent that a patent application is specifically and individually incorporated herein by reference, This specification is incorporated herein. [Effects of the Invention]

[0020] The siRNAs, drug compositions, and siRNA complexes provided herein are highly stable. Furthermore, it exhibits high KNG mRNA inhibitory activity, reduced off-target effects, and / or It can significantly treat or alleviate the symptoms of sepsis.

[0021] In some embodiments, the siRNA, drug composition or s provided herein The iRNA complex exhibits excellent target mRNA repression activity in in vitro cell experiments. Several experiments In form, the siRNA, drug composition, or siRNA complex provided by this disclosure is , at least 20%, 30%, 40%, 50%, 60%, 70%, 80% in hepatocytes It exhibits a target mRNA expression repression rate of 90% or 95%. In some embodiments, this The siRNA complex provided in the disclosure exhibits high inhibition in the psiCHECK system. It shows activity, IC 50 However, it is between 0.0048 and 0.2328 nM.

[0022] The siRNA provided in this disclosure is used in the psiCHECK system with KNG m It showed high inhibitory activity against RNA and, at different siRNA concentrations, against the KNG target sequence. All of them showed an inhibitory effect, and in particular, at a concentration of 0.1 nM, they suppressed KNG mRNA expression. The success rate for all of them is 75% or higher.

[0023] In some embodiments, the siRNA, drug composition or s provided herein iRNA complexes exhibit higher stability and / or activity in the body. In some embodiments... Furthermore, the siRNA, drug composition, or siRNA complex provided in this disclosure may be used in the body. At least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% This indicates the percentage of target gene expression suppression. In some embodiments, provided herein The siRNA, drug composition, or siRNA complex is present in the body at a concentration of at least 20%, 30%, KNG gene expression suppression rates of 40%, 50%, 60%, 70%, 80%, 90%, or 95% This illustrates the siRNAs and drug compositions provided by this disclosure in some embodiments. Alternatively, the siRNA complex makes up at least 20%, 30%, 40%, 50%, or 60% of the body. It shows suppression rates of 70%, 80%, 90%, or 95% of intrahepatic KNG gene expression. In terms of application, the siRNA, drug composition, or siRNA complex provided by this disclosure. It makes up at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, and 90% of the body. This shows the rate of suppression of intrahepatic KNG gene expression in animal models of % or 95%. Several implementations In form, the siRNA, drug composition, or siRNA complex provided by this disclosure is , at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% in the body Alternatively, it shows the suppression rate of intrahepatic KNG gene expression in 95% of human subjects. Several implementations In this state, the siRNA complex provided by this disclosure is used in humanized mice. It exhibits significant repressive activity against mRNA, suppressing the expression level of KNG mRNA. The rate can reach 56%. In some embodiments, provided herein The siRNA complex showed very high inhibitory activity in humanized mice, KNG mR The suppression rate relative to the expression level of NA is 97% or higher in all cases.

[0024] In some embodiments, the siRNA, drug composition or s provided herein The iRNA complex does not exhibit significant off-target effects. Off-target effects refer to: For example, this could involve suppression of the normal expression of non-target genes. Off-target gene expression The binding / repression is 50%, 40%, 30%, 20%, or more than the on-target gene effect. A 10% decrease is considered insignificant in this regard.

[0025] Thus, the siRNA, drug composition and siRNA complex provided by this disclosure are By suppressing KNG mRNA expression, it effectively treats and / or prevents the symptoms of sepsis. This is possible, and it has a bright outlook for applications.

[0026] Other features and advantages of this disclosure will be discussed in the embodiment for carrying out the invention, as described later. I will explain in detail. [Brief explanation of the drawing]

[0027] [Figure 1] This is a histogram of the relative residual activity of Renilla in in vitro HEK293A cells after transfection with many siRNAs at different concentrations. [Figure 2A-2F] This is a dose-effect curve fitted according to the relative residual activity of Renilla in HEK293A cells after transfection with multiple siRNAs at different concentrations. [Figure 3]This is a histogram of the relative expression levels of KNG protein in mice at different time points after administration of the siRNA complex (in vivo). [Modes for carrying out the invention]

[0028] The embodiments for carrying out the invention of this disclosure will be described in detail below. The modes for carrying out the invention are merely for illustrative or interpretive purposes of this disclosure. It should be understood that this is not intended to be restrictive.

[0029] In this disclosure, KNG mRNA refers to Genbank registration number NM_001102 This refers to mRNA having the sequence shown in 416.2. Furthermore, unless otherwise specified, this opening The term "target gene" used in this context refers to the gene that transcribes the above-mentioned KNG mRNA. This refers to the KNG mRNA mentioned above.

[0030] (definition) In context, unless otherwise specified, uppercase C, G, U, and A refer to the base combination of nucleotides. A column is represented, and the lowercase letter 'm' indicates that the nucleotide adjacent to the left of the letter 'm' is methoxy-modified. It represents a nucleotide, and the lowercase letter f is followed by one nucleus adjacent to the left of the letter f. Otide indicates that it is a fluoromodified nucleotide, and the lowercase 's' is followed by the letters on either side of the 's'. This indicates that two adjacent nucleotides are linked by a thiophosphate ester group. P1 is a nucleotide adjacent to the right of P1, and the nucleotide is a 5'-phosphate nucleotide. The symbol indicates a 5'-phosphate analog modified nucleotide, and the combined letters VP represent the pair. The nucleotide adjacent to the right of the combined letter VP is a vinyl phosphate ester modified nucleo It represents a combination character Ps, and the combination character Ps is adjacent to one to the right of the combination character Ps. The capital letter P indicates that the nucleotide is a thiophosphate-modified nucleotide. The fact that the nucleotide adjacent to the right of the letter P is a 5'-phosphate nucleotide represent.

[0031] In this context, the term "fluoromodified nucleotide" refers to the ribose group of a nucleotide. This refers to a nucleotide in which the hydroxyl group at the 2' position is replaced with fluorine, and is called a "non-fluoromodified nucleotide." A "rheotide" is a nucleotide in which the 2' hydroxyl group of the ribose group is replaced by a non-fluorine group. This refers to a modified nucleotide or nucleotide analog. "Nucleotide analog" means, In nucleic acids, it can substitute for nucleotides, but adenine ribonucleotides, Guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide or This refers to a group with a different structure from thymine deoxyribonucleotide, such as isonucleotides. Bridged nucleotides (BNA) or acyclic nucleotides There is a creotide. The aforementioned "methoxy-modified nucleotide" refers to the 2'-hydro ribose group. This refers to a nucleotide in which the xy group is replaced with a methoxy group.

[0032] In the context of this specification, the terms “complementary” and “reverse complementary” are used interchangeably. This is also well known to those skilled in the art, that is, in a double-stranded nucleic acid molecule, the bases of one strand This means that the base on one strand pairs complementaryly with the base on the other strand. In DNA, pre The RNA base adenine (A) is always replaced by the pyrimidine base thymine (T) (or, RNA In this case, uracil (U) pairs with guanine (C), which is a purine base, and always pi It pairs with the limidine base cytosine (G). Each base pair consists of one purine and one It contains two pyrimidines. Adenine on one chain is always present on the other chain (thymine or uracil). ) and when guanine always pairs with cytosine, the two chains are complementary. It is also thought that the sequence of the chain in question can be estimated from the sequence of its complementary chain. In this field, "mismatch" refers to a situation in double-stranded nucleic acids where the bases at corresponding positions are complementary. It means that it does not exist in opposition to the target.

[0033] In context, unless otherwise specified, "basically inversely complementary" means two related nuclei. This refers to the presence of three or fewer base mismatches between rheotide sequences, and is "effectively inversely complementary." "This refers to the presence of one or fewer base mismatches between two nucleotide sequences. "Perfectly reverse complementary" means that there is no base mismatch between the two nucleotide sequences. It refers to.

[0034] In this context, a "nucleotide difference" refers to a difference between one nucleotide sequence and the other nucleotide sequence. The existence of "difference" means that the type of base at the same position of the nucleotide has changed in the former compared to the latter. This refers to the fact that, for example, when one nucleotide base in the latter is A, the same as in the former If the corresponding nucleotide base at the same position is U, C, G, or T, then at that position 2 Nucleotide differences have been recognized between two nucleotide sequences. In the application form, a baseless nucleotide or its equivalent is used instead of the nucleotide at the original position. When using this method, it is also possible that a nucleotide difference occurred at that position.

[0035] In this context, in particular the siRNA, drug composition, or method for preparing the siRNA complex of the present disclosure. When explaining, unless otherwise specified, the nucleoside monomer (nucleosid e-monomer) refers to the nucleo in the siRNA or siRNA complex being prepared. Depending on the type and order of the nucleotides, modified or unmodified nucleotides are used in the solid-phase synthesis of phosphoramidites. Cleoside phosphoramidite monomer (unmodified or modified) d RNA phosphoramidites. RNA phosphoramid (tes is sometimes called Nucleoside phosphoramidites) This refers to phosphoramidite solid-phase synthesis, a method known to those skilled in the art for RNA synthesis. Yes. All nucleoside monomers used in this disclosure are commercially available. ru.

[0036] In the context of this disclosure, unless otherwise specified, “composite” means having a specific function. This refers to the covalent bonding between two or more chemical parts, and accordingly, A "complex" is a compound formed by the covalent bonding between its respective chemical parts. It refers to. Furthermore, an "siRNA complex" is a complex in which one or more chemical parts have a specific function. This refers to a compound formed by covalent binding to iRNA. In the following text, the s of this disclosure The iRNA complex is sometimes simply called the "complex." The siRNA complex is sometimes referred to as such depending on the context. , a collective term for multiple siRNA complexes, or an siRNA complex represented by a certain chemical formula. It is understood. In the context of this disclosure, “complex molecule” means a molecule that reacts with siRNA. A specific compound that can be compounded with and ultimately form the siRNA complex of the present disclosure It should be understood that it exists.

[0037] As used herein, “any” or “any” means the events or events described below. The situation may or may not occur, and the description may or may not be an event or situation. This refers to both cases where it occurs and cases where it does not. For example, "arbitrarily substituted" alkyl This includes "alkyl" and "substituted alkyl" as defined in the following text: 1 or more With respect to any group containing substituents, these groups are sterically impractical and synthetically unfeasible. It is not intended to introduce any substitutions or substitution patterns that are and / or inherently unstable. If not, it will be understood by those skilled in the art.

[0038] As used herein, "alkyl" means a linear chain having a specific number of carbon atoms and a fractional group. This refers to a branched chain, and the aforementioned specific number is usually 1 to 20 carbon atoms, for example, 1 to 10 carbon atoms. A child is a carbon atom consisting of 1 to 8 or 1 to 6 carbon atoms. For example, C1-C6 alkyl groups have 1 to 6 carbon atoms. This includes linear and branched alkyl groups of carbon atoms. It refers to alkyl residues having a specific number of carbon atoms. In this case, it is intended to include all branched and linear forms having that number of carbon atoms. Therefore, for example, "butyl" includes n-butyl, sec-butyl, isobutyl and tert -This means it contains butyl, and "propyl" includes n-propyl and isopropyl. Alkylenes are a subset of alkyls, similar to alkyls but with two bonding sites. It refers to the residue that does the following.

[0039] As used herein, "alkenyl" means at least one carbon-carbon double bond This refers to an unsaturated branched or linear alkyl chain having a carbon-carbon double bond, wherein the parent alkyl group It is obtained by removing one hydrogen molecule from an adjacent carbon atom of the group. The double bond may be in a cis or trans configuration. Typical alkenyls include vinyl and ,prop-1-en-1-il,prop-1-en-2-il,prop-2-en-1- Propenyls such as yl(allyl), propa-2-en-2-yl, and buta-1-en-1- Il, buta-1-en-2-yl, 2-methylpropa-1-en-1-yl, buta-2- En-1-yl, buta-2-en-2-yl, buta-1,3-dien-1-yl, buta- This includes, but is not limited to, but but also includes, but is not limited to, but but also includes, a certain implementation form. In this state, the alkenyl has 2 to 20 carbon atoms, but in other embodiments, It has 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkenylenes are alkenyl This is a subset, referring to residues that are the same as alkenils but have two binding sites.

[0040] As used herein, "alkynyl" means at least one carbon-carbon triple bond This refers to an unsaturated branched or linear alkyl group having a carbon-carbon triple bond, where the carbon-carbon triple bond is a hermaphrodite. It is obtained by removing two hydrogen molecules from adjacent carbon atoms of the kill molecule. Typical A Lukinyl is composed of ethinyl, propane-1-in-1-yl, and propane-2-in-1- Propynnyl, including yl, and buta-1-in-1-yl, buta-1-in-3-yl, buta- This includes, but is not limited to, but but also includes, 3-in-1-yl and other butynyl compounds. In one embodiment... In other embodiments, alkynyl has 2 to 20 carbon atoms, but in other embodiments, 2 to 1 They have 0, 2-8, or 2-6 carbon atoms. Alkynylenes are a subset of alkynyls. It is the same as alkynyl, but refers to a residue that has two binding sites.

[0041] As used herein, "alkoxy" means a specific number of carbon atoms linked by oxygen bridges. This refers to alkyl groups of elementary atoms, such as methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyl Oxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy Examples include 3-hexyloxy and 3-methylpentyloxy. Alkoxy compounds are usually 1- It has 10, 1-8, 1-6, or 1-4 carbon atoms bonded by oxygen bridges. .

[0042] As used herein, "aryl" refers to an aromatic monocyclic or polycyclic hydrocarbon ring system. This refers to a group formed by removing a hydrogen atom from a ring carbon atom, derived from the aforementioned aromatic compound. A cyclic or polycyclic hydrocarbon ring system contains only hydrogen and 6 to 18 carbon atoms. At least one of the rings in the ring system is perfectly unsaturated, that is, it follows Hückel's theory. It includes cyclic and delocalized (4n+2)π-electron systems. Examples of aryls include phenyl and fluorine. Arylenes include, but are not limited to, renyl and naphthyl groups. This is a subset, referring to residues that are the same as aryl residues but have two binding sites.

[0043] As used herein, "halogen substituent" or "halo" means fluoro, chloro The term "halogen" refers to bromine or iodine, and includes fluorine, chlorine, bromine, or iodine. .

[0044] As used herein, "alkyl halogenate" means a specific number of carbon atoms. This is an alkyl group defined above, which is substituted with multiple halogen atoms up to the maximum allowable number. It refers to a group. Examples of alkyl halides include trifluoromethyl and difluoromethyl. This includes, but is not limited to, 2-fluoroethyl or pentafluoroethyl.

[0045] A "heterocyclic group" is a group consisting of 2 to 12 carbon atoms and 1 atom selected from nitrogen, oxygen, or sulfur. This refers to a stable 3- to 18-membered non-aromatic cyclic group containing six heteroatoms. Unless otherwise specified, heterocyclic groups are monocyclic, dicyclic, tricyclic, or tetracyclic systems, and are fused or bridged rings. A ring system may be included. Heteroatoms in the heterocyclic group may be optionally oxidized. 1 or Multiple nitrogen atoms (if present) are optionally quaternized. Heterocyclic groups are partially saturated or complete. It is totally saturated. Heterocyclic groups can bond to the rest of the molecule via any atom in the ring. Yes, it is possible. Examples of such heterogeneous groups include: Dioxanyl, thiophenyl[1,3]disulfonyl thianyl), decahydroisoquinolinyl, imidazolinyl, imidazolidinyl, i Sothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindole, o 2-Oxahydroisoindole, 2-Oxapiperazinyl, 2-Oxapiperidyl, 2-Ox Sapirolidinil, oxazolidinil, piperidil, piperazinil, 4-piperidonil, pi Loridinil, pyrazolidinil, quinuclidinil, thiazolidinil, tetrahydrofuryl, Trithianyl, tetrahydropyranyl, thiomorpholinyl hiomorpholinyl, thiamorpholinyl ), 1-oxothiomorpholinyl and 1,1-dioxothiomorpholin This includes, but is not limited to, yl.

[0046] A "heteroaryl" is a compound consisting of 2 to 17 carbon atoms and selected nitrogen, oxygen, and sulfur. This refers to a group derived from a 3-18 membered aromatic ring radical containing 1-6 heteroatoms. As used herein, heteroaryl is a monocyclic, dicyclic, tricyclic, or tetracyclic system. Also, at least one of the rings in this ring system is completely unsaturated, that is, it is Hucke It contains a cyclic delocalized (4n+2)π-electron system that follows the theory of cyclic delocalization. Heteroaryls are fused rings or It contains a bridging ring system. The heteroatoms in the heteroaryl are optionally oxidized. One or more The nitrogen atom (if present) is optionally quaternized. The heteroaryl is any in the ring It is bonded to the rest of the molecule via atoms. An example of a heteroaryl is azepinine. Lu, acridinyl, benzimidazolyl, benzoindole, 1,3-benzodioxazol Lyl, benzofuryl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazol Lil, benzo[b][1,4]dioxepinyl pinyl), benzo[b][1,4]oxazinyl (benzo[b][1,4]ox azinyl), 1,4-benzodioxanyl, Benzonaphthofuranil, benzoxazolyl, benzodioxolyl olyl), benzodioxinyl, benzopyranyl, Nzopyronil, benzofuryl, benzofuranol, benzothiophenyl, benzothieno[ 3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2- a] Pyridyl, carbazolyl, cinnolinyl, cyclopenta[d ]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d ] Pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl (5,6-dihydro benzo[h]quinazolinyl), 5,6-dihydrobenzo[h]cinnoly Nyl(5,6-dihydrobenzo[h]cinnolinyl), 6,7-dihydrobenzo[h]cinnolinyl Dro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofri Lu, dibenzothiophenyl, furyl, furanol, flo[3,2-c]pyridyl, 5,6 ,7,8,9,10-Hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8, 9,10-Hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10- Hexahydrocycloocta[d]pyridyl, isothiazolyl, imidazolyl, indazoli Indazolyl, indole, isoindole, indolinyl, isoindri Nyl, Isoquinolyl, Indolizinyl, Isoxazolyl, 5,8-methano-5,6,7,8-tetrahydroquinazolinyl(5,8-methano (-5,6,7,8-tetrahydroquinazolinyl), naphthilidinyl (naphthyridinyl), 1,6-naphthyridinyl (1,6-naphth yridinonyl), oxadiazolyl, 2-oxoazepinyl pinyl), oxazolyl, oxiranyl, 5,6,6a,7, 8,9,10,10a-Octahydrobenzo[H]quinazolinyl,1-phenyl-1H- Pyrrolyl, phenazinil, phenothiazinil, phenoxadinil, phthalazinil (pht halazinyl, pteridinyl, prinyl, pyrrolyl, Pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridyl, pyrido[3,2-d]pyrimidinyl Limidinil, Pyrid[3,4-d]pyrimidinil, Pyrazinil, Pyrimidinil, Pyridadi Nyl, quinazolinyl, quinoxalinyl, quinolyl, tetra Hydroquinolyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetra Hydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9-tetrahydro Dro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7, 8-Tetrahydropyrid[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, Liazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno [3,2-d]pyrimidinyl, thieno[2,3-c]pridinyl -c]pridinyl) and thiophenyl (thiophenyl / thienyl) This includes, but is not limited to, the following:

[0047] Various hydroxy protecting groups can be used in this disclosure. Generally, protecting groups are The chemical functional group can be made insensitive to specific reaction conditions, and the rest of the molecule can be substantially It can be added to and removed from the functional group in the molecule without damaging it. A typical hydroxy protecting group is Beaucage et al., Tetrahedron 19 92,48,2223~2311, and Greene and Wuts, Protec tive Groups in Organic Synthesis, Chapter 2, 2nd ed, John Wiley & Sons, New York, 1991 which are disclosed in and incorporated herein by reference in their entireties. In some embodiments, a protecting group is stable under basic conditions but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxy protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl , 9-phenylxanthen-9-yl (Pixyl) or 9-(p-methoxyphenyl) xanthen-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxy protecting groups that can be used herein include Tr (trityl), MMTr (4-meth oxytrityl), DMTr (4,4'-dimethoxytrityl) or TMTr (4,4' ,4''-trimethoxytrityl). The term "subject" as used herein refers to any animal, e.g., a mammal or marsupial. Subjects of the present disclosure include humans, non-human primates (e.g., rhesus monkeys or other species of macaque monkeys), mice, pigs, horses, donkeys, cows, sheep, rats or any type of poultry, but are not limited thereto.

[0048] As used herein, "treatment" refers to a method of obtaining a beneficial or desired result, including, but not limited to, a therapeutic effect. A "therapeutic effect" eradicates or otherwise ameliorates a potential disorder being treated or otherwise ameliorates a potential disorder being treated or otherwise ameliorates a potential disorder being treated.

[0049] As used herein, "treatment" refers to a method of obtaining a beneficial or desired result, including, but not limited to, a therapeutic effect. A "therapeutic effect" eradicates or otherwise ameliorates a potential disorder being treated, including, but not limited to, the following: means to improve. Also, the therapeutic effect can be observed in the subject by eradicating or improving one or more physiological symptoms related to the potential disorder, even though the subject may still be suffering from the potential disorder. Although the subject may still be susceptible to the pain of the potential disorder, improvement can be observed in the subject by eradicating or improving one or more physiological symptoms related to the potential disorder.

[0050] As used herein, "prevention" is a method of obtaining a beneficial or desired result and includes, but is not limited to, a preventive effect. To obtain a "preventive effect", although a diagnosis of the disease may not have been made, an siRNA, siRNA complex or pharmaceutical composition can be administered to a subject at risk of developing a specific disease or to a subject in whom one or more pathological symptoms of the disease have been reported.

[0051] In one aspect, the present disclosure provides siRNAs No. 1 to No. 6 that can suppress KNG gene expression. These will be described in detail in order below.

[0052] The siRNAs of the present disclosure contain nucleotide groups as basic structural units. Since it is known to those skilled in the art that the nucleotide groups contain phosphate groups, ribose groups and bases, the description thereof is omitted here.

[0053] The siRNAs of the present disclosure contain a sense strand and an antisense strand. The lengths of the sense strand and the antisense strand may be the same or different. The length of the sense strand is 19 to 23 nucleotides, and the length of the antisense strand is 19 to 26 nucleotides. Thus, the length ratio of the sense strand to the antisense strand of the siRNAs provided by the present disclosure is 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 2 ​​​​​​​​​​​​0 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20 , 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 2 3 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25 or 23 / 2 6 may also be used. In some embodiments, the sense strand and antiseptic strand of the siRNA are used. The length ratio of the lance chains is 19 / 21, 21 / 23, or 23 / 25.

[0054] <First siRNA> According to this disclosure, the siRNA may be a first siRNA.

[0055] The first siRNA comprises a sense strand and an antisense strand, and each of the first siRNA Each nucleotide is independently modified or unmodified, and the sense strand is The nucleotide sequence I is included, the antisense strand includes the nucleotide sequence II, and the nucleotide sequence Cleotide sequence I and nucleotide sequence II are double-stranded in a reverse complementary manner, at least in part. The region is formed, and the nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 1 are different. , the lengths are equal, the nucleotide difference is 3 or less, and the nucleotide sequence II and the sequence The nucleotide sequence shown in number 2 is one that is equal in length and has three or fewer nucleotide differences. That is the case. 5'-AAAGUAACAACCAGUUUGZ1-3'(Sequence ID 1), 5'-Z2CAAACUGGUUGUUACUUU-3'(Sequence ID 2) However, Z1 is U and Z2 is A, and in the nucleotide sequence I, the position is Z1 It contains the corresponding nucleotide Z3, and in the nucleotide sequence II, the position corresponds to Z2 It contains the nucleotide Z4 whose position corresponds to Z2, and the Z4 is the first nucleotide at the 5' end of the antisense strand nucleotide.

[0056] In the context, "the position corresponds" means that from the same end of the nucleotide sequence, it refers to being at the same position in the nucleotide sequence. For example, the first nucleotide at the 3' end of nucleotide sequence I is the nucleotide whose position corresponds to the first nucleotide at the 3' end of SEQ ID NO: 1 nucleotide. In some embodiments, the sense strand contains only nucleotide sequence I, and the antisense strand contains only nucleotide sequence II.

[0057] In some embodiments, there is 1 or less nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1, and / or there is 1 or less nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2.

[0058] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 includes the difference at the position of Z4, and Z4 is selected from U, C or G. In some embodiments, the nucleotide difference is the difference at the position of Z4, and Z4 is selected from U, C or G. In some embodiments Z3 is a nucleotide complementary to Z4. The siRNA having the above nucleotide difference has high target mRNA suppression ability, and the siRNA containing these nucleotide differences is also <s

[0059] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 includes the difference at the position of Z4, and Z4 is selected from U, C or G. In some embodiments, the nucleotide difference is the difference at the position of Z4, and Z4 is selected from U, C or G. In some embodiments Z3 is a nucleotide complementary to Z4. The siRNA having the above nucleotide difference has high target mRNA suppression ability, and the siRNA containing these nucleotide differences is also In some embodiments, Z3 is a nucleotide complementary to Z4. The siRNA having the above nucleotide difference has high target mRNA suppression ability, and the siRNA containing these nucleotide differences also has , within the scope of protection of this disclosure.

[0060] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are They are basically inversely complementary, substantially inversely complementary, or completely inversely complementary.

[0061] In some embodiments, nucleotide sequence I is the nucleotide shown in SEQ ID NO: 3 The ocidal sequence is the nucleotide sequence II shown in Sequence ID No. 4. That is the case. 5'-AAAGUAACAACCAGUUUGZ3-3' (Sequence ID 3), 5'-Z4CAAACUGGUUGUUACUUUGG-3'(Sequence ID 4) However, the aforementioned Z4 is the first nucleotide at the 5' end of the antisense strand, and Z4 Z3 is selected from A, U, G, or C, and Z3 is a nucleotide complementary to Z4, and In one embodiment, Z3 is U and Z4 is A.

[0062] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. In some embodiments, the nucleotide sequence IV and the second nucleotide sequence The sequence is substantially or completely inversely complementary, and is related to the second nucleotide sequence. It is adjacent to the 5' end of the nucleotide sequence shown in SEQ ID NO: 1 in the target mRNA. This refers to a nucleotide sequence whose length is equal to that of nucleotide sequence IV.

[0063] In some embodiments, nucleotide sequence III and nucleotide sequence IV are The length of each is 1 nucleotide, and the base of nucleotide sequence III is C, The base of creotide sequence IV is G, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. It is CC, and the base sequence of nucleotide sequence IV is GG, and in this case the sense strand and annealed The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is ACC, and the base sequence of nucleotide sequence IV is GGU. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is AACC, and nucleotide sequence IV The base sequence is GGUU, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of nucleotide sequence III is CC, and the base sequence of nucleotide sequence IV is GG. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0064] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0065] <Second siRNA> According to this disclosure, the siRNA may be a second siRNA. iRNA consists of a sense strand and an antisense strand, and each nucleotide of the siRNA is The nucleotides are independently modified or unmodified, and the sense strand has nucleotide sequence I The antisense strand includes nucleotide sequence II, and the nucleotide sequence I and the preceding The nucleotide sequence II forms a double-stranded region in a reverse complementary manner in at least a portion thereof, and the nucleotide sequence II The nucleotide sequence shown in sequence number 61 and the nucleotide sequence shown in sequence number 61 are of equal length, and The creotide difference is three or less, and as shown in nucleotide sequence II and sequence number 62. A nucleotide sequence is one in which the nucleotides are equal in length and have three or fewer nucleotide differences. 5'-AUUGAACUUUCGAAUUACZ5-3' (Sequence ID 61), 5'-Z6GUAAUUCGAAAGUUCAAU-3'(Sequence ID 62) However, Z5 is C and Z6 is G, and in the aforementioned nucleotide sequence I, the position is Z5 The corresponding nucleotide Z7 is included, and the nucleotide sequence II has a position corresponding to Z6. The nucleotide Z8 is the first nucleotide at the 5' end of the antisense strand. It is creotide.

[0066] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0067] In some embodiments, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61 The nucleotide difference between the cleotide sequence and / or the nucleotide sequence is one or less, and / or the nucleotide sequence There is a nucleotide difference of 1 between sequence II and the nucleotide sequence shown in sequence number 62. It is one or less.

[0068] In some embodiments, the nucleotide sequence II and the sequence number 62 shown The nucleotide difference between the nucleotide sequence and the nucleotide sequence includes the difference at the position of Z8, where Z8 is A. Selected from U or C. In some embodiments, the nucleotide difference is Z8 This is the difference in position, where Z8 is selected from A, U, or C. In some embodiments, Therefore, Z7 is a nucleotide complementary to Z8. siR has the above nucleotide differences. NA possesses high target mRNA repression ability, and siRNAs containing these nucleotide differences. This is also within the scope of protection of this disclosure.

[0069] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are They are basically inversely complementary, substantially inversely complementary, or completely inversely complementary.

[0070] In some embodiments, nucleotide sequence I is the nucleotide shown in SEQ ID NO: 63 The rheotide sequence is the nucleotide sequence II shown in Sequence ID No. 64. It is an array. 5'-AUUGAACUUUCGAAUUACZ7-3'(Sequence ID 63), 5'-Z8GUAAUUCGAAAGUUCAAU-3'(Sequence ID 64) However, the aforementioned Z8 is the first nucleotide at the 5' end of the antisense strand, and Z8 Z7 is selected from A, U, G, or C, and Z7 is a nucleotide complementary to Z8, and In one embodiment, Z7 is C and Z8 is G.

[0071] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially inversely complementary or complete. It is completely inversely complementary, and the second nucleotide sequence is the sequence number in the target mRNA. Adjacent to the 5' end of the nucleotide sequence shown in No. 61, and the length of the nucleotide sequence This refers to a nucleotide sequence equal to IV.

[0072] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Both are nucleotides of length 1, and the base of nucleotide sequence III is G, The base of creotide sequence IV is C, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. It is GG, and the base sequence of nucleotide sequence IV is CC, and in this case the sense strand and annealed The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is UGG, and the base sequence of nucleotide sequence IV is CCA. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is CUGG, and nucleotide sequence IV The base sequence is CCAG, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of nucleotide sequence III is GG, and the base sequence of nucleotide sequence IV is CC. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0073] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0074] <Third siRNA> According to this disclosure, the siRNA may be a third siRNA.

[0075] The third siRNA comprises a sense strand and an antisense strand, and each nucleotide of the siRNA Each othide is independently a modified or unmodified nucleotide, and the sense strand is a nucleus. The nucleotide sequence I is included, the antisense strand is included, and the nucleotide sequence II is included. The nucleotide sequence I and the nucleotide sequence II are inversely complementary in at least part of their double-stranded regions. The nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 121 are formed, The lengths are equal, the nucleotide difference is 3 or less, and the nucleotide sequence is the same as sequence number II. The nucleotide sequence shown in No. 122 is one in which the nucleotides are of equal length and have no more than three nucleotide differences. It is below. 5'-UCGAAUUACCUACUCAAUZ9-3' (Sequence ID 121), 5'-Z 10 AUUGAGUAGGUAAUUCGA-3' (Sequence ID 122) However, Z9 is U, Z 10 It is A, and in the nucleotide sequence I, the position is Z9 Nucleotide Z corresponding to 11 It includes, and the nucleotide sequence II has position Z 10 to Corresponding nucleotide Z 12 The above Z 12 The 5' end of the antisense chain It is the first nucleotide.

[0076] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0077] In some embodiments, the nucleotide sequence I and the sequence number 121 shown The nucleotide sequence has one or fewer nucleotide differences, and / or the nucleo There is a nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in sequence number 122. There is one or fewer of these.

[0078] In some embodiments, the nucleotide sequence II and sequence number 122 are shown The nucleotide difference between the nucleotide sequence and the other nucleotide sequence is Z 12 Including the difference in position, Z 12 is selected from U, C, or G. In some embodiments, the nucleotide difference is , Z 12 This is the difference at the position of Z 12 is selected from U, C, or G. Several implementations In terms of form, Z 11 is, Z 12 It is a complementary nucleotide. The above nucleotide differences siRNA possessing these nucleotide differences has high target mRNA repression ability and The included siRNAs are also within the scope of protection of this disclosure.

[0079] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are They are basically inversely complementary, substantially inversely complementary, or completely inversely complementary.

[0080] In some embodiments, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 123 It is a creotide sequence, and nucleotide sequence II is the nucleo shown in Sequence ID No. 124. It is a CHIDO sequence. 5'-UCGAAUUACCUACUCAAUZ 11 -3' (Sequence ID 123), 5'-Z 12 AUUGAGUAGGUAAUUCGA-3' (Sequence ID 124) However, the aforementioned Z 12 Z is the first nucleotide at the 5' end of the antisense strand. 12 is selected from A, U, G, or C, and Z 11 is, Z 12 It is a complementary nucleotide. In some embodiments, Z 11 is U, Z 12 It is A.

[0081] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially inversely complementary or complete. It is completely inversely complementary, and the second nucleotide sequence is the sequence number in the target mRNA. Adjacent to the 5' end of the nucleotide sequence shown in No. 121, the length is the same as the nucleotide sequence This refers to a nucleotide sequence equal to sequence IV.

[0082] In some embodiments, nucleotide sequence III and nucleotide sequence IV are The length of each is 1 nucleotide, and the base of nucleotide sequence III is U, The base of creotide sequence IV is A, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. It is UU, and the base sequence of nucleotide sequence IV is AA, and in this case, the sense strand and AN The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is CUU, and the base sequence of nucleotide sequence IV is AAG. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is ACUU, and nucleotide sequence IV The base sequence is AAGU, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of sequence III is UU, and the base sequence of nucleotide sequence IV is AA. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0083] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0084] <The fourth siRNA> According to this disclosure, the siRNA may be a fourth siRNA.

[0085] The fourth siRNA comprises a sense strand and an antisense strand, and each nucleus of the siRNA Each othide is independently a modified or unmodified nucleotide, and the sense strand is a nucleus. The nucleotide sequence I is included, the antisense strand is included, and the nucleotide sequence II is included. The nucleotide sequence I and the nucleotide sequence II are inversely complementary in at least part of their double-stranded regions. The nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 181 are formed, The lengths are equal, the nucleotide difference is 3 or less, and the nucleotide sequence is the same as sequence number II. The nucleotide sequences shown in No. 182 are those with equal length and no more than three nucleotide differences. It is below. 5'-GAUAAUGCAUACAUCGAUZ 13 -3' (Sequence ID 181), 5'-Z 14 AUCGAUGUAUGCAUUAUC-3' (Sequence ID 182) However, Z 13 A is Z 14 It is U, and in the nucleotide sequence I, position Z 13 Nucleotide Z corresponding to 15 It includes, and the nucleotide sequence II has position Z1 nucleotide Z corresponding to 4 16 The above Z 16 This is the 5' end of the antisense chain. It is the first nucleotide at the end.

[0086] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0087] In some embodiments, the nucleotide sequence I and the sequence number 181 are shown The nucleotide sequence has one or fewer nucleotide differences, and / or the nucleo There is a nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in sequence number 182. There is one or fewer of these.

[0088] In some embodiments, the nucleotide sequence II and sequence number 182 are shown The nucleotide difference between the nucleotide sequence and the other nucleotide sequence is Z 16 Including the difference in position, Z 16 is selected from A, C, or G. In some embodiments, the nucleotide difference is , Z 16 This is the difference at the position of Z 16 is selected from A, C, or G. Several implementations In terms of form, Z 15 is, Z 16 It is a complementary nucleotide. The above nucleotide differences siRNA possessing these nucleotide differences has high target mRNA repression ability and The included siRNAs are also within the scope of protection of this disclosure.

[0089] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are They are basically inversely complementary, substantially inversely complementary, or completely inversely complementary.

[0090] In some embodiments, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 183 It is a creotide sequence, and nucleotide sequence II is the nucleo shown in SEQ ID NO: 184. It is a CHIDO sequence. 5'-GAUAAUGCAUACAUCGAUZ 15 -3' (Sequence ID 183), 5'-Z 16 AUCGAUGUAUGCAUUAUC-3' (Sequence ID 184) However, the aforementioned Z 16 Z is the first nucleotide at the 5' end of the antisense strand. 16 is selected from A, U, G, or C, and Z 15 is, Z 16 It is a complementary nucleotide. In some embodiments, Z 15 A is Z 16 It is U.

[0091] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially inversely complementary or complete. It is completely inversely complementary, and the second nucleotide sequence is the sequence number in the target mRNA. Adjacent to the 5' end of the nucleotide sequence shown in No. 181, the length is the same as the nucleotide sequence This refers to a nucleotide sequence equal to sequence IV.

[0092] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Each nucleotide is 1 nucleotide in length, and the base of nucleotide sequence III is A. The base of creotide sequence IV is U, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. CA, and the base sequence of nucleotide sequence IV is UG, and in this case, the sense strand and AN The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is ACA, and the base sequence of nucleotide sequence IV is UGU. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is UACA, and nucleotide sequence IV The base sequence is UGUA, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of sequence III is CA, and the base sequence of nucleotide sequence IV is UG. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0093] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0094] <The fifth siRNA> According to this disclosure, the siRNA may be a fifth siRNA. iRNA consists of a sense strand and an antisense strand, and each nucleotide of the siRNA is The nucleotides are independently modified or unmodified, and the sense strand has nucleotide sequence I The antisense strand includes nucleotide sequence II, and the nucleotide sequence I and the preceding The nucleotide sequence II forms a double-stranded region in a reverse complementary manner in at least a portion thereof, and the nucleotide sequence II The nucleotide sequence shown in creotide sequence I and sequence number 241 are of equal length. The nucleotide difference is three or less, and is shown in nucleotide sequence II and sequence number 242. A nucleotide sequence that is selected is one that is equal in length and has three or fewer nucleotide differences. 5'-GAAUAACGCAACUUUCUAZ 17 -3' (Sequence ID 241), 5'-Z 18 UAGAAAGUUGCGUUAUUC-3' (Sequence ID 242) However, Z 17 is U, Z 18 is A, and in the nucleotide sequence I, position Z 17 Nucleotide Z corresponding to 19 It includes, and the nucleotide sequence II has position Z1 Nucleotide Z corresponding to 8 20 The above Z 20 This is the 5' end of the antisense chain. It is the first nucleotide at the end.

[0095] In some embodiments, the sense strand comprises only nucleotide sequence I, and The antisense strand contains only nucleotide sequence II.

[0096] In some embodiments, the nucleotide sequence I and the sequence number 241 shown The nucleotide sequence has one or fewer nucleotide differences, and / or the nucleo There is a nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in sequence number 242. There is one or fewer of these.

[0097] In some embodiments, the nucleotide sequence II and the sequence number 242 are shown. The nucleotide difference between the nucleotide sequence and the other nucleotide sequence is Z 20 Including the difference in position, Z 20 is selected from U, C, or G. In some embodiments, the nucleotide difference is , Z 20 is the difference at the position of Z, and Z 20 is selected from U, C or G. In some embodiments , Z 19 is, Z 20 is a nucleotide complementary to Z. The siRNA having the above nucleotide difference has a high target mRNA suppression ability, and siRNAs containing these nucleotide differences are also within the protection scope of the present disclosure.

[0098] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, substantially reverse complementary or completely reverse complementary.

[0099] In some embodiments, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 243, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 244. 5’-GAAUAACGCAACUUUCUAZ 19 -3’ (SEQ ID NO: 243), 5’-Z 20 UAGAAAGUUGCGUUAUUC-3’ (SEQ ID NO: 244) However, the said Z 20 is the first nucleotide at the 5’ end of the antisense strand, Z 20 is selected from A, U, G or C, Z 19 is, Z 20 is a nucleotide complementary to Z and, in some embodiments, Z 19 is U, and Z 20 is A.

[0100] In some embodiments, the sense strand further includes a nucleotide sequence III , the antisense strand further includes a nucleotide sequence IV, and the nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially inversely complementary or complete. It is completely inversely complementary, and the second nucleotide sequence is the sequence number in the target mRNA. Adjacent to the 5' end of the nucleotide sequence shown in No. 241, the length is the same as the nucleotide sequence This refers to a nucleotide sequence equal to sequence IV.

[0101] In some embodiments, nucleotide sequence III and nucleotide sequence IV are Each nucleotide is 1 nucleotide in length, and the base of nucleotide sequence III is A. The base of creotide sequence IV is U, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. It is GA, and the base sequence of nucleotide sequence IV is UC, and in this case the sense strand and AN The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is AGA, and the base sequence of nucleotide sequence IV is UCU. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is CAGA, and nucleotide sequence IV The base sequence is UCUG, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of sequence III is CA, and the base sequence of nucleotide sequence IV is UG. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0102] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0103] <The 6th siRNA> According to this disclosure, the siRNA may be a sixth siRNA.

[0104] The sixth siRNA comprises a sense strand and an antisense strand, and each nucleotide of the siRNA Each othide is independently a modified or unmodified nucleotide, and the sense strand is a nucleus. The nucleotide sequence I is included, the antisense strand is included, and the nucleotide sequence II is included. The nucleotide sequence I and the nucleotide sequence II are inversely complementary in at least part of their double-stranded regions. The nucleotide sequence I and the nucleotide sequence shown in Sequence ID No. 301 are formed, The lengths are equal, the nucleotide difference is 3 or less, and the nucleotide sequence is the same as sequence number II. The nucleotide sequence shown in No. 302 is one in which the nucleotides are of equal length and have no more than three nucleotide differences. It is below. 5’-AACUUUCUAUUUCAAGAUZ 21 -3’ (SEQ ID NO: 301), 5’-Z 22 AUCUUGAAAUAGAAAGUU-3’ (SEQ ID NO: 302) However, Z 21 is U, Z 22 is A, and in the nucleotide sequence I, the nucleotide Z at the position corresponding to Z 21 is included, and in the nucleotide sequence II, the nucleotide Z at the position corresponding to Z2 23 2 is included, and the said Z is the first nucleotide at the 5' end of the antisense strand 24 24

[0105]

[0106] In some embodiments, the sense strand contains only the nucleotide sequence I, and the said

[0107] antisense strand contains only the nucleotide sequence II In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 302

[0108] includes the difference at the position of Z 24 where Z 24 is selected from U, C or G. In some embodiments, the nucleotide difference 24 is the difference at the position of Z 24 where Z

[0109] <00014is selected from U, C or G. In some embodiments 23is, Z 24 It is a complementary nucleotide. The above nucleotide differences siRNA possessing these nucleotide differences has high target mRNA repression ability and The included siRNAs are also within the scope of protection of this disclosure.

[0108] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are They are basically inversely complementary, substantially inversely complementary, or completely inversely complementary.

[0109] In some embodiments, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 303. It is a creotide sequence, and nucleotide sequence II is the nucleo shown in SEQ ID NO: 304. It is a CHIDO sequence. 5'-AACUUUCUAUUUCAAGAUZ 23 -3' (Sequence ID 303), 5'-Z 24 AUCUUGAAAUAGAAAGUU-3' (Sequence ID 304) However, the aforementioned Z 24 Z is the first nucleotide at the 5' end of the antisense strand. 24 is selected from A, U, G, or C, and Z 23 is, Z 24 It is a complementary nucleotide. In some embodiments, Z 23 is U, Z 24 It is A.

[0110] In some embodiments, the sense strand further comprises nucleotide sequence III. The antisense strand further comprises nucleotide sequence IV and nucleotide sequence III The nucleotide sequence IV has a length of 1 to 4 nucleotides, and the nucleotide sequence IV has a length of 1 to 4 nucleotides. Sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or complete. It is inversely complementary to the above, and the nucleotide sequence III is at the 5' end of the nucleotide sequence I. The nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. The nucleotide sequence IV and the second nucleotide sequence are substantially inversely complementary or complete. It is completely inversely complementary, and the second nucleotide sequence is the sequence number in the target mRNA. Adjacent to the 5' end of the nucleotide sequence shown in No. 301, the length is the same as the nucleotide sequence This refers to a nucleotide sequence equal to sequence IV.

[0111] In some embodiments, nucleotide sequence III and nucleotide sequence IV are The length of each is 1 nucleotide, and the base of nucleotide sequence III is C, The base of creotide sequence IV is G, and in this case, the length ratio of the sense strand to the antisense strand is It is 20 / 20, or nucleotide sequences III and IV are both 2 nucleotides in length. It is an Otid, and the base sequence of nucleotide sequence III is from the 5' end to the 3' end. It is GC, and the base sequence of nucleotide sequence IV is GC, and in this case, the sense strand and annealed The length ratio of the cysnes chains is 21 / 21, or nucleotide sequences III and IV are long Each of them consists of 3 nucleotides, and the nucleotide arrangement is such that it moves from the 5' end to the 3' end. The base sequence of column III is CGC, and the base sequence of nucleotide sequence IV is GCG. At this time, the length ratio of the sense chain to the antisense chain is 22 / 22, or nucleoty Sequences III and IV are both 4 nucleotides long, and from the 5' end to the 3' end... Towards the next step, the base sequence of nucleotide sequence III is ACGC, and nucleotide sequence IV The base sequence is GCGU, and in this case, the length ratio of the sense strand to the antisense strand is 23 / 2. 3. In some embodiments, the nucleotide sequence III and the nucleotide sequence Column IV is 2 nucleotides long, and from the 5' end to the 3' end, it is nucleotide The base sequence of sequence III is GC, and the base sequence of nucleotide sequence IV is GC. In this case, the length ratio of the sense chain to the antisense chain is 21 / 21.

[0112] In some embodiments, nucleotide sequences III and nucleotide IV are complete Since they are inversely complementary, given the bases of nucleotide sequence III, nucleotide The bases of sequence IV are also determined.

[0113] Below are nucleotide sequence V, nucleic acid sequence, nucleotide modification in siRNA, and The description of the modified sequence is applicable to any one of the 1st to 6th siRNAs listed above. Unless otherwise specified, the following descriptions of siRNA refer to the first siRNA, the second siRNA, and so on. siRNA, third siRNA, fourth siRNA, fifth siRNA, or sixth siRNA It should be considered that each siRNA is described individually. For example, if a specific siRNA is specified If not, "the siRNA further comprises nucleotide sequence V" means "the siRNA 1, siRNA 2, siRNA 3, siRNA 4, siRNA 5 This means that the RNA or sixth siRNA further contains nucleotide sequence V.

[0114] In some embodiments, the antisense strand further comprises nucleotide sequence V Furthermore, the nucleotide sequence V has a length of 1 to 3 nucleotides, and the 3 antisense strands It is attached to the terminal and forms the 3' overhanging end of the antisense chain. As a result, the sense strand to antisense strand length ratio of the siRNA provided in this disclosure is 1 9 / 20, 19 / 21, 19 / 22, 20 / 21, 20 / 22, 20 / 23, 21 / 22 , 21 / 23, 21 / 24, 22 / 23, 22 / 24, 22 / 25, 23 / 24, 23 / It may be 25 or 23 / 26. In some embodiments, the nucleotide arrangement Column V has a length of 2 nucleotides, thereby providing the siRNA provided by this disclosure. The ratio of the sense chain to the antisense chain length is 19 / 21, 21 / 23, or 23 / 25. That's good too.

[0115] Each nucleotide in the nucleotide sequence V may be any nucleotide. Furthermore, in order to facilitate synthesis and save on synthesis costs, the nucleotide sequence V is divided into two consecutive sequences. 1 thyminedeoxyribonucleotide (dTdT) or 2 consecutive uracilribonucleonucleotides It is a rheotide (UU), or the affinity between the antisense strand of siRNA and the target mRNA. To enhance its power, nucleotide sequence V is the nucleo at the corresponding position of the target mRNA. It is complementary to siRNA. Therefore, in some embodiments, the siRNA of this disclosure The ratio of the sense strand length to the antisense strand length is 19 / 21 or 21 / 23, and in this case, The disclosed siRNA has higher target mRNA silencing activity.

[0116] The nucleotide at the corresponding position of the target mRNA is the third nucleotide of the target mRNA at the 5' end. This refers to a nucleotide or nucleotide sequence adjacent to a nucleotide sequence. The creotide sequence is substantially or completely inversely complementary to nucleotide sequence II. It is a nucleotide sequence, or it is composed of nucleotide sequence II and nucleotide sequence IV. Nucleotide sequences that are substantially or completely inversely complementary to the resulting nucleotide sequence It is a row.

[0117] In some embodiments, the first siRNA is subjected to the siRNA's sensor The chain contains the nucleotide sequence shown in Sequence ID No. 5, and the antisensory nucleotide of the siRNA. The chain contains the nucleotide sequence shown in Sequence ID No. 6. 5'-AAAGUAACAACCAGUUUGZ3-3' (Sequence ID 5), 5'-Z4CAAACUGGUUGUUACUUUGG-3'(Sequence ID 6)

[0118] Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in Sequence ID No. 7. Furthermore, the antisense strand includes the nucleotide sequence shown in Sequence ID No. 8. 5'-CCAAAGUAACAACCAGUUUGZ3-3' (Sequence ID 7), 5'-Z4CAAACUGGUUGUUACUUUGGUU-3'(Sequence ID 8) However, the aforementioned Z4 is the first nucleotide at the 5' end of the antisense strand, and Z4 Z3 is selected from A, U, G, or C, and Z3 is a nucleotide complementary to Z4.

[0119] In some embodiments, the second siRNA is subjected to the siRNA's saturation. The siRNA chain comprises the nucleotide sequence shown in Sequence ID No. 65, and the antiseptic of the siRNA. The nucleotide chain contains the nucleotide sequence shown in Sequence ID No. 66. 5'-AUUGAACUUUCGAAUUACZ7-3'(Sequence ID 65), 5'-Z8GUAAUUCGAAAGUUCAAUCC-3'(Sequence ID 66)

[0120] Alternatively, the sense strand of the siRNA may have the nucleotide sequence shown in Sequence ID No. 67 The antisense strand of the siRNA includes the nucleotide sequence shown in Sequence ID No. 68. Includes. 5'-GGAUUGAACUUUCGAAUUACZ7-3'(Sequence ID 67), 5'-Z8GUAAUUCGAAAGUUCAAUCCAG-3'(Sequence ID 68) However, the aforementioned Z8 is the first nucleotide at the 5' end of the antisense strand, and Z8 Z7 is selected from A, U, G, or C, and Z7 is a nucleotide complementary to Z8.

[0121] In some embodiments, the third siRNA is used to obtain the siRNA. The siRNA chain comprises the nucleotide sequence shown in Sequence ID No. 125, and the anti-siRNA The sense strand contains the nucleotide sequence shown in Sequence ID No. 126. 5'-UCGAAUUACCUACUCAAUZ 11 -3' (Sequence ID 125), 5'-Z 12 AUUGAGUAGGUAAUUCGAAA-3' (Sequence ID 126)

[0122] Alternatively, the sense strand of the siRNA may be the nucleotide sequence shown in Sequence ID No. 127. The antisense strand of the siRNA is the nucleotide shown in SEQ ID NO: 128. Includes arrays. 5'-UUUCGAAUUACCUACUCAAUZ 11 -3'(Sequence ID 127) , 5'-Z 12 AUUGAGUAGGUAAUUCGAAAGU-3'(Sequence ID 12) 8) However, the aforementioned Z 12Z is the first nucleotide at the 5' end of the antisense strand. 12 is selected from A, U, G, or C, and Z 11 is, Z 12 It is a complementary nucleotide. ru.

[0123] In some embodiments, the fourth siRNA is used to obtain the siRNA. The siRNA chain comprises the nucleotide sequence shown in Sequence ID No. 185, and the anti-siRNA The sense strand contains the nucleotide sequence shown in Sequence ID No. 186. 5'-GAUAAUGCAUACAUCGAUZ 15 -3' (Sequence ID 185), 5'-Z 16 AUCGAUGUAUGCAUUAUCUG-3' (Sequence ID 186)

[0124] Alternatively, the sense strand of the siRNA may be the nucleotide sequence shown in Sequence ID No. 187. The antisense strand of the siRNA is the nucleotide shown in Sequence ID No. 188. Includes arrays. 5'-CAGAUAAUGCAUACAUCGAUZ 15 -3'(Sequence ID 187) , 5'-Z 16 AUCGAUGUAUGCAUUAUCUGUA-3'(Sequence ID 18) 8) However, the aforementioned Z 16 Z is the first nucleotide at the 5' end of the antisense strand. 16 is selected from A, U, G, or C, and Z 15 is, Z 16 It is a complementary nucleotide. ru.

[0125] In some embodiments, the siRNA is used with respect to the fifth siRNA. The siRNA chain comprises the nucleotide sequence shown in Sequence ID No. 245, and the antinucleotide of the siRNA. The sense strand contains the nucleotide sequence shown in Sequence ID No. 246. 5'-GAAUAACGCAACUUUCUAZ 19 -3' (Sequence ID 245), 5'-Z 20 UAGAAAGUUGCGUUAUUCUC-3' (Sequence ID 246)

[0126] Alternatively, the sense strand of the siRNA may be the nucleotide sequence shown in Sequence ID No. 247. The antisense strand of the siRNA is the nucleotide shown in SEQ ID NO: 248. Includes arrays. 5'-GAGAAUAACGCAACUUUCUAZ 19 -3'(Sequence ID 247) , 5'-Z 20 UAGAAAGUUGCGUUAUUCUCUG-3'(Sequence ID 24) 8) However, the aforementioned Z 20 Z is the first nucleotide at the 5' end of the antisense strand. 20 is selected from A, U, G, or C, and Z 19 is, Z 20 It is a complementary nucleotide. ru.

[0127] In some embodiments, the siRNA is used with respect to the sixth siRNA. The chain contains the nucleotide sequence shown in Sequence ID No. 305, and the anti-nucleotide of the siRNA. The sense strand contains the nucleotide sequence shown in Sequence ID No. 306. 5'-AACUUUCUAUUUCAAGAUZ 23 -3' (Sequence ID 305), 5'-Z 24 AUCUUGAAAUAGAAAGUUGC-3' (Sequence ID 306)

[0128] Alternatively, the sense strand of the siRNA may be the nucleotide sequence shown in Sequence ID No. 307. The antisense strand of the siRNA is the nucleotide shown in SEQ ID NO: 308. Includes arrays. 5'-GCAACUUUCUAUUUCAAGAUZ 23 -3'(Sequence ID 307) , 5'-Z 24 AUCUUGAAAUAGAAAGUUGCGU-3'(Sequence ID 30 8) However, the aforementioned Z 24 Z is the first nucleotide at the 5' end of the antisense strand. 24 is selected from A, U, G, or C, and Z 23 is, Z 24 It is a complementary nucleotide. ru.

[0129] In some embodiments, the siRNAs described herein are listed in Tables 1a to 1f. The following are known: siKNa1, siKNa2, siKNb1, siKNb2, siKNc1, siKNc2, siKNd1, siKNd2, siKNe1, siKNe2, siKNf The values ​​are 1 and siKNf2.

[0130] As mentioned above, each nucleotide in the siRNA of this disclosure is independently modified or This is an unmodified nucleotide. In some embodiments, each of the siRNAs of this disclosure All nucleotides are unmodified nucleotides. In some embodiments, Some or all of the nucleotides in the disclosed siRNA are modified nucleotides, These modifications on the creotide group allow the siRNA of this disclosure to repress KNG gene expression. It does not significantly weaken or cause loss of function.

[0131] In some embodiments, the siRNAs of this disclosure have at least one modified nucleo Contains nucleotides. In the context of this disclosure, the term "modified nucleotide" means nucleotide. A nucleotide or nucleotide in which the hydroxyl group at the 2' position of the ribose group of an ocide is substituted with another group. This refers to a rheotide analog, or a nucleotide having a modified base. Reotide clearly weakens or eliminates the gene expression repressive function of siRNA. It will not happen. For example, JK Watts, GF Deleavey, and MJ Damha,Chemically modified siRNA: to ols and applications. Drug Discov Today, Select the modified nucleotides disclosed in 2008,13(19-20):842-55. That's fine.

[0132] In some embodiments, the sense strand of the siRNA provided herein or the aforementioned The antisense strand has at least one modified nucleotide, and / or It is a phosphate ester group in which at least one phosphate ester group has a modifying group. Alternatively, at least one single-stranded phosphate group in the sense chain and the antisense chain. - At least a portion of the phosphate ester groups and / or ribose groups in the sugar skeleton have modifying groups. It is a ribose group having a phosphate ester group and / or a modifying group.

[0133] In some embodiments, the sense chain and / or the antisense chain Cleotides are all modified nucleotides. In some embodiments, as disclosed herein Each nucleotide in the sense strand and antisense strand of the provided siRNA is They are either fluoromodified nucleotides or non-fluoromodified nucleotides.

[0134] Surprisingly, the inventors of this disclosure have found that the siRNA described herein can be used in animal experiments. In this case, a high degree of balance is achieved between plasma stability and gene silencing efficiency. I found it.

[0135] In some embodiments, the fluoromodified nucleotide is nucleotide sequence I And located in nucleotide sequence II, from the 5' end toward the 3' end, the nucleotide At least the nucleotides at positions 7, 8, and 9 of sequence I are fluoromodified nucleotides. From the 5' end toward the 3' end, at least the 2nd, 6th, and 1st nucleotides of the nucleotide sequence II The nucleotides at positions 4 and 16 are fluoromodified nucleotides.

[0136] In some embodiments, the fluoromodified nucleotide is nucleotide sequence I It is located in nucleotide sequence II, and is a fluoromodified nucleus in nucleotide sequence I. There are 5 or fewer ocides, and from the 5' end to the 3' end, the nucleotide sequence I At least the nucleotides at positions 7, 8, and 9 are fluoromodified nucleotides, and the nucleotides The fluoromodified nucleotides in rheotide sequence II are 7 or fewer, and the nucleo At least the nucleotides at positions 2, 6, 14, and 16 of sequence II are fluoromodified nucleos It's Chido.

[0137] In some embodiments, the sense strand odor is located from the 5' end to the 3' end. Then, the nucleotides at positions 7, 8, and 9 or 5, 7, 8, and 9 of the nucleotide sequence I are It is a ruoro-modified nucleotide, and the remaining nucleotides in the sense strand are non-fu It is a ruoro-modified nucleotide, and from the 5' end to the 3' end, the antisense strand In the above nucleotide sequence II, positions 2, 6, 14, 16 or 2, 6, 8, 9, 1 The nucleotides at positions 4 and 16 are fluoromodified nucleotides, and the antisense strand is The remaining nucleotides are un-fluoromodified nucleotides.

[0138] In the context of this disclosure, “fluoromodified nucleotide” means a nucleotide with ribose It has the structure shown in formula (7) below, in which the hydroxyl group at the 2' position of the group is substituted with fluorine. This refers to nucleotides that have ribose added. "Non-fluoromodified nucleotides" are nucleotides that have ribose added. A nucleotide in which the hydroxyl group at the 2' position of the base is substituted with a nonfluorine group, or a nucleotide A Refers to the nucleotide. In some embodiments, each non-fluoromodified nucleotide is a nucleotide. A nucleotide in which the hydroxyl group at the 2' position of the ribose group of an ocide is substituted with a nonfluorine group or It is one of the nucleotide analogs that is selected independently.

[0139] These nucleotides, in which the hydroxyl group at the 2' position of the ribose group is replaced with a nonfluorine group, are These nucleotides are known to those skilled in the art, and are 2'-alkoxy modified nucleotides. 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted Alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides The rheotide may be one selected from 2'-deoxynucleotides.

[0140] In some embodiments, the 2'-alkoxy-modified nucleotide is shown in formula (8) It is a methoxy-modified nucleotide (2'-OMe). In some embodiments, 2'-substituted alkoxy modified nucleotides include, for example, the 2'-O-methionine shown in formula (9). It may also be a xyethyl-modified nucleotide (2'-MOE). In some embodiments... The 2'-amino modified nucleotide (2'-NH2) is shown in formula (10). In that embodiment, the 2'-deoxynucleotide (DNA) is represented by formula (11) .

[0141] [ka]

[0142] Nucleotide analogs are substances that can substitute for nucleotides in nucleic acids. adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, This refers to a group whose structure differs from that of uracil ribonucleotide or thymine deoxyribonucleotide. In some embodiments, the nucleotide analog is an isonucleotide, a cross-linked nucleotide. rheotide (bridged nucleic acid, BNA) or acyclic nucleotide It's also fine to use "do".

[0143] BNA refers to a nucleotide that is constrained or cannot be accessed. BNA is a five-membered ring, six-membered ring. Includes a crosslinked structure having a ring or seven-membered ring with "fixed" C3'-endosugar puckering. That's fine. Usually, the bridge is introduced at the 2'- and 4'- positions of the ribose, resulting in 2',4'-BN. Provides A nucleotide. In some embodiments, BNA is represented by formula (12). LNA, ENA shown in equation (13), cET BNA shown in equation (14), etc. That's fine.

[0144] [ka]

[0145] Acyclic nucleotides are nucleotides in which the sugar ring of the nucleotide has been opened. In that embodiment, the acyclic nucleotide is an unlocked nucleic acid represented by formula (15). (UNA), or glycerol nucleic acid (GNA) represented by formula (16).

[0146] [ka]

[0147] In formulas (15) and (16) above, R is H, OH, or alkoxy (O-alkoxy Selected from (Lu)

[0148] Isonucleotides are nucleotides in which the position of the base in the ribose ring changes. This refers to a compound. In some embodiments, the isonucleotide is of formula (17) or ( 18) The chemicals in which the base is transposed from the 1'-position to the 2'-position or 3'-position of the ribose ring. Mixed ingredients are also acceptable.

[0149] [ka]

[0150] In the compounds shown in formulas (17) to (18) above, the base is A, U, G, C. Alternatively, it represents a base such as T, and R is selected from H, OH, F, or the non-fluorinated group mentioned above.

[0151] In some embodiments, the nucleotide analog is an isonucleotide, LNA, One of the following is selected from ENA, cET, UNA, and GNA. Several implementations In terms of morphology, each non-fluoromodified nucleotide is a methoxy-modified nucleotide. In this context, the methoxy-modified nucleotide refers to the 2'-hydroxy of the ribose group. This refers to a nucleotide in which the c group is replaced with a methoxy group.

[0152] In this context, "fluoromodified nucleotide" and "2'-fluoromodified nucleotide" are used. "A nucleotide in which the 2'-hydroxyl group of the ribose group is replaced with fluorine" and "2'- "Nucleotides containing a fluororibose group" have the same meaning, and both are nucleotides. Compounds having the structure shown in formula (7), in which the 2'-hydroxyl group of is replaced with fluorine. This refers to "methoxy-modified nucleotides," "2'-methoxy-modified nucleotides," and "ribo." "nucleotides in which the 2'-hydroxyl group of the - group is replaced with methoxy" and "2'-methyl "Nucleotides containing a siribose group" have the same meaning, and both refer to nucleotides. The 2'-hydroxyl group of the bose group is substituted with methoxy, and the structure is as shown in formula (8). It refers to compounds.

[0153] In some embodiments, the siRNAs of this disclosure are siRNAs having the following modifications. That is, in the sense chain, from the 5' end toward the 3' end, the nucleus Nucleotides at positions 7, 8, and 9 or positions 5, 7, 8, and 9 of rheotide sequence I are fluoromodified. It is a nucleotide, and the remaining nucleotides in the sense strand are methoxy-modified It is a creotide, and in the antisense strand, the 2nd and 6th nucleotides of nucleotide sequence II , nucleotides at positions 14, 16 or 2, 6, 8, 9, 14, 16 are fluoromodified nucleotides It is a rheotide, and the remaining nucleotides in the antisense chain are methoxy-modified. It is a nucleotide.

[0154] In some embodiments, the siRNAs of this disclosure are siRNAs having the following modifications. That is, from the 5' end toward the 3' end, in the sense strand of the siRNA Nucleotides at positions 5, 7, 8 and 9 of nucleotide sequence I are fluoromodified nucleotides. The nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides. It is a do, and from the 5' end to the 3' end, in the antisense strand of the siRNA Nucleotides at positions 2, 6, 8, 9, 14 and 16 of nucleotide sequence II are fluoromodified. These are decorative nucleotides, and the nucleotides at the remaining positions of the antisense strand of the siRNA are met It is a xy-modified nucleotide, Alternatively, from the 5' end to the 3' end, the nucleus in the sense strand of the siRNA The nucleotides at positions 5, 7, 8, and 9 of the ocidal sequence I are fluoromodified nucleotides. The remaining nucleotides in the sense strand of the siRNA are methoxy-modified nucleotides. , from the 5' end toward the 3' end, the nucleo in the antisense strand of the siRNA The nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II are fluoromodified nucleotides. Yes, the nucleotides at the remaining positions of the siRNA antisense strand are methoxy-modified nucleos It is Chido, Alternatively, from the 5' end to the 3' end, the nucleus in the sense strand of the siRNA The nucleotides at positions 7, 8, and 9 of the ocidal sequence I are fluoromodified nucleotides, The remaining nucleotides in the sense strand of the iRNA are methoxy-modified nucleotides, and 5 From the 'terminus' to the '3' terminus, the nucleotides in the antisense strand of the siRNA The nucleotides at positions 2, 6, 14, and 16 of sequence II are fluoromodified nucleotides. The nucleotides at the remaining positions of the siRNA antisense strand are methoxy-modified nucleotides. That is the case.

[0155] In some embodiments, the siRNAs provided in this disclosure are shown in Tables 1a to 1f. The listed siKNa1-M1, siKNa1-M2, siKNa1-M3, siK Na2-M1, siKNa2-M2, siKNa2-M3, siKNb1-M1, siK Nb1-M2, siKNb1-M3, siKNb2-M1, siKNb2-M2, siK Nb2-M3, siKNc1-M1, siKNc1-M2, siKNc1-M3, siK Nc2-M1, siKNc2-M2, siKNc2-M3, siKNd1-M1, siK Nd1-M2, siKNd1-M3, siKNd2-M1, siKNd2-M2, siK Nd2-M3, siKNe1-M1, siKNe1-M2, siKNe1-M3, siK Ne2-M1, siKNe2-M2, siKNe2-M3, siKNf1-M1, siK Nf1-M2, siKNf1-M3, siKNf2-M1, siKNf2-M2 and si It is one of KNf2-M3.

[0156] siRNAs having the above modifications are not only low-cost, but also react with ribonucleases in the blood. This makes it more difficult to cleave nucleic acids, thereby improving the stability of nucleic acids. This further enhances the property of resistance to rease hydrolysis. Furthermore, the above modified siRNA targets m It has high RNA repressive activity.

[0157] In some embodiments, the sense strand and antinucleotide provided herein are used. In the sense chain, the number of phosphate ester groups in at least one single-chain phosphate-sugar skeleton is small. At least some of them are phosphate ester groups having modifying groups. In some embodiments , the phosphate ester group having a modifying group, the phosphate diester bond in the phosphate ester group It is a thiophosphate ester group in which at least one oxygen atom is replaced by a sulfur atom. In several embodiments, the phosphate ester group having the modifying group is represented by formula (1) It is a thiophosphate ester group with a specific structure.

[0158] [ka]

[0159] These modifications stabilize the double-stranded structure of siRNA, resulting in high base pairing specificity. And it can maintain a high level of affinity.

[0160] In some embodiments, the siRNA provided in this disclosure contains thioline The acid ester group is connected to the first nucleotide at any one end of the sense strand or antisense strand and 2 Between the second nucleotide and the second nucleotide at any end of the sense strand or antisense strand Selected from the group consisting of the relationship between the ocide and the third nucleotide, or any combination thereof. It exists bound to at least one of them. In some embodiments, thiophosphate ester The tel group is present at all of the above positions except the 5' end of the sense chain. In the embodiment, the thiophosphate ester group is located at all of the above positions except the 3' end of the sense chain. It exists bonded to the following. In some embodiments, the thiophosphate ester group is as follows: It is attached to at least one of the locations. Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second and third nucleotides from the 3' end of the sense strand, The first nucleotide and the second nucleotide from the 5' end of the aforementioned antisense strand Between, The second and third nucleotides from the 5' end of the aforementioned antisense strand Between, The first nucleotide and the second nucleotide from the 3' end of the aforementioned antisense strand between, and The second and third nucleotides from the 3' end of the aforementioned antisense strand Between.

[0161] In some embodiments, the siRNAs provided in this disclosure are shown in Tables 1a to 1f. The siKNa1-M1S, siKNa1-M2S, and siKNa1-M3S listed are siKNa2-M1S, siKNa2-M2S, siKNa2-M3S, siKNb1- M1S, siKNb1-M2S, siKNb1-M3S, siKNb2-M1S, siK Nb2-M2S, siKNb2-M3S, siKNc1-M1S, siKNc1-M2S , siKNc1-M3S, siKNc2-M1S, siKNc2-M2S, siKNc2 -M3S, siKNd1-M1S, siKNd1-M2S, siKNd1-M3S, si KNd2-M1S, siKNd2-M2S, siKNd2-M3S, siKNe1-M1 S, siKNe1-M2S, siKNe1-M3S, siKNe2-M1S, siKNe 2-M2S, siKNe2-M3S, siKNf1-M1S, siKNf1-M2S, s iKNf1-M3S, siKNf2-M1S, siKNf2-M2S and siKNf2- It is one of the M3S.

[0162] In some embodiments, the 5' terminal nucleoty of the antisense strand of the siRNA The nucleotide is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide.

[0163] The conventional 5'-phosphate nucleotide or 5'-phosphate analog modified nucleotide is, It is known to those skilled in the art that, for example, a 5'-phosphate nucleotide may have the following structure. .

[0164] [ka]

[0165] Also, for example, Anastasia Khvorova and Jonathan K. Watts,The chemical evolution of oligo nucleotide therapies of clinical utility . Nature Biotechnology,2017,35(3): 238~4 Section 8 discloses the following four types of 5'-phosphate analog modified nucleotides.

[0166] [ka]

[0167] In the formula, R is selected from H, OH, methoxy, and fluorine, Base represents a base, and A and U represent bases. Selected from C, G, or T.

[0168] In some embodiments, the 5'-phosphate nucleotide is represented by formula (2), 5 nucleotides containing '-phosphate modification, and 5'-phosphate analog modified nucleotides are The vinyl phosphate ester (5'-(E)-vinylphospho shown in formula (3) A nucleotide containing a nate (E-VP) modification, or a thio shown in formula (5). It is a phosphate-modified nucleotide.

[0169] In some embodiments, the siRNAs provided in this disclosure are shown in Tables 1a to 1f. The listed siKNa1-M1P1, siKNa1-M2P1, and siKNa1-M3 P1, siKNa2-M1P1, siKNa2-M2P1, siKNa2-M3P1, s iKNa1-M1SP1, siKNa1-M2SP1, siKNa1-M3SP1, si KNa2-M1SP1, siKNa2-M2SP1, siKNa2-M3SP1, siK Nb1-M1P1, siKNb1-M2P1, siKNb1-M3P1, siKNb2- M1P1, siKNb2-M2P1, siKNb2-M3P1, siKNb1-M1SP 1, siKNb1-M2SP1, siKNb1-M3SP1, siKNb2-M1SP1 , siKNb2-M2SP1, siKNb2-M3SP1, siKNc1-M1P1, s iKNc1-M2P1, siKNc1-M3P1, siKNc2-M1P1, siKNc 2-M2P1, siKNc2-M3P1, siKNc1-M1SP1, siKNc1-M 2SP1, siKNc1-M3SP1, siKNc2-M1SP1, siKNc2-M2 SP1, siKNc2-M3SP1, siKNd1-M1P1, siKNd1-M2P1 , siKNd1-M3P1, siKNd2-M1P1, siKNd2-M2P1, siK Nd2-M3P1, siKNd1-M1SP1, siKNd1-M2SP1, siKNd 1-M3SP1, siKNd2-M1SP1, siKNd2-M2SP1, siKNd2 -M3SP1, siKNe1-M1P1, siKNe1-M2P1, siKNe1-M3 P1, siKNe2-M1P1, siKNe2-M2P1, siKNe2-M3P1, s iKNe1-M1SP1, siKNe1-M2SP1, siKNe1-M3SP1, si KNe2-M1SP1, siKNe2-M2SP1, siKNe2-M3SP1, siK Nf1-M1P1, siKNf1-M2P1, siKNf1-M3P1, siKNf2- M1P1, siKNf2-M2P1, siKNf2-M3P1, siKNf1-M1SP 1, siKNf1-M2SP1, siKNf1-M3SP1, siKNf2-M1SP1 It is either siKNf2-M2SP1 or siKNf2-M3SP1.

[0170] The inventors of this disclosure have demonstrated the plasma and lysosomal stability of the siRNA provided herein. Not only was there a significant improvement, but we also unexpectedly found that it exhibited high target mRNA repression activity. .

[0171] The siRNAs provided in this disclosure are prepared using conventional siRNA preparation methods in the art (e.g., For example, it can be obtained by a solid-phase synthesis method and a liquid-phase synthesis method. Here, solid-phase synthesis is A commercial customization service is already available. Nucleosids with corresponding modifiers. By using a mer, modified nucleotide groups are introduced into the siRNA described herein. A method for preparing nucleoside monomers having the corresponding modifications, and modified nucleos Methods for introducing a rheotide group into siRNA are also well known to those skilled in the art.

[0172] <Drug composition> This disclosure relates to a drug comprising the above-mentioned siRNA as an active ingredient and a pharmaceutically acceptable carrier. A composition is provided.

[0173] Even if the pharmaceutically acceptable carrier is a carrier commonly used in the field of siRNA administration, Often, for example, magnetic nanoparticles, for example (nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes (carbon nanotubes, mesoporous silicon n), calcium phosphate nanoparticles Polyethylenes (PEI) , polyamidoamine dendrimer (PAMAM) d endrimer, polylysine (poly(L-lysine, PLL), chitosan) (chitosan), 1,2-dioleoyl-3-trimethylammonium propane ( 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly-D- or L-lactic acid / glycolic acid copolymer (poly(D&L-l Actic / glycolic acid copolymer, PLGA, poly(a) (poly(2-aminoethyl ethylene phosphate ester)) lene phosphate), PPEEA), and poly(N,N-dimethylaminoethyl) (poly(2-dimethylaminoethyl methacrylate)) This includes acrylate, PDMAEMA, and one or more derivatives thereof. These are not the only options.

[0174] With respect to the content of siRNA and pharmaceutically acceptable carrier in the aforementioned drug composition, There is no requirement for this, but the usual content of each component may be acceptable. In some embodiments, The weight ratio of siRNA to a pharmaceutically acceptable carrier may be 1:(1-500). In some embodiments, the above weight ratio is 1:(1~50).

[0175] In some embodiments, the drug composition contains other pharmaceutically acceptable additives. It may be included, and the additive is one of the various formulations or compounds commonly used in this field. There may be multiple types. For example, the other pharmaceutically acceptable additives may be a pH buffer, It may contain at least one of a protective agent and an osmotic pressure regulator.

[0176] The aforementioned pH buffer is trishydroxymethylaminomethane hydrochloride with a pH of 7.5 to 8.5. Buffer solution (tris(hydroxymethyl) aminomethane hyd rochloride buffer and / or phosphate buffer with a pH of 5.5 to 8.5 It may also be a phosphate buffer solution with a pH of 5.5 to 8.5.

[0177] The aforementioned protective agents are inositol, sorbitol, sucrose, trehalose, and mannose. The drug combination may be at least one of maltose, lactose, and glucose. Based on the total weight of the product, the content of the protective agent may be 0.01 to 30% by weight.

[0178] The osmotic pressure regulator may be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator is such that the osmotic pressure of the drug composition is 200 to 700 milliosmoles / kilogram. It is determined to be ram (mOsm / kg). With the desired osmotic pressure, a person skilled in the art will know the above The content of the osmotic pressure regulator can be easily determined.

[0179] In some embodiments, the drug composition may be a liquid formulation such as an injection solution. Alternatively, it may be prepared as a lyophilized powder injection, mixed with a liquid additive at the time of administration, to form a liquid formulation. The liquid formulation described above can be administered by subcutaneous, intramuscular, or intravenous injection, but is not limited to these methods. It is administered to the lungs by spraying, or to other organs and tissues (e.g., the liver) through the lungs by spraying. It can also be administered to, but is not limited to, the following embodiments. The drug composition is used for intravenous administration.

[0180] In some embodiments, the drug composition may be in the form of a liposomal formulation. i. In some embodiments, pharmaceutically acceptable substances used in the liposome formulation The carrier is an amine-containing transfection compound (hereinafter also called an organic amine), and an auxiliary lipid. Contains organic ammonium compounds and / or PEGylated (polyethylene glycolated) lipids. Here, the organic ammonium compounds The cereal, auxiliary lipids, and PEGylated lipids are described in their entirety in CN103380113A (quoted above). Amine-containing transfection compounds or their pharmaceutically acceptable properties as described in the specification (to be incorporated into the specification) One or more selected from acceptable salts or derivatives, auxiliary lipids, and PEGylated lipids Multiple species are acceptable.

[0181] In some embodiments, the organic amine is as described in CN103380113A. The compound shown in formula (201) or a pharmaceutically acceptable salt thereof may be used.

[0182] [ka] During the ceremony, X 101 or X 102 Each of these is independently O, S, NA, or CA, where A is hydrogen. or C1-C 20 It is a hydrocarbon chain, Y 101 or Z 101 Each of these is independently C=O, C=S, S=O, CH-OH, or S It is O2, R 101 , R 102 , R 103 , R 104 , R 105 , R 106 or R 107 Each Independently, hydrogen, cyclic or acyclic, substituted or unsubstituted, branched or linear aliphatic group, cyclic or acyclic, substituted or unsubstituted, branched or linear heteroaliphatic groups, substituted or unsubstituted, Branched or linear acyl groups, substituted or unsubstituted; branched or linear aryl groups, substituted or unsubstituted. It is a substitute, branched-chain or linear heteroaryl group. x is an integer from 1 to 10, n is an integer between 1 and 3, m is an integer between 0 and 20, and p is either 0 or 1, where, If m=p=0, then R 102 It is hydrogen, If at least one of n or m is 2, then R 103 And nitrogen in equation (201) , forming a structure shown in formula (202) or formula (203).

[0183] [ka] In the formula, g, e, or f are each an integer from 1 to 6, and "HCC" represents a hydrocarbon chain. This represents each * N represents the nitrogen atom in equation (201).

[0184] In some embodiments, R 103 is a polyamine. In other embodiments, R 103 is a ketal. In some embodiments, R in formula (201) 10 1 and R 102 Each of these can be independently and optionally substituted or unsubstituted, branched or linear aluminum chains. The alkyl or alkenyl is a alkyl or alkenyl having 3 to about 20 carbon atoms. For example, 8 to about 18 carbon atoms and 0 to 4 double bonds, for example, 0 to 2 double bonds They have a common characteristic.

[0185] In some embodiments, when n and m are independently a value of 1 or 3, R 103 This may be any one of the following equations (204) to (213).

[0186] [ka] In equations (204) to (213), g, e, and f are each independent integers from 1 to 6. Each "HCC" represents a hydrocarbon chain, and each * is R 103 and nitrogen in equation (201) It shows the bonding points with atoms, and any * Each H at position corresponds to the nitrogen atom in equation (201) and It may be substituted for joining purposes.

[0187] The compound shown in formula (201) is prepared according to the description in CN103380113A. That's good too.

[0188] In some embodiments, the organic amine is an organic amine represented by formula (214). and / or an organic amine represented by formula (215).

[0189] [ka]

[0190] The aforementioned supplementary lipids are cholesterol, cholesterol analogs and / or cholesterol It is a derivative of , The PEGylated lipid is 1,2-dipalmitamide-sn-glycero-3-phosphatidi Ethanolamine-N-[methoxy(polyethylene glycol)]-2000(1,2 -dipalmitoyl-sn-glycero-3-phosphatidylet hanolamine-N-[methoxy(polyethylene glyco l)-2000).

[0191] In some embodiments, the drug composition includes the organic amine and the auxiliary lipid. The molar ratio of the PEGylated lipids is (19.7~80):(19.7~80):(0.3~ 50) and for example, (50~70):(20~40):(3~20) may also be the case. .

[0192] In some embodiments, the siRNA of the present disclosure and the amine-containing transfects The drug composition particles formed by the reagent have an average diameter of approximately 30 nm to approximately 200 nm. Generally, the wavelength is approximately 40 nm to 135 nm, and more generally, the average of the liposome particles. The diameter is approximately 50nm to 120nm, 50nm to 100nm, and 60nm to 90nm. The wavelength is approximately 70 nm to 90 nm, and for example, the average diameter of the liposome particles is approximately 30,4 0, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 1 The wavelength is 40, 150, or 160 nm.

[0193] In some embodiments, the siRNA of the present disclosure and the amine-containing transfects In a drug composition formed by a reagent, siRNA and total lipids (e.g., organic amines) The weight ratio (weight / weight ratio) of the supplementary lipids and / or PEGylated lipids is approximately 1:1 to 1:5 0, approximately 1:1~1:30, approximately 1:3~1:20, approximately 1:4~1:18, approximately 1:5~ Approximately 1:17, approximately 1:5 to approximately 1:15, approximately 1:5 to approximately 1:12, approximately 1:6 to approximately 1:12 or The ratio is within the range of approximately 1:6 to approximately 1:10, for example, the weight ratio of siRNA to total lipids in this disclosure is Approximately 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13 , 1:14, 1:15, 1:16, 1:17, or 1:18.

[0194] In some embodiments, the drug composition is such that each component exists independently at the time of market release. In some embodiments, this disclosure may exist as a liquid formulation at the time of use. Drug composition formed from siRNA provided by and the above-mentioned pharmaceutically acceptable carrier. These may be prepared according to various known methods, and instead of conventional siRNA, the present disclosure The provided siRNA can be used. In some embodiments, the following method is used. It may be prepared in a different way.

[0195] The organic amine, auxiliary lipid, and PEGylated lipid are suspended in alcohol in the above molar ratio and mixed uniformly. Combine to obtain a lipid solution. The amount of alcohol is such that the total mass concentration of the obtained lipid solution is 2-25 The concentration is determined to be mg / mL, for example, 8-18 mg / mL. The alcohol is Pharmaceutically acceptable alcohols, such as ethanol, propylene glycol, and benzyl Alcohol, glycerin, polyethylene glycol 200, polyethylene glycol 30 Selected from alcohols that are liquid at around room temperature, such as polyethylene glycol 400. It may be one or more types, for example, ethanol.

[0196] The siRNA provided in this disclosure is dissolved in a buffer salt solution to obtain an aqueous siRNA solution. The concentration of the buffer salt solution is 0.05 to 0.5 M, but it may also be, for example, 0.1 to 0.2 M. Adjust the pH of the buffer salt solution to 4.0-5.5, or for example, 5.0-5.2. The amount of buffer salt solution should be such that the siRNA concentration is 0.6 mg / mL or less, for example, 0.2~ The concentration is determined to be 0.4 mg / mL. The buffer salt is soluble acetate, soluble citrate One or more salts selected from salts, for example, sodium acetate and / or potassium acetate. It's fine if it's "um".

[0197] After mixing the lipid solution and the siRNA aqueous solution, the resulting product was heated at 40-60°C to a minimum temperature. Also, culture for 2 minutes, for example, 5 to 30 minutes to obtain the cultured liposome formulation. Lipid solution and s The volume ratio of iRNA aqueous solutions is 1:(2~5).

[0198] The cultured liposome formulation is concentrated or diluted, impurities are removed, and sterilization is performed according to the present disclosure. To obtain the provided pharmaceutical composition. Its physicochemical parameters include a pH of 6.5 - 8 and an encapsulation efficiency of 80% or more, a particle size of 40 - 200 nm, and a polydispersity index of 0 .30 or less, and an osmotic pressure of 250 - 400 mOsm / kg. For example, the physicochemical parameters may include a pH of 7.2 - 7.6, an encapsulation efficiency of 90% or more, a particle size of 60 - 100 nm, a polydispersity index of 0.20 or less, and an osmotic pressure of 300 - 400 mOsm / kg. Here, concentration or dilution may be performed before, after, or simultaneously with the removal of impurities.

[0199] Here, concentration or dilution may be performed before, after, or simultaneously with the removal of impurities. As a method for removing impurities, various conventional methods may be employed. For example , a tangential flow system, using a hollow fiber column, ultrafiltration under the condition of 100 KDa, and the ultrafiltration exchange solution may be a phosphate buffer (PBS) with a pH of 7.4. As a sterilization method , various conventional methods may be employed. For example, it may be sterilized by filtration with a 0.22 μm filter.

[0200] <siRNA complex> The present disclosure provides an siRNA complex including the above siRNA and a complexing group complexed and bound to the siRNA.

[0201] Generally, the complexing group includes at least one targeting group and an optional linker that are pharmaceutically acceptable, and the siRNA, the linker, and the targeting group are sequentially bound. In some embodiments, the number of the targeting groups is 1 - 6. In some embodiments, the number of the targeting groups is 2 - 4. The siRNA molecule may be complexed to the complexing group non-covalently or covalently. For example, it may be covalently complexed to the complexing group. ​ They may be combined. The complex site of siRNA and the complex group is at the 3' end of the sense strand of siRNA or It may be at the 5' end, or at the 5' end of the antisense strand, and is located within the siRNA. They may be in a row. In some embodiments, the complex site of the siRNA and the complex group It is located at the 3' end of the sense strand of siRNA.

[0202] In some embodiments, the complex group is the phosphate group of the nucleotide, the 2'-position nucleotide It may be bonded to a droxy group or a base. In some embodiments, the composite group is It may also be bonded to the hydroxyl group at the 3' position, in which case the nucleotide-nucleotide bond is 2'-5'. They are linked by nitrate diester bonds. The complex group is attached to the end of the siRNA chain. In this case, it is usually bound to the phosphate group of a nucleotide and to the internal sequence of siRNA. They are usually bonded to a ribose sugar ring or a base. For various bonding methods, see Muthia. h Manoharan et.al. siRNA conjugates carr ying sequentially assembled trivalent N- acetylgalactosamine linked through nucleus osides elicit robust gene silencing in v ivo in hepatocytes. ACS Chemical biology See 2015, 10 (5): 1181~7.

[0203] In some embodiments, the relationship between the siRNA and the complex group is acid-unstable or reducible. They may be bound by chemical bonds, and in the acidic environment of cell endosomes, these chemical bonds The compound is broken down, and the siRNA can be released. The complex group is bound to the sense strand of the siRNA, and the complex has an effect on siRNA activity. It can be reduced as much as possible.

[0204] In some embodiments, the pharmaceutically acceptable target group is the siRNA administration field. Ligands commonly used in this, for example, the various types described in WO2009082607A2 It may also be a ligand, and its disclosure as a whole is incorporated herein by reference. .

[0205] In some embodiments, the pharmaceutically acceptable target group is cholesterol, bile duct. Lipophilic molecules such as juice acids, vitamins (e.g., tocopherol), and lipid molecules with different chain lengths, Polymers such as polyethylene glycol, polypeptides such as membrane-permeable peptides, and apters Mer, antibodies, quantum dots, lactose, polylactose, mannose, galactose Sugars such as N-acetylgalactosamine (GalNAc) and folic acid (folate) , asialoglycoprotein, asialoglycoprotein residue, lipoprotein (e.g., high-density lipoprotein) (e.g., low-density lipoproteins), glucagon, neurotransmitters (e.g., adrenaline), growth Factors, target molecules such as receptor ligands expressed in hepatocytes such as transferrin, or their It may be one or more ligands selected from those formed by the derivatives.

[0206] In some embodiments, each ligand is a ligand that can bind to a receptor on the cell surface. Selected independently from the ligand. In some embodiments, at least one ligand It is a ligand that can bind to receptors on the surface of hepatocytes. In some embodiments, At least one ligand is a ligand that can bind to receptors on the surface of mammalian liver cells. In some embodiments, at least one ligand is a receptor on the surface of human hepatocytes. It is a ligand that can bind to. In some embodiments, at least one ligand It is a ligand that can bind to the asialoglycoprotein receptor (ASGPR) on the surface of the liver. The types of these ligands are known to those skilled in the art, and their action is generally to target the surface of cells. It binds to specific receptors on the surface and mediates the delivery of ligand-bound siRNA to target cells. do.

[0207] In some embodiments, the pharmaceutically acceptable target group is the surface of mammalian hepatocytes. One of the ligans that binds to the asialocryprotein receptor (ASGPR) on the surface It may also be a compound. In some embodiments, each ligand is independently an asialocactose compound. Proteins, for example, asialoorosomucoid (A) It is either SOR or asialofetuin (ASF). In several embodiments, the ligand is a sugar or a derivative of a sugar.

[0208] In some embodiments, at least one ligand is a sugar. Morphologically, each ligand is a sugar. In some embodiments, at least Another ligand is a monosaccharide, polysaccharide, modified monosaccharide, modified polysaccharide, or sugar derivative. In the embodiment, at least one of the ligands may be a monosaccharide, disaccharide, or trisaccharide. In some embodiments, at least one ligand is a modified sugar. In this embodiment, each ligand is a modified sugar. Each ligand is independently a polysaccharide, modified polysaccharide, monosaccharide, modified monosaccharide, polysaccharide derivative or Selected from monosaccharide derivatives. In some embodiments, each or a few of the ligands At least one of them is glucose and its derivatives, mannan and its derivatives, galactose and Its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives Conductors, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives Selected from the group consisting of conductors, fructose and its derivatives, and sialic acid.

[0209] In some embodiments, each ligand is D-mannopyrano, L-mannopyrano Pyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D- Glucose, L-glucose, D-galactose, L-galactose, α-D-mannofura North, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyrano -α-D-glucopyranose, β-D-glucopyranose, α-D-glucofurano S, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyrano - α-D-galactopyranose, β-D-galactopyranose, α-D-galactof Lanose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N - Acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionine Lugalactosamine, Nn-butyrylgalactosamine, N-isobutyrylgalactosamine , 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-g Lucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-di Deoxy-4-formamido-2,3-di-O-methyl-D-mannopyrano, 2-de Oxy-2-sulfamino-D-glucopyranose, N-glycolyl-α-neuraminic acid , 5-thio-β-D-glucopyranose, methyl 2,3,4-tris-O-acetyl-1 -Thio-6-O-trityl-α-D-glucopyranoside, 4-Thio-β-D-galactopyranoside Lanose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-diethyl O-α-D-glucoheptopyranoside, 2,5-anhydro-D-alonitrile, ribo From D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose They may be selected independently. Other alternative ligands include, for example, CN1053780 You may also refer to the description in 82A, which, by reference, incorporates the entirety of its disclosure into this Specified. Born.

[0210] In some embodiments, the pharmaceutically acceptable label in the siRNA complex The target group may be galactose or N-acetylgalactosamine, or galactose or The N-acetylgalactosamine molecule may be monovalent, divalent, trivalent, or tetravalent. The terms monovalent, divalent, trivalent, and tetravalent refer to the siRNA molecule and the galactose used as the target group, respectively. An siRNA complex formed from a complex group containing a molecule of or N-acetylgalactosamine The molar ratio of siRNA molecules to galactose or N-acetylgalactosamine molecules is It should be understood that this refers to a ratio of 1:1, 1:2, 1:3, or 1:4. In the application form, the pharmaceutically acceptable target group is N-acetylgalactosamine. In some embodiments, the siRNA described herein is N-acetylgalactosa When compounded with a complex group containing mine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, the siRNA described herein is N-acetylgalactam When combined with a complex group containing tosamine, the N-acetylgalactosamine molecule is trivalent.

[0211] The target group may be bound to the siRNA molecule via a suitable linker, and those skilled in the art will know The appropriate linker can be selected depending on the specific type of target substrate. These linkers, For information on the types of target groups and methods of binding to siRNA, please refer to WO2015006740A2. You may refer to the disclosed content, which will be incorporated into this specification in whole by citation.

[0212] In some embodiments, when the target group is N-acetylgalactosamine, A suitable linker may have the structure shown in formula (301).

[0213] [ka] During the ceremony, k is an integer between 1 and 3. L A This is a chain-like portion containing an amide bond having the structure shown in formula (302), and each of the above L A It has one target group at each end and the L C Bonded to the part by ether bond It will be done.

[0214] [ka] L B This is a chain portion containing N-acylpyrrolidine having the structure shown in formula (303). Furthermore, the chain portion has a carbonyl group at one end, and the L C The parts are bonded by amide bonds. It has an oxygen group at the other end and is bonded to the siRNA by a phosphate ester bond.

[0215] [ka] L C This refers to hydroxymethylaminomethane, dihydroxymethylaminomethane, or trihydroxymethylaminomethane. A divalent to tetravalent linker group based on droxymethylaminomethane, and the L C is an oxygen source Each of the Ls is connected by ether bonding via the child. A It is bonded to the part, and via nitrogen atoms The L B It is joined to the part.

[0216] In some embodiments, n=3, L C is trihydroxymethylaminometh If it is a tetravalent linker group based on , then -(L A )3-trihydroxy Methylaminomethane-L B - This allows N-acetylgalactosamine molecules and siRNA molecules to The structure of the siRNA complex formed by binding is shown in formula (304) below.

[0217] [ka] In the formula, the double helix structure represents siRNA.

[0218] Similarly, the complex site between siRNA and the complex group is the 3' or 5' end of the sense strand of siRNA. It may be at the end, or at the 5' end of the antisense strand, or within the internal sequence of the siRNA. That's fine.

[0219] In some embodiments, the 3' end of the sense strand of the siRNA described herein is Linker-(L A )3-trihydroxymethylaminomethane-L B - three N-A It is covalently bound to the cetylgalactosamine (GalNAc) molecule and to the siRNA molecule. The structure of the si molecule with a molar ratio of 1:3 to the GalNAc molecule is shown in the following formula (305). An RNA complex (hereinafter also referred to as (GalNAc)3-siRNA) is obtained.

[0220] [ka] In the formula, the double helix structure represents the siRNA, and the linker represents the sense of the siRNA. It is attached to the 3' end of the chain.

[0221] In some embodiments, when the target group is N-acetylgalactosamine, A suitable linker may have the structure shown in formula (306).

[0222] [ka] During the ceremony, l is an integer between 0 and 3. * This represents the site in the linker that is bonded to the target group by an ether bond. # This represents the site in the linker that binds to siRNA via a phosphate ester bond. .

[0223] In some embodiments, when l=2, the siRNA complex is given by formula (30 It has the structure shown in 7).

[0224] [ka] In the formula, the double helix structure represents the siRNA, and the linker represents the sense of the siRNA. It is attached to the 3' end of the chain.

[0225] The above siRNA complex was synthesized by a method already described in detail in the prior art. This may also be the case. For example, WO2015006740A2 contains a complex of multiple types of siRNAs. The manufacturing method is described in detail. The siR of this disclosure is manufactured by a method well known to those skilled in the art. A NA complex is obtained. For example, in WO2014025805A1, as shown in formula (305) The method for preparing the structure is described, and Rajeev et al. published ChemBioChem 20 Sections 15, 16, and 903-908 describe the method for preparing the structure shown in formula (307).

[0226] In some embodiments, the siRNA complex has a structure shown in formula (308). It has.

[0227] [ka] During the ceremony, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4. , m1, m2, or m3 are independent integers selected from 2 to 10. R 10 , R 11 , R 12 , R 13 , R 14 or R 15 Each of them is independently H. , or C1-C 10 Alkyl alkyl group, C1-C 10 Alkyl halogens and C1-C 10 a Selected from the group consisting of lucoxy groups, R3 is the base of the structure shown in formula A59.

[0228] [ka] In the formula, E1 is OH, SH, or BH2, and Nu is the siRNA of the present disclosure.

[0229] R2 is a linear alkylene group of carbon atoms with a length of 1 to 20, and one or more of these are... Carbon atoms are C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenile group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C 18 Heterozy Cryylene group and C5-C 10 One or more selected from the group consisting of heteroarylene groups It can be arbitrarily substituted, and R2 is C1-C 10 Alkyl alkyl group, C6-C 10 Aryl group, C5-C 10 Heteroaryl group, C1-C 10 Alkyl halogens, -OC1-C 10 Alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 alkyl-OH, -OC1- C 10 Alkyl halogens, -SC1-C 10 Alkyl, -SC1-C 10 Alkyl Phenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, Halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N( C1-C 10 (Alkyl group)(C1-C 10 Alkyl(alkyl group), -NH(C1-C 10 Alkyl Base), -N(C1-C 10 (Alkyl group)(C1-C10 Alkylphenyl group), -NH( C1-C 10 Alkylphenyl group), cyano group, nitro group, -CO2H, -C(O)O( C1-C 10 Alkyl(C1-C) 10 (Alkyl group)(C1-C 10 Alki ), -CONH(C1-C 10 Alkyl(alkyl group), -CONH2, -NHC(O)(C1 -C 10 Alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 alkyl group )C(O)(C1-C 10 Alkyl(C1-C) 10 Alkyl(C)(O)(F (enyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alkyl fer Nyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 alkyl group , -SO2(C1-C 10 Alkyl group), -SO2 (phenyl group), -SO2 (C1-C 10 (Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 alkyl group ), -SO2NH (phenyl group), -NHSO2 (C1-C 10 (alkyl group), -NHS O2 (phenyl group) and -NHSO2 (C1-C 10 group consisting of halogenated alkyl groups It may optionally have one or more substituents, Each L1 is independently a linear alkylene group of carbon atoms with a length of 1 to 70, and one of them Or multiple carbon atoms, C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene group, C2-C 10Alkynylene group, C6-C 10 Arylene group, C3-C1 8 heterocyclylene group and C5-C 10 Selected from the group consisting of heteroarylene groups Alternatively, it can be replaced with any number of other elements, and L1 is C1-C 10 Alkyl alkyl group, C6-C 10 aryl group , C5-C 10 Heteroaryl group, C1-C 10 Alkyl halogens, -OC1-C1 0 alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 alkyl-OH, -OC1-C 10 Alkyl halogens, -SC1-C 10 Alkyl, -SC1-C1 0 alkylphenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated Lukyl group, halogen substituent, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH 2, -N(C1-C 10 (Alkyl group)(C1-C 10 Alkyl(alkyl group), -NH(C1-C1 0 alkyl group), -N(C1-C 10 (Alkyl group)(C1-C 10 (Alkylphenyl group) , -NH(C1-C 10 Alkylphenyl group, cyano group, nitro group, -CO2H, -C (O)O(C1-C 10 Alkyl(C1-C) 10 (Alkyl group)(C1-C 10 Alkyl(C1-C) 10 Alkyl(), -CONH2, -NHC( O)(C1-C 10 Alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Alkyl(C)C(O)(C1-C 10 Alkyl(C1-C) 10 (Alkyl group) C (O)(phenyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 a Lucylphenyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Alkyl, -SO2(C1-C 10 Alkyl group), -SO2 (phenyl group), -SO2 (C1-C 10 (Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 Alkyl group), -SO2NH (phenyl group), -NHSO2 (C1-C 10 (Alkyl group) -NHSO2 (phenyl group) and -NHSO2 (C1-C 10 (Halogenated alkyl groups) It may optionally have one or more substituents from the group consisting of the above.

[0230] In some embodiments, L1 is made up of a base of A1 to A26 or any combination thereof. The groups may be selected from the following, and the structures and definitions of A1 to A26 are as follows.

[0231] [ka] In the formula, each j1 is an independent integer between 1 and 20, and each j2 is an independent integer between 1 and 20. the law of nature, Each R' is independently C1-C 10 It is an alkyl group, Each Ra is independently selected from the group consisting of formula A27-A45 and any combination thereof. ru.

[0232] [ka] Each Rb independently corresponds to C1-C 10 It is an alkyl group, JPEG0007872622000023.jpg5170 represents the site where groups are covalently bonded.

[0233] For convenience, L1 is defined as a linear alkylene group, but for example, the above substitution and / or The amine or alkenyl groups resulting from substitution may not be linear groups, or they may have different names. It will be understood by those skilled in the art that there are two lengths of L1. This is the number of atoms in the chain that connects the bond points. For this purpose, the carbon of the straight-chain alkylene A ring obtained by substituting elementary atoms (for example, heterocyclylene or heteroarylene) is 1 Let's consider them as individual atoms.

[0234] M1 represents the target group, and its definition and selectable range are the same as those for the target group described above. How many? In that embodiment, each M1 is an asial glycoprotein on the surface of mammalian liver cells It is one of the ligands that are independently selected from those that have affinity for the receptor.

[0235] M1 has affinity for asialoglycoprotein receptors on the surface of mammalian liver cells. In some embodiments, when the ligand is present, n1 is an integer from 1 to 3. n3 may be an integer from 0 to 4, and the M1 target in the siRNA complex may be Ensure that the number of target groups is at least 2. In some embodiments, n1+ n3≧2, which means that the number of M1 target groups is at least 3, and the M1 target groups and liver To facilitate the binding of surface asialocrycoprotein receptors, and furthermore, the siRNA complex This promotes the uptake of the substance into cells through endocytosis (intracellular uptake). This can be done. As can be seen from the experiment, when the number of M1 target groups is 3 or more, the M1 target Since the improvement in the ease of binding between the ba and the asialoglycoprotein receptor on the liver surface is not clear, Considering various factors such as ease of synthesis, structure / process cost, and delivery efficiency, In some embodiments, n1 is an integer between 1 and 2, and n3 is an integer between 0 and 1. Furthermore, n1 + n3 = 2 to 3.

[0236] In some embodiments, m1, m2, or m3 are independently selected from integers between 2 and 10. If selected, the spatial position between multiple M1 target groups is determined by the relationship between the M1 target group and the asialoglycoprotein on the liver surface. The siRNA complex provided by this disclosure can be adapted to bind to nucleotide receptors. To simplify the body, make it easier to synthesize, and / or reduce the cost, several In this embodiment, m1, m2, or m3 are each an independent integer between 2 and 5. In some embodiments, m1 = m2 = m3.

[0237] R 10 , R 11 , R 12 , R 13 , R 14 or R 15 However, H, C1-C 10 alkyl group , C1-C 10 Alkyl halogens and C1-C 10 Each alkoxy group is independent If one is selected, neither alters the properties of the siRNA complex of this disclosure. Those skilled in the art will understand that the purposes of this disclosure can be achieved without any other means. In this embodiment, R 10 , R 11 , R 12 , R 13 , R 14or R 15 These are, Independently selected from H, a methyl group, or an ethyl group. In some embodiments, R1 0, R 11 , R 12 , R 13 , R 14 or R 15 All of these are H.

[0238] R3 is the base of the structure shown in formula A59, where E1 is OH, SH, or BH2. In some embodiments, considering the availability of the raw materials for preparation, E1 is OH or It is SH.

[0239] R2 is selected to enable bonding between the N atom on the nitrogen-containing skeleton and A59. In the context of the above, "nitrogen-containing skeleton" means R 10 , R 11 , R 12 , R 13 , R 14 Reach biR 15 This refers to a chain-like structure in which carbon atoms and N atoms are bonded to each other. R2 is capable of bonding the A59 group to the N atom on the nitrogen-containing skeleton in an appropriate manner. It may be any linker group. In some embodiments, by a solid-phase synthesis process When preparing the siRNA complex shown in formula (308), the R2 group contains a nitrogen-containing skeleton. It includes both the site that bonds to the N atom above and the site that bonds to the P atom in R3. It is necessary. In some embodiments, the N atoms on the nitrogen-containing skeleton in R2 The bonding site is the site that forms an amide bond with the N atom and bonds to the P atom on R3. R2 forms a phosphate ester bond with the P atom, and in some embodiments, R2 is B5 It may also be B6, B5', or B6'.

[0240] [ka] During the ceremony, JPEG0007872622000025.jpg5170 represents the site where groups are covalently bonded.

[0241] The range of the value of q2 may be an integer from 1 to 10, and in some embodiments, q 2 is an integer between 1 and 5.

[0242] L1 is bonded to the M1 target group and N on the nitrogen-containing skeleton, forming the siRN shown in formula (308). It plays a role in providing liver targeting function to the A complex. In some embodiments, L 1 is a combination of one or more bonds selected from the bases of formulas A1 to A26. In this embodiment, L1 is A1, A4, A5, A6, A8, A10, A11 and A13 It is a combination of one or more combinations selected from. In some embodiments, L1 is , in a combination of at least two joins selected from A1, A4, A8, A10 and A11 Yes. In some embodiments, L1 is selected from A1, A8, A10. Both are combinations of two bonds.

[0243] In some embodiments, the length of L1 is 3 to 25 atoms, 3 to 20 atoms, The number of atoms may be 4 to 15 or 5 to 12. In some embodiments, The length of L1 is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 pieces. 13 pieces, 14 pieces, 15 pieces, 16 pieces, 17 pieces, 18 pieces, 19 pieces, 20 pieces, 21 pieces, 22 pieces, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 It is an atom.

[0244] In some embodiments, j1 is an integer from 2 to 10, and in some embodiments... In some embodiments, j1 is an integer between 3 and 5. In some embodiments, j2 is an integer between 2 and 10. In some embodiments, j2 is an integer between 3 and 5. R' is C1-C4. It is a methyl group, and in some embodiments, R' is a methyl group, an ethyl group, and an isopyl group. It is one of the ropyl groups. Ra is one of A27, A28, A29, A30 and A31. In some embodiments, Ra is A27 or A28. Rb is C1-C It is a 5-alkyl group, and in some embodiments, Rb is a methyl group, an ethyl group, or an iso It is one of the propyl group and the butyl group. In some embodiments, formulas A1 to A26 By selecting j1, j2, R', Ra, and Rb respectively, the M1 target group and nitrogen This achieves bonding with the N atom on the contained skeleton, and the spatial position between the M1 target groups is determined between the M1 target group and the liver surface. Further improves the binding to the asialoclycoprotein receptor.

[0245] In some embodiments, the siRNA complex is of formula (403), (404), (405), (406), (407), (408), (409), (410), (411 ), (412), (413), (414), (415), (416), (417), (4 It has the structure shown in 18), (419), (420), (421), or (422).

[0246] [ka] JPEG0007872622000027.jpg186170JPEG0007872622000028.jpg184170JPEG0007872622000029.jpg173170 JPEG0007872622000030.jpg208170JPEG0007872622000031.jpg193170JPEG0007872622000032.jpg149170

[0247] In some embodiments, the P atom in formula A59 is a randomly selected atom in the siRNA sequence. It may be bonded to any possible position; for example, the P atom in formula A59 is of the siRNA. It may be bound to one nucleotide of either the sense strand or the antisense strand, and any number In that embodiment, the P atom in formula A59 is any one of the sense strands of the siRNA. In some embodiments, the P atom in formula A59 It is bound to the end of the sense or antisense strand of the siRNA, and in some embodiments In formula A59, the P atom is bound to the end of the sense strand of the siRNA. The part refers to the four nucleos in the sense chain or antisense chain from one end to the front. It refers to siRNA. In some embodiments, the P atom in formula A59 is the siRNA. Bonded to the end of an antisense chain or antisense chain, in some embodiments, formula A59 The P atom is attached to the 3' end of the sense strand of the siRNA. When bound to the above position, the siRNA complex represented by formula (308) enters the cell. After being inserted, when it is unwound, it releases the antisense strand of a single siRNA, KNG By blocking the process by which mRNA translates into protein, KNG gene expression can be suppressed. Cut.

[0248] In some embodiments, the P atom in formula A59 is a nucleus in siRNA. Any possible position on the ocide, for example, the 5' position of the nucleotide, the 2' position of the nucleotide, It may be attached to the 3' position of the nucleotide or to a base of the nucleotide. Several embodiments In this, the P atom in formula A59 forms a phosphate diester bond, thereby It may be bound to the 2', 3', or 5' position of the nucleotide in siRNA. In several embodiments, the P atom in formula A59 is the 3' end of the sense strand of the siRNA. The 3' hydroxyl group of the nucleotide is bonded to the oxygen atom from which it was dehydrogenated (at this time, A59 The P atom in this can also be considered as the P atom of the phosphate group contained in siRNA), or In formula A59, the P atom is one nucleotide in the sense strand of siRNA. '-By substituting a hydrogen in the hydroxyl group, it is bound to the nucleotide, or, formula A The P atom at 59 is the 5' hydroxyl group of the 5' terminal nucleotide of the sense strand of siRNA. It is bonded to a nucleotide by substituting a hydrogen atom in the group.

[0249] The inventors of this disclosure claim that the siRNA complex of this disclosure exhibits significantly improved stability in plasma and is off The target effect is reduced, and the KNG mRNA silencing activity is further enhanced. We unexpectedly discovered that in some embodiments, the siRNA of this disclosure is shown in Tables 1a-1. It may be one of the siRNAs shown in f. Multiple siRNAs including these siRNAs. The combination exhibits higher KNG mRNA silencing activity.

[0250] [Table 1a] JPEG0007872622000034.jpg229170 [Table 1b] JPEG0007872622000036.jpg226170 [Table 1c] JPEG0007872622000038.jpg228170 [Table 1d] JPEG0007872622000040.jpg229170 [Table 1e] JPEG0007872622000042.jpg230170 [Table 1f] JPEG0007872622000044.jpg227170 However, uppercase C, G, U, and A represent the base sequence of a nucleotide, and lowercase m represents the This indicates that the nucleotide adjacent to the left of the letter 'm' is a methoxy-modified nucleotide. Furthermore, the lowercase letter f is a fluoromodified nucleus, where one nucleotide adjacent to the left of the letter f is fluoromodified. The lowercase 's' indicates that there is a thiol between the two nucleotides to the left and right of the letter. This indicates that the molecules are bonded by an ester group, and P1 is the molecule adjacent to the right of P1. One nucleotide is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide. It indicates that it is a do. In some embodiments, P1 is a specific modifier of VP, Ps or represents P, and the combination character VP is one adjacent to the right of the combination character VP. The nucleotide is a vinyl phosphate ester (5'-(E)-vinylphosphonat e, E-VP) indicates a modified nucleotide, and the combination character Ps is the same combination character The nucleotide adjacent to the right of Ps is a thiophosphate-modified nucleotide. This indicates that the capital letter P is a nucleotide adjacent to the right of the letter P, specifically a 5'-phosphorus nucleotide. This indicates that it is an acid nucleotide.

[0251] In the siRNA or siRNA complex described in this disclosure, each adjacent nucleoti The bonds between the phosphates are connected by phosphate diester bonds or thiophosphate diester bonds, In a sterling bond or thiophosphate diester bond, the non-crosslinked oxygen or sulfur atom is negatively charged. It carries a charge and has a hydroxyl group or sulfhydryl group. They may exist as such, and the hydrogen ions in the hydroxyl group or sulfhydryl group may be partially or The entire molecule may be substituted with a cation. The cation is any cation, for example, a metal. Cation, ammonium ion NH4 + Even if it is one of the organic ammonium cations i. Considering the improvement of solubility, in some embodiments, the cation is alkali gold Ammonium cations and quaternary ammonium cations formed by group ions and tertiary amines. It is one or more types selected from thion. Alkali metal ions are K + and / or N a + It may also be the case that the cation formed by the tertiary amine is due to triethylamine The ammonium ions formed by and / or N,N-diisopropylethylamine The ammonium ions formed by this disclosure may also be sigma. RNA or siRNA complexes may exist as salts, at least partially. In this embodiment, non-crosslinking occurs in the phosphate diester bond or thiophosphate diester bond. An oxygen atom or a sulfur atom is at least partially bonded to a sodium ion as described in this disclosure. The prepared siRNA or siRNA complex exists as a sodium salt or a partial sodium salt. To exist.

[0252] As will be obvious to those skilled in the art, nucleoside monomas having the corresponding modifications By using -, modified nucleotide groups can be introduced into the siRNA described in this disclosure. This can be done. A method for preparing nucleoside monomers having the corresponding modifications, and modified nucleos Methods for introducing rheotide groups into siRNA are also well known to those skilled in the art. Rheoside monomers may be purchased commercially or prepared by known methods. stomach.

[0253] <Preparation of the siRNA complex shown in formula (308)> Even if the siRNA complex shown in formula (308) is prepared by any reasonable synthetic route, good.

[0254] In some embodiments, the siRNA complex represented by formula (308) is as follows: It can be prepared by the method. This method is performed under the conditions of phosphoramidite solid-phase synthesis. Depending on the nucleotide types and order of the sense and antisense strands of each siRNA, 3' Nucleoside monomers are sequentially bonded from the 5' end, and the bonding of each nucleoside monomer... This involves four reactions: deprotection, coupling, capping, oxidation, or sulfidation, and siRNA The process includes isolating the sense strand and antisense strand of the siRNA and annealing them, wherein the siRNA is , the siRNA of the present disclosure described above.

[0255] Furthermore, this method, under coupling reaction conditions and in the presence of a coupling reagent, is performed using formula (32 1) The compound shown in 1) is bound to a nucleoside monomer or a nucleotide on a solid support. The sequence is brought into contact with the compound shown in formula (321) and coupled to form a nucleotide. This further includes binding to the sequence. Below, the compound shown in formula (321) is a complex molecule. It is also called [another name].

[0256] [ka] During the ceremony, R4 can bind to the siRNA represented by Nu in the compound shown in formula (308). It is a group. In some embodiments, R4 is a si represented by covalent bonding to Nu. It is a group that can bind to RNA. In some embodiments, R4 reacts to form a phosphate group. It is a group that can be compounded with any functional group of siRNA represented by Nu via a diester bond. In each S1, all active hydroxyl groups in M1 are independently replaced with YCOO- groups. The group is a methyl group, trifluoromethyl group, difluoromethyl group, fluoromethyl group, and fluoromethyl group. Tyl group, trichloromethyl group, dichloromethyl group, chloromethyl group, ethyl group, n-pro Independently of pyr group, isopropyl group, phenyl group, halophenyl group and alkylphenyl group One of the selected elements is a methyl group, and in some embodiments, Y is a methyl group.

[0257] n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , The definitions and selectable ranges for L1 and M1 are as described above.

[0258] R4 forms a bond with the N atom on the nitrogen-containing skeleton, resulting in the siRN shown in formula (308). Selected to provide a suitable reaction site for the synthesis of complex A. And R4 is either an R2 linker group or a protected R2 linker group, and reacts It contains functional groups that can form the structure shown in siRNA and A59.

[0259] In some embodiments, R4 is represented by Nu, which is an siRNA or nucleoside. A first functional group that can form a phosphite ester with a group on the nomer, and a hydroxyl group Alternatively, a second functional group that can react with an amino group to form a covalent bond or the covalent bond It includes a solid support bonded by bonding. In some embodiments, the first functional group These are phosphoramidites, hydroxyl groups, or protected hydroxyl groups. In embodiments, the second functional group is a phosphoramidite, a carboxyl group, or a carbo It is a phosphate salt. In some embodiments, the second functional group is separated by a covalent bond. A solid support bonded to the rest of the child, wherein the covalent bond is a hydroxyl group or an amino group It is formed by phosphate ester. In some embodiments, the solid phase support is phosphate ester They are bonded via carboxylic acid ester bonds or amide bonds. Several implementations In terms of form, the solid-phase carrier is a resin.

[0260] In some embodiments, the first functional group is a hydroxyl group, -OR k or formula ( The group is represented by C3), and the second functional group is represented by formula (C1), (C2), (C3), ( Includes the structure shown in C1' or (C3').

[0261] [ka] In the formula, q1 is an integer from 1 to 4, X is O or NH, and M + R is a cation, k is a hydroxy protecting group, and SPS represents a solid support. JPEG0007872622000047.jpg5170 represents the site where groups are covalently bonded.

[0262] In some embodiments, the first functional group is as shown in formula (C3), It contains a foramidite group, and the phosphoramidite group is at any position on the nucleotide Coupling with a hydroxyl group, for example, a hydroxyl group at the 2' position or a hydroxyl group at the 3' position. The reaction forms a phosphite ester, which is then oxidized or sulfurized to form a phosphate diphosphate represented by formula A59. By forming an ester bond or thiophosphate ester bond, the complex molecule can be combined with siRNA. This can be done. In this case, even if the second functional group is not present, the chemical shown in formula (321) can be formed. The compound can be complexed with nucleotides, forming an siRNA complex represented by formula (308). This will not affect the acquisition of [the substance]. In this case, by methods such as phosphoramidite solid-phase synthesis, After obtaining the sense strand or antisense strand of the siRNA, the compound shown in formula (321) is used, The hydroxyl group on the terminal nucleotide in the nucleotide sequence reacts, and subsequent oxidation or During the sulfurization process, a bond is formed by a phosphate diester bond or a thiophosphate ester bond. The compound shown in formula (321) is conjugated onto the siRNA.

[0263] In some embodiments, the first functional group comprises a protected hydroxyl group. In some embodiments, the second functional group includes a group that can react with a solid support, and The reaction provides a composite molecule containing a solid support. In some embodiments, the The functional group of 2 is a carboxyl group, as shown in formula (C1), (C2), or (C3). The second functional group is a carboxyl group or a carboxyl group. If a sodium chloride is included, the compound shown in formula (321) and the solid support, for example, the resin, A hydroxyl group or amino group is subjected to an esterification or amidation reaction, forming a carboxylic acid ester compound. The bonding forms a composite molecule including a solid support. The second functional group is phosphor If it contains an amidite functional group, the compound shown in formula (321) and a general-purpose solid support, for example The hydroxyl groups in the resin undergo a coupling reaction and are oxidized to form phosphate diester bonds. A composite molecule containing a solid support is formed by bonding. Subsequently, the solid support is bonded Starting with the resulting product, the nucleoside monomer was synthesized according to the phosphoramidite solid-phase synthesis method. The complex groups are bound sequentially to obtain a sense or antisense strand of siRNA. In the solid-phase synthesis process of foramidite, the first functional group is deprotected, and then cut Under pulling reaction conditions, the phosphoramidite group in the nucleoside monomer couples. Let it happen.

[0264] In some embodiments, the first functional group is a hydroxyl group or a protected hydroxyl group The roxy group is included, and the second functional group is as shown in formula (C1') or (C3'), Solid support bonded by carboxylic acid ester bonds or solid phase bonded by amide bonds It includes a carrier, or a solid-phase carrier bonded by phosphate ester bonds. In this case, as Using the compound shown in formula (321) instead of a solid support, phosphoramidite solid-phase synthesis Nucleoside monomers are sequentially bonded according to the method, and the sense of the siRNA to which the complex group is attached. Obtain a chain or antisense chain.

[0265] In some embodiments, the carboxylate salt is -COO - M + It may also be expressed as this, Here, M + These are cations, such as metal cations and ammonium cations (NH4). + , It is one selected from organic ammonium cations. In one embodiment, the gold The group ion is one selected from alkali metal ions, for example, K + or Na + in Yes. In some embodiments, taking into consideration the need to improve solubility and facilitate the reaction, In this case, the organic ammonium ion is formed by tertiary amines, ammonium catio Ammonia formed by a quaternary ammonium cation, such as triethylamine. Ammonium ions formed by ammonium ions or N,N-diisopropylethylamine In some embodiments, the carboxylate salt is triethylaminecarboxylic acid. It is a salt or an N,N-diisopropylethylamine carboxylate salt.

[0266] In some embodiments, R4 is derived from formulas (B9), (B10), (B9'), and (B1 Includes the structure shown in (0'), (B11), (B12), (B11'), or (B12'). .

[0267] [ka] In the formula, q1 is an integer between 1 and 4, q2 is an integer between 1 and 10, and X is either O or NH. Ri, M +R is a cation, k is a hydroxy protecting group, and SPS represents a solid support. JPEG0007872622000049.jpg5170 represents a site where the group is covalently bonded. In some embodiments, q1 is 1 or It is 2. In some embodiments, q2 is an integer from 1 to 5. In this state, R4 includes the structure shown in formula (B9) or (B10). Several implementations In terms of form, R4 includes the structure shown in formula (B11) or (B12).

[0268] In some embodiments, R k This is Tr (trityl group), MMTr (4-methoxy Trityl group), DMTr (4,4'-bismethoxytrityl group), TMTr (4,4', It is one or more 4''-trimethoxytrityl groups. In some embodiments, R k This is DMTr, i.e., 4,4'-bismethoxytrityl(4,4'-dimetho (xytrityl) is also acceptable.

[0269] The definition of L1 is as described above.

[0270] In some embodiments, L1 bonds the M1 target group to the N atom on the nitrogen-containing skeleton. It is used to provide liver targeting function to the siRNA complex shown in formula (308). In some embodiments, L1 includes one of A1 to A26 or a combination thereof. nothing.

[0271] As can be easily understood by those skilled in the art from the above description, phosphorus known in the art Compared to the midite solid-phase synthesis method, the above first functional group and an arbitrary second functional group allow for multiple synthesis. The compound molecule can be placed at any possible position in the nucleotide sequence, for example, at the ends of the nucleotide sequence. Obtain an siRNA complex represented by formula (308) bound to the end of a rheotide sequence. This is possible. Accordingly, unless otherwise specified, the following refers to siRNA complexes and / or compound complexes. In descriptions concerning the preparation of molecules, the terms "deprotection," "coupling," and "capping" are used. When referring to reactions such as "oxidation" and "sulfidation," the phosphoramidite nucleic acids known in this field... The reaction conditions and reagents related to solid-phase synthesis methods should also be understood to apply to these reactions. The exemplary reaction conditions and reagents are described in detail below.

[0272] In some embodiments, each S1 is independently M1. In each S1, at least one active hydroxyl group is present in M1. It is a group protected by a protective group. In some embodiments, each S1 is independently M1 All of the active hydroxyl groups present are protected by hydroxyl protecting groups. In embodiments, any hydroxy protecting group known to those skilled in the art is used to activate the hydroxyl group at M1. It can be used to protect the roxy group. In some embodiments, it is protected. The hydroxyl group may also be represented by the formula YCOO-, where each Y is independently C1-C 10 Al Kill group and C6-C 10 Selected from the group consisting of aryl groups, the C1-C 10 Alkyl Base and C6-C 10 The aryl group is optionally substituted with one or more substituents, and the substituents are Selected from the group consisting of halogens and C1-C6 alkyl groups. In some embodiments In this structure, each Y independently comprises a methyl group, a trifluoromethyl group, a difluoromethyl group, and a mo Nofluoromethyl group, trichloromethyl group, dichloromethyl group, chloromethyl group, ethyl Groups, n-propyl groups, isopropyl groups, phenyl groups, halophenyl groups and C1-C6 groups Selected from the group consisting of chylphenyl groups.

[0273] In some embodiments, each S1 independently consists of formulas A46 to A54. Selected from the group.

[0274] [ka]

[0275] In some embodiments, S1 is formula A49 or A50.

[0276] In some embodiments, each Y is a methyl group, a trifluoromethyl group, a difluoromethyl group. Methyl group, fluoromethyl group, trichloromethyl group, dichloromethyl group, chloromethyl group ethyl group, n-propyl group, isopropyl group, phenyl group, halophenyl group and alkyl One independently selected from the phenyl group, and in some embodiments, Y is me It is a chill group.

[0277] As mentioned above, the method for preparing the siRNA complex shown in formula (308) is as follows: Synthesize the other chain (for example, the sense chain of the siRNA to which the complex molecule was attached in the above step). When synthesizing, further synthesize the siRNA antisense strand according to the solid-phase synthesis method. (Included in, and vice versa), isolate the sense strand and antisense strand, and anneal them. The process further includes the following steps: Specifically, in the isolation step, the nucleotide sequence and / or The solid support bonded to the composite molecule is cleaved, and the necessary protecting groups are removed (at this point In combination, each S1 group in the compound shown in formula (321) is converted to the corresponding M1 target group. (,) the sense strand (or antisense strand) of the siRNA to which the complex molecule is bound and the corresponding An antisense chain (or sense chain) is obtained, and the sense chain and antisense chain are annealed to form two This forms a main-stranded RNA structure and yields the siRNA complex shown in formula (308).

[0278] In some embodiments, the method for preparing the siRNA complex shown in formula (308) Under coupling reaction conditions and in the presence of a coupling reagent, the compound represented by formula (321) The substance is brought into contact with the first nucleoside monomer at the 3' end of the sense chain or antisense chain. The compound shown in formula (321) is attached to the first nucleotide in the sequence, and a phosphorus is formed. Under the conditions of ruamidite solid-phase synthesis, seed nucleotides of the desired sense or antisense strand are obtained. Depending on the class and order, nucleoside monomers are bonded sequentially from 3' to 5', forming siRN A step of synthesizing a sense chain or antisense chain of A, wherein the chemical shown in formula (321) The substance has a first functional group containing a protected hydroxyl group in R4, and formula (C1') or (C A compound containing a second functional group having the structure shown in 3'), and the first nucleo Before bonding with the side monomer, the compound shown in formula (321) is deprotected, and each nucleocy The bond of the monomer undergoes one of four reactions: deprotection, coupling, capping, oxidation, or sulfidation. A process to obtain a sense strand or antisense strand of nucleic acid to which a complex group is attached; phosphoramine Under the conditions of Dyte solid-phase synthesis, the type and order of nucleotides in the antisense or sense strands Then, nucleoside monomers are sequentially bonded from 3' to 5', forming the antisense strand of the nucleic acid. Alternatively, sense chains are synthesized, and the bonds of each nucleoside monomer are deprotected, coupled, and capped. The reaction involves four steps: ping, oxidation, or sulfurization. The protecting group is removed, the material is cleaved from the solid support, and then isolated. The process includes purifying the material to obtain sense and antisense chains, followed by annealing.

[0279] In some embodiments, the method for preparing the siRNA complex shown in formula (308) , the type and order of nucleotides in the sense strand or antisense strand of the double-stranded siRNA. In order, nucleoside monomers are bonded sequentially from 3' to 5', and the sense chain and A The nucleosine chain is synthesized, and the bonds of each nucleoside monomer undergo deprotection, coupling, and capping. The process involves four reactions: ping, oxidation, or sulfurization, and includes a sense chain bonded to a solid support, and the solid support Steps to obtain an antisense chain bound to a body; coupling reaction conditions and coupling reagents In the presence of the compound shown in formula (321), the sense chain or solid phase bonded to the solid support The antisense chain bound to the support is brought into contact with the first phosphoramidite group at R4. A compound represented by formula (321) containing a functional group is bonded to a sense chain or an antisense chain. Then, the protecting group is removed and the compound group is cleaved from the solid support, isolated and purified, and the complex group is attached to s The process includes obtaining a sense strand or antisense strand of iRNA and performing annealing.

[0280] In some embodiments, the P atom in formula A59 is a sense atom in siRNA. The method for preparing the siRNA complex shown in formula (308), which is bound to the 3' end of the chain, is as follows: (1) The compound shown in formula (321) (The compound shown in formula (321) is stored in R4. Protected hydroxyl group OR k A first functional group including and shown in formula (C1') or (C3') (A compound containing a second functional group having the structure in which the hydroxyprotecting group R k Remove the deprotected product under coupling reaction conditions and in the presence of the coupling reagent. A substance is brought into contact with a nucleoside monomer, and the nucleoside is bonded to a solid support by a composite molecule. To obtain a monomer, (2) Starting with a nucleoside monomer that is bonded to a solid support by the composite molecule, 3 The sense strand of siRNA was synthesized in the '-5' direction using a phosphoramidite solid-phase synthesis method. to do, (3) Synthesize the antisense chain of siRNA by a phosphoramidite solid-phase synthesis method. to (4) The sense strand and antisense strand of the siRNA are isolated and annealed, and formula (308) This includes obtaining the siRNA complex shown in [reference].

[0281] In step (1), the protecting group R in the compound represented by formula (321) above k Remove The method involves contacting the compound shown in formula (321) with a deprotection reagent under deprotection conditions. This includes. The deprotection conditions are a temperature of 0-50°C, and in some embodiments, 15-35°C. The reaction time is 30 to 300 seconds, and in some embodiments, 50 to 150 seconds, and the deprotection test The drug is selected from trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid. It may be one or more species, and in some embodiments, it is dichloroacetic acid. Deprotection reagent The molar ratio of the compound shown in equation (321) is 10:1 to 1000:1, and several In this embodiment, the ratio is 50:1 to 500:1.

[0282] The coupling reaction conditions and coupling reagents are selected to be suitable for the above coupling reaction. Any conditions and reagents may be used. In some embodiments, a solid-phase synthesis method is employed. The same conditions and reagents as in the coupling reaction may be used.

[0283] In some embodiments, the conditions for the coupling reaction are such that the reaction temperature is 0 to 50°C. In some embodiments, the temperature is 15 to 35°C. The compound shown in formula (321) and the nucleate The molar ratio with osid monomer is 1:1 to 1:50, and in some embodiments it is 1:2 to The ratio is 1:5. The molar ratio of the compound shown in formula (321) to the coupling reagent is 1:1~ The reaction time may be 1:50, and in some embodiments it is 1:3 to 1:10, and the reaction time Coupling: 200-3000 seconds, and in some embodiments, 500-1500 seconds. The reagents are 1H-tetrazole, 5-ethylthio-1H-tetrazole, and 5-benzylthio-1H-tetrazole. One or more selected from H-tetrazoles, and in some embodiments, 5-E This is tilthio-1H-tetrazole. The coupling reaction may be carried out with an organic solvent. The organic solvent is selected from anhydrous acetonitrile, anhydrous DMF, and anhydrous dichloromethane. It is one or more types, and in some embodiments it is anhydrous acetonitrile. Formula (3 For the compounds shown in 21), the dose of the organic solvent is 3 to 50 L / mol, several In this embodiment, the concentration is 5 to 20 L / mol.

[0284] In step (2), the phosphoramidite nucleic acid prepared in the above step is synthesized by a solid-phase synthesis method. Starting with a nucleoside monomer bonded to a solid support by a composite molecule, 3'-5' In this direction, the sense strand SS of the second siRNA complex is synthesized. In this case, the complex group is obtained It is attached to the 3' end of the sense strand.

[0285] Other conditions for the solid-phase synthesis in steps (2) and (3) include the removal of nucleoside monomers. Protection conditions, type and dosage of deprotection reagent, coupling reaction conditions, type of coupling reagent and Dosage, conditions for the capping reaction, type and dosage of the capping reagent, conditions for the oxidation reaction, oxidation This includes the types and amounts of reagents, the sulfurization reaction conditions, and the types and amounts of sulfurizing reagents commonly used in this field. Various reagents, dosages, and conditions are used.

[0286] For example, in some embodiments, in steps (2) and (3), the solid-phase synthesis Then, the following conditions may be used.

[0287] The deprotection conditions for nucleoside monomers are a temperature of 0-50°C, and in some embodiments, 1 The temperature is 5-35°C, and the reaction time is 30-300 seconds, or 50-150 seconds in some embodiments. The deprotection reagents are trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid. It may be one or more selected from, and in some embodiments, dichloroacetic acid Yes. The molar ratio of the deprotection reagent to the 4,4'-dimethoxytrityl protecting group in the solid support is The ratio may be 2:1 to 100:1, and in some embodiments it is 3:1 to 50:1.

[0288] The coupling reaction conditions are a temperature of 0-50°C, and in some embodiments, 15-35°C. Yes, the molar ratio of the nucleic acid sequence bound to the solid support to the nucleoside monomer is 1:1 to 1: It may be 50, and in some embodiments it is 1:5 to 1:15, and is bonded to the solid support. The molar ratio of the nucleic acid sequence to the coupling reagent is 1:1 to 1:100, and several implementations In this state, the reaction time is 1:50 to 1:80, and the reaction time and selection of coupling reagents are the same as described above. be.

[0289] The capping reaction conditions are a temperature of 0-50°C, and in some embodiments, 15-35°C. Yes, the reaction time is 5 to 500 seconds, and in some embodiments it is 10 to 100 seconds, and the catch The selection of the capping reagent is the same as described above. The total amount of capping reagent and the amount bound to the solid support. The molar ratio of the nucleic acid sequence is 1:100 to 100:1, and in some embodiments, 1:10 to 1 The ratio is 0:1. Equimolar amounts of anhydride acetate and N-methylimidazole are used as the capping reagent. When using acetic anhydride, N-methylimidazole, and nucleic acid sequence bound to the solid support The molar ratio may be 1:1:10 to 10:10:1, and in some embodiments it is 1:1 The ratio is 2~2:2:1.

[0290] The conditions for the oxidation reaction are a temperature of 0-50°C, and in some embodiments, 15-35°C. The reaction time is 1 to 100 seconds, and in some embodiments, 5 to 50 seconds, and the oxidizing reagent is... In some embodiments, it is iodine (provided as iodine water in some embodiments). The molar ratio of the oxidizing reagent to the nucleic acid sequence bound to the solid support in the coupling step is 1 The ratio may be 1 to 100:1, and in some embodiments it is 5 to 50:1. In some embodiments, the oxidation reaction is carried out using tetrahydrofuran:water:pyridine = 3:1: The reaction is carried out using a mixed solvent of 1 to 1:1:3. The sulfurization reaction conditions are a temperature of 0 to 50°C, and several In some embodiments, the temperature is 15-35°C, the reaction time is 50-2000 seconds, and in some embodiments... The time is 100 to 1000 seconds, and the sulfiding reagent is xanthan hydride in some embodiments. The ratio of the sulfurizing reagent to the nucleic acid sequence bonded to the solid support in the coupling step is as follows: The ratio is 10:1 to 1000:1, and in some embodiments it is 10:1 to 500:1. In some embodiments, the sulfurization reaction is carried out in a ratio of acetonitrile:pyridine = 1:3~3 This is done using a mixed solvent of :1.

[0291] After all nucleoside monomers have been bonded, and before annealing, the method involves siRN The method further includes isolating the sense and antisense strands of A. The isolation method is publicly known to those skilled in the art. It is a known process, and generally, it involves cleaving a synthesized nucleotide sequence from a solid support, and then, on the base, phosphorus... This involves removing protecting groups from acid groups and ligands, purifying the product, and desalting it.

[0292] The synthesized nucleotide sequence is cleaved from the solid support, and then cleaved at the base, phosphate group, and ligand. The protecting group above is removed by the usual cleavage and deprotection methods used in siRNA synthesis. For example, the nucleotide sequence to which the obtained solid support is bound can be measured in concentrated ammonia water. In contact with the hydroxyl group, the protecting group YCOO- of the A46-A54 group is removed during the deprotection process. The S1 group is converted to the corresponding M1 group, and the siRNA compound shown in formula (308) is obtained. A compound is formed. Here, the concentrated ammonia water is 25-30% by weight ammonia water. However, the dosage of concentrated ammonia water is 0.2 ml / of the target siRNA sequence. The concentration may be μmol to 0.8 ml / μmol.

[0293] If the synthesized nucleotide sequence has at least one 2'-TBDMS protection, then The notation method involves recording the nucleotide sequence from which the solid support has been removed using triethylamine hydrofluoric acid. This further includes removing the 2'-TBDMS protection by bringing it into contact with the In this case, the corresponding nucleotide in the obtained target siRNA sequence contains two free nucleotides. It has a hydroxyl group. The dose of pure triethylamine hydrofluoric acid is intended and For the siRNA sequence, a concentration of 0.4 ml / μmol to 1.0 ml / μmol is acceptable. i. Thus, an siRNA complex represented by formula (308) can be obtained.

[0294] Methods of purification and desalting are well known to those skilled in the art. For example, preparative ion chromatography Nucleic acid purification is performed by gradient elution of NaBr or NaCl using a Graphy purification column. After completing the process and collecting and combining the products, desalting is performed using a reverse-phase chromatography purification column. It is possible.

[0295] In the siRNA complex shown in formula (308) obtained in this way, nucleotides Non-crosslinked oxygen atoms or sulfur in the phosphate diester bond or thiophosphate diester bond between them. The yellow atoms are basically bonded to sodium ions, as shown in formula (308) siR The NA complex basically exists as a sodium salt. By well known ion exchange methods... or, the sodium ion is replaced with a hydrogen ion and / or other cation, and other forms of formula An siRNA complex shown in (308) can be obtained. The cation is as described above. That is correct.

[0296] During the synthesis process, the purity and molecular weight of the nucleic acid sequence are constantly detected to better control the synthesis quality. Such detection methods are known to those skilled in the art. For example, ion exchange chromatography Nucleic acid purity is detected by matrixing, and liquid chromatography-tandem mass spectrometry (L) is performed. Molecular weight can be measured by C-MS.

[0297] The annealing method is also well known to those skilled in the art. For example, a easily synthesized annealing Mix the S chain and antisense chain (AS chain) in equimolar ratios with sterile water for injection and use 70-95 By heating to °C and then cooling to room temperature, a double-chain structure can be formed through hydrogen bonding. Thus, an siRNA complex represented by formula (308) can be obtained.

[0298] After obtaining the siRNA complex, in some embodiments, for example, liquid chromatography Formula (30) was synthesized by molecular weight detection using methods such as graphi-tandem mass spectrometry. The characteristics of the siRNA complex shown in 8) were clarified, and the synthesized siRNA complex was The siRNA complex shown in the target design formula (308), as well as the synthesized siR Confirm that the NA sequence is one of the desired siRNA sequences, for example, one of the sequences shown in Table 1. It is also possible.

[0299] The compound shown in formula (321) reacts in organic solvents under esterification conditions and in base And in the presence of an esterification catalyst, the compound shown in formula (313) is brought into contact with a cyclic acid anhydride. A preparation method comprising ion exchange and isolation to obtain a compound shown in formula (321). It can be obtained by doing so.

[0300] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15, L 1、 The definitions and selectable ranges for each S1 are as described above. R6 is the group that provides R4 in formula (321). In some embodiments, R6 has the structure shown in formula (A61).

[0301] [ka] In the formula, R i This enables bonding with N atoms on the nitrogen-containing skeleton, R k It combines with O to form one Any group to which the free hydroxyl group is attached, R k This is a hydroxy protecting group. In this case, R4 includes a first functional group and a second functional group as hydroxy protecting groups, and the above The second functional group is a structure represented by formula (321) which includes the structure represented by formula (C1) or (C2). A mixed product can be obtained.

[0302] The esterification reaction conditions are a reaction temperature of 0 to 100°C and a reaction time of 8 to 48 hours. In some embodiments, the esterification reaction conditions are such that the reaction temperature is 10-4 The temperature is 0°C, and the reaction time is 20-30 hours.

[0303] In some embodiments, the organic solvent is an epoxy solvent, an ether solvent, etc. Alkyl chloroformides solvents, dimethyl sulfoxide, N,N-dimethylformamide and N , comprising one or more types of N-diisopropylethylamine. In some embodiments, The epoxy solvent is dioxane and / or tetrahydrofuran, and the The tert solvent is ethyl ether and / or methyl tert-butyl ether, and the above Alkyl halogenated solvents include dichloromethane, trichloromethane, and 1,2-dichloro It is one or more types of ethane. In some embodiments, the organic solvent is dichloro It is lomethane. For the compound shown in formula (313), the amount of the organic solvent is 3 The concentration is approximately 50 L / mol, and in some embodiments, it is 5 to 20 L / mol.

[0304] In some embodiments, the cyclic acid anhydride is succinic acid anhydride, glutaric acid anhydride. It is one of the substances, adipic anhydride, or pimeric acid anhydride, and in some embodiments , succinic anhydride. The cyclic acid anhydride and the compound represented by formula (313) The ratio is 1:1 to 10:1, and in some embodiments, it is 2:1 to 5:1.

[0305] The esterification catalyst may be any catalyst that catalyzes the esterification reaction, for example. For example, the catalyst may be 4-dimethylaminopyridine. The catalyst and formula (313 The molar ratio with the compound shown in ) is 1:1 to 10:1, and in some embodiments The ratio is 2:1 to 5:1.

[0306] In some embodiments, the base is any inorganic base, organic base, or combination thereof. They may be combined. Considering solubility and product stability, the base may be, for example, the It may be a tertiary amine. In some embodiments, the tertiary amine is a tri- It is ethylamine or N,N-diisopropylethylamine. The above tertiary amine and formula (3 The molar ratio with the compound shown in 13) is 1:1 to 20:1, and in some embodiments... And the ratio is 3:1 to 10:1.

[0307] The aforementioned ion exchange action involves transferring the compound shown in formula (321) to a desired carboxylic acid or carbo. This involves converting to an ion salt form, and the ion exchange method is known to those skilled in the art, and appropriate Using an on-exchange solution and exchange conditions, M + A complex molecule having a cation can be obtained, here I will omit the detailed explanation. In some embodiments, the ion exchange reaction is performed by Tri The procedure is carried out using an ethylamine phosphate solution, and the concentration of the triethylamine phosphate solution is The concentration is 0.2 to 0.8 M, and in some embodiments, the triethylamine phosphate The concentration of the salt solution is 0.4 to 0.6 M, and for the compound shown in formula (313), the above The dose of the triethylamine phosphate solution is 3-6 L / mol, and in further embodiments... The concentration is 4-5 L / mol.

[0308] The compound shown in formula (321) was isolated from the reaction mixture by any suitable isolation method. This is possible. In some embodiments, after the solvent is evaporated and removed, chromatography is performed. The compound shown in formula (321) can be isolated by the Fee method, for example, (1) Normal-phase purified silica gel: 200-300 mesh silica gel packing material, 1 wt‰ triethyl Dichloromethane containing ruamine elutes at a gradient with methanol in a ratio of 100:18 to 100:20. (2) Reverse phase purification: C18, C8 reverse phase packing material, methanol:acetonitrile Under two chromatographic conditions, gradient elution is performed with a ratio of 0.1:1 to 1:0.1. It can be isolated. In some embodiments, the solvent can be directly removed to obtain formula (321). A crude product of the compound shown can be obtained, and this crude product can be used as is in subsequent reactions. It is possible.

[0309] In some embodiments, the method for preparing the compound shown in formula (321) involves a condensation reaction. Under these conditions, in an organic solvent, in the presence of a condensing agent, a condensing catalyst, and a tertiary amine, the above io The product obtained by the exchange reaction is further transported to a solid support containing an amino group or a hydroxyl group. This further includes bringing the two into contact. In this case, R4 includes the first functional group and the second functional group. The first functional group contains a hydroxy protecting group, and the second functional group has the structure shown in formula (C1'). A compound represented by formula (321) containing the compound is obtained.

[0310] The aforementioned solid-phase support is one of the supports used in the solid-phase synthesis of siRNA, and among them The details are known to those skilled in the art. For example, the solid support is an activated hydroxyl group or an amino A solid support containing functional groups may be selected, and in some embodiments, the solid support The body is an amino resin or a hydroxy resin. In some embodiments, the amino The resin or hydroxy resin has a particle size of 100 to 400 mesh, and on the surface The parameter for the amount of amino or hydroxyl group supported is 0.2 to 0.5 mmol / g. The dose ratio of the compound shown in formula (321) to the solid support is 10 to 400 μmol. The solid phase support is a compound per gram (μmol / g). In some embodiments, the above The dose ratio of the compound shown in formula (321) to the solid support is 50 to 200 μmol / g. .

[0311] The aforementioned organic solvent may be any suitable solvent or mixture known to those skilled in the art. In several embodiments, the organic solvent is acetonitrile, epoxy solvents, ether Solvents, alkyl halides, dimethyl sulfoxide, N,N-dimethylformaldehyde It is one or more of mido and N,N-diisopropylethylamine. Several implementations In form, the epoxy solvent is dioxane and / or tetrahydrofuran. The ether solvent is ethyl ether and / or methyl tert-butyl ether. Yes, the alkyl halogenated solvents are dichloromethane, trichloromethane and 1,2 - One or more types of dichloroethane. In some embodiments, the organic solvent This is acetonitrile. For the compound shown in formula (321), the use of the above organic solvent The volume is 20-200 L / mol, and in some embodiments, 50-100 L / m³. I am an office lady.

[0312] In some embodiments, the condensing agent is benzotriazole-1-yloxy Tripyrrolidino-phosphonium hexafluorophosphate / ester (benzotr iazol-1-yl-oxytripyrrolidino phosphonium hexafluorophosphate (PyBop), 3-diethoxyphosphoryl -1,2,3-Benzoxazole 4(3H)-one (3-(Diethoxyphos phoryloxy)-1,2,3-benzotriazin-4(3H)-one, DEPBT) and / or O-benzotriazole-tetramethyluronium hexafluor Lophosphate / ester (O-benzotriazol-1-yl-tetrame It may also be thyluronium hexafluorophosphate. In some embodiments, the condensing agent is O-benzotriazole-tetramethyl It is rhonium hexafluorophosphate / ester. The condensing agent is shown in formula (321). The molar ratio with the compound being used is 1:1 to 20:1, and in other embodiments it is 1:1 to 5: It is 1.

[0313] In some embodiments, the tertiary amine is triethylamine and / or N, It is N-diisopropylethylamine, and in some embodiments, N,N-diiso It is a propylethylamine, and is a compound of the tertiary amine and the compound shown in formula (321). The ratio is 1:1 to 20:1, and in some embodiments, it is 1:1 to 5:1.

[0314] In some embodiments, the method for preparing the compound represented by formula (321) is described as cappy Under the condensation reaction conditions, the obtained condensation product is treated with a capping reagent and an asphalt in an organic solvent. The process further includes contacting the compound with a ionization catalyst and isolating it to obtain the compound shown in formula (321). This is also acceptable. The effect of the capping reaction is that it prevents the formation of unwanted by-products in subsequent reactions. To avoid this, remove any active functional groups that have not yet fully reacted. Yes. The conditions for the capping reaction are that the reaction temperature is 0 to 50°C, and in some embodiments, The temperature is 15-35°C, and the reaction time is 1-10 hours, or 3-6 hours in some embodiments. As a capping reagent, a capping reagent known to those skilled in the art and used in siRNA solid-phase synthesis is used. A sizing agent may also be used.

[0315] In some embodiments, the capping reagent is capping reagent 1 (cap 1) consists of capping reagent 2 (cap2), and capping reagent 1 is N-methyl It is an imidazole, and in some embodiments, a pyridine of N-methylimidazole. / Provided as an acetonitrile mixed solution, with a volume ratio of pyridine to acetonitrile of 1: The ratio is 10 to 1:1, and in some embodiments, 1:3 to 1:1, with pyridine and The volume ratio of acetonitrile to N-methylimidazole is 1:1 to 10:1. In some embodiments, the ratio is 3:1 to 7:1. The capping reagent 2 is vinegar. It is an acid anhydride. In some embodiments, the capping reagent 2 is an acetic anhydride. It is provided as an acetonitrile solution, with a volume ratio of acetic anhydride to acetonitrile of 1:1 The ratio is approximately 1:10, and in further embodiments, it is 1:2 to 1:6.

[0316] In some embodiments, the pyridine / acetonite of the N-methylimidazole The ratio of the volume of the mixed solution to the mass of the compound shown in formula (321) is 5 ml / g to 50 ml. The concentration is / g, and in some embodiments it is 15 ml / g to 30 ml / g. The ratio of the volume of the acetonitrile solution of the substance to the mass of the compound shown in formula (321) is 0.5 m The concentration ranges from l / g to 10 ml / g, and in some embodiments, it ranges from 1 ml / g to 5 ml / g.

[0317] In some embodiments, the capping reagent consists of equimolar amounts of anhydride acetate and N2. -Methylimidazole is used. In some embodiments, the organic solvent is acetone. Nitriles, epoxy solvents, ether solvents, alkyl halogens, dimethyl sulfur One of the following: hooxide, N,N-dimethylformamide and N,N-diisopropylethylamine It is one or more species. In some embodiments, the organic solvent is acetonitrile. Yes. For the compound shown in formula (321), the amount of the organic solvent is 10 to 50 L / m³. In some embodiments, the concentration is 5 to 30 L / mol.

[0318] In some embodiments, the acylation catalyst undergoes esterification condensation or amidation condensation. Any catalyst that can be used may be selected, for example, from alkali heterocyclic compounds. In this embodiment, the acylation catalyst is 4-dimethylaminopyridine. The mass ratio of the catalyst to the compound shown in formula (321) is 0.001:1 to 1:1, and how many In that embodiment, the ratio is 0.01:1 to 0.1:1.

[0319] In some embodiments, the reaction mixture is isolated from formula (321) by any suitable isolation method. The compounds shown in ) can be isolated. In some embodiments, an organic solvent Wash thoroughly and filter to remove unreacted reactants, excess capping reagent, and other impurities. By doing so, the compound shown in formula (321) can be obtained. The organic solvent is Selected from acetonitrile, dichloromethane, and methanol, in some embodiments And it's acetonitrile.

[0320] In some embodiments, the method for preparing the complex molecule represented by formula (321) is an organic solvent In the agent, under coupling reaction conditions and in the presence of a coupling reagent, formula (313) The compound shown was contacted with phosphordiamidite, isolated, and chemically converted as shown in formula (321). This includes obtaining a compound. In this case, R4 contains a first functional group and a second functional group, and the first The functional group of the first is a hydroxy protecting group, and the second functional group is a formula containing the structure shown in formula (C3). The compound shown in (321) is obtained.

[0321] In some embodiments, the coupling reaction conditions are such that the temperature is 0 to 50°C. Often, for example, the temperature range is 15-35°C. The compound shown in formula (313) and phosphoridia The molar ratio of to may be 1:1 to 1:50, for example, 1:5 to 1:15, and the formula ( The molar ratio of the compound shown in 313) to the coupling reagent is 1:1 to 1:100. This is also common, for example, 1:50 to 1:80. The reaction time can also be 200 to 3000 seconds. For example, 500 to 1500 seconds. The phosphordiamidite is, for example, bis(di) Sopropylamino(2-cyanoethoxy)phosphine may also be used; purchase a commercially available product. It may be synthesized by methods known in the art. The coupling reagent is 1H -Tetrazole, 5-ethylthio-1H-tetrazol, 5-benzylthio-1H-tetrazo One or more selected from the following, for example, 5-ethylthio-1H-tetrazole The coupling reaction may be carried out in an organic solvent, and the organic solvent is anhydrous a One or more selected from cetonitrile, anhydrous DMF, and anhydrous dichloromethane. For example, anhydrous acetonitrile. In some embodiments, the formula (313) is For the compound, the amount of the organic solvent is 3 to 50 L / mol, for example, 5 to 20 The concentration may be L / mol. By carrying out this coupling reaction, the expression shown in formula (313) The hydroxyl group in the compound reacts with a phosphordiamidite to produce a phosphoramida A ion group is formed. In some embodiments, the solvent is directly removed to form the compound shown in formula (321). A crude product of the compound can be obtained, and this crude product can be used as is in subsequent reactions. It is possible.

[0322] In some embodiments, the method for preparing the compound represented by formula (321) is described as a cupping method. Under coupling reaction conditions, isolated in an organic solvent in the presence of a coupling reagent. The process further includes contacting the product with a hydroxyl group-containing solid support. A capping reaction and an oxidation reaction are performed, and the compound shown in formula (321) is isolated to obtain this In this case, R4 contains a first functional group and a second functional group, and the first functional group is a hydroxy protecting group. It contains and the second functional group has the structure shown in formula (321) as shown in formula (C3'). A mixed product can be obtained.

[0323] In some embodiments, the solid support is used in solid-phase nucleic acid synthesis known in the art. It is a solid phase support that can be used, for example, a commercially available general-purpose solid phase support that has undergone a deprotection reaction (NittoPh ase(registered trademark)HL UnyLinker TM 300 Oligonucleot ide Synthesis Support, Kinovate Life Science The structure may also be as shown in formula B80 (nces Inc.).

[0324] [ka]

[0325] The deprotection reaction is known to those skilled in the art. In some embodiments, the deprotection conditions are: The temperature range is 0-50°C, for example, 15-35°C, and the reaction time is 30-300 seconds, for example, 50- The time is 150 seconds. The deprotection reagents are trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and It may be one or more selected from loroacetic acid, and in some embodiments, The deprotection agent is dichloroacetic acid. The deprotection agent and the stationary phase are -DMTr(4,4' The molar ratio with the (dimethoxytrityl) protecting group is 2:1 to 100:1, for example, 3:1 to The ratio is 50:1. By performing the deprotection, the surface of the solid support has reactive activity. A free hydroxyl group is obtained, facilitating the subsequent coupling reaction.

[0326] The coupling reaction conditions and the selection of coupling reagents are as described above. By performing the pulling reaction, the free hydroxyl group formed in the deprotection reaction and the phosphorus The midite group reacts to form a phosphite ester bond.

[0327] In some embodiments, the capping reaction conditions are such that the temperature is 0 to 50°C, for example 1 The temperature is 5-35°C, the reaction time is 5-500 seconds, for example, 10-100 seconds, and the aforementioned cap The Ping reaction is performed in the presence of a capping reagent. The selection and dosage of the capping reagent are as follows: That is correct.

[0328] The conditions for the oxidation reaction may be a temperature of 0 to 50°C, for example, 15 to 35°C, and the reaction time This can be 1 to 100 seconds, for example, 5 to 50 seconds, and the oxidizing agent is, for example, iodine. It is also fine (provided as iodine water in some embodiments). In some embodiments, The molar ratio of the oxidizing reagent to the nucleic acid sequence bound to the solid support is 1:1 to 100:1, for example The ratio may be 5:1 to 50:1. In some embodiments, the oxidation reaction is performed by tetra This is done using a mixed solvent of lahydrofuran, water, and pyridine in a ratio of 3:1:1 to 1:1:3.

[0329] In some embodiments, R6 is one of the bases of formula B7 or B8.

[0330] [ka] In the formula, q 2、 R k The definition is as stated above.

[0331] In this case, the compound shown in formula (313) reacts in an organic solvent under amidation reaction conditions. And in the presence of an amidation reaction condensing agent and a tertiary amine, the compound shown in formula (314) is converted to formula Contact the compound shown in (A-1) or the compound shown in formula (A-2), and then isolate. It can be obtained by the following preparation method.

[0332] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , L1, S1, q2 and R k The definitions and selectable ranges for each are as described above. be.

[0333] The amidation reaction conditions are such that the reaction temperature is 0 to 100°C and the reaction time is 1 to 48 hours. It may be present, and in some embodiments, the amidation reaction conditions are such that the reaction temperature is 10-4 The temperature is 0°C, and the reaction time is 2 to 16 hours.

[0334] In some embodiments, the organic solvent is an alcohol solvent, an epoxy solvent, Ether solvents, alkyl halogen solvents, dimethyl sulfoxide, N,N-dimethyl It is one or more of formamide and N,N-diisopropylethylamine. In some embodiments, the ethanol solvent is methanol, ethanol, propano It is one or more types of , and in some embodiments, it is ethanol. In some embodiments, the xylic solvent is dioxane and / or tetrahydrofuran. The ether solvent is, in some embodiments, ethyl ether and / or It is methyl tert-butyl ether. The alkyl halogen solvents are several In the embodiment, dichloromethane, trichloromethane and 1,2-dichloroethane It is one or more types. In some embodiments, the organic solvent is dichloromethane. The amount of organic solvent is 3 to 50 L / mol for the compound shown in formula (314). In further embodiments, the concentration is 3 to 20 L / mol.

[0335] In some embodiments, the amidation reaction condensation agent is benzotriazole-1- Il-oxytripyrrolidino-phosphonium hexafluorophosphate / ester, 3 -diethoxyphosphoryl-1,2,3-benzoxazole 4(3H)-one, 4-(4 ,6-dimethoxytriazine-2-yl)-4-methylmorpholine hydrochloride (4-(4,6 -dimethoxytriazin-2-yl)-4-methylmorpholi (1,2 hydrochloride), 2-ethoxy-1-ethoxycarbonyl-1,2 -Dihydroquinoline (EEDQ) or O-benzotriazole-tetramethyluronium Hexafluorophosphate / ester, and in further embodiments, 3-diethoxy It is cyphosphoryl-1,2,3-benzoxazole 4(3H)-one. The amidation The molar ratio of the reaction condenser to the compound shown in formula (314) may be 1:1 to 10:1. In some embodiments, the ratio is 2.5:1 to 5:1.

[0336] In some embodiments, the tertiary amine is triethylamine or N,N-di It is isopropylethylamine, and in further embodiments, N,N-diisopropyl ethylamine It is a thylamine. The molar ratio of the tertiary amine to the compound shown in formula (314) is 3: The ratio is 1 to 20:1, and in some embodiments, it is 5 to 10:1.

[0337] In some embodiments, the compounds represented by formulas (A-1) and (A-2) are, It may be prepared by a suitable method of the intent. For example, R k If it is a DMTr group, glycer The compound shown in formula (A-1) is prepared by reacting calcium phosphate with DMTrCl. Similarly, 3-amino-1,2-propanediol and a cyclic acid anhydride can be brought into contact. After that, it can be reacted with DMTrCl to prepare the compound shown in formula (A-2). The cyclic acid anhydride has 4 to 13 carbon atoms, and in some embodiments, 4 to 8 carbon atoms. It may also be an acid anhydride. As can be easily understood by those skilled in the art, the cyclic acid anhydride The selection corresponds to different values ​​of q2 in the compounds shown in (A-2), for example, If the cyclic acid anhydride is succinic acid anhydride, then q2 = 1, and the cyclic acid anhydride is If it is taric anhydride, then q2=2, and this can be inferred by analogy.

[0338] In some variations, the compound shown in formula (314) is the cyclic acid anhydride, 3- By reacting amino-1,2-propanediol and DMTrCl in sequence, the formula ( The compounds shown in 313) can also be prepared. This will be easily understood by those skilled in the art. Therefore, these deformations affect the structure and function of the compound shown in formula (313). It is free from [unspecified problem] and can be easily realized by a person skilled in the art using the above method.

[0339] Similarly, the chemical shown in formula (313) is obtained from the reaction mixture by any suitable isolation method. The mixture can be isolated. In some embodiments, after the solvent is evaporated and removed, The compound shown in formula (313) can be isolated by chromatography, for example (1) Normal-phase purified silica gel: 200-300 mesh silica gel packing material, petroleum -ethyl acetate:dichloromethane:N,N-dimethylformamide = 1:1:1:0 Gradient elution should be performed at 0.5~1:1:1:0.6, and (2) Reverse-phase purification: C18, C8 reverse The phase packing material should be eluted using a gradient elution ratio of methanol:acetonitrile = 0.1:1 to 1:0.1. It can be isolated using the following two chromatographic conditions. In some embodiments... By directly removing the solvent, a crude product of the compound shown in formula (313) can be obtained. The crude product can be used directly in subsequent reactions.

[0340] In some embodiments, the compound represented by formula (314) is used in organic solvents. Under condensation reaction conditions in the presence of an amidation reaction coupling agent and a tertiary amine, the reaction shown in formula (320) A preparation method comprising contacting a compound with a compound represented by formula (316) and then isolating it. It can be obtained by law.

[0341] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R13 , R 14 , R 15 The definitions and selectable ranges for each are as described above.

[0342] Examples of compounds represented by formula (316) include those from J. Am. Chem. Soc. Compounds disclosed in 2014, 136, 16958-16961 may be used, or For example, the compound represented by formula (316) can be prepared by various methods by those skilled in the art. For example, see the method disclosed in Example 1 of U.S. Patent US 8,106,022 B2. Several compounds represented by formula (316) can be prepared, and by reference the above statement All the contents of the references are incorporated into this specification as a whole.

[0343] In some embodiments, the condensation reaction conditions are such that the reaction temperature is 0 to 100°C. The reaction time is 0.1 to 24 hours, and in some embodiments, the reaction temperature is 10 to 40°C. The reaction time is 0.5 to 16 hours.

[0344] Considering the structure of the compound shown in formula (314), which is the desired product, the above formula (31 6) The molar ratio of the compound shown in formula (320) to the compound shown in formula (320) is given by formula (320) It should be determined based on the sum of n1 and n3 in the given form. In some embodiments, For example, in the case of n1 + n3 = 3, to ensure that the reaction is complete and not in excess, The molar ratio of the compound shown in formula (316) to the compound shown in formula (320) is 3 :1~3.5:1 may also be the case, and in some embodiments, 3.01:1~3.1 The ratio is 5:1.

[0345] In some embodiments, the organic solvent is acetonitrile, epoxy solvents, etc. methyl solvents, alkyl halogens, dimethyl sulfoxide, N,N-dimethyl hydroxypropyl alcohol The epoxy is one or more of the following: lumamide and N,N-diisopropylethylamine. In some embodiments, the xylic solvent is dioxane and / or tetrahydrofuran. The ether solvent is, in some embodiments, ethyl ether and / or It is methyl tert-butyl ether, and the alkyl halogen solvent is several In the embodiment, dichloromethane, trichloromethane and 1,2-dichloroethane There may be one or more types, and in some embodiments, the organic solvent is dichloromethane. The amount of the organic solvent for the compound shown in formula (320) is 3 to 50 L / m³. It is ol, and in some embodiments, it is 5 to 20 L / mol.

[0346] In some embodiments, the amidation reaction condensation agent is benzotriazole-1- Il-oxytripyrrolidino-phosphonium hexafluorophosphate / ester, 3 -Diethoxyphosphoryl-1,2,3-benzoxazole 4(3H)-one (DEPB T), O-benzotriazole-tetramethyluronium hexafluorophosphate / Ester, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine salt The salt is one or more of the salt or 1-hydroxybenzotriazole, and in further embodiments... In this case, benzotriazole-1-yl-oxytripyrrolidino-phosphonium hexaf It is a mixture of ruolophosphate / ester and 1-hydroxybenzotriazole, Nzotriazole-1-yl-oxytripyrrolidino-phosphonium hexafluorophosphonium Equimolar amounts of phosphate / ester and 1-hydroxybenzotriazole are used. The molar ratio of the total amidation reaction condenser to the compound shown in formula (316) is 1:1 to 3:1. It is also possible that the ratio is 1.05:1 to 1.5:1 in some embodiments.

[0347] The tertiary amine is N-methylmorpholine, triethylamine, or N,N-diisopropylamine. It may also be propylethylamine, and in some embodiments, N-methylmorphol The tertiary amine and the compound represented by formula (316) are in a molar ratio of 2:1 to 10. The ratio may be 1, and in some embodiments, it is 2:1 to 5:1.

[0348] Similarly, the chemical shown in formula (314) is obtained from the reaction mixture by any suitable isolation method. The mixture can be isolated. In some embodiments, after the solvent is evaporated and removed, The compound shown in formula (314) can be isolated by chromatographic methods, for example (1) Normal-phase purified silica gel: 200-300 mesh silica gel packing material, dichloro Gradient elution occurs with a lmethane:methanol ratio of 100:5 to 100:7, and (2) reversed phase Purification: C18 and C8 reverse-phase packing materials are prepared using methanol:acetonitrile in a ratio of 0.1:1 to 1:0. It can be isolated using two chromatographic conditions: gradient elution in condition 1. In some embodiments, the solvent is directly removed to obtain the crude product of the compound represented by formula (314). This can be obtained, and the crude product can be used directly in subsequent reactions.

[0349] The compound shown in formula (320) is available commercially or known to those skilled in the art. It can be obtained using the method. For example, if m1=m2=m3=3, n1=1, n3=2 Yes, each R 10 , R 11 , R 12 , R 13 , R 14 , R 15 If both are H, then the formula The compound shown in (320) can be purchased commercially from Alpha Acer. can.

[0350] The siRNA complex of this disclosure may be used in combination with other pharmaceutically acceptable additives. The additive may be one or more of the various formulations or compounds commonly used in this field. For further details, please refer to the description of the drug composition in this disclosure above.

[0351] <Use of the siRNA, drug composition and siRNA complex of this disclosure> In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or siRNA complexes in the preparation of drugs for the treatment and / or prophylaxis of sepsis To provide a suitable usage.

[0352] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or administering an effective amount of the siRNA complex to a subject requiring it. To provide a method for preventing and / or treating sepsis.

[0353] By administering the siRNA active component of this disclosure to a subject requiring it, RN The intervention mechanism can achieve the objective of preventing and / or treating sepsis. However, Therefore, the siRNA and / or drug composition and / or siRNA complex of this disclosure are used for sepsis Used for the prevention and / or treatment of the disease, or for the preparation of drugs for the prevention and / or treatment of sepsis. It can be used in manufacturing.

[0354] In some embodiments, the sepsis is a systemic inflammatory response syndrome typically caused by infection. It refers to, essentially, the body's response to an infectious agent. In some embodiments, Bloody cerebral stenosis is a condition that is often seen in patients with serious illnesses, such as severe burns, multiple injuries, or post-surgical conditions. It develops in patients such as those with diabetes, chronic obstructive bronchitis. In some embodiments, sepsis develops in patients with diabetes, chronic obstructive bronchitis, etc. Also for patients suffering from chronic diseases such as bronchitis, leukemia, aplastic anemia, and urinary tract stones. It's being watched a lot.

[0355] As used herein, the term "drug administration / administration" refers to the siRNA, drug composition of this disclosure. and / or localize at least a portion of the siRNA complex to a desired site to produce the desired effect. By a method or route that causes the siRNA, drug composition and / or siRNA polymorphism of the Disclosure, This refers to introducing the combined substance into the body of the subject. Suitable administration routes for the method disclosed herein include local administration and This includes systemic administration. Generally, local administration allows for a greater amount of siRNA to be administered than is available in the subject's systemic circulation. The complex is delivered to a specific site, but systemic administration allows the siRNA, drug composition of this disclosure to be used. and / or the siRNA complex is delivered to the subject's basic systemic circulation. This disclosure is for sepsis Considering the need to provide preventive and / or therapeutic means, several embodiments In this case, a drug administration method is employed that allows the drug to be delivered to the liver.

[0356] The subject can be administered via any appropriate route known in this field, such as: Oral administration or extra-gastrointestinal routes, such as intravenous, intramuscular, subcutaneous, transdermal, or tracheal administration. Intravenous administration (aerosol), pulmonary administration, nasal administration, rectal administration, and local administration (oral administration and sublingual administration) This includes, but is not limited to, administration of, daily, weekly, or bi-weekly doses. This may be once or multiple times every three weeks, one month, two months, three months, six months, or one year.

[0357] The doses of siRNA, drug compositions, or siRNA complexes described herein are in the Art of the Disclosure. The usual dose may be used, and the dose may be determined by various parameters, particularly the age of the subject. It may also be determined by weight and sex. Toxin can be obtained in cell cultures or experimental animals using standard pharmaceutical procedures. Sexuality and therapeutic effect are measured, for example, LD 50 (Dose that causes death in 50% of the population) and ED5 0 (In quantitative reactions, this refers to the dose that can produce 50% of the maximum response intensity.) (In qualitative reactions, this refers to the dose at which a positive reaction occurs in 50% of the experimental subjects.) This may be done. Based on data obtained from cell culture analysis and animal studies, the range of human doses may be determined. You can obtain an enclosure.

[0358] When administering the siRNA, drug composition and / or siRNA complex described in this disclosure For example, male or female, 6-12 weeks old, weighing 18-25g, C57BL / 6J or 3 For ob / ob mice weighing 0-45g, the amount of siRNA is (i) siRNA complex Regarding the body, the siRNA dose may be 0.001 to 100 mg / kg body weight. In some embodiments, the amount is 0.01 to 50 mg / kg body weight, and in some embodiments, The range is 0.05 to 20 mg / kg body weight, and in some embodiments, it is 0.1 to 1 The dosage is 5 mg / kg body weight, and in some embodiments, 0.1 to 10 mg / kg (ii) Body weight, and a drug composition formed by (ii) siRNA and a pharmaceutically acceptable carrier. Regarding the substance, the siRNA dose may be 0.001 to 50 mg / kg body weight. In some embodiments, it is 0.01 to 10 mg / kg body weight, and in some embodiments, 0 The concentration is 0.05 to 5 mg / kg body weight, and in some embodiments it is 0.1 to 3 mg / kg body weight. be.

[0359] In some embodiments, the Disclosure relates to the siRNA and / or drug compositions of the Disclosure. and / or bring an effective amount of the siRNA complex into contact with hepatocytes, and / Alternatively, the drug composition and / or siRNA complex may be introduced into the hepatocytes, and by the RNA interference mechanism The objective is to suppress the expression of the KNG gene in hepatocytes, This invention provides a method for suppressing the expression of the KNG gene in the hepatocytes SMMC-7721. They may be selected from liver cancer cell lines such as HepG2 and Huh7, or isolated primary hepatocytes. .

[0360] The method provided herein suppresses the expression of the KNG gene in cells. Modified siRNA, drug composition, and / or siRNA dosage in siRNA complexes. Generally, it can reduce the expression of target mRNA, reaching 1 pM to 1 μM on the surface of target cells, or 0.01nM to 100nM, or 0.05nM to 50nM, or 0.05nM to approximately 5nM This is the amount that results in the extracellular concentration. The amount required to achieve this local concentration depends on the delivery method and delivery The site, the number of cell layers between the delivery site and the target cells or tissue, the delivery route (local or systemic), etc. It varies depending on various factors, including the concentration at the delivery site on the surface of target cells or tissues. The concentration may be significantly higher than the concentration at [location].

[0361] <Kit> This disclosure relates to at least one of the siRNAs, drug compositions and siRNA complexes of this disclosure. We provide a kit containing an effective amount.

[0362] In some embodiments, the kit described herein includes a container for modified siRNA. It is possible to provide. In some embodiments, the kit described herein is The container may include a container that provides pharmaceutically acceptable excipients. Furthermore, the aforementioned kit may contain other ingredients, such as stabilizers or preservatives. In several embodiments, the kit described herein is modified as described herein. The container providing the iRNA may contain at least one other therapeutic agent in a separate container. In several embodiments, the kit comprises modified siRNA and a pharmaceutically acceptable carrier. It may also include instructions for mixing in / and / or additives or other ingredients (if any).

[0363] In the kit of this disclosure, the siRNA and a pharmaceutically acceptable carrier and / or additive Agents, as well as the siRNA, drug compositions and / or siRNA complexes, and / or pharmaceuticals The additives that are generally acceptable are in any form, for example, liquid form, dry form or freeze-dried form. It may be provided as follows. In some embodiments, the siRNA and pharmaceutically acceptable Possible carriers and / or additives, as well as the drug composition and / or siRNA complex and Any pharmaceutically acceptable additives are essentially clean and / or sterile. In that embodiment, sterile water can be provided by the kit of the present disclosure.

[0364] The present disclosure will be further illustrated below by examples, but the present disclosure is not limited in any way. do not have. [Examples]

[0365] Unless otherwise specified, the reagents and culture media used in the following examples are all commercially available products. The nucleic acid electrophoresis and real-time PCR procedures used are all performed by Mole. cular Cloning(Cold Spring Harbor Laborat This is done by referring to the method described in Ory Press (1989).

[0366] siRNA, siRNA complex, or negative for the KNG gene synthesized by this disclosure. When cells were transfected with control siRNA or siRNA complex, Lipofectamine as an infection reagent TM 2000 (Invitro Use the gen(gen) and refer to the instruction manual provided by the manufacturer for specific operation details. and.

[0367] Unless otherwise specified, all reagent ratios provided below are expressed as volume ratios (v / v). It will be calculated.

[0368] Unless otherwise specified, the experimental data on in-vitro / ex-vitro effects below are all

number

[0369] (Preparation Example 1) Preparation of siRNA complex L10-siKNa1M1SP In this preparation example, the siRNA complex L10-siKNa1M1SP was synthesized. The siRNA complexed with the NA complex is the siRNA complex L10-siKN shown in Table 3. It has sense strand and antisense strand sequences corresponding to a1M1SP.

[0370] (1-1) Synthesis of L-10 compounds The L-10 compound was synthesized according to the following method.

[0371] [ka]

[0372] (1-1-1) Synthesis of the composite terminal segment GAL-5 [ka]

[0373] (1-1-1a) Synthesis of GAL-2 100.0g of GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS number: Purchased on March 8, 1772, from Ningbo Hongxiang Biochemical Company, 1000 ml of 463.8 mmol. Dissolve in anhydrous pyridine and dissolve in 540 ml of anhydrous acetic acid (purchased from Enox) in an ice bath. Add 5565.6 mmol) and stir at room temperature for 1.5 hours. The reaction solution was then placed in 10 L of ice water. Inject into, filter under reduced pressure and suction, wash the cake with 2L of ice water, and then ace until completely dissolved. Add a tonitrile / toluene mixed solvent (volume ratio of acetonitrile:toluene = 1:1), The solvent was evaporated to dryness, yielding 130.0 g of a white solid product, GAL-2.

[0374] (1-1-1b) Synthesis of GAL-3 The GAL-2 (35.1g, 90.0 mmol) obtained in step (1-1-1a) was divided into 21 Dissolve in 3 ml of anhydrous 1,2-dichloroethane and steep in an ice bath under nitrogen protection conditions until 24.0 g TMSOTf (CAS number: 27607-77-8, purchased from Maclin Corporation, 108 (0.0 mmol) was added and the mixture was reacted overnight at room temperature.

[0375] Dilute the reaction solution by adding 400 ml of dichloromethane, filter it through diatomaceous earth, and add 1 L of saturated carbon Add an aqueous solution of sodium oxyhydrogen, stir uniformly, separate the organic phase, and collect the aqueous phase from dichloroethane. The extraction was performed twice with 300ml each time, combining the organic phases, and then 300ml of saturated solution was added for each extraction. Wash with sodium bicarbonate aqueous solution and 300 ml of saturated saline solution to separate the organic phase, and then anhydrous The mixture was dried with sodium sulfate, and the solvent was evaporated under reduced pressure to dryness, yielding 26.9 g of a pale yellow, viscous, syrup-like substance. Product GAL-3 was obtained.

[0376] (1-1-1c) Synthesis of GAL-4 The GAL-3 (26.9g, 81.7 mmol) obtained in step (1-1-1b) was divided into 13 Dissolve in 6 ml of anhydrous 1,2-dichloroethane, add 30 g of dried 4 Å molecular sieve powder, 9.0g of 5-hexen-1-ol (CAS number: 821-41-0, Adamas- Purchased from Beta, add 89.9 mmol), stir at room temperature for 30 minutes, then ice bath and nitrogen Under protective conditions, add 9.08 g of TMSOTf (40.9 mmol) and stir overnight at room temperature. The 4Å molecular sieve powder was filtered out, and the filtrate was diluted with 300 ml of dichloromethane. Filter with diatomaceous earth, add 500 ml of saturated sodium bicarbonate solution, and stir for 10 minutes to wash. The solution is purified, the organic phase is separated, the aqueous phase is extracted once with 300 ml of dichloroethane, and the organic phase is foamed. Then, using 300 ml of saturated sodium bicarbonate solution and 300 ml of saturated saline solution, Wash, separate the organic phase, dry with anhydrous sodium sulfate, evaporate the solvent under reduced pressure to dryness, 41 0.3g of a yellow, syrup-like product, GAL-4, was obtained, and without purification, the following oxidation reaction was carried out. .

[0377] (1-1-1d) Synthesis of GAL-5 GAL-4 (14.9g, 34) obtained by the method described in step (1-1-1c) Dissolve 0.7 mmol) in a mixed solvent of 77 ml of dichloromethane and 77 ml of acetonitrile. Dissolve the mixture in 103 ml of deionized water and 29.7 g of sodium periodate (CA). S number: 7790-28-5, purchased from Aladdin, with 138.8 mmol added. Stir in an ice bath for 10 minutes to remove ruthenium(III) chloride (CAS number: 14898-6 Add 7-0 (purchased from Energy, 238 mg, 1.145 mmol) and leave at room temperature. The reaction was carried out in the evening. 300 ml of water was added to the reaction solution to dilute and stir, and saturated sodium bicarbonate was added. In addition, the pH was adjusted to approximately 7.5, the organic phase was separated and discarded, and the aqueous phase was treated with dichloromethane once. The mixture was extracted three times using 200ml of liquid, and the organic phase was discarded. The pH of the aqueous phase was adjusted to approximately 3 using solid citric acid. The organic phase was then combined with dichloromethane, extracted three times at 200 ml each time, and then subjected to anhydrous sulfurous acid extraction. Dry with sodium acid, evaporate the solvent under reduced pressure to dryness, and obtain 6.85 g of white foamy solid product GAL I got -5. 1 H NMR (400 MHz,DMSO) δ 12.01 (br, 1H),7.83 (d,J = 9.2 Hz,1H),5.21 (d,J = 3 .2 Hz,1H),4.96 (dd,J = 11.2,3.2 Hz,1H),4 .49 (d,J = 8.4 Hz,1H),4.07-3.95 (m,3H),3 .92-3.85 (m,1H),3.74-3.67 (m,1H),3.48-3. 39 (m,1H),2.20 (t,J = 6.8 Hz,2H),2.11 (s ,3H),2.00 (s,3H),1.90 (s,3H),1.77 (s,3H) ,1.55-1.45 (m,4H).

[0378] (1-1-2) Synthesis of L-8 [ka]

[0379] J-0 (9.886g, 52.5mmol, purchased from Alpha Acer) and process ( 1-1-1) GAL-5 obtained (72.819 g, 162.75 mmol, multiple lo Dissolve the combined product (of the set) in 525 ml of dichloromethane, and diisopropyl Ethylamine (DIEA, 44.782g, 346.50mmol), benzotriazole Lu-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate / es Tel (PyBOP, 90.158g, 173.25mmol) and hydroxybenzotri Add azole (HOBt, 23.410 g, 173.25 mmol) and react at room temperature for 4 hours. Then, wash by adding 20 ml of saturated sodium bicarbonate and 200 ml of saturated saline solution. The aqueous phase was extracted twice with dichloromethane at a rate of 100 ml each time, and the organic phase was combined. The crude product was dried with sodium hydroxide sulfate, filtered, and then the solvent was evaporated under reduced pressure to dryness. For this, normal-phase silica gel of 200-300 mesh is used, and 10 wt% triethylamine is used. The acidity of the silica gel was neutralized, the column was equilibrated with 1 wt‰ triethylamine, and dichloromethyl Gradient elution was performed using a tan:methanol ratio of 100:25 to 100:40, and the product eluate was collected. The solvent was evaporated under reduced pressure to dryness to obtain 38.8 g of pure L-8. 1 1H NMR (400 M) Hz,DMSO) δ 7.84 (d,J = 9.0 Hz,3H),7.27-7 .23 (m,1H),7.13-7.18 (m,1H),5.22 (d,J = 3.1 Hz,3H),4.97 (dd,J = 11.3,3.1 Hz,3H), 4.48 (d,J = 8.4 Hz,3H),4.09-3.98 (m,9H), 3.88 (dd,J = 19.3,9.3 Hz,3H),3.75-3.66 ( m,3H),3.44-3.38 (m,3H),3.17-3.30 (m,4H), 3.10-2.97 (m,4H),2.35-2.20 (m,6H),2.15-2 .08 (m,9H),2.07-1.98 (m,13H),1.94-1.87 ( m,9H),1.81-1.74 (m,9H),1.65-1.42 (m,18H) MS m / z:C 85 H 119 N7O 30 [M+H] + Theoretical value: 1477.59 Actual measured value: 1477.23.

[0380] (1-1-3a) Synthesis of A-1 [ka]

[0381] DMTrCl(4,4'-bismethoxytrityl chloride, 101.65g, 300ml) Dissolve (mol) in 1000 ml of anhydrous pyridine and hydrate DL-glycerate calcium Add the substance (28.63g, 100 mmol), react at 45°C for 20 hours, and filter the reaction solution. Rinse the cake with 200 ml of DCM, concentrate the filtrate under reduced pressure until dry, and use 500 ml of the remainder. Dissolve again in 1 liter of dichloromethane and 0.5 M triethylamine phosphate (pH=7~ 8) Wash twice with 200 ml each time, and rinse the aqueous phase with dichloromethane, 20 ml each time. Extract twice with 0 ml, combine the organic phases, dry with anhydrous sodium sulfate, filter, and remove the solvent. The solution is evaporated to dryness under reduced pressure, purified using a normal-phase silica gel column with a 200-300 mesh size, and then processed into petroleum ether. L:ethyl acetate:dichloromethane:methanol = 1:1:1:0.35~1:1:1:0 Gradient elution was performed at 0.55, the product eluate was collected, the solvent was evaporated under reduced pressure to dryness, and 600 ml of the solution was added. Dissolve again in lolomethane and wash once with 200 ml of 0.5 M triethylamine phosphate. The solution is purified, the aqueous phase is extracted once with 200 ml of dichloromethane, and the organic phase is combined with anhydrous sodium sulfate. Dry with alum, filter, evaporate the solvent under reduced pressure to dryness, and vacuum oil overnight using a vacuum oil pump. A 7g white solid product A-1 was obtained. 1 1H NMR (400 MHz, DMSO-d6) δ 7.46 (ddd,J = 6.5,2.3,1.1 Hz,1H),7.40 -7.28 (m,7H),6.89-6.81 (m,4H),4.84 (d,J = 5.0 Hz,1H),4.36-4.24 (m,1H),4.29 (s,6H ),3.92 (dd,J = 12.4,7.0 Hz,1H),3.67 (dd, J = 12.3,7.0 Hz,1H),2.52 (q,J = 6.3 Hz,6 H),1.03 (t,J = 6.3 Hz,9H).MS m / z:C24 H 23 O6, [MH] - Theoretical value: 407.15, measured value: 406.92.

[0382] (1-1-3b) Synthesis of L-7 [ka]

[0383] L-8 obtained in process (1-1-2) (40g, 27.09 mmol, multiple lots) (combining the products) and A-1 obtained in process (1-1-3a) (41.418g, 81 Mix with (0.27 mmol) and dissolve in 271 ml of dichloromethane, then add 3-diethoxy Phosphoryl-1,2,3-benzoxazole 4(3H)-one (DEPBT) (24. Add 318g (81.37 mmol), and further add diisopropylethylamine (21.0 Add 0.7g (162.54 mmol) and stir at 25°C for 1.5 hours, then add 800ml The organic phase is washed with saturated sodium bicarbonate, and the aqueous phase is washed with dichloromethane, 50 ml per cycle. Extract three times with 1 ml, wash the organic phase with 150 ml of saturated saline solution, and remove the aqueous phase with 50 ml of dichloroethylene solution. Extract once with methane, combine with the organic phase, dry with anhydrous sodium sulfate, filter, and then dissolve. The agent was evaporated to dryness under reduced pressure, and then foam-dried overnight using a vacuum oil pump to obtain the crude product. For column purification... Using 2 kg of 200-300 mesh normal-phase silica gel, add 200 ml of triethyl alcohol. The acidity of the silica gel was neutralized with amine, and then colored with petroleum ether containing 1 wt% triethylamine. Equilibrate the mixture: petroleum ether: ethyl acetate: dichloromethane: N,N-dimethylformaldehyde Gradient elution was performed with a mid ratio of 1:1:1:0.5 to 1:1:1:0.6, and the product eluate was collected. The solvent was evaporated under reduced pressure to dryness to obtain 40.4 g of pure L-7. 1 1H NMR (400 M) Hz,DMSO) δ7.90-7.78 (m,4H),7.75-7.64 (m, 1H),7.38-7.18 (m,9H),6.91-6.83 (m,4H),5. 25-5.10 (m,4H),4.97 (dd,J = 11.2,3.2 Hz, 3H),4.48-4.30 (m,4H),4.02 (s,9H),3.93-3. 84 (m,3H),3.76-3.66 (m,9H),3.45-3.35 (m, 3H),3.24-2.98 (m,10H),2.30-2.20 (m,2H),2 .11-1.88 (m,31H),1.80-1.40 (m,28H). MS m / z:C 90 H 128 N7O 35 [M-DMTr] + Theoretical value: 1564.65, actual measurement Value: 1564.88.

[0384] (1-1-4) Synthesis of L-9 [ka]

[0385] L-7 (40g, 21.4247 mmol) obtained in process (1-1-3b), succinate Acid anhydride (4.288 g, 42.8494 mmol) and 4-dimethylaminopyridine ( Mix DMAP (5.235g, 42.8494mmol) in 215ml of dichloromethyl Dissolve in tan, and further diisopropylethylamine (DIEA, 13.845g, 10 Add 7.1235 mmol) and stir at 25°C for 24 hours, then add 800 ml of 0.5 M triethyl alcohol. Wash the reaction mixture with luminamine phosphate, and rinse the aqueous phase with dichloromethane at a rate of 5 ml per rinse, for a total of three rinses. Extraction, combination of organic phases, and evaporation to dryness under reduced pressure were performed to obtain the crude product. For column purification, 1 kg of 2 Using normal-phase silica gel of 00-300 mesh, with 1 wt% triethylamine, silica gel The acidity is neutralized, the column is equilibrated with dichloromethane, and 1 wt‰ triethylamine is added. Gradient elution was performed using dichloromethane:methanol = 100:18 to 100:20, and the product eluate was obtained. The sample was recovered, and the solvent was evaporated to dryness under reduced pressure to obtain 31.0 g of pure L-9 composite molecules. 1 HN MR (400 MHz,DMSO) δ 8.58 (d,J = 4.2 Hz,1 H),7.94-7.82 (m,3H),7.41-7.29 (m,5H),7.2 2 (d,J = 8.1 Hz,5H),6.89 (d,J = 8.3 Hz,4 H),5.49-5.37 (m,1H),5.21 (d,J = 3.0 Hz,3 H),4.97 (d,J = 11.1 Hz,3H),4.49 (d,J = 8 .2 Hz,3H),4.02 (s,9H),3.88 (dd,J = 19.4, 9.4 Hz,3H),3.77-3.65 (m,9H),3.50-3.39 (m ,6H),3.11-2.90 (m,5H),2.61-2.54 (m,4H),2 .47-2.41 (m,2H),2.26-2.17 (m,2H),2.15-1. 95 (m,22H),1.92-1.84 (m,9H),1.80-1.70 (m ,10H),1.65-1.35 (m,17H),1.31-1.19 (m,4H) ,0.96 (t,J = 7.1 Hz,9H). MS m / z:C 94 H 132 N 7O 38[M-DMTr] + Theoretical value: 1664.72, measured value: 1665.03.

[0386] (1-1-5) Synthesis of L-10 compounds [ka]

[0387] In this process, the L-9 composite molecule is bonded to the solid support, thereby forming the L-10 compound We prepared it.

[0388] L-9 composite molecule obtained in step (1-1-4) (22.751 g, 11 mmol), O -Benzotriazole-tetramethyluronium hexafluorophosphate (HBTU) , 6.257g, 16.5 mmol) and diisopropylethylamine (DIEA, 2. Mix 843g (22 mmol), dissolve in 900ml of acetonitrile, and leave at room temperature for 5 minutes. Stir for minutes, then add aminomethyl resin (88g, 100-200 mesh, amino group carrier) to the reaction solution. Add the 400 μmol / g solution (purchased from Minamikai Kazunari Co., Ltd.) and react in a shaker at 25°C. After performing the process and allowing it to react for 18 hours at a rotation speed of 150 rpm, filter the cake once. Rinse twice with 300ml each time, then rinse three times with acetonitrile, 300ml each time. The raw materials (CapA) are dried for 18 hours using a vacuum oil pump, and then mixed according to the proportions shown in Table 2. Add CapB, 4-dimethylaminopyridine (DMAP), and acetonitrile to the mixture. The capping reaction was performed. The mixture was left standing in a shaker at 25°C and rotated at 150 revolutions per minute for 5 hours. After the reaction, filter the reaction solution and rinse the cake with acetonitrile in 3 batches of 300 ml each. The solvent was evaporated under reduced pressure until dry, then dried under reduced pressure overnight using a vacuum oil pump, 102g, L-10 compound with a holding weight of 90.8 μmol / g (i.e., L-9 complex compound bound to solid support) He had a child.

[0389] [Table 2] Here, CapA and CapB are capping reagent solutions, and CapA is 20 volumes. This is a pyridine / acetonitrile mixture solution of % N-methylimidazole, and contains pyridine and a The volume ratio with cetonitrile is 3:5, and CapB is 20 vol% acetonitrile anhydride. This is Toll's solution.

[0390] (1-2) Synthesis of the sense strand of the siRNA complex L10-siKNa1M1SP Starting with the L-10 compound prepared in the above step by the solid-phase phosphoramidite method Circulate and the sense chain nucleoty corresponding to L10-siKNa1M1SP in Table 3 Nucleoside monomers were attached one by one in the 3'-5' direction according to the order of the dos. Each time a side monomer is bonded, deprotection, coupling, capping, oxidation, or sulfidation occurs. Four reactions were performed. When two nucleotides are bonded together by a phosphate ester, the following occurs: When nucleoside monomers are bonded, deprotection, coupling, capping, and oxidation occur. Four reactions were performed. When two nucleotides are bonded by a thiophosphate ester. When the next nucleoside monomer is attached, deprotection, coupling, capping, sulfur Four chemical reactions were carried out. The synthesis conditions were defined as follows:

[0391] Nucleoside monomers are provided in a 0.1 M acetonitrile solution, and each deprotection reaction is performed. The conditions are the same, namely the temperature is 25°C, the reaction time is 70 seconds, and the deprotection reagent is It is a dichloromethane solution (3% v / v) of dichloroacetic acid, and dichloroacetic acid and a solid support The molar ratio of the 4,4'-dimethoxytrityl protecting group to the protecting group was 5:1.

[0392] The conditions for each coupling reaction are the same: the temperature is 25°C, and the solid support is... The molar ratio of the bound nucleic acid sequence to the nucleoside monomer is 1:10, and it binds to a solid support. The molar ratio of the nucleic acid sequence to be coupled to the coupling reagent is 1:65, and the reaction time is 600 seconds. The coupling reagent is 5-ethylthio-1H-tetrazole (5-(Ethyl This is a 0.5 M acetonitrile solution of thio)-1H-tetrazole (ETT). .

[0393] The capping conditions were all the same: a temperature of 25°C and a reaction time of 15 It took seconds. The capping reagent solution is a mixture of CapA and CapB in a molar ratio of 1:1. It is a solution, and the molar ratio of the capping reagent to the nucleic acid sequence bound to the solid support is acetic anhydride. The ratio of substance:N-methylimidazole to the nucleic acid sequence bound to the solid support was 1:1:1.

[0394] The conditions for each oxidation reaction are the same: the temperature is 25°C, the reaction time is 15 seconds, and the acid The chemical reagent was iodine solution with a concentration of 0.05 M. Iodine and solid phase in the coupling process. The molar ratio of the nucleic acid sequence bound to the support was 30:1. The reaction was carried out using tetrahydrofuran: The procedure was performed using a mixed solvent of water and pyridine in a ratio of 3:1:1.

[0395] After the binding of the last nucleoside monomer is complete, the nucleic acid sequence bound to the solid support Then, after sequentially performing cleavage, deprotection, purification, and desalting, the sense chain was obtained by freeze-drying.

[0396] The cleavage and deprotection conditions are as follows: The synthesized support is bound to the nucleotide. The column was added to a 25 wt% ammonia solution, and the volume of the ammonia solution was 0.5 ml / μmol. The mixture was reacted at 55°C for 16 hours, the remaining support was filtered off, and the supernatant was vacuum concentrated until dry. did.

[0397] The purification and desalting conditions are as follows: Preparative ion chromatography purification column. Nucleic acid purification was completed by gradient elution with NaCl using (Source 15Q). Specifically, the eluent A is 20 mM sodium phosphate (pH 8.1), and the solvent is water / acetone. The nitrile ratio is 9:1 (by volume), and the eluent B consists of 1.5M sodium chloride and 20mM phosphorus. The solution is sodium acetate (pH 8.1), and the solvent is water / acetonitrile in a volume ratio of 9:1. Elution gradient: Eluting agent A:Eluting agent B = 100:0 to 50:50. Product eluate was obtained. After recovery and combination, desalting was performed using a reverse-phase chromatography purification column, and specific conditions were determined. Then, desalting is performed using a dextran gel column, and the packing material is dextran gel G25 (Se It was identified as phadex G25 and eluted with deionized water.

[0398] The detection method is as follows: Ion exchange chromatography (IEX-HPLC) The purity of the sense chain is detected using [a specific method], and then determined by liquid chromatography-mass spectrometry (LC-MS). The molecular weight was analyzed. The measured value matched the theoretical value, and an L-9 complex molecule was found at the 3' end. This demonstrated that the sense chain SS was synthesized.

[0399] (1-3) Synthesis of the antisense chain of the siRNA complex L10-siKNa1M1SP The solid-phase phosphoramidite method allows for the production of general-purpose solid-phase supports (UnyLinker TM loa ded NittoPhase(registered trademark)HL Solid Supports, Ki Starting from Novate Life Sciences, the cycle is circulated, and in Table 3, L According to the order of nucleotides in the antisense strand corresponding to 10-siKNa1M1SP The antisense strand of the iRNA complex L10-siKNa1M1SP was synthesized. For the nucleotide chain, the first nucleotide at the 5' end has a 5'-phosphate nucleotide. Therefore, in the process of preparing antisense chains by the solid-phase phosphoramidite method, After bonding the last nucleoside monomer of the cysnes chain, deprotection, coupling, and capping are performed. The four reactions of ping and oxidation are carried out to produce the CPR-I monomer (Suzhou Jima, number Cat#13- Attach 2601-XX) to the 5' end of the antisense strand and perform 5'-phosphate nucleotide modification. Aside from forming the acid, the solid-phase synthesis method involves deprotection, coupling, capping, and acid The conditions for the chemical or sulfurization reaction, cleavage and deprotection, purification and desalting were the same as those for the sense chain synthesis. .

[0400] [ka]

[0401] The conditions for the deprotection, coupling, capping, and oxidation reactions used in the bond in question, The conditions for cleavage and deprotection, purification and desalting were the same as those for the sense chain synthesis. Subsequently, freeze-drying was performed. An antisense chain was obtained by ion exchange chromatography (IEX-HPLC). The purity of the inchense chain is detected and then separated by liquid chromatography-mass spectrometry (LC-MS). The particle quantity was analyzed. As a result, the measured value matched the theoretical value, and the anticellarium possessing the target sequence was found. This demonstrated that the lance chain AS was synthesized.

[0402] (1-4) Synthesis of siRNA complex L10-siKNa1M1SP The sense chain and antisense chain obtained in (1-2) and (1-3) are dissolved in sterile water for injection, respectively. Dissolve to obtain a 40 mg / mL solution, and then divide the obtained solution into equimolar sense chains and antisense chains. The mixture was heated at 50°C for 15 minutes, cooled to room temperature, and then annealed to obtain the product. The powder was freeze-dried to obtain a freeze-dried powder. Ultrapure water (Milli-Q ultrapure water apparatus, resistivity 1 The siRNA complex was diluted using 8.2 MΩ*cm (25℃) to a concentration of 0.2 mg / After reducing to mL, the liquid chromatography-mass spectrometry (LC-MS) is performed. Omatography-Mass Spectrometry, purchased from Waters. The molecular weight was detected using a test tube (model number: LCT Premier). The measured value matched the theoretical value. The synthesized siRNA complex contains the L-9 complex molecule and is a double-stranded nucleic acid of the design. It was shown to be a column. Its structure is shown in formula (403). The siRNA is a table The sense strand and annealing corresponding to the siRNA complex L10-siKNa1M1SP shown in 3 It has a chisen chain arrangement.

[0403] [Table 3] However, uppercase C, G, U, and A represent the base sequence of a nucleotide, and lowercase m represents the same This indicates that the nucleotide adjacent to the left of the letter 'm' is a methoxy-modified nucleotide. Furthermore, the lowercase letter f is a fluoromodified nucleus, where one nucleotide adjacent to the left of the letter f is fluoromodified. The lowercase letter 's' indicates that there is a thio between the two nucleotides to the left and right of the letter 's'. The uppercase letter P indicates that the molecules are bonded by a phosphate ester group, and the letter P is adjacent to the right of the uppercase letter P. This indicates that the adjacent nucleotide is a 5'-phosphate nucleotide.

[0404] (Preparation Examples 2-6) Synthesis of the siRNA complex of this disclosure The sense strand and antisequence strand of the siRNA corresponding to each siRNA complex in Table 3. Aside from synthesizing the sense and antisense strands according to the sense strand sequence, the method is the same as in Preparation Example 1. Therefore, the siRNA complexes L10-siKNb1M1SP and L10 of the present disclosure, as shown in Table 3, -siKNc1M1SP, L10-siKNd1M1SP, L10-siKNe1M1S P and L10-siKNf1M1SP were synthesized. These siRNA complexes include Each siRNA consists of a sense strand and an antisequence strand, corresponding to each siRNA complex in Table 3. It has a lance chain sequence.

[0405] After the preparation is complete, the molecular weight of each prepared siRNA complex is determined by the method of Preparation Example 1. When each was detected, the measured values ​​matched the theoretical values, indicating the synthesized siRNA complex. However, it was shown to be a double-stranded nucleic acid sequence designed for the purpose, containing an L-9 complex molecule. The structures are all shown in formula (403). The siRNAs contained in these siRNA complexes These are the siRNA complexes L10-siKNb1M1SP and L10- shown in Table 3, respectively. siKNc1M1SP, L10-siKNd1M1SP, L10-siKNe1M1SP It also has a sequence corresponding to L10-siKNf1M1SP.

[0406] (Preparation Examples 7-14 and Comparative Preparation Examples 15, 16) <Synthesis of siRNA sequences> Using a solid-phase synthesis method, the sense strand or antisense strand of the siRNA sequences shown in Table 4 was synthesized respectively. After dissolving a mixture of equimolar sense strand and antisense strand using DEPC-treated water, annealing was performed to form siRNA duplexes, and siKNa1M1S, siKNb1M1S, siKNc1M1S, siKNd1M1S, siKNe1M1S, siKNf1M1S, siKNa0, siKNc0, siKNa0-com, and NC were obtained. ... ... ... ... obtained.

[0407]

Table 4

[0408] In the preparation process of the above sequences, if the target sequence contains unmodified nucleotides, after treatment with aqueous ammonia under cleavage and deprotection conditions, the product was dissolved with N-methylpyrrolidone at 0.4 ml / μmol based on the amount of single-stranded nucleic acid, then triethylamine at 0.3 ml / μmol and triethylamine hydrofluoride at 0.6 ml / μmol were added to remove the 2'-TBDMS protection on ribose. When the molecular weight of the above siRNAs was detected by the method of Preparation Example 1, the measured values were consistent with the theoretical values, and the obtained siRNAs were respectively... ... ... ... ... ... It was confirmed that each siRNA had a sequence corresponding to the one shown in Table 4.

[0409] After the preparation of the siRNA or siRNA complex described above is completed, the solid powder is obtained It was stored by freeze-drying. When using, for example, dilute with sterile water for injection, physiological saline (NS), or phosphoric acid. Redissolve in a solution of the desired concentration using a buffer solution (PB) or phosphate buffer solution (PBS), etc. It can be used in this way.

[0410] (Experimental Example 1) In vitro inhibitory activity of the siRNAs disclosed herein. 10% fetal bovine serum (FBS, Hyclone) and 0.2% by volume of penicillin - Streptomycin (Penicillin-Streptomycin, Gibco) HEK2 93A cells (purchased from Nanjing Kebei Biotechnology Co., Ltd.) with 5% CO2 / 95% air-containing ink The cells were cultured in an incubator at 37°C.

[0411] Kumico Ui-Tei et.al., Functional dissec tion of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammali an gene silencing with significantly red uced off-target effect. Nucleic Acids Re In accordance with the method described in search, 2008.36(7), 2136-2151, the test subject Rasmid was constructed and evaluated by co-transfecting HEK293A cells with siRNA. Furthermore, the expression level of the dual luciferase reporter gene indicates the inhibitory activity of siRNA. This was reflected in the specific steps, which are as follows:

[0412] [1] Construction of the test plasmid psiCHECK TM -2(Promega TM ) Using plasmids, the target sequence Test plasmids containing siRNA target sequences were constructed. For each test siRNA, the objective was... The sequence is shown below.

[0413] Target sequence of siKNa0: AAAGTAACAACCAGTTTGT (Sequence ID 393) Target sequence of siKNc0: TCGAATTACCTACTCAATT (Sequence ID 394)

[0414] Check the target sequence using psiCHECK TM -2 plasmid Xho I / Not I site I did it.

[0415] [2] transfection 8 × 10⁶ HEK293A cells 3 Inoculate cells / well into a 96-well plate at 4 PM. When the cell growth density reached 70-80% after a certain period, the H-DMEM complete medium in the culture wells was used. Remove all of it by aspirating, and then add 80 μl of Opti-MEM medium (GIBCO) to each well. In addition, the culture was continued for 1.5 hours.

[0416] For each siRNA, the corresponding test plasmid was diluted with DEPC-treated water and 20 Use a 0 ng / μl diluted standard solution (Working Solution) of the test plasmid. For each siRNA, the siRNA was treated with DEPC-treated water, and the concentration was set to 10¹¹. Prepare siRNA dilution standard solutions of M, 3nM, and 1nM (as the amount of siRNA). Ta.

[0417] 1 μl of siRNA diluted standard solution with a concentration of 10 nM, 0 μl of test plasmid diluted standard solution Contains 0.05 μl (containing 10 ng of test plasmid) and 10 μl of Opti-MEM medium. Solution 1A1 was prepared.

[0418] 1 μl of siRNA diluted standard solution with a concentration of 3 nM, and 0 μl of the test plasmid diluted standard solution. 10 μl (containing 10 ng of test plasmid) and 10 μl of Opti-MEM medium Solution A2 was prepared.

[0419] 1 μl of siRNA diluted standard solution with a concentration of 1 nM, and 0 μl of the test plasmid diluted standard solution. 10 μl (containing 10 ng of test plasmid) and 10 μl of Opti-MEM medium Solution A3 was prepared.

[0420] 0.2 μl of Lipofectamine TM 2000 and 10 μl Opti-M A 1B solution containing EM medium was prepared.

[0421] 0.05 μl of diluted standard solution of the test plasmid (containing 10 ng of the test plasmid) and Op A 1C solution containing 10 μl of ti-MEM medium was prepared.

[0422] For each siRNA, one 1B solution, one 1A1 solution, and one 1A2 solution are provided. Incubate one 1A3 solution at room temperature for 20 minutes, then transfect the 1X1 complex. 1X2 and 1X3 solutions were obtained. One 1B solution and one 1C solution were mixed and left at room temperature. Transfection complex 1X4 was obtained after 20 minutes of incubation.

[0423] For each siRNA, add 20 μl / well to each of the three culture wells. Add the siRNA infection complex 1X1 and mix uniformly until the final siRNA concentration is approximately 0. A cotransfection mixture with a concentration of 1 nM was obtained and designated as test group 1.

[0424] For each siRNA, add 20 μl / well to three separate culture wells. Then add transfection complex 1X2 and mix uniformly until the final concentration of siRNA is approximately A cotransfection mixture with a concentration of 0.03 nM was obtained and designated as test group 2.

[0425] For each siRNA, add 20 μl / well to three separate culture wells. Then add transfection complex 1X3 and mix uniformly until the final concentration of siRNA is approximately A cotransfection mixture with a concentration of 0.01 nM was obtained and designated as test group 3.

[0426] Transfection was carried out in three other culture wells with a starting volume of 20 μl / well. Adding complex 1X4, a transfection mixture without siRNA was obtained, and compared with the control group. did.

[0427] Cotransfection mixture containing siRNA and transfection mixture without siRNA After cotransfecting the ion mixture in the culture wells for 4 hours, each well 100 μl of H-DMEM complete medium containing 20% ​​FBS was added. The 96-well plate was then converted to C The culture was continued for 24 hours in an O2 incubator.

[0428] [3] Detection Remove the culture medium from the culture wells by aspirating, and add 150 μl of Dual-Glo (indicated in each well). (Registered Trademark) Add a mixed solution of Luciferase reagent and H-DMEM (volume ratio 1:1) Mix thoroughly until uniform, incubate at room temperature for 10 minutes, then add 120 μl of the mixture to 9 Transfer to a 6-well ELISA plate and use Synergy II multi-function microplate. Using a reader (BioTek), the Firefly chemiluminescence value (Fir) is read, In addition, 60 μl of Dual-Glo (registered trademark) is added to each well. Stop & Glo (Registration) Add the (trademark) reagent, mix thoroughly until homogeneous, and incubate at room temperature for 10 minutes. Then read the result. Following the arrangement of the Fir, use a microplate reader to check the R in each culture well. The chemiluminescence value (Ren) of enilla was read.

[0429] The emission ratio (Ratio = Ren / Fir) for each well was calculated, and the emission ratio for each test group or control group was determined. Ratio(test) or Ratio(control) is the average of the ratios in the three culture wells. Then, using the emission ratio of the control group as a baseline, the emission ratio of each test group is normalized, and Ratio(test) / R The ratio R of the atio (control) is obtained, thereby determining the expression level of the Renilla reporter gene. This represents the residual activity. The inhibition rate of siRNA = (1-R) ​​× 100%.

[0430] HEK293A after transfection with siKNa0 and siKNc0 respectively. Figure 1 shows the residual activity of the Renilla reporter gene in cells.

[0431] <Comparative Experiment Example 1> In vitro inhibitory activity of reference siRNA The measured siRNAs were the reference siRNAs NC and siKNa0-com, respectively. Except for the above, the method for Experimental Example 2 was followed, using reference siRNA NC and siKNa0-co The residual activity of m in the psiCHECK system was investigated simultaneously.

[0432] Target sequence of siKNa0-com: CCAAAGTAACAACCAGTTT (Sequence ID 395)

[0433] The target sequence for NC was set to be the same as the target sequence for siKNa0.

[0434] The results are shown in Figure 1.

[0435] As can be seen from the results in Figure 1, the siRNA disclosed herein was effective in HEK293A cells. All of the samples showed excellent inhibitory effects on the target sequences, and the inhibition rate was concentration-dependent. Furthermore, at an siRNA concentration of 0.1 nM, the inhibition rates for both siKNa0 and siKNc0 were 75%. The percentage was over %, indicating a good suppression effect on KNG gene expression. In stark contrast to this, see the reference. Although siKNa0-com has a sequence very similar to siKNa0, the siRNA concentration... Even at 0.1 nM, the inhibition rate against the target sequence is less than 50%, and the siRNA of this disclosure is Surprisingly, it showed excellent suppressive effects on KNG gene expression.

[0436] (Experimental Example 2) IC for target sequences in the siRNA-based psiCHECK system 50 Measurement 10% fetal bovine serum (FBS, Hyclone) and 0.2% by volume of penicillin - Streptomycin (Penicillin-Streptomycin, Gibco) HEK2 93A cells (purchased from Nanjing Kebei Biotechnology Co., Ltd.) with 5% CO2 / 95% air-containing ink The cells were cultured in an incubator at 37°C.

[0437] Kumico Ui-Tei et.al., Functional dissec tion of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammali an gene silencing with significantly red uced off-target effect. Nucleic Acids Re In accordance with the method described in search, 2008.36(7), 2136-2151, the test subject Rasmid was constructed, and the test plasmid and test siRNA were introduced into HEK293A cells. Infection occurs, and the expression level of the dual luciferase reporter gene determines s This reflects the target sequence repression activity of the iRNA. The specific procedure is as follows:

[0438] [1] Construction of the test plasmid psiCHECK TM -2(Promega TM ) Using plasmids, the target sequence A test plasmid containing the siRNA target sequence was constructed. Regarding the test siRNA, the target distribution... The columns are shown below.

[0439] siKNa1M1S target sequence: CATGGCCACGGAAAACATAAAAATAAAGGCAAAAAGAAT GGAAAGCACAATGGTTGGAAAACAGAGCATTTGGCAAGCT CTTCTGAAGACAGTACTACACCTTCTGCACAGACACAAGA GAAGACAGAAGGGCCAACACCCATCCCTTCCCTAGCCAAG CCAGGTGTAACAGTTACCTTTTCTGACTTTCAGGACTCTG ATCTCATTGCAACTATGATGCCTCCTATATCACCAGCTCC CATACAGAGTGATGACGATTGGATCCCTGATATCCAGATA GACCCAAATGGCCTTTCATTTAACCCAATATCAGATTTTC CAGACACGACCTCCCCAAAATGTCCTGGACGCCCCTGGAA GTCAGTTAGTGAAATTAATCCAACCACACAAATGAAAGAA TCTTATTATTTCGATCTCACTGATGGCCTTTCTTAATTTA AGTGGCTATGGGTATTTCTTTCATACTTTATTAAAGTATC AATATCCCTCTCTCCATTGTCCAGATGAAAATATCCTGAT ATAATGCACCAAAAACCATGCAGCTTCGGAACAGTCTAAA GAGAAGTGGTGAGACTCCCAGTGGAGACACC (SEQ ID NO: 39 6) Target sequences of siKNb1M1S, siKNc1M1S, siKNd1M1S, siKNe1M1S and siKNf1M1S: CATGGCCACGGAAAACATAAAAATAAAGGCAAAAAGAAT GGAAAGCACAATGGTTGGAAAACAGAGCATTTGGCAAGCT CTTCTGAAGACAGTACTACACCTTCTGCACAGACACAAGA GAAGACAGAAGGGCCAACACCCATCCCTTCCCTAGCCAAG CCAGGTGTAACAGTTACCTTTTCTGACTTTCAGGACTCTG ATCTCATTGCAACTATGATGCCTCCTATATCACCAGCTCC CATACAGAGTGATGACGATTGGATCCCTGATATCCAGATA GACCCAAATGGCCTTTCATTTAACCCAATATCAGATTTTC CAGACACGACCTCCCCAAAAATGTCCTGGACGCCCCTGGAA GTCAGTTAGTGAAATTAATCCAACCACACAAATGAAAGAA TCTTATTATTTCGATCTCACTGATGGCCTTTCTTAATTTA AGTGGCTATGGGTATTTCTTTCATACTTTATTAAAGTATC AATATCCCTCTCTCCATTGTCCAGATGAAAATATCCTGAT ATAATGCACCAAAAACCATGCAGCTTCGGAACAGTCTAAA GAGAAGTGGTGAGACTCCCAGTGGAGACACC (Sequence No. 39) 7)

[0440] All of the above target sequences were gene fragments encoding human KNG mRNA genes. Ta.

[0441] Check the target sequence using psiCHECK TM -2 plasmid Xho I / Not I site I did it.

[0442] [2] transfection 8 × 10⁶ HEK293A cells 3 Inoculate cells / well into a 96-well plate at 4 PM. When the cell growth density reached 70-80% after a certain period, the H-DMEM complete medium in the culture wells was used. Remove all of the contents by aspirating, and then add 80 μl of Opti-MEM medium (GIBCO) to each well. In addition, the culture was continued for 1.5 hours.

[0443] The above test plasmid was diluted with DEPC-treated water to obtain a 200 ng / μl test plasmid. A dilution standard solution was prepared. Using DEPC-treated water, siKNa1M1S and siKNb1M 1S, siKNc1M1S, siKNd1M1S, siKNe1M1S and siKNf1 From each siRNA in M1S, concentrations of 100nM, 50nM, 25nM, 12.5nM, and 6 0.25nM, 3.125nM, 1.5625nM, 0.7813nM, and 0.3906n A total of nine siRNA dilution standard solutions, designated as M, were prepared.

[0444] For each siRNA, prepare solutions 2A1 to 2A9, and then prepare each solution 2A1 to 2A9 This consists of 1 μl of siRNA dilution standard solution at the nine concentrations listed above, and 0 μl of the test plasmid dilution standard solution. Contains 0.5 μl (containing 10 ng of test plasmid) and 10 μl of Opti-MEM medium, in that order. nothing.

[0445] Mix one 1B solution with one 2A1-2A9 solution of each obtained siRNA. Then, each was cultured at room temperature for 20 minutes, and the transfection complex of each siRNA was 2X 1 to 2 x 9 was obtained.

[0446] Transfection conjugates of each siRNA were applied to the culture wells at a rate of 20 μl / well. Add 2x1 to 2x9 units respectively and mix uniformly until the final concentration of each siRNA is approximately 1nM, 0.5nM, 0.25nM, 0.125nM, 0.0625nM, 0.0312 The values ​​are 5 nM, 0.015625 nM, 0.007813 nM, and 0.003906 nM. Obtain the transfection complex, and each siRNA transfection complex 2X1~ Three culture wells were transfected in 2x9 and siRNA-containing KOTRA An infection mixture was obtained and designated as the test group.

[0447] In three other culture wells, add transfection complex 1 at a starting volume of 20 μl / well. X3 was added to each to obtain a cotransfection mixture that did not contain siRNA, and the control group was... That's what I decided.

[0448] Cotransfection mixtures containing siRNA and cotransfection mixtures without siRNA After transfecting the culture wells with the infection mixture for 4 hours, each well 100 μl of H-DMEM complete medium containing 20% ​​FBS was added. The 96-well plate was then converted to C The culture was continued for 24 hours in an O2 incubator.

[0449] [3] Detection Remove the culture medium from the culture wells by aspirating, and add 150 μl of Dual-Glo (indicated in each well). (Registered Trademark) Add a mixed solution of Luciferase reagent and H-DMEM (volume ratio 1:1) Mix thoroughly until uniform, incubate at room temperature for 10 minutes, then add 120 μl of the mixture to 9 Transfer to a 6-well ELISA plate and use Synergy II multi-function microplate. Using a processor (BioTek), each culture well on a 96-well ELISA plate was processed. Read the chemiluminescence value (Fir) of Firefly in the 96-well ELISA, and then read the value of Firefly in the 96-well ELISA. Place 60 μl of Dual-Glo® into each well on the plate. Stop & G Add the lo(registered trademark) reagent, mix thoroughly until homogeneous, and incubate at room temperature for 10 minutes. Next, following the sequence of Fir values ​​read, use a microplate reader to read a 96-well E The chemiluminescence value (Ren) of Renilla in each culture well on the LISA plate is calculated as follows: I read it.

[0450] The luminescence ratio of each well on a 96-well ELISA plate is Ratio=Ren / Fir. The emission ratios (Ratio(test) or Ratio(control)) for each test group or control group are calculated and there are three such ratios. This is the average ratio of the culture wells, with the luminescence ratio of the control group as the baseline, and the luminescence ratio of each test group. Normalize the ratio R (test) / Rati (control), and use that to obtain Renil This represents the relative expression level of the LA reporter gene, i.e., the residual activity. The suppression rate is (1-R) ​​× 100%.

[0451] After transfection with test siRNAs of different concentrations, HEK293A cells were subjected to the following treatment. From the relative residual activity of Renilla, the non-linear behavior of Graphpad 5.0 software Linear regression analysis function: log(inhibitor) vs. response-Va A pliable slope (four parameters) of the dose-effect curve. Figures 2A to 2F show siKNa1M1S, siKNb1M1S, and siK Dosage of Nc1M1S, siKNd1M1S, siKNe1M1S, and siKNf1M1S -The effect curve is shown. Here, the common logarithm (lgnM) of the final concentration of siRNA is shown horizontally. The coordinate system is used, with the relative residual activity (%) of Renilla as the vertical axis, and each black circle represents the relative activity of the control group. This represents the average relative residual activity of Renilla in the three culture wells of the test group.

[0452] From the following function corresponding to the fitted dose-effect curve, the subject siRN IC A targets the desired array 50 The value was calculated.

[0453]

number

[0454] From the dose-effect curve and the corresponding function, the corresponding X when Y = 50% 50 value Determine the IC for each siRNA. 50 Value = 10^X 50 (nM) is calculated, IC 50 Values I summarized it in section 5.

[0455] [Table 5]

[0456] As can be seen from Figures 2A to 2F and the results in Table 5 above, the siR provided by this disclosure The NA complex exhibits high target sequence repression activity in in vitro HEK293A cells, and IC 50 but, The values ​​ranged from 0.0048 to 0.2328 nM.

[0457] (Experimental Example 3) The siRNA complex provided herein in humanized mice (in vivo) Measurement of activity The humanized mice used in this study were constructed by the Tang Zhongying Hematology Research Center at Suzhou University. Humanized mice aged 6-8 weeks were randomly divided into groups of 4 (2 males and 2 females). Each group of mice received 6 mg / kg (as siRNA), and multiple siRNAs were administered. Combined L10-siKNa1M1SP, L10-siKNc1M1SP, L10-siKN e1M1SP and L10-siKNf1M1SP, and physiological saline (sali) as a control. Each siRNA complex was administered as a single dose by subcutaneous injection at a concentration of 0.6 mg / mL (siR It was administered as a 0.9% sodium chloride aqueous solution (as NA), and the administration volume was 10 in all cases. The concentration was mL / kg.

[0458] The animals were then killed on the 28th day, and liver tissue was collected from each mouse. Approximately 100 mg was taken per mouse, and RNA later (Sigma Aldrich) was used. The liver tissue of each mouse was then homogenized using a tissue homogenizer. The instructions were further documented using Trizol (Thermo Fisher). The total RNA of each mouse's liver tissue was obtained by extraction according to the specified procedure.

[0459] ImProm-II TM Using a reverse transfer kit (Promega), following the instructions... The extracted total RNA was reverse transcribed into cDNA to obtain a solution containing cDNA, and then fluorescence quantitative analysis was performed. PCR kit (Beijing Kangwei Century Biotechnology Co., Ltd.) for the development of KNG mRNA in liver tissue. Aside from detecting the actual quantity, the method followed that of Experimental Example 2, including fluorescence quantitative PCR detection and KNG. The relative expression levels and suppression rates of mRNA were calculated using the fluorescence quantitative PCR method. Therefore, the β-actin gene is used as the endogenous reference gene, and primers and β- Using primers for the actin gene, the KNG and β-actin genes were respectively targeted. The following was detected. The sequences of the detection primers are shown in Table 6. KNG mRNA expression level and suppression rate. In the calculation, the control group consisted of control mice that were administered PBS in this experiment, and each The test groups consisted of mice administered with different siRNA complexes. (Control group) The KNG mRNA expression level is set to 100%, and the KNG mRNA expression level is suppressed accordingly. The rate was set to 0%, and the test results were standardized using the KNG mRNA expression level of the control group. The results are shown in Table 6.

[0460] [Table 6]

[0461] Using the comparative Ct (ΔΔCt) method, the expression of the target gene KNG in each test group and the control group was measured. Relative quantitative calculations were performed for the quantities, and the calculation method is as follows. ΔCt(test group) = Ct(target gene in the test group) - Ct(endogenous reference gene in the test group) ΔCt(control group) = Ct(target gene in the control group) - Ct(endogenous reference gene in the control group) ΔΔCt(test group) = ΔCt(test group) - ΔCt(mean of control group) ΔΔCt(control group) = ΔCt(control group) - ΔCt(mean of control group) Here, ΔCt (mean of the control group) is the ΔCt of each mouse in the control group (control group). This is the arithmetic mean of the group. Therefore, each mouse in both the test group and the control group has one ΔΔ This corresponds to the Ct value.

[0462] Using the control group as a baseline, the KNG mRNA expression level of the test group was normalized, and the KN of the control group was normalized. The expression level of G mRNA was defined as 100%.

[0463] Relative expression level of KNG mRNA in the test group = 2 -ΔΔCt(試験群) ×100% ru.

[0464] The mean of the relative expression level of KNG mRNA in the test group compared to siRNA in the same test group. This is the arithmetic mean of the relative expression levels of mice in each group at the given concentration.

[0465] The test results were standardized using the KNG mRNA expression level of the control group, and the results are shown in Table 7. As shown in Table 7, the human KNG mRNA suppression rate is determined by the corresponding siRNA complex. This represents the mean and standard deviation of the suppression rate of human KNG mRNA in the administered mice.

[0466] [Table 7]

[0467] As can be seen from the results in Table 7, the siRNA complex of this disclosure was found in humanized mouse liver. Both showed excellent inhibitory effects against human KNG mRNA, and against KNG mRNA The suppression rate ranged from 48.35% to 56.29%.

[0468] (Experimental Example 4) The siRNA complex provided herein in humanized mice (in vivo) Measurement of the effect on KNG protein concentration The humanized mice used in this experiment were the same as those used in Experiment 3. In the test group, 6-8 weeks Two humanized mice of the same age were used, and each mouse was given 6 mg / kg (siRNA and The siRNA complex L10-siKNa1M1SP was administered as a single subcutaneous injection. The siRNA complex L10-siKNa1M1SP is 0.6 mg / mL (siRNA and It is provided as a 0.9% sodium chloride aqueous solution, and the dosage volume is 10 mL / The weight of the mouse was set to kg. 1×PBS was administered to another humanized mouse, and the dose volume was measured. The control group was 10 mL / kg mouse body weight.

[0469] The mice were each subjected to the following tests on the day of administration and on days 7, 14, 21, and 28 after administration. Blood samples were taken (each of the above time points is labeled D0, D7, D14, D21, D28 in order), and whole blood samples were taken. A pull was obtained. In each mouse whole blood sample, the volume ratio of anticoagulant to whole blood was 1:9 (v / v) Add 3.8 wt% sodium citrate aqueous solution anticoagulant in the specified proportion, isolate by centrifugation, and use the supernatant. A sample of test plasma was obtained and stored at -80°C.

[0470] 6x Protein Loading Buffer (containing DTT, from Beijing Baerdi Biotechnology Co., Ltd.) Purchase (item number DE0105-1mL) and dilute with sterile water to make 2x protein loading buffs. Ah, so. Each of the three mice in the test group and the control group had a test plasma sample. Add 5 μL to each of two different 1.5 mL centrifuge tubes, and then add 5 μL of sterile water to each centrifuge tube. Add 15 μL of 2× protein loading buffer, mix uniformly, and then 1 in a metal bath. The protein was denatured at 0°C for 10 minutes to obtain a protein sample solution.

[0471] A 10% separation gel and a 4% concentration gel were prepared. 200 mL 5×SDS-PAGE Electrophoresis buffer (purchased from Beijing Baierdi Biotechnology Co., Ltd., product number DE0100-500) Add water to the mixture to make 800 mL, mix uniformly to obtain a dilution buffer. In the electrophoresis tank... Dilution buffer was added. 10 μL was taken from each prepared protein sample solution. The protein marker was added to each of the different gel pores of the SDS-PAGE gel. (Spectra Multcolor Broad Range Protein L Adder (Thermo Scientific, part number 26634) and constant voltage After electrophoresis was performed at 120V for 80 minutes, the electrophoresis process was stopped.

[0472] 10× Protein Electrophoresis Transfer Buffer (Beijing Baierdi Biotechnology Co., Ltd., No. DE01) (81-500mL) Add water to 100mL to make 800mL, and then add 200mL of anhydrous methyl Add tanol and mix uniformly to obtain a diluted transfer buffer. Add polyfluoride to methanol. After immersing the nylidene film (hereinafter referred to as PVDF film) for 2 minutes, add it to the diluted transfer buffer. The sponge, filter paper, and PVDF film were soaked. The gel was removed from the gel plate and from below Negative electrode plate (black) - sponge - filter paper - gel - PVDF film - filter paper - sponge - positive electrode plate ( A sandwich board was made in the order of white, and placed in the transfer tank. The transfer tank was placed in an icebox and set The transfer was performed at 100V for 1 hour.

[0473] Remove the PVDF film after the transfer is complete and apply it to an 80-150KD protein marker. The corresponding PVDF film is sheared, and the sheared PVDF film is mixed with 5 wt% skim milk ( Skim milk powder was purchased from Beijing Suolaibao Technology Co., Ltd. (product number D8340), soaked in the powder, and shaken in a shaker for 2 minutes. Time blocking was performed. Primary antibody (an) was mixed with 5 wt% skim milk in a volume ratio of 1:1500. Dilute ti-h-KNG (purchased from the Tang Zhongying Hematology Research Center, Suzhou University) and culture overnight at 4°C. We obtained cultured and nourished PVDF films.

[0474] 20×TBS buffer (purchased from Beijing Baird Biotechnology Co., Ltd., number DE0190- 500) was diluted by adding water until it reached 1 L, and then 1000 μl of Twee n-20 (purchased from Beijing Solarbio Science & Technology Co., Ltd., number T8220) was added and mixed uniformly. After that, TBST buffer was prepared.

[0475] The above-cultured PVDF film was eluted 3 times with excess TBST buffer for 5 minutes each time. After that, the secondary antibody (horseradish peroxidase-labeled goat anti-rabbit IgG (H+L) (purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., number ZB-2301)) was diluted with 5 wt% skim milk at a volume ratio of 1:2000, and cultured on a shaker at room temperature for 1 hour. Then, the PVDF film was eluted 3 times with excess TBST buffer for 5 minutes each time. The washed PVDF film was obtained.

[0476] Using a Western luminescence detection kit (purchased from Vigorous Biotechnology (Beijing) Co., Ltd., number P004), a protein blot was photographed according to the steps described in the instruction manual. Specifically, solution A and solution B (contained in the Western luminescence detection kit) were mixed at a ratio of 1:1 (v / v) to obtain a horseradish peroxidase reaction substrate solution (HRP reaction substrate), and the HRP reaction substrate was applied to the washed PVDF film. [[ID=3G]] The PVDF film coated with the HRP reaction substrate was placed in an imager, and the protein marker was photographed in the bright field mode according to the method described in the instruction manual. The protein luminescence band was photographed in the chemiluminescence mode, and the exposure time was 10 min.

[0477] The PVDF film coated with the HRP reaction substrate was placed in an imager, and the protein marker was photographed in the bright field mode according to the method described in the instruction manual. The protein luminescence band was photographed in the chemiluminescence mode, and the exposure time was 10 min. The protein luminescence band was photographed, and the exposure time was 10 min.

[0478] As can be seen from the protein marker imaging results, the control group and each test group at different time points were All of them showed clear protein markers. And with ImageJ software... Protein markers were analyzed, and the protein blocks of each test group were compared with the control group and at different time points. The light intensity values ​​of the retband were obtained. Analysis revealed that each test group compared to the data of the control group and D0. Furthermore, the light intensity values ​​of the protein blot bands decreased significantly at different time points after administration. It was revealed that...

[0479] Furthermore, the light intensity values ​​of the protein blot bands in the control group were used as a reference, and the values ​​of the test group at each time point were used as a reference. The light intensity values ​​of the KNG protein blot bands were standardized, and the protein expression level of the control group was set to 1. Defined as 00%, the relative expression level of KNG protein in the test group was calculated using the following formula. .

[0480] KNG protein relative expression level = (light intensity value of the KNG protein blot band in the test group / (Optical intensity value of KNG protein blot band in the control group) × 100% Suppression rate of KNG protein expression = (1 - relative expression level of KNG protein) × 10 0%

[0481] For the test group, the relative expression level and suppression rate were the arithmetic mean of the test results from two mice. That is the case.

[0482] Figure 3 shows the relative expression of KNG protein in the control group and test group samples at different blood sampling times. The level was indicated.

[0483] As can be seen from the results in Figure 3, the siRNA complex provided in this disclosure is used in mouse bodies In the test plasma samples, it showed excellent inhibitory activity against KNG protein. The siRNA complex provided by [company name] is transmitted over a long period of 28 days to test plasma samples. The KNG protein inhibition rate in all cases reached over 97%, and even approximately 99%, indicating that inhibition is possible. The inhibitory effect was significant. From this, it can be concluded that the siRNA complex of this disclosure controls the KNG protein It can effectively suppress expression, and therefore is useful in the treatment of KNG-related diseases, especially sepsis. It is clear that there is great potential for its application.

[0484] Although several embodiments of this disclosure have been described in detail above, this disclosure is not limited to the embodiments described above. Not limited to physical details, but within the scope of the technical concept of this disclosure, the technical solutions of this disclosure are also applicable. Several types of simple modifications can be made, and all of these simple modifications are protected under the protection of this disclosure. It belongs to the range.

[0485] In addition to the above, there are specific techniques described in the various embodiments described above. Technical features can be combined in any appropriate way, provided there is no contradiction, and unnecessary To avoid unnecessary repetition, this disclosure does not separately describe various possible combination methods.

[0486] Furthermore, the various different embodiments of this disclosure can be combined in any way that aligns with the spirit of this disclosure. Unless it deviates from the above, such combinations should also be considered as being disclosed in this disclosure. be.

Claims

1. An siRNA that suppresses the expression of the kininogen (KNG) gene in hepatocytes, The siRNA is a siRNA comprising a sense strand and an antisense strand, wherein each nucleotide of the siRNA is independently modified or unmodified. The sense chain and the antisense chain have the same or different lengths. The sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides. The sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II, and nucleotide sequence I and nucleotide sequence II form a double-stranded region that is substantially or completely inversely complementary. The nucleotide sequence I and the nucleotide sequence II are selected from the sequences shown in i) to vi) below. i) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:

4. 5'-AAAGUAACAACCAGUUUGZ 3-3' (Sequence ID 3), 5'-Z 4 CAAAACUGGUUGUUACUUU-3' (Sequence ID 4) However, Z4 is selected from A, U, G, or C. Z4 is the first nucleotide at the 5' end of the antisense strand, and Z3 is the first nucleotide at the 3' end of the sense strand. ii) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 63, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:

64. 5'-AUUGAACUUUCGAAUUACZ 7-3' (Sequence ID 63), 5'-Z 8 GUAAUUCGAAAAGUUCAAU-3' (Sequence ID 64) However, Z 8 is selected from A, U, G, or C. Z8 is the first nucleotide at the 5' end of the antisense strand, and Z7 is the first nucleotide at the 3' end of the sense strand. iii) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 123, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:

124. 5'-UCGAAUUACCUACUCAAUZ 11-3' (Sequence ID 123), 5'-Z 12 AUUGAGUGGUAAUUCGA-3' (Sequence ID 124) However, Z 12 is selected from A, U, G, or C. Z12 is the first nucleotide at the 5' end of the antisense strand, and Z11 is the first nucleotide at the 3' end of the sense strand. iv) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 183, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:

184. 5'-GAAUAAUGCAUACAUCGAUZ 15-3' (Sequence ID 183), 5'-Z 16 AUCGAAUGUAUGCAUUAUC-3' (Sequence ID 184) However, Z 16 is selected from A, U, G, or C. Z16 is the first nucleotide at the 5' end of the antisense strand, and Z15 is the first nucleotide at the 3' end of the sense strand. v) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 243, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:

244. 5'-GAAUAACGCCAACUUUCUAZ 19-3' (Sequence ID 243), 5'-Z 20 UAGAAAGUUGCGGUUAUUC-3' (Sequence ID 244) However, Z 20 is selected from A, U, G, or C. Z20 is the first nucleotide at the 5' end of the antisense strand, and Z19 is the first nucleotide at the 3' end of the sense strand. vi) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 303, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:

304. 5'-AACUUUCUAUUUCAAGAUZ 23-3' (Sequence ID 303), 5'-Z 24 AUCUUGAAAUAGAAAGUU-3' (Sequence ID 304) However, Z 24 is selected from A, U, G, or C. Z24 is the first nucleotide at the 5' end of the antisense strand, and Z23 is the first nucleotide at the 3' end of the sense strand, in this siRNA.

2. Z 3 is, Z 4 It is a complementary nucleotide, or Z 7 is, Z 8 It is a complementary nucleotide, or Z 11 is, Z 12 It is a complementary nucleotide, or Z 15 is, Z 16 It is a complementary nucleotide, or Z 19 is a nucleotide complementary to Z 20 or Z 23 is, Z 24 The siRNA according to claim 1, which is a nucleotide complementary to the siRNA.

3. The siRNA according to claim 1, wherein the sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence IV, the lengths of nucleotide sequence III and nucleotide sequence IV are independently 1 to 4 nucleotides, nucleotide sequence III is attached to the 5' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 3' end of nucleotide sequence II, and nucleotide sequence III and nucleotide sequence IV are of equal length and substantially inversely complementary or completely inversely complementary, wherein substantially inversely complementary means that there is one or fewer base mismatches between the two nucleotide sequences, and completely inversely complementary means that there are no mismatches between the two nucleotide sequences.

4. The nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO: 1, and the difference between it and the nucleotide sequence shown in SEQ ID NO: 1 is 1 nucleotide or less, and the nucleotide sequences III and IV are both 1 nucleotide in length, and the base of nucleotide sequence III is C, or the nucleotide sequences III and IV are both 2 nucleotides in length, and the base sequence of nucleotide sequence III is CC from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 3 nucleotides in length, and the base sequence of nucleotide sequence III is ACC from the 5' end to the 3' end, or the nucleotide sequences III and IV are both 4 nucleotides in length, and the base sequence of nucleotide sequence III is AACC from the 5' end to the 3' end. Alternatively, nucleotide sequence I may be of equal length to the nucleotide sequence shown in SEQ ID NO: 61, with a difference of 1 nucleotide or less from the nucleotide sequence shown in SEQ ID NO: 61, and nucleotide sequences III and IV may both be of 1 nucleotide in length, with the base of nucleotide sequence III being G, or nucleotide sequences III and IV may both be of 2 nucleotides, with the base sequence of nucleotide sequence III being GG from the 5' end to the 3' end, or nucleotide sequences III and IV may both be of 3 nucleotides, with the base sequence of nucleotide sequence III being UGG from the 5' end to the 3' end, or nucleotide sequences III and IV may both be of 4 nucleotides, with the base sequence of nucleotide sequence III being CUGG from the 5' end to the 3' end. Alternatively, nucleotide sequence I may be of equal length to the nucleotide sequence shown in SEQ ID NO: 121, with a difference of 1 nucleotide or less from the nucleotide sequence shown in SEQ ID NO: 121, and nucleotide sequences III and IV may both be of 1 nucleotide in length, with the base of nucleotide sequence III being U, or nucleotide sequences III and IV may both be of 2 nucleotides, with the base sequence of nucleotide sequence III being UU from the 5' end to the 3' end, or nucleotide sequences III and IV may both be of 3 nucleotides, with the base sequence of nucleotide sequence III being CUU from the 5' end to the 3' end, or nucleotide sequences III and IV may both be of 4 nucleotides, with the base sequence of nucleotide sequence III being ACUU from the 5' end to the 3' end. Alternatively, nucleotide sequence I may be equal in length to the nucleotide sequence shown in SEQ ID NO: 181, with a difference of 1 nucleotide or less from the nucleotide sequence shown in SEQ ID NO: 181, and nucleotide sequences III and IV may both be 1 nucleotide in length, with the base of nucleotide sequence III being A, or nucleotide sequences III and IV may both be 2 nucleotides in length, with the base sequence of nucleotide sequence III being CA from the 5' end to the 3' end, or nucleotide sequences III and IV may both be 3 nucleotides in length, with the base sequence of nucleotide sequence III being ACA from the 5' end to the 3' end, or nucleotide sequences III and IV may both be 4 nucleotides in length, with the base sequence of nucleotide sequence III being UACA from the 5' end to the 3' end. Alternatively, nucleotide sequence I may be equal in length to the nucleotide sequence shown in SEQ ID NO: 241, with a difference of 1 nucleotide or less from the nucleotide sequence shown in SEQ ID NO: 241, and nucleotide sequences III and IV may both be 1 nucleotide in length, with the base of nucleotide sequence III being A, or nucleotide sequences III and IV may both be 2 nucleotides in length, with the base sequence of nucleotide sequence III being GA from the 5' end to the 3' end, or nucleotide sequences III and IV may both be 3 nucleotides in length, with the base sequence of nucleotide sequence III being AGA from the 5' end to the 3' end, or nucleotide sequences III and IV may both be 4 nucleotides in length, with the base sequence of nucleotide sequence III being CAGA from the 5' end to the 3' end. Alternatively, the siRNA according to claim 3, wherein nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO: 301, and the difference between it and the nucleotide sequence shown in SEQ ID NO: 301 is 1 nucleotide or less, and nucleotide sequences III and IV are both 1 nucleotide in length, and the base of nucleotide sequence III is C, or nucleotide sequences III and IV are both 2 nucleotides in length, and the base sequence of nucleotide sequence III is GC from the 5' end to the 3' end, or nucleotide sequences III and IV are both 3 nucleotides in length, and the base sequence of nucleotide sequence III is CGC from the 5' end to the 3' end, or nucleotide sequences III and IV are both 4 nucleotides in length, and the base sequence of nucleotide sequence III is ACGC from the 5' end to the 3' end.

5. The siRNA according to claim 1, wherein the antisense strand further comprises a nucleotide sequence V, the nucleotide sequence V having a length of 1 to 3 nucleotides, and is bound to the 3' end of the antisense strand, constituting the 3' protruding end of the antisense strand.

6. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 5, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

6. 5'-AAAGUAACAACCAGUUUGZ 3 -3' (Sequence ID 5), 5'-Z 4 CAAAACUGGUUGUUACUUUGG-3' (Sequence ID 6) Alternatively, the sense strand of the siRNA includes the nucleotide sequence shown in SEQ ID NO: 7, and the antisense strand includes the nucleotide sequence shown in SEQ ID NO:

8. 5'-CCAAAGUAAACAACCAGUUUGZ 3 -3' (Sequence ID 7), 5'-Z 4 CAAAACUGGUUGUUACUUUGGUU-3' (Sequence ID 8) However, the above Z 4 Z is the first nucleotide at the 5' end of the antisense strand. 3 is selected from A, U, G, or C, and Z 4 is, Z 3 It is a complementary nucleotide, Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 65, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

66. 5'-AUUGAACUUUCGAAUUACZ 7 -3' (Sequence ID 65), 5'-Z 8 GUAAUUCGAAAAGUUCAAUCC-3' (Sequence ID 66) Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 67, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

68. 5'-GGAUUGAACUUUCGAAUUACZ 7 -3' (Sequence ID 67), 5'-Z 8 GUAAUUCGAAAAGUUCAAUCCAG-3' (Sequence ID 68) However, the above Z 8 Z is the first nucleotide at the 5' end of the antisense strand. 7 is selected from A, U, G, or C, and Z 8 is, Z 7 It is a complementary nucleotide, Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 125, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

126. 5'-UCGAAUUACCUACUCAAUZ 11 -3' (Sequence ID 125), 5'-Z 12 AUUGAGUGGUAAUUCGAAAA-3' (Sequence ID 126) Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 127, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

128. 5'-UUUCGAAUUACCUACUCAAUZ 11 -3' (Sequence ID 127), 5'-Z 12 AUUGAGUGGUAAUUCGAAAAGU-3' (Sequence ID 128) However, the above Z 12 Z is the first nucleotide at the 5' end of the antisense strand. 11 is selected from A, U, G, or C, and Z 12 is, Z 11 It is a complementary nucleotide, Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 185, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

186. 5'-GAUAAUGCAUACAUCGAUZ 15 -3' (Sequence ID 185), 5'-Z 16 AUCGAAUGUAUGCAUUAUCUG-3' (Sequence ID 186) Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 187, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

188. 5'-CAGAUAAUGCAUACAUCGAUZ 15 -3' (Sequence ID 187), 5'-Z 16 AUCGAAUGUAUGCAUUAUCUGUA-3' (Sequence ID 188) However, the above Z 16 Z is the first nucleotide at the 5' end of the antisense strand. 15 is selected from A, U, G, or C, and Z 16 is, Z 15 It is a complementary nucleotide, Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 245, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

246. 5'-GAAUAAACGCAACUUUCUAZ 19 -3' (Sequence ID 245), 5'-Z 20 UAGAAAGUUGCGUUAUUCUC-3' (Sequence ID 246) Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 247, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

248. 5'-GAGAAUAAACGCAACUUUCUAZ 19 -3' (Sequence ID 247), 5'-Z 20 UAGAAAGUUGCGGUUAUUCUCUG-3' (Sequence ID 248) However, the above Z 20 Z is the first nucleotide at the 5' end of the antisense strand. 19 is selected from A, U, G, or C, and Z 20 is, Z 19 It is a complementary nucleotide, Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 305, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

306. 5'-AACUUUCUAUUUCAAGAUZ 23 -3' (Sequence ID 305), 5'-Z 24 AUCUUGAAAUAGAAAGUGC-3' (Sequence ID 306) Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 307, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:

308. 5'-GCAACUUUCUAUUUCAAGAUZ 23 -3' (Sequence ID 307), 5'-Z 24 AUCUUGAAAUAGAAAGUGCGU-3' (Sequence ID 308) However, the above Z 24 Z is the first nucleotide at the 5' end of the antisense strand. 23 is selected from A, U, G, or C, and Z 24 is, Z 23 The siRNA according to claim 5, which is a nucleotide complementary to the above.

7. Each nucleotide in the sense strand and the antisense strand is independently either a fluoromodified nucleotide or an unfluoromodified nucleotide. The siRNA according to claim 1, wherein the fluoromodified nucleotides are located in nucleotide sequence I and nucleotide sequence II, and from the 5' end toward the 3' end, at least the nucleotides at positions 7, 8, and 9 of nucleotide sequence I are fluoromodified nucleotides, and from the 5' end toward the 3' end, at least the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II are fluoromodified nucleotides.

8. Each non-fluoromodified nucleotide is independently selected from nucleotides or nucleotide analogs in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is substituted with a non-fluorinated group, or A nucleotide in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is substituted with a nonfluorine group is one selected from 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides, and the nucleotide analog is one selected from isonucleotides, LNA, ENA, cET, UNA, and GNA, or The siRNA according to claim 7, wherein each non-fluoromodified nucleotide is a methoxy-modified nucleotide, and the methoxy-modified nucleotide refers to a nucleotide in which the 2'-hydroxyl group of the ribose group is replaced with methoxy.

9. From the 5' end towards the 3' end, the nucleotides at positions 7, 8, and 9 of nucleotide sequence I in the sense strand of the siRNA are fluoromodified nucleotides, and the nucleotides at the remaining positions of the siRNA sense strand are methoxymodified nucleotides; From the 5' end towards the 3' end, the nucleotides at positions 2, 6, 8, 9, 14, and 16 of nucleotide sequence II in the antisense strand of the siRNA are fluoromodified nucleotides, and the nucleotides at the remaining positions of the siRNA antisense strand are methoxymodified nucleotides. Alternatively, from the 5' end to the 3' end, the nucleotides at positions 5, 7, 8 and 9 of nucleotide sequence I in the sense strand of the siRNA are fluoromodified nucleotides, and the remaining nucleotides in the sense strand of the siRNA are methoxymodified nucleotides; and from the 5' end to the 3' end, the nucleotides at positions 2, 6, 14 and 16 of nucleotide sequence II in the antisense strand of the siRNA are fluoromodified nucleotides, and the remaining nucleotides in the antisense strand of the siRNA are methoxymodified nucleotides. Alternatively, the siRNA according to claim 8, wherein, from the 5' end to the 3' end, the nucleotides at positions 7, 8 and 9 of nucleotide sequence I in the sense strand of the siRNA are fluoromodified nucleotides, and the nucleotides at the remaining positions of the sense strand of the siRNA are methoxymodified nucleotides, and from the 5' end to the 3' end, the nucleotides at positions 2, 6, 14 and 16 of nucleotide sequence II in the antisense strand of the siRNA are fluoromodified nucleotides, and the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxymodified nucleotides.

10. In the siRNA, the thiophosphate ester group is Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second and third nucleotides from the 3' end of the sense strand, Between the first and second nucleotides from the 5' end of the antisense strand, Between the second and third nucleotides from the 5' end of the aforementioned antisense strand, Between the first and second nucleotides from the 3' end of the antisense strand, and The siRNA according to claim 1, wherein the siRNA is bound to at least one selected from the group consisting of the space between the second and third nucleotides from the 3' end of the antisense strand.

11. The 5' terminal nucleotide of the antisense strand of the siRNA is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide. Alternatively, the 5'-phosphate nucleotide is a nucleotide having the structure shown in formula (2), and the 5'-phosphate analog modified nucleotide is selected from nucleotides having the structure shown in any one of formulas (3) to (6). 【Chemistry 1】 The siRNA according to claim 1, wherein R is selected from H, OH, a methoxy group or fluorine, and Base represents a base and is selected from A, U, C, G or T.

12. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 9, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

10. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 11, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

12. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 69, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

70. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 71, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

72. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 129, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

130. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 131, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

132. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 189, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

190. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 191, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

192. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 249, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

250. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 251, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

252. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 309, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

310. Alternatively, the sense strand of the siRNA may include the nucleotide sequence shown in SEQ ID NO: 311, and the antisense strand may include the nucleotide sequence shown in SEQ ID NO: 312, or The sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 13, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:

14. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 15, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

16. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 17, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

18. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 19, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

20. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 21, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

22. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 23, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

24. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 73, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

74. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 75, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

76. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 77, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

78. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 79, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

80. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 81, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

82. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 83, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

84. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 133, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

134. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 135, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

136. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 137, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

138. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 139, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

140. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 141, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

142. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 143, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

144. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 193, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

194. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 195, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

196. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 197, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

198. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 199, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

200. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 201, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

202. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 203, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

204. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 253, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

254. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 255, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

256. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 257, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

258. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 259, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

260. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 261, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

262. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 263, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

264. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 313, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

314. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 315, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

316. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 317, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

318. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 319, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

320. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 321, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

322. Alternatively, the sense strand of the siRNA may contain the nucleotide sequence shown in SEQ ID NO: 323, and the antisense strand may contain the nucleotide sequence shown in SEQ ID NO: 324, or The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 25, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

26. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 27, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

28. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 29, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

30. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 31, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

32. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 33, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

34. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 35, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

36. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 85, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

86. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 87, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

88. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 89, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

90. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 91, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

92. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 93, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

94. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 95, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

96. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 145, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

146. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 147, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

148. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 149, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

150. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 151, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

152. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 153, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

154. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 155, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

156. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 205, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

206. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 207, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

208. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 209, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

210. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 211, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

212. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 213, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

214. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 215, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

216. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 265, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

266. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 267, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

268. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 269, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

270. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 271, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

272. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 273, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

274. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 275, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

276. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 325, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

326. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 327, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

328. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 329, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

330. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 331, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

332. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 333, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

334. Alternatively, the sense strand of the siRNA may contain the nucleotide sequence shown in SEQ ID NO: 335, and the antisense strand may contain the nucleotide sequence shown in SEQ ID NO: 336, or The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 37, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

38. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 39, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

40. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 41, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

42. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 43, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

44. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 45, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

46. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 47, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

48. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 49, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

50. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 51, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

52. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 53, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

54. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 55, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

56. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 57, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

58. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 59, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

60. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 97, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

98. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 99, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

100. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 101, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

102. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 103, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

104. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 105, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

106. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 107, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

108. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 109, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

110. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 111, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

112. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 113, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

114. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 115, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

116. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 117, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

118. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 119, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

120. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 157, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

158. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 159, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

160. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 161, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

162. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 163, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

164. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 165, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

166. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 167, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

168. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 169, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

170. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 171, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

172. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 173, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

174. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 175, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

176. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 177, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

178. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 179, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

180. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 217, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

218. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 219, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

220. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 221, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

222. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 223, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

224. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 225, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

226. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 227, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

228. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 229, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

230. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 231, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

232. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 233, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

234. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 235, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

236. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 237, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

238. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 239, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

240. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 277, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

278. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 279, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

280. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 281, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

282. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 283, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

284. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 285, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

286. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 287, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

288. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 289, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

290. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 291, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

292. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 293, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

294. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 295, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

296. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 297, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

298. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 299, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

300. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 337, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

338. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 339, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

340. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 341, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

342. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 343, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

344. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 345, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

346. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 347, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

348. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 349, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

350. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 351, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

352. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 353, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

354. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 355, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

356. Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 357, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

358. Alternatively, the siRNA according to claim 1, wherein the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 359, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

360.

13. A drug composition characterized by comprising the siRNA described in claim 1 and a pharmaceutically acceptable carrier.

14. A siRNA complex comprising the siRNA described in claim 1 and a complex group that is bound to the siRNA.

15. A composition for the treatment and / or prevention of sepsis, comprising the siRNA described in any one of claims 1 to 12, the drug composition described in claim 13, and / or the siRNA complex described in claim 14.

16. A composition for suppressing KNG gene expression, comprising the siRNA described in any one of claims 1 to 12, the drug composition described in claim 13, and / or the siRNA complex described in claim 14.