Preparation method of male sterility rice using Os05g20150 gene, composition for inducing male sterility of rice and male sterility rice

KR102998313B1Active Publication Date: 2026-08-03UNIVERSITY INDUSTRY COOPERATION GROUP OF KYUNG HEE UNIVERSITY +2
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
KR1020220117955
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Priority Date
2022-06-16
Filing Date
2022-09-19
Publication Date
2026-08-03
Estimated Expiration
2042-09-19

Smart Images

  • Figure 112022098237478-PAT00002_ABST
    Figure 112022098237478-PAT00002_ABST
Patent Text Reader

Abstract

The present invention relates to a method for producing male sterility and male sterile rice produced therefrom. According to the present invention, when the Os05g20150 gene is mutated and its expression and function are suppressed, pollen germination and pollen tube elongation are reduced, thereby causing male sterility. Therefore, the method for producing a male sterile line through the regulation of the activity of the Os05g20150 gene according to the present invention and the male sterile line produced therefrom are intended to effectively improve existing breeding methods. Since they can be used stably with almost no environmental influence, they can contribute significantly to the development of the rice breeding industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention Os05g20150 The present invention relates to a method for producing male-sterile rice using a gene, a composition for inducing male sterility in rice, and male-sterile rice. Background Technology

[0003] rice( Oryza sativa Rice is a plant that produces rice, which is a staple food in more than one-third of countries worldwide, as well as in Korea. It is one of the most economically important crops, and much research is being conducted to increase production yields. To increase rice yields, the production of F1 hybrids through the introduction of male sterility is a technological development that is attracting the attention of researchers around the world. Although cytoplasmic male sterility (CMS) is possible in rice, it is not realistic in terms of production costs or actual application. In the development of male-sterile transgenic plants through genetic engineering, a method is being used to induce male sterility by using a tapetum-specific promoter and external toxic genes (bacterial or plant genes) to induce selective death of stamen tissue.

[0004] Meanwhile, in flowering plants, pollen formation and subsequent pollination and fertilization are critical stages for sexual reproduction. Pollen development from microspores involves a series of coordinated cellular events, and mature pollen possesses specialized functions, such as rapid germination, the production of a polar-growing pollen tube (PT) derived from a vegetative cell, and the delivery of two sperm cells to the ovule. Efficient and rapid pollen germination and tube growth are known to be important for normal fertilization and fertilization ability.

[0005] Regarding mutations affecting rice pollen germination and tube growth, only a very small number of genes have been functionally identified to date. For example, mutations in rice OsSUT1 (Sucrose Transporter 1) cause male sterility. Pollen grains with OsSUT1 mutations generally accumulate starch during development but do not germinate or fertilize eggs. As another example, it is known that the destruction of the rice OsSPS1 (Sucrose Phosphate Synthase 1) gene results in the formation of sterile pollen. It was confirmed that mutants with the destroyed OsSPS1 gene accumulated sufficient starch in the pollen, but their germination efficiency was reduced to half that of the wild type.

[0006] To date, research on genes affecting rice pollen germination and tube growth has been extremely limited, and further research on genes that may cause male sterility is required. The problem to be solved

[0008] The inventors completed the present invention by confirming that when the expression of a specific gene in rice is suppressed and its function is lost, pollen germination and pollen tube elongation are reduced, causing male sterility.

[0009] Therefore, the objective of the present invention is to provide a method for producing male-sterile rice.

[0010] Another objective of the present invention is to provide male-sterile rice.

[0011] Another objective of the present invention is to provide a composition for inducing male sterility in rice.

[0012] Another objective of the present invention is to provide a method for confirming male sterility of rice.

[0013] Another objective of the present invention is to provide a composition for confirming male sterility of rice. means of solving the problem

[0015] To achieve the above objective, the present invention relates to rice Os05g20150 A method for producing male-sterile rice is provided, comprising a step of suppressing gene expression.

[0016] In addition, to achieve the above-mentioned other objectives, the present invention Os05g20150 Provides male-sterile rice with suppressed gene expression.

[0017] In addition, to achieve the above-mentioned other objectives, the present invention Os05g20150 A composition for inducing male sterility in rice is provided, comprising a preparation that inhibits gene expression.

[0018] In addition, to achieve the above-mentioned other objectives, the present invention Os05g20150 A method for confirming male sterility in rice is provided, comprising the step of measuring whether gene expression is present.

[0019] In addition, to achieve the above-mentioned other objectives, the present invention Os05g20150 A composition for confirming male sterility in rice is provided, comprising a preparation for measuring the mRNA or protein level of a gene. Effects of the invention

[0021] The present invention Os05g20150 The present invention relates to a method for producing male-sterile rice with inhibited gene expression and function, and male-sterile rice produced therefrom. According to the present invention, Os05g20150 It was confirmed that male sterility is induced in rice in which gene expression and function are suppressed, due to reduced pollen germination and pollen tube elongation. According to the present invention Os05g20150 A method for producing a male-sterile line through the regulation of gene activity and a male-sterile line produced therefrom are intended to effectively improve existing breeding methods and can be used stably with minimal environmental influence, thereby contributing significantly to the development of the rice breeding industry. Brief explanation of the drawing

[0023] Figure 1 shows the identification of pollen-specific genes in rice, and Figure 1(a) shows independent pollen-specific genes ( Os05g20150 This is the result of confirming ). Figure 1(b) shows the confirmed pollen-specific gene ( Os05g20150 This is the result of the RT-qPCR (Reverse transcription-quantitative polymerase chain reaction) analysis. In Figure 1(b) above, the RT-qPCR analysis was performed using various rice tissues including 7-day-old shoots and roots, leaf blades of mature plants, young panicles 2 cm in length, whole mature flowers, seeds 3 days after pollination, and anthers at the tetrad, microspore (Msp), vaculoated young pollen (YP), and mature pollen (MP) stages. The analysis was performed through three biological and technical replications, and the results showed rice ubiquitin 5 ( OsUbi5The values ​​were normalized using Os01g22490), and the values ​​were expressed as means ± standard deviation. In Figure 1(a), PMe (Pre-meiosis) refers to the pre-meiotic stage, Me (Meiosis stage) refers to the meiotic stage, UG (Unicellular gametophyte stage) refers to the unicellular gametophyte stage, BG (Bicellular gametophyte stage) refers to the bicellular gametophyte stage, TG (Tricellular pollen stage) refers to the tricellular pollen stage, FI (Flowering stage) refers to the flowering stage, ACF (archesporial cell-forming stage) refers to the early differentiated cell stage, MP (Mature pollen stage) refers to the mature pollen stage, and GP (Germinated pollen stage) refers to the germinated pollen stage. FIG. 2 shows a pollen-specific gene identified according to the present invention ( Os05g20150 This confirms the effect of ) on rice male transmission, and Fig. 2(a) is Os05g20150 It shows the gene structure, the T-DNA insertion site, and the location of the CRISPR target site. In the above Fig. 2(a), the CRISPR / Cas9 target site is underlined, and the homozygous mutant ( osmtd2-2 The deleted positions of the nucleotides are indicated by boxes. osmtd2-2The modified amino acid codon was terminated prematurely. Fig. 2(b) shows the results of the segregation analysis of progeny of the T-DNA-inserted heterozygous mutant (3A-51606) by PCR (polymerase chain reaction)-based penotyping. In Fig. 2(b), WT represents the wild-type, HZ represents the heterozygote, and HM represents the homozygote, ( osmtd2-1 Represents )). To evaluate the relationship between the observed data and the predicted ratio 1:1, X 2 -Test(X 2 -test) was performed. Figure 2(c) is osmtd2-2 Figures 2(d) to 2(h) show the results of its vegetative growth and reproductive development, respectively. Wild type (WT) and osmtd2-2 After removing the lemma and palea (Fig. 2(e)), the spikelets (Fig. 2(d)) and flower organs were photographed using a stereo microscope. Pollen grains stained with KI2 (Fig. 2(f)) and pollen walls stained with auramine and calcofluor (Fig. 2(g)) were photographed using bright channel, GFP, and UV fluorescence microscopes, respectively. The panicle after pollen grain maturation was photographed using a camera (Fig. 2(h)). osmtd2-2 Two different rows of panicle photographs were merged (Scale bars: 20 cm (Fig. 2(c), Fig. 2(h)), 2 mm (Fig. 2(d), Fig. 2(e)). FIG. 3 shows a pollen-specific gene identified according to the present invention ( Os05g20150This confirms the effect of ) on pollen formation; Fig. 3(a) shows the results for in vivo pollen tube growth of wild-type (WT) stained with aniline blue, and Fig. 3(b) stained with aniline blue osmtd2-2 These are the results regarding in vivo pollen tube growth, and Fig. 3(c) is the statistics of the above results. Figs. 3(d) to 3(f) show the wild type (WT) and osmtd2-2 This is the result of confirming in vitro pollen germination. In Figures 3(e) and 3(f), the scale bar represents 200 μm. Figure 4 shows the wild type and osmtd2-2 As a result of confirming the distribution of pectin in the pollen tubes between, Fig. 4(a) shows WT and germinated after 1-2 minutes and 5-10 minutes in the test tube. osmtd2-2 Figure 4(b) shows the results of collecting pollen, labeling it with LM19, and examining it under a confocal microscope, while Figure 4(b) shows the results of labeling it with LM20 and examining it under a confocal microscope. The scale bar represents 10 μm. Figure 4(c) shows the results of quantifying LM19 and LM20 fluorescence intensity (FI) in the tip and shank regions. The error bar represents the standard deviation (SD) of at least 10 independent tubes. **P<0.01. Figure 5 shows the wild type (WT) and osmtd2-2As a result of confirming the generation of Reactive Oxygen Species (ROS) during pollen tube growth, Fig. 5(a) shows hydrated pollen grains stained with CM-H2DCFDA and FM4-64. The endomembrane of the hydrated pollen grain was stained with CM-H2DCFDA. Fig. 5(b) confirms the generation of ROS during pollen tube germination, and immediately germinated pollen grains in solid pollen media were stained with CM-H2DCFDA and FM4-64. Figs. 5(c) and 5(d) are confocal images of pollen tubes stained with CM-H2DCFDA in solid media. The scale bar in Fig. 5(c) is 20 μm, and the scale bar in Fig. 5(d) is 10 μm. Figure 6 shows wild-type (WT) and OsMTD2 gene function deletion plants ( osmtd2 This is a diagram showing a schematic representation of the pollen tube development mechanism of ). Specific details for implementing the invention

[0024] The present invention will be described in detail below.

[0025] While conducting various studies to produce male-sterile rice, the inventors of the present invention, Os05g20150 Confirmed that this is a gene involved in pollen germination and pollen tube elongation, Os05g20150 The present invention was completed by confirming that male-sterile rice can be produced by suppressing gene expression.

[0026] Therefore, the present invention relates to rice. Os05g20150 A method for producing male-sterile rice is provided, comprising a step of suppressing gene expression.

[0027] In this invention, the term "rice" refers to the scientific name Oryza sativa L. is an annual herbaceous plant, and the rice in the present invention may be any one selected from the group consisting of Japonica type, Indica type and Javanica type.

[0028] In the present invention, the above " Os05g20150 " may mean a gene consisting of a nucleotide sequence indicated by sequence number 1, but may also be interpreted to include a sequence that exhibits substantial identity with it.

[0029] The above substantial identity refers to a sequence in which, when the sequence of SEQ ID NO. 1 is aligned with any other sequence to the greatest extent possible and the aligned sequence is analyzed using an algorithm commonly used in the art, it exhibits at least 60% homology, more specifically 70% homology, even more specifically 80% homology, and most specifically 90% homology. Alternatively, the above gene is a protein encoded by the gene of SEQ ID NO. 1. Os05g20150 It may refer to a gene encoding a protein that exhibits substantially the same physiological activity. In the present invention, the above Os05g20150 The gene can be named the "OsMTD2 gene".

[0030] In the present invention, "male sterility" refers to a phenomenon in which pollination, fertilization, and seeding do not occur due to morphological or functional abnormalities of male organs; while it may manifest as a temporary environmental variation or as a genetic trait, male sterility in the present invention may be induced as a genetic trait. In particular, male sterility in the present invention refers to the nucleus involved in pollen germination and pollen tube elongation. Os05g20150 It may be induced by suppressing gene expression.

[0031] In the present invention, the above step Os05g20150This may be achieved by substituting or deleting one or more bases of a gene, for example, by substituting or deleting 10%, specifically 0.01% or more of the bases of the whole DNA. More preferably, it may be achieved by substituting or deleting five bases. In addition, the above step may be achieved by T-DNA insertion or gene editing by CRISPR-Cas9.

[0032] In the present invention, the above Os05g20150 The gene may have a base sequence at positions 100 to 115 substituted or deleted, and more preferably, the TCTCC bases at positions 106 to 110 substituted or deleted, and said 106 to 110 positions deleted Os05g20150 A gene may consist of a nucleotide sequence represented by sequence number 2.

[0033] In addition, the above step may be performed by T-DNA insertion. According to one embodiment of the present invention Os05g20150 It was confirmed that when a mutant with T-DNA inserted into the gene was used as a female donor and crossed with male-fertile rice, the segregation ratio of normal offspring to heterozygous offspring was approximately 1:1 (1:1.12). Therefore Os05g20150 It was confirmed that the gene is essential for male-gamete gene transmission. In the present invention, the T-DNA Os05g20150 There are no specific restrictions on the location where the gene is inserted, and in one embodiment of the present invention Os05g20150 It was confirmed that it is inserted at a position of approximately 1,350 bp in the exon region of the gene and causes male sterility.

[0034] In addition, the above steps may be performed using, but are not limited to, foreign genes capable of being inserted into the plant genome such as T-DNA, endogenous transposons such as TOS17, inducing mutations by injecting X-rays or gamma rays, or using RNAi or antisense methods.

[0035] In the present invention, the "T-DNA" refers to a DNA fragment that is transferred into the nucleus of a host plant cell as transfer DNA within the Ti (tumor-inducing) plasmid of the Agrobacterium species. There are 25 bp repeat sequences at both ends of the T-DNA, and transfer begins at the left border and ends at the right border. Bacterial T-DNA is approximately 20,000 bp in length and is used to induce insertional mutagenesis by disrupting target genes through insertion, and the inserted T-DNA sequence not only causes mutations but also marks target genes.

[0036] If the above step is performed by gene editing using CRISPR-Cas9, Os05g20150 This can be achieved by targeting bases at positions 281 to 300 bp of the gene (see Fig. 2(a)).

[0037] In addition, the method described above Os05g20150 It may further include a step of crossing male-fertile rice with a maternal parent of rice in which gene expression is suppressed. Conversely, Os05g20150 If the step of crossing a wild-type parent with a rice plant in which gene expression is suppressed is additionally included, male-sterile rice cannot be produced.

[0038] The above-mentioned crossbreeding method may use any of the previously known methods, for example, the most commonly used crossbreeding method for rice may be used, but is not limited thereto.

[0039] In addition, the present invention Os05g20150 Provides male-sterile rice with suppressed gene expression.

[0040] The above rice may be any one selected from the group consisting of Japonica, Indica, and Javanica types, and is applicable to all rice varieties.

[0041] The male sterility of the above-mentioned rice may be reversible. That is, the fertility of the above-mentioned male-sterile rice is normal Os05g20150 It can be restored by the introduction of genes.

[0042] In addition, the present invention Os05g20150 A composition for inducing male sterility in rice is provided, comprising a preparation that inhibits gene expression.

[0043] The above preparation is Os05g20150 By binding directly or indirectly to genes or mRNA Os05g20150 It refers to a substance that can inhibit the expression of.

[0044] For example, the above preparation is Os05g20150 It may be one or more selected from the group consisting of siRNA, shRNA, miRNA, ribozyme, PNA (peptide nucleic acid), and antisense oligonucleotides that specifically bind to the mRNA of a gene, but is not limited thereto. That is, the above siRNA, shRNA, miRNA, ribozyme, PNA (peptide nucleic acid), or antisense oligonucleotide Os05g20150 It specifically binds to the mRNA of the gene Os05g20150 It can inhibit translation for protein synthesis.

[0045] In the present invention, the "siRNA" refers to a short double-stranded RNA capable of inducing RNAi (RNA interference) phenomena through the cleavage of a specific mRNA. It consists of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto. Since siRNA can suppress the expression of a target gene, it is an efficient gene knockdown method.

[0046] The above siRNA is not limited to a double-stranded RNA portion that forms a pair with another RNA, but may include a non-paired portion due to mismatch (corresponding bases are not complementary), bulge (lack of a corresponding base on one strand), etc. The total length is 10 to 100 bases, preferably 15 to 80 bases, and most preferably 20 to 70 bases. The siRNA terminal structure can be either a blunt end or a cohesive end, provided that it can inhibit the expression of the target gene by the RNAi effect. The cohesive end structure can be either a structure with a protruding 3-terminal end or a structure with a protruding 5-terminal end. The number of protruding bases is not limited. For example, the number of bases can be 1 to 8 bases, preferably 2 to 6 bases. In addition, the siRNA may include, for example, a small molecule RNA (e.g., natural RNA molecules such as tRNA, rRNA, or viral RNA, or artificial RNA molecules) in a protruding portion of one end, within a range that can maintain the effect of suppressing the expression of the target gene. The siRNA terminal structure does not need to have a cleavage structure on both ends, and may be a stem loop type structure in which one end of the double-stranded RNA is connected by a linker RNA. The length of the linker is not particularly limited as long as it is a length that does not hinder the pairing of the stem portions.

[0047] In the present invention, the "shRNA (short hairpin RNA)" refers to a single strand consisting of 50 to 70 nucleotides and forms a stem-loop structure in vivo. Long RNA of 19 to 29 nucleotides forms base pairs complementarily on both sides of the loop region of 5 to 10 nucleotides to form a double-stranded stem.

[0048] In the present invention, the "miRNA (microRNA)" refers to a single-stranded RNA molecule that regulates gene expression and consists of a total length of 20 to 50 nucleotides, preferably 20 to 45 nucleotides, more preferably 20 to 40 nucleotides, even more preferably 20 to 30 nucleotides, and most preferably 21 to 23 nucleotides. miRNA is an oligonucleotide that is not expressed within a cell and has a short stem-loop structure. miRNA has wholly or partially homology with one or more mRNAs (messenger RNAs) and inhibits target gene expression through complementary binding with said mRNAs.

[0049] In the present invention, the "ribozyme" refers to a type of RNA molecule that has an enzyme-like function of recognizing a specific RNA base sequence and cleaving it. The ribozyme consists of a region that specifically binds to the base sequence complementary to the target messenger RNA strand and a region that cleaves the target RNA.

[0050] In the present invention, "PNA (Peptide nucleic acid)" refers to a molecule that possesses the properties of both nucleic acids and proteins and is capable of binding complementarily to DNA or RNA. PNA is a DNA-like substance in which nucleobases are linked by peptide bonds; it is not found in nature and is synthesized artificially through chemical methods.

[0051] The above PNA forms a double strand by undergoing a hybridization reaction with natural nucleic acids of complementary base sequences. When comparing equal lengths, the PNA / DNA double strand is more stable than the DNA / DNA double strand, and the PNA / RNA double strand is more stable than the DNA / RNA double strand. The most commonly used peptide backbone consists of N-(2-aminoethyl)glycines repeatedly linked by amide bonds; in this case, the backbone of the peptide nucleic acid is electrically neutral, unlike the backbone of natural nucleic acids which carries a negative charge. The spatial size and distance between the four nucleic acid bases present in PNA are nearly identical to those of natural nucleic acids. PNA is not only chemically more stable than natural nucleic acids but is also biologically stable as it is not degraded by nucleases or proteases.

[0052] In the present invention, the term "antisense oligonucleotide" refers to DNA or RNA or a derivative thereof containing a nucleotide sequence complementary to the sequence of a specific mRNA, and is characterized by inhibiting the translation of the mRNA into a protein by binding to the complementary sequence within the mRNA. The antisense oligonucleotide sequence of the present invention refers to a DNA or RNA sequence that is complementary to the mRNA of a target gene and capable of binding to the mRNA of the target gene, and can inhibit essential activities regarding the translation, translocation into the cytoplasm, maturation, or all other overall biological functions of the mRNA of the target gene. The length of the antisense oligonucleotide is 6 to 100 bases, preferably 10 to 40 bases.

[0053] The above antisense oligonucleotide may be modified at one or more bases, sugars, or backbone positions to enhance efficacy. The oligonucleotide backbone may be modified with phosphorothioates, phosphotriesters, methyl phosphonates, short-chain alkyls, cycloalkyls, short-chain heteroatomics, heterocyclic inter-sugar bonds, etc. Additionally, the antisense nucleic acid may contain one or more substituted sugar moieties. The antisense oligonucleotide may contain modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-methylpyrimidine (especially 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, zentobiosil HMC, 2-aminoadenine, 2-thiouracil, 2-thiothimine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine, 2,6-diaminopurine, etc.

[0054] In addition, the present invention Os05g20150 A method for confirming male sterility in rice is provided, comprising the step of measuring whether gene expression is present.

[0055] The above Os05g20150 In the step of measuring whether gene expression is present, the target rice Os05g20150 By measuring whether the gene is expressed, if the expression is suppressed, the target rice can be determined to be male sterile.

[0056] The method for confirming the above male sterility is the above Os05g20150 This may be achieved by measuring the mRNA level of a gene or the level of a protein expressed therefrom.

[0057] The mRNA level of the above gene can be measured using a separate agent. The agent for measuring the mRNA level of the above gene may be, for example, a primer or probe capable of specifically binding to the above gene, but is not limited thereto.

[0058] In the present invention, the "primer" refers to a short nucleic acid sequence having a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and functioning as a starting point for template strand replication. DNA synthesis can be initiated in the presence of a primer, a reagent for a polymerization reaction (i.e., DNA polymerase or reverse transcriptase), and four different nucleoside triphosphates at an appropriate buffer solution and temperature.

[0059] Methods for measuring the mRNA level of the above gene may include, but are not limited to, reverse transcription-polymerase chain reaction (RT-PCR), quantitative RT-PCR (RT-qPCR), competitive RT-PCR, quantitative real-time PCR (qRT-PCR), RNase protection assay (RPA), Northern blotting, and DNA chip analysis.

[0060] The level of the above protein may be measured using a separate preparation. The preparation for measuring the level of the above protein may be, for example, an antibody or aptamer that specifically binds to the above protein, but is not limited thereto.

[0061] In the present invention, the term "antibody" refers to a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. Such an antibody may be produced by conventional methods by cloning each gene into an expression vector according to conventional methods to obtain a protein encoded by the marker gene, and from the obtained protein. The form of the antibody is not particularly limited, and polyclonal antibodies, monoclonal antibodies, or parts thereof having antigen-binding ability may be included in the antibody of the present invention, and all immunoglobulin antibodies may be included. In addition, special antibodies such as humanized antibodies may be included. Furthermore, the antibody includes not only a complete form having two full-length light chains and two full-length heavy chains, but also functional fragments of the antibody molecule. A functional fragment of the antibody molecule refers to a fragment possessing at least an antigen-binding function and may be Fab, F(ab'), F(ab') 2, Fv, etc.

[0062] In the present invention, the term "aptamer" refers to a single-stranded oligonucleotide and is a nucleic acid molecule having binding activity toward a specific target molecule. The aptamer may have various three-dimensional structures depending on its base sequence and may have high affinity for a specific substance, such as in an antigen-antibody reaction. The aptamer may inhibit the activity of a specific target molecule by binding to the target molecule. The aptamer of the present invention may be RNA, DNA, modified nucleic acid, or a mixture thereof, and may be in a linear or cyclic form, but is not limited thereto.

[0063] Methods for measuring the level of the above protein may include, but are not limited to, Western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, immunofluorescence, immunochromatography, FACS (fluorescence-activated cell sorter analysis), and protein chip technology assay.

[0064] In addition, the present invention Os05g20150 A composition for confirming male sterility in rice is provided, comprising a preparation for measuring the mRNA or protein level of a gene.

[0065] The above preparation is the above Os05g20150 It may be a primer or probe capable of specifically binding to a gene, but is not limited thereto.

[0066] The above preparation is the above Os05g20150 It may be an antibody or aptamer that specifically binds to a protein, but is not limited thereto.

[0068] The contents of the present invention described above shall apply equally unless they are mutually contradictory, and implementation by a person skilled in the art with appropriate modifications is also included within the scope of the present invention.

[0070] The present invention will be described in detail below through examples, but the scope of the present invention is not limited to the following examples.

[0072] Example 1. Pollen-specific OsMTD2 gene ( Os05g20150) discrimination

[0073] First, the nucleotide sequence data of rice was downloaded from the Rice Genome Annotation Project database (RGAP; http: / / rice.plantbiology.msu.edu / ).

[0074] Seventeen Arabidopsis CrRLK1L protein sequences were downloaded from the Arabidopsis Information Resource (TAIR) database. Protein sequences were aligned using ClustalX software, and a phylogenetic tree based on the neighbor joining method was constructed using 500 bootstrap clones with MEGA (ver. 4.0). A three-dimensional (3D) model was prepared in the SWISS-MODEL workspace in automation mode using OsMTD2 and its nearest homolog as templates. The generated 3D structures were visualized using the UCSF Chimera package. Additionally, meta-expression analysis was performed using the rice male gamete expression database (RMEDB; http: / / ricephylogenomics-khu.org / RMEDB / home.php) (Fig. 1(a)).

[0075] As a result, it was confirmed that the rice genome contains 16 presumed CrRLK1L genes, excluding 4 similar genes that code only for the malein domain sequence.

[0076] Integrated anatomical expression analysis of the OsCrRLK1L gene combined with phylogenetic context identified a gene that exhibits significant expression during the late-pollen stage and appears to be located independently in the phylogenetic tree alongside other genes: OsCrRLK1L11( Os05g20150 )(Fig. 1(a)).

[0077] In addition, expression profiling analysis was performed by conducting reverse-transcription quantitative PCR (RT-qPCR) using the primers listed in Table 2 below. First, the samples were immediately frozen in liquid nitrogen. Subsequently, total RNA was extracted using the RNase Plant Mini kit (Qiagen) conjugated with TRIZOL reagent (Invitrogen) and DNase treatment. First-strand cDNA was synthesized using MMLV reverse transcriptase (Promega) and Oligo(dT) 15 primers. RT-qPCR was then performed using a previously known method.

[0078] purpose Primer name order RT-qPCR analysis OsMTD2-RT-F GAGTTCACACTCCCACCATC OsMTD2-RT-R CTGTCAGTGGTGCTCACCTC

[0079] As a result, it was confirmed that the OsCrRLK1L11(Os05g20150) transcript is mainly present in anthers containing mature pollen (Fig. 1(b)).

[0080] Example 2. OsMTD2 gene ( Os05g20150) Production of mutant plants

[0081] 2-1. OsMTD2 gene( Os05g20150) T-DNA insertion mutant

[0082] OsMTD2 gene ( Os05g20150 A heterozygous mutant (3A-51606) in which T-DNA is inserted into ) was obtained from the PFG (Plant Functional Genomics) seed bank. In the said mutant, the T-DNA is Os05g20150 It was inserted at a position approximately 1,350 bp in the exon region of the gene.

[0083] Seeds of the above mutants were grown in a CO2 incubator in Murashige and Skoog media for 10 days and transferred to soil for further growth. Genomic DNA was prepared from leaves using the CTAB (cetyltrimethylammonium bromide) method, and the genotype was determined by performing PCR using genotype and T-DNA primers.

[0084] purpose Primer name order T-DNA genotyping 3A-51606( osmtd2-1 -F CGAGACAAGGTGCTTGTGTC 3A-51606( osmtd2-1 )-R CTAATGACACTGTCCAGATC

[0086] 2-2. OsMTD2 gene using CRISPR / Cas ( Os05g20150) Creation of mutants

[0087] Since mutations with T-DNA insertion cannot produce homozygous offspring, homozygous mutations were generated in the T0 generation using the CRISPR-Cas9 system. The OsMTD2 gene ( Os05g20150) KO mutation of ( osmtd2-2 Guide RNA (gRNA) was designed to generate ). An oligomer corresponding to the gRNA targeting bases at positions 281 to 300 bp of the OsMTD2 gene was annealed and ligated to a Bsal-treated pRGEB32 binary vector (Addgene plimid number: 63142). The primers used for cloning are shown in Table 3 below.

[0088] purpose Primer name order CRISPR-Cas9 OsMTD2-1 F GGCATGTGAACTGTGGTTCAGACA OsMTD2-1 R AAACTGTCTGAACCACAGTTCACA OsMTD2-2 F GGCAGACAGTAAGTGGCTCATCGA OsMTD2-2 R AAACTCGATGAGCCACTTACTGTC

[0089] For stable transformation, Agrobacterium tumefaciens ( Agrobacterium tumefaciens, A. tumefaciens ) Transformed into LBA4404.

[0090] Agrobacterium competent cell ( Agrobacterium tumefaciens 50 μL of LB4404 and 1 μg of plant expression vector were mixed and left on ice for 15 minutes. Then, the mixture was placed in liquid nitrogen for 75 seconds, incubated in a 37°C oven for 5 minutes, 1 ml of LB liquid medium was added, and the mixture was incubated in a shaking incubator at 28°C for 3 hours. Subsequently, the cells were plated onto tetracycline-resistant LB solid medium, and colonies formed after 36 hours were selected by cell culture in 1 ml of LB liquid medium.

[0091] The transformed Agrobacterium generated above was used in rice transformation experiments. Dongjin rice seeds were grown on N6D solid medium for about 7 days in a growth chamber at 28°C to generate rice calluses. The generated calluses were mixed with Agrobacterium cells transformed with the pGA2707 plant expression vector cultured for 72 hours, and cultured in a medium containing N6D-acetoxyringone in a growth chamber at 22°C in a dark room.

[0092] After thoroughly washing the callus contaminated with Agrobacterium about 5 times with triple distilled water, hygromycin selection was performed through subculture in stages of 1st (hygromycin 30 mg / L) and 2nd (hygromycin 40 mg / L) under N6D solid medium. The hygromycin selection was carried out for 4 weeks in a 28°C growth chamber (2 weeks for each stage). The divided callus was transferred to the regeneration medium, MSR (hygromycin 40 mg / L) solid medium, and regeneration was induced for 4 weeks in a 28°C light-condition growth chamber. Afterward, the plantlets were transferred to MS solid medium and grown in a 28°C light-condition growth chamber for 7 days, then transferred to a greenhouse to grow the regenerated plantlets.

[0093] After extracting DNA from the leaves of regenerated transgenic plants, the 500 bp nucleotide sequence was amplified via PCR using the primers in Table 4 below, and plants with sequence mutations were selected through sequencing analysis.

[0094] purpose Primer direction order PCR Forward direction CATGTCCTGATTGCTGCACT reverse direction GAAGATCAGCGACAAGGAGC

[0096] 2-3. Plants and Growth Conditions

[0097] Wild-type rice (Wild-type(WT), ( Oryza sativa L. spp. japonica cv. Dongin) and the transgenic line were grown in a growth chamber at 28℃ / 25℃ (day / night), 16 hours / 8 hours (light / dark), and 80% humidity for 2 weeks, after which they were transferred to a paddy field.

[0099] Example 3. Method for analyzing the characteristics of OsMTD2 mutants

[0100] 3-1. Pollen Germination and Cytological Observation

[0101] Flowers and anthers were imaged using an SZX61 microscope (Olympus). To investigate pollen maturation, spikelets were collected before anthesis, and pollen grains were squeezed out using tweezers and stained with 1% I2-KI. Similarly, the intine layer of the pollen grains was stained with 0.1% Calcofluor White for 15 minutes and monitored under UV light. The exine, the outer layer of the pollen wall, was stained with 0.001% Auramine O and observed in the FITC (fluorescein isothiocyanate) channel of the BX61 microscope (Olympus).

[0102] Callose staining of PT using aniline blue on pistils was performed as follows. First, after 2 hours of pollination, the pistils were removed from the plant and incubated overnight in Carnoy's solution. Afterward, they were washed 5 times with distilled water (5 minutes per wash) and incubated in 1 M NaOH for 6 hours; after washing the pistils 2 times (10 minutes per wash), they were stained in the dark with 0.05% aniline blue (included in 0.1 M K2HPO4, pH 8.5) for 1 hour. Subsequently, the pistils were fixed with 50% glycerol and observed under ultraviolet light using a fluorescence microscope (Olympus BX61).

[0103] To observe the in vitro pollen germination rate and pollen tube (PT) morphology, fresh pollen grains collected immediately after flowering were placed in a solid or liquid pollen germination medium (PGM) and incubated by shaking immediately. The PGM consisted of 20% (w / v) sucrose, 10% polyethylene glycol (PEG) 4000, 3 mM calcium nitrate, and 40 mg L⁻¹. -1 boric acid and 10 mg L -1 It was prepared by adding vitamin B1 (pH 6.8-7.0). Coagulated PGM slides containing 1% agarose were covered with a cover glass and incubated in a dark, humid chamber at 28°C for 20 minutes. In each experiment, the germination rate and PT length were analyzed for at least 150 pollen grains.

[0104] To visualize the plasma membrane (PM), germinated pollen was stained with FM4-64 (Invitrogen) at a final concentration of 10 μM and observed in the RFP (Red Fluorescent Protein) channel using a BX61 microscope or a confocal scanning laser microscope (CSLM (LSM 510 META, Carl Zeiss)).

[0105] To visualize pectin in PTs, germinated pollen was stained with ruthenium red (Sigma-Aldrich) at a final concentration of 0.01% (w / v) and examined under a BX61 microscope. Similarly, pectin immunolabeling was performed as follows: PTs germinated within 2 to 5 minutes and sufficiently elongated within 15 minutes were fixed by immersion in liquid PGM containing 4% formaldehyde for 30 minutes, and then immersed in PEM buffer containing 4% formaldehyde (100 mM piperazine-N,N'-bis(2-ethanesulfonic acid), 10 mM EGTA, 5 mM MgSO4, 0.3 M mannitol, pH 6.9) for 30 minutes The samples were fixed. After washing with PBS, they were incubated with LM19 and LM20 monoclonal antibodies (diluted 1:50 with PBS) for 2 hours. After washing again with PBS, the PTs were incubated with rabbit anti-rat IgG conjugated with FITC (fluorescein isothiocyanate) (Sigma F1763, diluted 1:200 with PBS) for 2 hours. After washing with PBS, they were observed using a CSLM. To visualize hydrogen peroxide, pollen grains and germinated pollen were stained with 0.1% NBT (Nitro Blue Tetrazolium) containing liquid PGM solution.

[0107] 3-2. RNA Sequencing Analysis (RNA sequencing (RNA-seq) analysis)

[0108] For RNA-seq analysis, anthers containing mature pollen grains at steps 13-14 (see Chin. Sci. Bull. 54, 2342-2353) were used. Sequencing libraries were constructed from the anthers using the TruSeq Stranded mRNA LT Sample Preparation Kit (Illumina) according to the manufacturer's instructions (Part #15031047 Rev. E).

[0109] The library was sequenced using the Illumina NovaSeq 6000 platform from Macrogen Inc., and raw data files in FASTQ format were generated. The raw data was refined using the Cutadapt program.

[0110] Then, the reads were mapped to the rice reference genome of RGAP (http: / / rice.plantbiology.msu.edu / ) using a HISAT2 aligner with default parameters. The number of raw reads was calculated using the featureCount program, and differentially expressed gene (DEG) analysis was performed using the DESeq2 R package. The DEG analysis was performed using DESeq2 and genes with a log2-fold change of P < 0.05 and > 1. That is, fold change (FC) > 2 was selected. Gene ontology (GO) enrichment (P < 0.05, minimum 2-fold enrichment value) and MapMan analysis of the DEGs were performed according to methods known in the art.

[0112] Example 4. Confirmation of the effect of the OsMTD2 gene on rice male transmission

[0113] 3A-51606, a heteromorphic T-DNA insertion mutant in which a single T-DNA is inserted into the exon region of the OsMTD2 gene ( osmtd2-1When comparing the growth of the wild-type (Fig. 2(a)) and the wild-type, both individuals showed normal growth. However, a distorted segregation ratio of 1:1.02 was observed for heterozygotes without homozygous progenies compared to the wild-type, confirming the presence of a gametophytic defect.

[0114] Next, it was determined whether the gametogenic fusion identified above was due to a male or female defect. To this end, a heterozygous osmtd2-1 / + Interbreeding was performed between and wild-type plants (Fig. 2(b)). The heterozygous osmtd2-1 / + When used as a pollen donor, all offspring were of the wild type. However, osmtd2-1 / + When used as a pollen acceptor, at a ratio of 1:1.25 osmtd2-1 / + ...and obtained both wild-type offspring. Therefore, through this, osmtd2-1 The female gametophyte produces normal offspring as seen in the wild type, but osmtd2-1 It was confirmed that male gametophytes have a defect in male transmission.

[0115] Meanwhile, a homozygous mutant with a frame-shift mutation produced using the CRISPR-Cas9 system ( osmtd2-2 ) exhibited normal growth and development until the anthesis stage (Figs. 2(c) to 2(g)). However, during the ripening stage, the panicles did not produce seeds (Fig. 2(h)). osmtd2-2The spikelets of the mutant formed yellow anthers, similar to the wild type, and exhibited normal starch accumulation in pollen grains (Fig. 2(f)) and the formation of exine and intin in the normal pollen wall (Fig. 2(g)).

[0116] Along with germinated osmtd2-2 The immediate rupture of the pollen tube and the above osmtd2-2 To determine the reason why the pollen failed to produce offspring, the patterns during pollen germination and pollen tube growth were examined (Fig. 3).

[0117] In vivo pollen tube growth analyzed by aniline blue staining, it was found that most wild-type pollen tubes grow through the stigma and style and reach the micropyle of the pistil within 2–3 hours after germination (Figs. 3(a) and 3(c)). In contrast, germinated osmtd2-2 Most pollen grains stopped elongating at the stigma, and only a very small amount of pollen tubes (about 2%) reached the style (Figs. 3(b) and 3(c)).

[0118] Under in vitro pollen germination conditions, 82.83% of wild-type pollen germinated to an average length of 100 μm within 20 minutes, producing intact pollen tubes (Figs. 3(b) and 3(e)). On the other hand, most osmtd2-2 The pollen tube germinated but ruptured immediately without elongation (Fig. 3(d) and Fig. 3(f)). Through this osmtd2-2 It was confirmed that the pollen had a defect in terms of pollen tube elongation.

[0119] osmtd2-2To determine whether pollen tubes can precipitate cell wall components, germinated pollen grains were fixed 2 and 5 minutes after germination, and immunofluorescence analysis was performed using LM19 and LM20 antibodies labeled with deesterified methyl pectin and methyl-esterified pectin, respectively. As a result osmtd2-2 It was confirmed that the pollen tube ruptured approximately 5 minutes after germination. In the wild type, the LM19-labeled pectin signal was detected along the shank of the germinated and elongated pollen tube, but not at the apex (Fig. 4(a)). In the case of the LM20-labeled pectin signal, it could be detected at the tip of the tube (Fig. 4(b)).

[0120] however, osmtd2-2 In this case, the LM19 signal was observed at the tip of the germinating pollen tube (Fig. 4(a)), while the LM20 signal could not be confirmed (Fig. 4(b)). Additionally, during the early germination stage, LM19 levels were detected at high levels in the terminal region, and LM20 levels were osmtd2-2 It decreased in both the end and the shank (Fig. 4(c)). Through these results osmtd2-2 It was confirmed that abnormal cell wall deformation occurs during pollen germination, hindering the polar cell wall expansion necessary for normal pollen tube elongation.

[0121] In addition osmtd2-2We investigated whether pollen was defective in terms of reactive oxygen species (ROS) signaling. To examine the spatial and temporal generation of ROS in rice pollen grains and pollen tubes, ROS production during the growth of rice pollen tubes was visualized using CM-H2DCFDA (5-(and-6)-chloromethyl-2',7'-dichlorodihydrofluorescein diacetate), the most commonly used dye for hydrogen peroxide detection. Through this, ROS signals were detected in the plasma membrane (PM) and the endomembrane of the entire pollen grain (Fig. 5(a)). In particular, when the pollen tube formed, the ROS signal was concentrated at the elongated tip of the tube, while a weak signal was observed in the pollen grain (Fig. 5(b)).

[0122] To determine whether OsMTD2 regulates ROS levels in pollen grains and pollen tubes, under conditions similar to in vitro experiments... osmtd2-2 Fluorescence was detected in the mutant and wild types. After germination for 30 minutes, examination using a CLSM (confocal laser-scanning microscope) (Fig. 5(c)) revealed ROS signals in most pollen grains and pollen tubes of the wild type. On the other hand, osmtd2-2 Fluorescence was hardly observed in the pollen grains and ruptured tubes (Fig. 5(d)).

[0123] It is known that most rice pollen tubes rupture spontaneously 20 minutes after germination, and sperm cells are released from the elongated tubes. However, osmtd2-2 In this case, the weakly stained signal in sperm cells remained localized to the pollen grains (Fig. 5(d)), indicating that OsMTD2 is required for ROS-mediated pollen tube elongation as well as for the release of sperm cells in rice.

[0124] Wild-type (Wildtype, WT) and OsMTD2 gene function deletion plants shown in Fig. 6 ( osmtd2 As shown in the schematic diagram of the pollen tube development mechanism of ), the present invention confirmed that the OsMTD2 gene is a gene that maintains the balance of reactive oxygen species, which plays an important role in the normal growth of the pollen tube of rice, and that male-sterile plants can be induced through the functional deletion of this gene.

[0126] In summary, the present invention relates to the OsMTD2 gene ( Os05g20150) It was confirmed that when the expression and / or function of the OsMTD2 gene is suppressed through male sterile heterozygous or homozygous mutants of rice with deleted function, pollen tube germination and elongation are reduced, causing male sterility.

Claims

Claim 1 Composed of the nucleotide sequence represented by Sequence No. 1 in rice Os05g20150 A method for producing male-sterile rice comprising a step of suppressing gene expression, wherein the above Os05g20150 A method for producing male-sterile rice, characterized in that the rice with suppressed gene expression consists of a nucleotide sequence indicated by SEQ ID NO.

2. Claim 2 delete Claim 3 delete Claim 4 In paragraph 1, Os05g20150 A method for producing male-sterile rice, further comprising the step of crossing male-fertile rice with a maternal model of rice in which gene expression is suppressed. Claim 5 delete Claim 6 delete Claim 7 Consisting of the nucleotide sequence represented by SEQ ID NO. 1 Os05g20150 As male-sterile rice with suppressed gene expression, the above Os05g20150 Male-sterile rice characterized by having suppressed gene expression and consisting of a nucleotide sequence indicated by SEQ ID NO.

2. Claim 8 Consisting of the nucleotide sequence represented by SEQ ID NO. 1 Os05g20150 A composition for inducing male sterility in rice comprising an agent that inhibits gene expression, wherein the above Os05g20150 A composition for inducing male sterility in rice, characterized in that the rice with suppressed gene expression consists of a nucleotide sequence represented by SEQ ID NO.

2. Claim 9 In Clause 8, the above-mentioned preparation is Os05g20150 A composition for inducing male sterility in rice, characterized by comprising one or more selected from the group consisting of siRNA, shRNA, miRNA, ribozyme, PNA (peptide nucleic acid), and antisense oligonucleotide that specifically bind to the mRNA of a gene. Claim 10 Consisting of the nucleotide sequence represented by SEQ ID NO. 1 Os05g20150 A method for confirming male sterility of rice, comprising the step of measuring whether gene expression is present, wherein the Os05g20150 A method for confirming male sterility in rice, characterized in that the rice with suppressed gene expression consists of a nucleotide sequence indicated by SEQ ID NO.

2. Claim 11 Consisting of the nucleotide sequence represented by SEQ ID NO. 1 Os05g20150 A composition for confirming male sterility in rice, comprising a preparation for measuring the mRNA or protein level of a gene, wherein the above Os05g20150 A composition for confirming male sterility in rice, characterized in that the rice with suppressed gene expression consists of a nucleotide sequence indicated by SEQ ID NO.

2. Claim 12 In Clause 11, the above formulation is the above Os05g20150 A composition for confirming male sterility in rice, which is a primer or probe capable of specifically binding to a gene. Claim 13 In Clause 11, the above formulation is the above Os05g20150 A composition for confirming male sterility in rice, which is an antibody or aptamer that specifically binds to a protein.