Compositions and methods for treating pain or for increasing pain sensitivity

Abstract

Disclosed herein are compositions and methods for treating pain in subjects in need thereof. Further disclosed herein are compositions and methods for treating conditions associated with pain loss in subjects in need thereof. In some examples, the compositions comprise an amino acid sequence that is conjugated to a heterologous group that competes with NMDA receptor NR1C2 subunits for binding to Magi2.

Description

COMPOSITIONS AND METHODS FOR TREATING PAIN OR FOR INCREASING PAIN SENSITIVITYCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Application Number 63 / 598,137, filed on November 12, 2023, and U.S. Provisional Application Number 63 / 634,783, filed on April 16, 2024, the disclosures of which are incorporated herein.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under grant numbers NS113991 and NS128543 awarded by the National Institutes of Health. The government has certain rights in the invention.SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing, which has been submitted in .xml format and is hereby incorporated by reference in its entirety. Said .xml copy was created on November 12, 2024, is named “011520_01878_ST26.xml”, and is 64,154 bytes in size.BACKGROUND OF THE DISCLOSURE

[0004] The CDC estimates that 7-8% of adults in the US suffer from “high impact” chronic pain in which pain is so severe that it limits activities on most days or every day. A drawback associated with use of opioids for pain treatment is that they may stop working over time as drug tolerance develops, and they may create debilitating and life-threatening physical dependence and withdrawal symptoms. Additionally, opioid overdose has become a leading cause of death among adults aged 18-44 in many states of the US.

[0005] In 1992, Corderre and Melzack made a seminal observation: selective N-methyl- D-aspartate (NMD A) receptor antagonists, but not AMPA receptor antagonists, blocked inflammatory pain behavior. To date, NMDA receptor antagonists have been used clinically to treat various pain conditions, with mixed results. For example, ketamine provides analgesic and antihyperalgesic effects, however, pain relief is modest, suggesting ketamine is only useful when opioids are contraindicated. Ketamine is not selective for specific NMD AR subtypes and therefore at increasing doses of ketamine, there will be many off target adverse effects. Thislimits the use of some NMDA antagonists at higher concentrations, which may be required for effective pain treatment.

[0006] A functional NMDA receptor is a heterotetramer composed mainly of two NR1 subunits and two NR2 subunits (in some cases NR.3 subunits can be incorporated into the heterotetramer). The NR1 subunit is the obligate subunit of NMDA receptors. Conditional deletion of the NR1 subunit in the spinal cord dorsal hom, while not altering basal pain behavior, has been shown to reduce injury-induced pain. The NR1 subunit is alternatively spliced in the N- terminal and C-terminal domain. There are 8 identified splice isoforms of NR1. Multiple splice isoforms are expressed in the spinal cord. There is extensive structural and functional information on the large extracellular N-terminal domain, the site of ligand binding. The last stretch of the C-terminal domain consists of the C2 cassette. Alternative splicing of the C2 cassette produces two distinct C-termini called C2 and C2’. The function of the C2’ isoform has been identified: it contains a PDZ binding motif which was shown to bind to postsynaptic density protein 95 (PSD-95) and associated postsynaptic density proteins. Functional NMDA receptors containing only the C2’ subunit will have 4 PDZ binding motifs as all the NR2 subunits also possess PDZ binding motifs. The C2 isoform does not contain a PDZ binding motif, and the function is unknown. By extension, NMDA receptors containing only NR1C2will have half the number of PDZ binding motifs.

[0007] PSD-95 remains the canonical post-synaptic density protein for excitatory synapses, principally involved in synaptic plasticity. For example, during nerve-injury induced- neuropathic pain, it was observed that thermal hyperalgesia, mechanical allodynia, and cold allodynia were all virtually absent in PSD-95 null mice. Although quite surprisingly, inflammatory pain behaviors, such as those produced by the formalin assay, were unaffected by PSD-95 deficiency. The Magi family of scaffold proteins are also expressed in the brain and peripheral nervous system but haven’t received the attention PSD-95 has with respect to excitatory transmission. Magi2 (also referred to as S-SCAM) was first discovered by its ability to bind to NMDA receptors. Like PSD-95, Magi2 contains multiple PDZ binding domains and a guanylate kinase-like (GUK) domain. However, unique to the Magi family, are the existence of WW (tryptophan-tryptophan) domains. WW binding domains are typically found in ubiquitin ligases, as these enzymes use WW domains to recognize substrates to target them for ubiquitination and subsequent degradation. The first WW domain of Magi-2 is the most likethose of the calcium-dependent, E3 ligase Nedd4-1. Presumably the Magi proteins with their WW domains compete with ubiquitin ligases for substrate recognition, and indeed the Magi proteins might confer substrate protection from ubiquitin ligase-dependent degradation. For example, the non-ubiquitin ligase Yes-associated protein 1 protects against Nedd4-2 protein degradation via its WW domain. We previously showed that Navi.8 binds to Magil, and Magil deficiency causes Navi.8 channel protein loss. We also showed that heterologous expression of Magil with the Slick K\achannel increases Slick protein expression. Finally, Magi2 was shown to protect the protein dendrin from Nedd4-2-mediated ubiquitination and degradation in kidney cells. In addition to PDZ binding, the Magi family of proteins might protect and stabilize membrane receptors.

[0008] In the adult brain, approximately one-fifth of NMD A receptors contain the NR1C2splice isoform, whereas the other approximately four-fifths contain the alternate splice isoform NR1C2. NMDA receptors containing NR1C2cluster outside of the synapse in nanodomains. Paindependent increase in NR1C2is dependent on the scaffold protein Magi2. Presumably, the Magi proteins with their WW domains compete with ubiquitin ligases for substrate recognition may confer substrate protection from ubiquitin ligase-dependent degradation.SUMMARY OF THE DISCLOSURE

[0009] Disclosed herein, in some examples, are compositions comprising an amino acid sequence that comprises the sequence according to NQX1DX2VX3PRRAIERE (SEQ ID NO: 1), wherein Xi is selected from K and R; X2 is selected from T, S, E, and D; and X3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle.

[0010] In some examples, Xi is K. In some examples, Xi is R. In some examples, X2 is selected from T, S and E. In some examples, X2 is selected from T and S. In some examples, X2 is T. In some examples, X2 is S. In some examples, X2 is E. In some examples, X2 is D. In some examples, X3 is L. In some examples, X3 is P.

[0011] In some examples, Xi is K and X2 is T. In some examples, Xi is K and X2 is S. In some examples, Xi is K and X2 is E. In some examples, Xi is K and X2 is D. In some examples, Xi is R and X2 is T. In some examples, Xi is R and X2 is S. In some examples, Xi is R and X2 is E. In some examples, Xi is R and X2 is D. In some examples, Xi is K and X3 is L. In someexamples, Xi is K and X3 is P. In some examples, Xi is R and X3 is L. In some examples, Xi is R and X3 is P.

[0012] In some examples, X2 is T and X3 is L. In some examples, X2 is T and X3 is P. In some examples, X2 is S and X3 is L. In some examples, X2 is S and X3 is P. In some examples, X2 is E and X3 is L. In some examples, X2 is E and X3 is P. In some examples, X2 is D and X3 is L. In some examples, X2 is D and X3 is P.

[0013] In some examples, Xi is K, X2 is T, and X3 is L. In some examples, Xi is K, X2 is T, and X3 is P. In some examples, Xi is K, X2 is S, and X3 is L. In some examples, Xi is K, X2 isS, and X3 is P. In some examples, Xi is K, X2 is E, and X is L. In some examples, Xi is K, X2is E, and X3 is P. In some examples, Xi is K, X2 is D, and X3 is L. In some examples, Xi is K, X2 isD, and X3 is P. In some examples, Xi is R, X2 is T, and X3 is L. In some examples, Xi is R, X2 isT, and X3 is P. In some examples, Xi is R, X2 is S, and X3 is L. In some examples, Xi is R, X2 is S, and X3 is P. In some examples, Xi is R, X2 is E, and X3 is L. In some examples, Xi is R, X2 isE, and X3 is P. In some examples, Xi is R, X2 is D, and X3 is L. In some examples, Xi is R, X2 is D, and X3 is P.

[0014] In some examples, the amino acid sequence comprises a sequence according to any one of SEQ ID NOs: 2-25.

[0015] In some examples, the composition is phosphorylated. In some examples, the amino acid sequence is phosphorylated. In some examples, position X2 of the amino acid sequence is phosphorylated. In some examples, X2 is T, and T is phosphorylated. In some examples, X2 is S, and S is phosphorylated.

[0016] In some examples, the lipid moiety is conjugated to the N-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the C-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the amino acid sequence through a linker. In some examples, the linker comprises a Gly / Ser linker.

[0017] In some examples, the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (C14) group, a palmitoyl (Cis) group, or a stearoyl (Cis) group. In some examples, the lipid moiety comprises an octanoyl (Cs) group. In some examples, the lipid moiety comprises a lauroyl (C12) group. In some examples, the lipid moiety comprises a myristoyl (C14) group. In some examples, the lipid moiety comprises a palmitoyl (Cis) group. In some examples, the lipid moiety comprises a stearoyl (Cis) group.

[0018] In some examples, the amino acid sequence is no more than 30 amino acid residues in length. In some examples, the amino acid sequence is no more than 25 amino acid residues in length. In some examples, the amino acid sequence is no more than 20 amino acid residues in length. In some examples, the amino acid sequence is no more than 15 amino acid residues in length.

[0019] In some examples, the composition is a pharmaceutical composition and the composition further comprises a pharmaceutically acceptable excipient.

[0020] In some examples, the amino acid sequence is a synthetic amino acid sequence. In some examples, the amino acid sequence comprises an unnatural amino acid residue. In some examples, the unnatural amino acid residue comprises a D-amino acid residue.

[0021] Disclosed herein, in some examples, are methods for treating pain in a subject in need thereof comprising administering to the subject the composition according to any one of the preceding examples. Disclosed herein, in some examples, are methods for treating pain in a subject in need thereof comprising administering to the subject a composition that comprises an amino acid sequence that comprises the sequence according to NQX1DX2VX3PRRAIERE (SEQ ID NO: 1), wherein Xi is selected from K and R; X2 is selected from T, S, E, and D; and X3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle. In some examples, the subject does not take opioids, does not tolerate opioids well, suffers from opioid addiction, or is at risk of relapse for opioid addiction. In some examples, the risk of relapse for opioid addiction is determined subjectively or objectively by the subject or a medical professional. In some examples, the pain comprises nociceptive pain. In some examples, the pain comprises neuropathic pain. In some examples, the pain is a symptom of a disease, condition, or an injury. In some examples, the injury comprises a spinal cord injury, a nerve injury, a somatic injury, or a bum. In some examples, the disease comprises a chronic disease. In some examples, the chronic disease comprises diabetes, Herpes zoster, major depressive disorder, fibromyalgia, migraine, arthritis, cancer, multiple sclerosis, inflammatory bowel disease or HIV / AIDS. In some examples, the disease comprises chronic inflammation. In some examples, the disease that comprises chronic inflammation comprises carpal tunnel syndrome. In some examples, the pain is associated with chemotherapy, radiation, Morton’s neuroma, mechanical stress, thermal stress, allodynia, or hyperalgesia. In some examples, the allodynia or hyperalgesia is mechanical,thermal, or associated with movement. In some examples, the hyperalgesia is opioid-induced hyperalgesia. In some examples, the pain comprises post-surgical pain.

[0022] In some examples, the composition is administered to the subject prophylactically. In some examples, the composition is administered to the subject prophylactically prior to surgery, laparoscopy, chemotherapy, dental work, radiation, or childbirth.

[0023] In some examples, the pain is chronic pain or acute pain. In some examples, the chronic pain comprises pain that lasts at least 12 weeks. In some examples, the chronic pain comprises pain that extends beyond an expected period of healing. In some examples, the acute pain comprises sharp pain. In some examples, the acute pain comprises pain associated with surgery, laparoscopy, broken bones, dental work, burns, cuts, childbirth labor, or childbirth.

[0024] Disclosed herein, in some examples, are compositions comprising an amino acid sequence that comprises the sequence according to NQU1DU2VU3PRRAIERE (SEQ ID NO: 26), wherein Ui is selected from K and R; U2 is selected from A, V, G, and L; U3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle.

[0025] In some examples, Ui is K. In some examples, Ui is R. In some examples, U2 is selected from A, V, and G. In some examples, U2 is selected from A and V. In some examples, U2 is A. In some examples, U2 is V. In some examples, U2 is G. In some examples, U2 is L. In some examples, U3 is L. In some examples, U3 is P.

[0026] In some examples, Ui is K and U2 is A. In some examples, Ui is K and U2 is V. In some examples, Ui is K and U2 is G. In some examples, Ui is K and U2 is L. In some examples, Ui is R and U2 is A. In some examples, Ui is R and U2 is V. In some examples, Ui is R and U2 is G. In some examples, Ui is R and U2 is L. In some examples, Ui is K and U3 is L. In some examples, Ui is K and U3 is P. In some examples, Ui is R and U3 is L. In some examples, Ui is R and U3 is P. In some examples, U2 is A and U3 is L. In some examples, U2 is A and U is P. In some examples, U2 is V and U3 is L. In some examples, U2 is V and U3 is P. In some examples, U2 is G and U3 is L. In some examples, U2 is G and U3 is P. In some examples, U2 is L and U3 is L. In some examples, U2 is L and U3 is P.

[0027] In some examples, Ui is K, U2 is A, and U3 is L. In some examples, Ui is K, U2 is A, and U3 is P. In some examples, Ui is K, U2 is V, and U3 is L. In some examples, Ui is K, U2 isV, and U3 is P. In some examples, Ui is K, U2 is G, and U3 is L. In some examples, Ui is K, U2 isG, and U3 is P. In some examples, Ui is K, U2 is L, and U3 is L. In some examples, Ui is K, U2 isL, and U3 is P. In some examples, Ui is R, U2 is A, and U3 is L. In some examples, Ui is R, U2 isA, and U3 is P. In some examples, Ui is R, U2 is V, and U3 is L. In some examples, Ui is R, U2 isV, and U3 is P. In some examples, Ui is R, U2 is G, and U3 is L. In some examples, Ui is R, U2 isG, and U3 is P. In some examples, Ui is R, U2 is L, and U3 is L. In some examples, Ui is R, U2 isL, and U3 is P.

[0028] In some examples, the composition comprises an amino acid sequence according to any one of SEQ ID NOs: 27-42 .

[0029] In some examples, the composition is phosphorylated. In some examples, the amino acid sequence is phosphorylated.

[0030] In some examples, the lipid moiety is conjugated to the N-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the C-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the amino acid sequence through a linker. In some examples, the linker comprises a Gly / Ser linker. In some examples, the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (C14) group, a palmitoyl (Cie) group, or a stearoyl (Cis) group. In some examples, the lipid moiety comprises an octanoyl (Cs) group. In some examples, the lipid moiety comprises a lauroyl (C12) group. In some examples, the lipid moiety comprises a myristoyl (C14) group. In some examples, the lipid moiety comprises a palmitoyl (Cie) group. In some examples, the lipid moiety comprises a stearoyl (Cis) group.

[0031] In some examples, the amino acid sequence is no more than 30 amino acid residues in length. In some examples, the amino acid sequence is no more than 25 amino acid residues in length. In some examples, the amino acid sequence is no more than 20 amino acid residues in length. In some examples, the amino acid sequence is no more than 15 amino acid residues in length.

[0032] In some examples, the composition is a pharmaceutical composition and the composition further comprises a pharmaceutically acceptable excipient.

[0033] In some examples, the amino acid sequence is a synthetic amino acid sequence. In some examples, the amino acid sequence comprises an unnatural amino acid residue. In some examples, the unnatural amino acid residue comprises a D-amino acid residue.

[0034] Disclosed herein, in some examples, are methods for treating a condition associated with pain loss in a subject in need thereof comprising administering to the subject the composition according to certain examples disclosed herein. Disclosed herein, in some examples, are methods for treating a condition associated with pain loss in a subject in need thereof comprising administering to the subject a composition that comprises an amino acid sequence that comprises the sequence according to NQU1DU2VU3PRRAIERE (SEQ ID NO: 26), wherein Ui is selected from K and R; U2 is selected from A, V, G, and L; U3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle. In some examples, the condition associated with pain loss comprises congenital insensitivity to pain (CIP), a hereditary sensory neuropathy, or a hereditary sensory autonomic neuropathy (HSAN). In some examples, the administering to the subject increases the subject’s sensitivity to pain.

[0035] Disclosed herein, in some examples, are methods for treating a condition associated with NMDA NR1C2in a subject in need thereof comprising administering to the subject the composition according to certain examples disclosed herein. Disclosed herein, in some examples, are methods for treating a condition associated with NMDA NR1C2in a subject in need thereof comprising administering to the subject a composition that comprises an amino acid sequence that comprises the sequence according to NQU1DU2VU3PRRAIERE (SEQ ID NO: 26), wherein Ui is selected from K and R; U2 is selected from A, V, G, and L; U3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle. In some examples, the condition associated with NMDA NR1C2comprises stroke, Alzheimer's Disease, attention-deficit hyperactivity disorder (ADHD), schizophrenia, bipolar disorder, epilepsy, Huntington's disease, Parkinson's disease, Amyotrophic lateral sclerosis, chronic fatigue syndrome, anxiety, depression, post-traumatic stress disorder, obsessive compulsive disorder, or a phobia.BRIEF DESCRIPTION OF THE FIGURES

[0036] For a fuller understanding of the nature and objects of the disclosure, reference should be made to the following detailed description taken in conjunction with the accompanying figures.

[0037] Fig. 1. A Magi -2 floxed line has endogenous Magi-2 deficiency and exhibits diminished inflammatory pain behavior A) Schematic of the three isoforms of Magi-2. The alpha, beta, and gamma isoforms differ with respect to whether they contain the PDZ-0 and GK domains. B) Immunolabeling of Magi-2 (green) in the lumbar spinal cord dorsal horn revealed superficial expression relative to the lamina 2 / 3 border as defined by PKCy (red) expression. Scale Bar is 100 microns C) Western analysis of Magi-2 protein levels from the synaptic fraction of dorsal horn lysates of WT, heterozygous and homozygous (floxed) AMagi-2 mice. AMagi-2 mice exhibit reduced Magi-2 alpha and beta isoforms expression and no Magi-2 gamma expression. Actin was used as a loading control. Individual lanes represent one replicate from a single lysate which run in triplicate. D) Densitometric quantification of relative Magi-2 protein levels normalized to actin from 1C. Each set of three bands from a single lysate is averaged to create an n of 1, for a total of n = 7 different mice for each genotype. Relative protein levels of each isoform were compared by One-way ANOVA with Tukey post hoc test. (Magi-2 Alpha: WT vs. AMagi-2, p= 0.0369*; Magi-2 Beta: WT vs AMagi-2, p=0.0146*; Magi-2 Gamma: WT vs AMagi-2, p=0.0006***, Het vs AMagi-2 p=0.0173 *). E) AMagi-2 mice exhibit deficits in the formalin assay of inflammatory pain. Mice received a unilateral 20 L intraplantar injection of 5% formalin and subsequent licking and lifting behaviors were scored by a blinded observer. Nocifensive behaviors (defined as the sum of lifts and licks directed at the injected hindpaw of mice injected with formalin and video recorded for one hour n= 6 mice per genotype (3 males, 3 females). F) Cumulative nocifensive behaviors for Phase 1 (0-5min) and Phase 2 (10-55min) following intraplantar injection are shown in the bar graphs. (WT vs AMagi-2, p=0.0085** One- Way ANOVA with Tukey post hoc test).

[0038] Fig. 2. Magi-2 deficiency is associated with a decrease in NR1 protein and decreased NMDA currents in the SCDH. A) Western analysis of NR1, NR2A, and NR2B NMDA receptor levels from spinal cord dorsal horn lysates of WT, heterozygous and homozygous AMagi-2 mice with actin as a loading control (n=5 mice per genotype). B) Densitometric analysis of 2A. Relative protein levels of each NMDA receptor subunit were compared using one-way ANOVA with Tukey post hoc analysis (NR1: WT vs. Het p=0.0249*; WT vs AMagi-2 p = 0.0004***) C) Immunoblot of NR1 following Magi-2 coimmunoprecipitation from dorsal horn lysates. D & F) Representative NMDA-evoked current traces recorded from lamina 1 neurons of WT, heterozygous, and AMagi-2 mice. Neurons wereheld at D) +60mV and F) +40mV and then 50 pM NMDA was bath applied for 60 seconds followed by a washout for 3 minutes. E & G) Current densities (peak NMDA-evoked current amplitude divided by cell capacitance compared by One-way ANOVA with Tukey post-hoc test. E) +60mV: WT vs AMagi-2 p= 0.0392* (n=7 WT, n= 9 Het, n= 7 AMagi-2) one-way ANOVA with Tukey post hoc test. G) +40mV: WT vs. AMagi-2 p=0.0436*(n=8 WT, n= 10 Het, n= 8 AMagi-2): one-way ANOVA with Tukey post hoc test.

[0039] Fig. 3. Viral knockdown of Magi -2 in wildtype mice results in reduced chronic inflammatory pain behavior and a specific decrease in NR1C2protein. A) Mice were injected intrathecally with either AAV2 / 9-GFP-U6-m-Magi-2-scrambled or AAV2 / 9-GFP-U6-m-Magi- 2-shRNA. B) Western analysis of total Magi-2 protein levels from spinal cord dorsal horn of mice two weeks after receiving either AAV2 / 9-GFP-U6-m-Magi-2-scrambled or AAV2 / 9-GFP- U6-m-Magi-2-shRNA relative to the actin loading control. C) Densitometric analysis of 3B compared using unpaired student’s t-test: scrambled shRNA vs Magi-2 shRNA p=0.0090**. Sum of all isoforms were included in the analysis (n= 9 scram, n= 7 shRNA. D) Thermal withdrawal latencies following unilateral intraplantar injection of CFA 2 weeks after intrathecal injection of either of AAV2 / 9-GFP-U6-m-Magi-2-shRNA or scrambled shRNA control.Baseline responses were recorded two days prior to AAV administration and for two weeks until CFA injection. Two-way ANOVA with Bonferroni correction for paw withdrawal latencies following CFA injection (n= 12 mice (6 males, 6 females), (ipsilateral scrambled shRNA vs ipsilateral Magi-2 shRNA: 24 hours: p=0.0233*; 3 days: p<0.0001****; 5 days: p<0.0001****; 10 days: p=0.0308* E) Scrambled shRNA injected mice spend less time on the hind paw after injection with CFA as measured via Dynamic Weight Bearing. Student’s paired t-test (scrambled shRNA: Baseline vs. 72 hours post CFA p = 0.0104*). F) Magi-2 shRNA injected mice spend an equivalent amount time spent on the hind paw after injection of CFA compared to baseline as measured via Dynamic Weight Bearing. No significant change from baseline was observed (n= 12 mice (6 males, 6 females) G) Western analysis of total NR1 protein levels in the ipsilateral vs contralateral dorsal hom following unilateral intraplantar injection of CFA (72 hours) two weeks following intrathecal Magi-2 knockdown using an N-terminal targeting antibody which recognizes both C-terminal splice isoforms. In the scrambled group, there was an increase in NR1 expression. (n=5 mice) H) Western analysis of NR1C2levels from the same lysates as G / H. I) Western analysis of NR1C2levels from the same lysates as G / H. J) Densitometricquantification of G, paired students t-test ((n=5 mice) scrambled: Ipsilateral vs. contralateral p=0.0231 *) K) Densitometric quantification of I: paired t-test: (n=5 mice) scrambled: ipsilateral vs. contralateral p=0.0216*; Magi-2 shRNA: ipsilateral vs. contralateral p=0.0178*. L) Densitometric quantification of I.

[0040] Fig. 4. NR1C2is a substrate of the Nedd4-1 ubiquitin ligase. A) Schematic of the NR1C2and NR1C2carboxy-terminal splice isoforms of NR1 as well as the engineered mutation of the NR1C2Group 3 WW-binding domain construct. C2 is SEQ ID NO: 53, C2P918Ais SEQ ID NO: 54, and C2’ is SEQ ID NO:55. B) Western analysis depicting the effect heterologous expression of NR1C2, NR1C2’ or NR1C2 P918Awith the E3 ubiquitin ligase Nedd4-1 compared to pcDNA control. C-E) Densitometric Analysis for B: (C) NR1C2: pcDNA vs Nedd4-1 p = 0.0201* n =5 per group, paired Students t-test F) Immunoprecipitation of NR1C2followed by immunoblotting for ubiquitin demonstrates WW-binding motif-dependent ubiquitination of NR1C2G) Western analysis of NR1C2co-expressed with NR2B to demonstrate the effect of Nedd4-l(left) or Nedd4-2 (right) on presumably fully formed channels. H) Densitometric analysis shows a reduction in NR1 when coexpressed with NR2B and Nedd4-1 (pcDNA vs. Nedd4-1 p = 0.0417*: paired students t-test, n= 3 / group) I) No difference was observed in NR1 levels when co-transfected with NR2B and Nedd4-2. 1) Western analysis of NR2B co-expressed with NR1C2to demonstrate the effect of Nedd4-1 (left) of Nedd4-2 (right) on presumably fully formed channels. K) Densitometric analysis shows a reduction in NR2B when coexpressed with NR1C2and Nedd4-1 (pcDNA vs. Nedd4-1 p = 0.0048**: paired students t-test, n= 3 / group) L) Densitometric analysis shows a reduction in NR2B when coexpressed with NR1C2and Nedd4-2 (pcDNA vs. Nedd4-2 p = 0.0160*: paired students t-test, n= 3 / group).

[0041] Fig. 5. Bidirectional control of pain behavior using NRlC2-derived peptidomimetics A) Upper: Schematic depicting intrathecal injection of NR1 lipidated peptidomimetics into WT C57B1 / 6 mice 24 hours following unilateral intraplantar injection of CFA. SEQ ID NOs: 2, 3, 27, and 50 are shown. Lower: Following two days of baseline measurements, thermal withdrawal latencies were measured 24 hours after unilateral intraplantar injection of CFA. Mice were then immediately injected intrathecally with the NR1 -targeted peptidomimetics, and thermal withdrawal latency was measured 48 hours, 72 hours, and 5, 7, 10, and 14 days after CFA for all experiments, n = 12 mice per p[eptide (6 males, 6 females). Paw withdrawal latencies for Hargreaves Thermal assay for mice receiving NR 1 -targeted peptides.n=12 mice per peptide (6 males, 6 females). Statistically significant differences in mean paw withdrawal latency (sec) + / - SEM are given for scrambled vs Phosphorylated peptide (48 hours post CFA p=0.0012**; 72 hours p<0.0001****; 5 days p=0.0009***) and Scrambled vs Alanine peptide (48 hours p=0.0201#; 5 days p=0.0313#; 14 Days p=0.0045##) two-way ANOVA with Bonferroni Correction B) Females from A. Scrambled vs Phosphorylated Peptide (72 hours p=0.0128*; 5 days p=0.0044**) and Scrambled vs Alanine (5 days p=0.019#; 7 days p=0.0122#;10 days p=0.0357#; 14 days p=0.0134#). C) Males from A: Scrambled vs Phosphorylated Peptide (72 hours p=0.0084**) two-way ANOVA with Bonferroni correction D) Tau analysis for recovery from CFA with lines of best fit demonstrating the rates of recovery from CFA-induced hyperalgesia. A one-phase decay line was fit to the data and the tau of recovery was calculated. Tau values are as follows: scrambled t=3.451; phosphorylated t=l .457; alanine t=5.949; WT t=3.769 E) Area under the curve for Thermal withdrawal latencies shows a significant difference between scrambled vs phosphorylated peptide (p=0.0003***) and scrambled vs alanine (p=0.0050**) one way ANOVA with Tukey post hoc test F) Time spent bearing weight on the CFA-injected hindpaw as measured via Dynamic Weight Bearing. (Top) At 48 hours following CFA injection (24 hours post-peptide) only the group receiving the phosphorylated peptide showed a significant increase in the amount of time spent placing weight on the injected hindpaw indicative of recovery (Phosphorylated: pre- peptide injection vs post-peptide injection p=0.001***). (Bottom) At 72 hours, only the mice receiving alanine peptide did not display any increase in time spent placing weight on the CFA-injected paw, while all other groups trended toward recovery (scrambled: pre- vs post-peptide injection p=0.0009***; phosphorylated: pre- vs post-peptide injection (24 vs. 72) p<0.0001****; WT: pre- vs post- peptide injection (24 vs. 72) p=0.0470* ) paired students t-test, n= 12 per group.

[0042] Fig. 6. Magi-2 isoform ratio in spinal cord dorsal horn lysates of WT C57Bl / 6j mice. Spinal cord dorsal horn tissue lysates were harvested from 8-week-old WT mice and processed through differential centrifugation (see materials and methods) to acquire the crude synaptosomal and cytosolic fractions. A & B) As previously reported, (9) only the Alpha and Beta isoforms were present in the cytosolic fraction, while all three isoforms, including the gamma isoform was present in the synaptic fraction. This suggest that the gamma isoform is locally translated. C & D) Parts of whole representation of the isoform distribution in each fraction. n=6, 3 males and 3 females.

[0043] Fig. 7. Immunocytochemical verification of Mouse monoclonal antibody raised against Magi-2 Chinese Hamster Ovary Cells were cultured and transiently transfected using Lipofectamine Reagent with plasmid DNA carrying Magi-2. Lipofectamine transfection gives -20% transfection efficiency. 48 hours after transfection, cells were fixed and stained with mouse monoclonal Magi-2 antibody (Abnova) 1 :250 (left) followed by goat ant-mouse Alexafluor 488 (1:750) (left and right) and mounted with Vectashield Hardset mounting media with DAPI. Images were acquired using a Leica DMi8 equipped with LasX acquisition software. Scale Bar is 66.5 pm.

[0044] Fig. 8. Immunofluorescent staining using a polyclonal Magi-2 antibody. Immunolabeling using this antibody similarly shows labeling in the superficial dorsal horn, recapitulating staining seen with monoclonal mouse Magi-2 antibody (Fig. IB). Spinal cord sections were obtained as described in material and methods. Co-staining was performed to determine colocalization relative to PKCy and TACR1. Scale bar is 10 microns.

[0045] Fig. 9. Further Characterization of the floxed AMagi-2 mouse line (A) The genetic loxP insertion strategy to generate Magi-2 floxed mouse (adapted from Shirata et al (73)). The endogenous 3’ UTR is altered in this genetic strategy perhaps explaining the Magi-2 deficiency B) Image of agarose gel showing PCR product for genotyping of AMagi-2 mice. Primer sequences available in Materials and Methods. C) Western analysis showing the cytosolic fraction of lysates described in Fig 1C. D) Quantification by densitometric analysis of Magi-2 Alpha and Beta levels in cytosolic fraction demonstrated in C n= 7 mice per genpotype. E) Baseline thermal withdrawal latencies showed no differences across genotypes using Hargreaves apparatus. F) Baseline mechanical withdrawal thresholds measured via ascending von Frey Fibers showed no differences across genotypes. For both Hargreaves and von Frey: (WT: n= 10 (4 males, 7 females), Het n = 19 (6 males, 13 females), AMagi-2: n = 12 ( 7 males, 5 females).

[0046] Fig. 10. No differences in spontaneous EPSC (sEPSC) properties or synaptic AMPA receptor protein levels across genotypes of Magi-2 deficient mice A). Whole-cell patchclamp recordings were obtained from lamina 1 neurons as described in Materials and Methods. Prior to bath application of NMD A, neurons were held at -70mV for one minute to obtain baseline current recordings. This timeframe was then analyzed using Easy Electrophysiology software to obtain the average amplitude, frequency and decay fit tau values for sEPSC. B-D) Events were detected with a threshold of -5pA. (WT: n= 4, Het n = 7, AMagi-2: n = 7) E)Western analysis of AMP A receptor subunits GluAl and GluA2 from the synaptic fraction of spinal cord dorsal horn lysates. These were the same lysates used to determine Magi-2 deficiency in Fig 1 and Fig. 9. F) Densitometric analysis revealed no differences in the levels of GluAl or GluA2 across genotypes. One-way ANOVA with Tukey Post hoc test for all comparisons across genotypes WT : n= 6, Het n = 6, AMagi-2: n = 6.

[0047] Fig. 11. Confirmation of SCDH viral transduction and densitometric analysis of the western analysis from Fig. 3b separated by isoform. (A, B) Immunohistochemical verification of GFP expression in the lumbar dorsal horn two weeks after intrathecal injection of AAV2 / 9-GFP-U6-m-Magi-2-shRNA using an antibody against GFP (B) versus a naive mouse stained and imaged under the same conditions (A); scale bar is 100 pm. (C-E) Alpha: shRNA VS. Scram p=0.0115*; Beta: shRNA VS. Scram p=0.0059**; Gamma: shRNA VS. Scram p=0.0033**. Unpaired students t-test: n=8 scram, n=6 shRNA.

[0048] Fig. 12. Baseline thermal paw withdrawal latencies and segregation by sex during Magi-2 knockdown. A) Baseline thermal paw withdrawal latencies show no differences across groups prior to either intrathecal administration of AAV2 / 9-GFP-U6-m-Magi-2-shRNA or AAV2 / 9-GFP-U6-m-Magi-2-scram control. B) Thermal Paw Withdrawal Latencies for only the male cohort: shRNA vs. Scram; 24 hours post-CFA: p=0.0028**; Day 3: p=0.0121*; Day 5 p=0.0123* C) Thermal Paw withdrawal latencies for only the female cohort: shRNA vs Scram: 3 days post-CFA: p=0.0016**; Day 5: p=0.0293*, Day 10: p=0.0297*; Day 14: p=0.0066**.D) direct comparison of males vs. females revealed no sex differences. All data represented as mean PWL + / - SEM, Two-way ANOVA with Bonferroni Correction n=l 1 scram (5 males, 6 females) n=12 shRNA (6 males, 6 females).

[0049] Fig. 13. NR1C2is selectively lost in AMagi-2 mice. A) Western analysis of NR1C2in WT, Heterozygous and AMagi-2 mice. B) Densitometric Analysis of A : WT vs. Het p=0.0201*. C) Western analysis of NR1C2in WT, Heterozygous and AMagi-2 mice. D) Densitometric Analysis of C. No differences were observed. Data represented as mean protein / actin. One-Way ANOVA with Tukey post hoc test. Each set of three bands is from a single lysate, the density of these three bands relative to the actin for each lane from each lysate are then averaged to create an n of 1 from a single animal. WT: n=5, Het: n=5, AMagi-2 : n=5

[0050] Fig. 14. Sequence alignment of NR1 C2 and C2’ C-termini from various species. Red denotes PDZ binding domain. Blue denotes Group III WW binding domain. NR1C2is only found in mammals. SEQ ID NOs: 55-66 are shown.

[0051] Fig. 15. Proteasome and lysosome inhibitors block the ability of Nedd4-1 to promote the ubiquitination and degradation of NR1C2. A) Western analysis showing the effect of MG-132 (50 pM) treatment on NR1C2levels in CHO cells transfected with NR1C2. B) Western analysis showing the effect of MG-132 (50 pM) treatment on NR1C2levels co-transfected with Nedd4-1. C) Densitometric analysis of A reveals no difference in NR1C2levels upon treatment with MG-132. D) Densitometric Analysis of B shows that MG-132 blocks the Nedd4-1 dependent loss of NR1C2levels. Vehicle (0.1% DMSO in PBS) vs. MG-132 p= 0.0498*, paired students t-test n=3. Data represented as mean protein level relative to actin + / - SEM. E) Treatment of co-transfected cells with the lysosomal inhibitor Bafilomycin Al (lOOnM) or vehicle (0.2% DMSO in PBS) increases the proportion of higher molecular weight bands corresponding to ubiquitinated NR1C2. In CHO cells, most NR1C2is expected to be retained in the ER due to the presence of an ER retention signal in the C-terminal therefore there would be a higher proportion of channel subunits susceptible to proteasomal rather than lysosomal activity. F) Densitometric analysis of NR1C2levels relative to actin following treatment with Bafilomycin Al. Density of upper band corresponding to higher molecular weight (i.e ubiquitinated) NR1C2was compared relative to vehicle (p= 0.0151*, paired students t-test n=4). G) Coimmunoprecipitation of NR1C2upon pull-down of Nedd4-1 in transfected Chinese Hamster Ovary cells.

[0052] Fig. 16. NR2B is selectively susceptible to Nedd4-2 but not Nedd4-1 mediated degradation while NR2A unaffected by either. A) Representative western analysis for NR2A following co-transfection with Nedd4-1. B) Representative western analysis for NR2A following co-transfection with Nedd4-2. C) Densitometric analysis for A showing no difference in NR2A protein levels upon co-transfection with Nedd4-1. D) Densitometric analysis for A showing no difference in NR2A protein levels upon co-transfection with Nedd4-2. E) Representative western analysis for NR2B following co-transfection with Nedd4-1. F) Representative western analysis for NR2B following co-transfection with Nedd4-2. G) Densitometric analysis for E showing no difference in NR2B protein levels upon co-transfection with Nedd4-1. H) Densitometric analysis forF: pcDNA vs. Nedd4-2 p=0.0467*. paired students t-test n=3 / group

[0053] Fig. 17. Magi-2 directly interacts with NR1C2via a WW-domain interaction. Coimmunoprecipitation of NR1C2was performed in CHO cells co-transfected with either full length myc-tagged Magi-2 or a myc-tagged construct containing only the WW domains of Magi-2. The interaction was absent when either construct was co-transfected with the NR1C2WW-binding motif mutant NRlC2-P918A.

[0054] Fig. 18. Contralateral paw withdrawal latencies of peptide and CFA treated mice from Main Text Figure 5B. Two-way ANOVA with Bonferroni post hoc analysis. No differences were observed.

[0055] Fig. 19. Phosphorylated peptide has analgesic effect in formalin assay. A) Time course of nocifense behaviors (sum of lick and lifts directed at injected hindpaw following injection of 20 pL of 5% Formalin (minute 0). B) No difference was observed in Phase 1 nocifense behavior. B) A significant reduction in Phase 2 nocifense behavior was observed in the Phosphorylated Peptide-injected mice compared to scrambled control (scram n = 12 (6 males, 6 females), Phos n= 13 (5 males, 7 females) p = 0.0198* unpaired Student’s t-test). D-G) When separated by sex, male mice injected with the phosphorylated peptide showed a significant reduction in Phase 1 nocifense behavior (p = 0.047* unpaired Student’s t-test).

[0056] Fig. 20. Glutamate substituted peptide has an analgesic effect in the formalin assay. B) A significant reduction in Phase 1 nocifensive behavior and a reduction in Phase 2 behavior (scrambled peptide n = 6 males, Glut n= 6 males, p = 0.0016 ** unpaired Student’s t- test. The sequence labelled “Glutamate” is SEQ ID NO:5.DETAILED DESCRIPTION OF THE DISCLOSURE

[0057] Although claimed subject matter will be described in terms of certain examples, other examples, including examples that do not provide all of the benefits and features set forth herein, are also within the scope of this disclosure. Various structural, logical, and process step changes may be made without departing from the scope of the disclosure.

[0058] Disclosed herein, in some examples, are compositions and methods for treating pain. Without being bound by any particular theory, in some examples of the present disclosure, the composition comprises an amino acid sequence that competes with NMDA receptor NR1C2subunits for binding to Magi2, thereby exposing free NR1C2to proteasomal degradation and selectively reducing perisynaptic NMDA receptor levels. Further disclosed herein, in some examples, are compositions and methods for treating a condition associated with pain loss in asubject in need thereof. Further disclosed herein, in some examples, are compositions and methods for treating a condition associated with NMDA NR1C2in a subject in need thereof.Certain Definitions

[0059] Although claimed subject matter will be described in terms of certain examples, other examples, including examples that do not provide all of the benefits and features set forth herein, are also within the scope of this disclosure. Various structural, logical, and process step changes may be made without departing from the scope of the disclosure.

[0060] The terminology used herein is for the purpose of describing particular cases only and is not intended to be limiting. As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed description and / or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.” Throughout this application, the singular form encompasses the plural and vice versa.

[0061] As used herein, unless otherwise indicated, “about”, “substantially”, or “the like”, when used in connection with a measurable variable (such as, for example, a parameter, an amount, a temporal duration, or the like) or a list of alternatives, is meant to encompass variations of and from the specified value including, but not limited to, those within experimental error (which can be determined by, e.g., a given data set, an art accepted standard, etc. and / or with, e.g., a given confidence interval (e.g. 90%, 95%, or more confidence interval from the mean), such as, for example, variations of + / -10% or less, + / -5% or less, + / -1% or less, and + / - 0.1% or less of and from the specified value), insofar such variations in a variable and / or variations in the alternatives are appropriate to perform in the instant disclosure. As used herein, the term “about” may mean that the amount or value in question is the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, compositions, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error, or the like, or other factors known to those of skill in the art such that equivalent results or effects are obtained. In general, an amount, size, composition, parameter, or other quantity or characteristic, or alternative is “about” or “the like,” whether or not expressly stated to be such. It is understoodthat where “about,” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0062] Ranges of values are disclosed herein. The ranges set out a lower limit value and an upper limit value. Unless otherwise stated, the ranges include the lower limit value, the upper limit value, and all values between the lower limit value and the upper limit value, including, but not limited to, all values to the magnitude of the smallest value (either the lower limit value or the upper limit value) of a range. It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a numerical range of “0.1% to 5%” should be interpreted to include not only the explicitly recited values of 0.1% to 5%, but also, unless otherwise stated, include individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g., 0.5% to 1.1%; 0.5% to 2.4%; 0.5% to 3.2%, and 0.5% to 4.4%, and other possible sub-ranges) within the indicated range. It is also understood (as presented above) that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about, it will be understood that the particular value forms a further disclosure. For example, if the value “about 10” is disclosed, then “10” is also disclosed.

[0063] As used herein, unless otherwise stated, the term “group” refers to a chemical entity that is monovalent (i.e., has one terminus that can be covalently bonded to other chemical species), divalent, or polyvalent (i.e., has two or more termini that can be covalently bonded to other chemical species). The term “group” also includes radicals (e.g., monovalent and multivalent, such as, for example, divalent, trivalent, and the like, radicals). Illustrative examples of groups include:

[0064] The term “treatment” as used herein refers to reduction in one or more symptoms or features associated with the presence of the particular condition being treated. Treatment doesnot necessarily mean complete cure or remission, nor does it preclude recurrence or relapses. For example, treatment in the present disclosure means reducing pain (e.g., decreasing pain sensitivity) or increasing pain sensitivity.

[0065] The term “therapeutically effective amount” as used herein refers to an amount of an agent sufficient to achieve, in a single or multiple doses, the intended purpose of treatment. Treatment does not have to lead to complete cure, although it may. Treatment can mean alleviation of one or more of the symptoms or markers of the indication. The exact amount desired or required will vary depending on the particular compound or composition used, its mode of administration, patient specifics and the like. Treatment can be orientated symptomatically, for example, to suppress symptoms. It can be affected over a short period, over a medium term, or can be a long-term treatment, such as, for example within the context of a maintenance therapy. Treatment can be continuous or intermittent.

[0066] Unless otherwise indicated, nucleic acids are written left to right in 5’ to 3’ orientation; amino acid sequences are written left to right in amino to carboxyl orientation, respectively. Numeric ranges recited within the specification are inclusive of the numbers defining the range and include each integer within the defined range. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

[0067] The present disclosure provides agents and methods of using these agents to affect an individual’s perception of pain and / or cognition. The agents may be proteins / peptides, siRNAs, and / or shRNAs targeting or acting on Magi-2 and / or NR1C2. In one aspect, use of these agents will affect an individual’s perception of pain and / or cognition.

[0068] In an aspect, the present disclosure provides proteins / peptides. As used throughout, the protein or peptide may simply be referred to as either a protein or a peptide, which can be used interchangeably throughout. The protein may be phosphorylated and / or lipidated (e.g., having a lipid group conjugated thereto). The protein may be phosphorylated at a functional group of any one of the protein’s amino acid residues’ side chains. The proteins may comprise all L-amino acids, all D-amino acids, or a mixture of L- and D-amino acids. The proteins / peptides or amino acid sequences as disclosed herein may comprise natural amino acids such as naturally occurring proteinogenic amino acids and non-proteinogenic amino acids, and / or unnatural amino acids such as synthetic non-proteinogenic amino acids.

[0069] As used herein, a “heterologous group” is a moiety such as a lipid group, a phosphate group, or a nanoparticle group, that is conjugated to, covalently attached to, or formulated with the peptides described herein that renders the peptide different from how the peptide appears in nature.

[0070] As used herein, in some examples, “chronic pain” is pain lasting for more than around 12 weeks. In other examples, “chronic pain” is pain that extends beyond an expected period of healing. As used herein, in some examples, “acute pain” is sharp and does not typically last longer than around six months. Acute pain goes away when there is no longer an underlying cause of pain.

[0071] The term “pharmaceutically acceptable excipient” as used herein refers to ingredients which are added to pharmaceutical compositions such as, but not limited to, buffers, tonicity agents, and preservatives.

[0072] The references cited in this application are hereby incorporated by reference. All sections of this application, including any supplementary sections or figures, are fully a part of this application.Peptide Compositions for Treating Pain

[0073] Disclosed herein, in some examples, are compositions that comprise an amino acid sequence that comprises the sequence according to NQX1DX2VX3PRRAIERE (SEQ ID NO: 1), wherein Xi is selected from K and R; X2 is selected from T, S, E, and D; and X3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle.Xi, X2, and X3

[0074] In some examples, Xi is K. In some examples, Xi is R. In some examples, X2 is selected from T, S and E. In some examples, X2 is selected from T and S. In some examples, X2 is T. In some examples, X2 is S. In some examples, X2 is E. In some examples, X2 is D. In some examples, X3 is L. In some examples, X3 is P.

[0075] In some examples, Xi is K and X2 is T. In some examples, Xi is K and X2 is S. In some examples, Xi is K and X2 is E. In some examples, Xi is K and X2 is D. In some examples, Xi is R and X2 is T. In some examples, Xi is R and X2 is S. In some examples, Xi is R and X2 is E. In some examples, Xi is R and X2 is D. In some examples, Xi is K and X3 is L. In some examples, Xi is K and X is P. In some examples, Xi is R and X3 is L. In some examples, Xi is Rand X3 is P. In some examples, X2 is T and X3 is L. In some examples, X2 is T and X3 is P. In some examples, X2 is S and X3 is L. In some examples, X2 is S and X3 is P. In some examples, X2 is E and X3 is L. In some examples, X2 is E and X3 is P. In some examples, X2 is D and X3 is L. In some examples, X2 is D and X3 is P.

[0076] In some examples, Xi is K, X2 is T, and X3 is L. In some examples, Xi is K, X2 is T, and X3 is P. In some examples, Xi is K, X2 is S, and X3 is L. In some examples, Xi is K, X2 isS, and X3 is P. In some examples, Xi is K, X2 is E, and X3 is L. In some examples, Xi is K, X2is E, and X3 is P. In some examples, Xi is K, X2 is D, and X3 is L. In some examples, Xi is K, X2 isD, and X3 is P. In some examples, Xi is R, X2 is T, and X3 is L. In some examples, Xi is R, X2 isT, and X3 is P. In some examples, Xi is R, X2 is S, and X3 is L. In some examples, Xi is R, X2 is S, and X3 is P. In some examples, Xi is R, X2 is E, and X3 is L. In some examples, Xi is R, X2 isE, and X3 is P. In some examples, Xi is R, X2 is D, and X3 is L. In some examples, Xi is R, X2 is D, and X3 is P.

[0077] In some examples, the amino acid sequence comprises a sequence according to any one of SEQ ID NOs: 2-25. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 2. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 3. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 4. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 5. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 6. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 7. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 8. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 9. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 10. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 11. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 12. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 13. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 14. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 15. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 16. In some examples, the amino acid sequence comprises the amino acidsequence of SEQ ID NO: 17. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 18. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 19. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 20. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 21. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 22. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 23. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 24. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 25.

[0078] Table. 1 Example Amino Acid Compositions for Treating Pain1JpThr is phosphothreonine; pSer is phosphoserine

[0079] In some examples, the amino acid sequence consists of a sequence according to any one of SEQ ID NOs: 2-25. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 2. In some examples, the amino acid sequence consists of theamino acid sequence of SEQ ID NO: 3. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 4. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 5. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 6. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 7. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 8. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 9. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 10. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 11. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 12. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 13. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 14. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 15. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 16. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 17. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 18. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 19. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 20. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 21. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 22. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 23. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 24. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 25.

[0080] In some examples, the composition is phosphorylated. In some examples, the amino acid sequence is phosphorylated. In some examples, position X2 of the amino acid sequence is phosphorylated. In some examples, X2 is T, and T is phosphorylated. In some examples, X2 is S, and S is phosphorylated.Lipid Moiety

[0081] In some examples, the lipid moiety is conjugated to the N-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the C-terminus of the aminoacid sequence. In some examples, the lipid moiety is conjugated to the amino acid sequence through a linker. In some examples, the linker comprises a Gly / Ser linker.

[0082] In some examples, the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (Cu) group, a palmitoyl (Cie) group, or a stearoyl (Cis) group. In some examples, the lipid moiety comprises an octanoyl (Cs) group. In some examples, the lipid moiety comprises a lauroyl (C12) group. In some examples, the lipid moiety comprises a myristoyl (C14) group. In some examples, the lipid moiety comprises a palmitoyl (Cie) group. In some examples, the lipid moiety comprises a stearoyl (Cis) group.

[0083] In some examples, X2 is T, T is phosphorylated, and the lipid moiety comprises a myristoyl (C14) group. In some examples, X2 is T, T is phosphorylated, the lipid moiety is conjugated to the N-terminus of the amino acid sequence, and the lipid moiety comprises a myristoyl (C14) group. In some examples, Xi is K, X2 is T and T is phosphorylated, X3 is L, the lipid moiety is conjugated to the N-terminus of the amino acid sequence, and the lipid moiety comprises a myristoyl (C14) group. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 3, the lipid moiety is conjugated to the N-terminus of the amino acid sequence, and the lipid moiety comprises a myristoyl (C14) group. In some examples, the amino acid sequence consists of the amino acid sequence of SEQ ID NO: 3, the lipid moiety is conjugated to the N-terminus of the amino acid sequence, and the lipid moiety is a myristoyl (C14) group.

[0084] In some examples, the amino acid sequence is no more than 30 amino acid residues in length. In some examples, the amino acid sequence is no more than 25 amino acid residues in length. In some examples, the amino acid sequence is no more than 20 amino acid residues in length. In some examples, the amino acid sequence is no more than 15 amino acid residues in length.

[0085] In some examples, the composition is a pharmaceutical composition and the composition further comprises a pharmaceutically acceptable excipient.

[0086] In some examples, the amino acid sequence is a synthetic amino acid sequence. In some examples, the amino acid sequence comprises an unnatural amino acid residue. In some examples, the unnatural amino acid residue comprises a D-amino acid residue. In some examples, the amino acid sequence one or more post-translational modifications.Methods for Treating Pain

[0087] Disclosed herein, in some examples, are methods for treating pain in a subject in need thereof comprising administering to the subject the composition according to certain examples disclosed herein.

[0088] Disclosed herein, in some examples, are methods for treating pain in a subject in need thereof comprising administering to the subject a composition that comprises an amino acid sequence that comprises the sequence according to NQX1DX2VX3PRRAIERE (SEQ ID NO: 1), wherein Xi is selected from K and R; X2 is selected from T, S, E, and D; and X3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle. In some examples, Xi is K. In some examples, Xi is R. In some examples, X2 is selected from T, S and E. In some examples, X2 is selected from T and S. In some examples, X2 is T. In some examples, X2 is S. In some examples, X2 is E. In some examples, X2 is D. In some examples, X3 is L. In some examples, X3 is P. In some examples, Xi is K and X2 is T. In some examples, Xi is K and X2 is S. In some examples, Xi is K and X2 is E. In some examples, Xi is K and X2 is D. In some examples, Xi is R and X2 is T. In some examples, Xi is R and X2is S. In some examples, Xi is R and X2is E. In some examples, Xi is R and X2is D. In some examples, Xi is K and X3 is L. In some examples, Xi is K and X3 is P. In some examples, Xi is R and X3 is L. In some examples, Xi is R and X3 is P. In some examples, X2 is T and X3 is L. In some examples, X2 is T and X3 is P. In some examples, X2 is S and X3 is L. In some examples, X2 is S and X3 is P. In some examples, X2 is E and X3 is L. In some examples, X2 is E and X3 is P. In some examples, X2 is D and X3 is L. In some examples, X2 is D and X3 is P. In some examples, Xi is K, X2 is T, and X3 is L. In some examples, Xi is K, X2 is T, and X3 is P. In some examples, Xi is K, X2 is S, and X3 is L. In some examples, Xi is K, X2 is S, and X3 is P. In some examples, Xi is K, X2 is E, and X3 is L. In some examples, Xi is K, X2 is E, and X3 is P. In some examples, Xi is K, X2 is D, and X3 is L. In some examples, Xi is K, X2 is D, and X3 is P. In some examples, Xi is R, X2 is T, and X3 is L. In some examples, Xi is R, X2 is T, and X3 is P. In some examples, Xi is R, X2 is S, and X3 is L. In some examples, Xi is R, X2 is S, and X3 is P. In some examples, Xi is R, X2 is E, and X3 is L. In some examples, Xi is R, X2 is E, and X3 is P. In some examples, Xi is R, X2 is D, and X3 is L. In some examples, Xi is R, X2 is D, and X3 is P. In some examples, the amino acid sequence comprises a sequence according to any one of SEQ ID NOs: 2-25.

[0089] In some examples, the composition is phosphorylated. In some examples, the amino acid sequence is phosphorylated. In some examples, position X of the amino acid sequence is phosphorylated. In some examples, X2 is T, and T is phosphorylated. In some examples, X2 is S, and S is phosphorylated.

[0090] In some examples, the lipid moiety is conjugated to the N-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the C-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the amino acid sequence through a linker. In some examples, the linker comprises a Gly / Ser linker. In some examples, the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (Cu) group, a palmitoyl (Cie) group, or a stearoyl (Cis) group. In some examples, the lipid moiety comprises an octanoyl (Cs) group. In some examples, the lipid moiety comprises a lauroyl (C12) group. In some examples, the lipid moiety comprises a myristoyl (C14) group. In some examples, the lipid moiety comprises a palmitoyl (Cie) group. In some examples, the lipid moiety comprises a stearoyl (Cis) group. In some examples, X2 is T, T is phosphorylated, and the lipid moiety comprises a myristoyl (C14) group. In some examples, X2 is T, T is phosphorylated, the lipid moiety is conjugated to the N-terminus of the amino acid sequence, and the lipid moiety comprises a myristoyl (C14) group.

[0091] In some examples, the subject does not take opioids, does not tolerate opioids well, suffers from opioid addiction, or is at risk of relapse for opioid addiction. In some examples, the risk of relapse for opioid addiction is determined subjectively or objectively by the subject or a medical professional.

[0092] In some examples, the pain comprises nociceptive pain. In some examples, the pain comprises neuropathic pain. In some examples, the pain is a symptom of a disease, condition, or an injury. In some examples, the injury comprises a spinal cord injury, a nerve injury, a somatic injury, or a burn. In some examples, the disease comprises a chronic disease. In some examples, the chronic disease comprises diabetes, Herpes zoster, major depressive disorder, fibromyalgia, migraine, arthritis, cancer, multiple sclerosis, inflammatory bowel disease or HIV / AIDS. In some examples, the disease comprises chronic inflammation. In some examples, the disease that comprises chronic inflammation comprises carpal tunnel syndrome. In some examples, the pain is associated with chemotherapy, radiation, Morton’s neuroma, mechanical stress, thermal stress, allodynia, or hyperalgesia. In some examples, the allodynia orhyperalgesia is mechanical, thermal, or associated with movement. In some examples, the hyperalgesia is opioid-induced hyperalgesia. In some examples, the pain comprises post-surgical pain.

[0093] In some examples, the composition is administered to the subject prophylactically. In some examples, the composition is administered to the subject prophylactically prior to surgery, laparoscopy, chemotherapy, dental work, radiation, or childbirth.

[0094] In some examples, the pain is chronic pain or acute pain. In some examples, the chronic pain comprises pain that lasts at least 12 weeks. In some examples, the chronic pain comprises pain that extends beyond an expected period of healing. In some examples, the acute pain comprises sharp pain. In some examples, the acute pain comprises pain associated with surgery, laparoscopy, broken bones, dental work, burns, cuts, childbirth labor, or childbirth.

[0095] In various other examples, the pain is associate in complex regional pain syndrome (CRPS), post-herpetic neuralgia, trigeminal neuralgia, HIV-associated neuropathy, phantom limb pain, vasculitis-associated pain, or brachial / lumbosacral plexopathy. In various examples, the pain is associated with any of one or more of the preceding.

[0096] In some examples, the composition is administered to the subject using any known method and route including, but not limited to, oral, parenteral, intrathecal, subcutaneous, intraperitoneal, intrapulmonary, intranasal, intracranial, topical, or transdermal administration. In some examples, parenteral administration includes, but is not limited to, intramuscular, intravenous, intraarterial, intraperitoneal, and subcutaneous administration. In some examples, the composition is administered to the subject using needless administration.

[0097] In some examples, the effect of the composition is exhibited by the individual for 0.25-120 hours (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including all integers and decimals to the 100th place and all ranges therebetween, following administration to the individual.Peptides for Increasing Pain Sensitivity

[0098] Disclosed herein, in some examples, are compositions that comprise an amino acid sequence that comprises the sequence according to NQU1DU2VU3PRRAIERE (SEQ ID NO: 26), wherein Ui is selected from K and R; U2 is selected from A, V, G, and L; and U3 isselected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle.Ui, U2, and Us

[0099] In some examples, Ui is K. In some examples, Ui is R. In some examples, U2 is selected from A, V, and G. In some examples, U2 is selected from A and V. In some examples, U2 is A. In some examples, U2 is V. In some examples, U2 is G. In some examples, U2 is L. In some examples, U3 is L. In some examples, U3 is P.

[0100] In some examples, Ui is K and U2 is A. In some examples, Ui is K and U2 is V. In some examples, Ui is K and U2 is G. In some examples, Ui is K and U2 is L. In some examples, Ui is R and U2 is A. In some examples, Ui is R and U2 is V. In some examples, Ui is R and U2 is G. In some examples, Ui is R and U2 is L. In some examples, Ui is K and U3 is L. In some examples, Ui is K and U3 is P. In some examples, Ui is R and U3 is L. In some examples, Ui is R and U3 is P. In some examples, U2 is A and U3 is L. In some examples, U2 is A and U3 is P. In some examples, U2 is V and U3 is L. In some examples, U2 is V and U3 is P. In some examples, U2 is G and U3 is L. In some examples, U2 is G and U3 is P. In some examples, U2 is L and U3 is L. In some examples, U2 is L and U3 is P.

[0101] In some examples, Ui is K, U2 is A, and U3 is L. In some examples, Ui is K, U2 is A, and U3 is P. In some examples, Ui is K, U2 is V, and U3 is L. In some examples, Ui is K, U2 is V, and U3 is P. In some examples, Ui is K, U2 is G, and U3 is L. In some examples, Ui is K, U2 is G, and U3 is P. In some examples, Ui is K, U2 is L, and U3 is L. In some examples, Ui is K, U2 is L, and U3 is P. In some examples, Ui is R, U2 is A, and U3 is L. In some examples, Ui is R, U2 is A, and U3 is P. In some examples, Ui is R, U2 is V, and U3 is L. In some examples, Ui is R, U2 is V, and U3 is P. In some examples, Ui is R, U2 is G, and U3 is L. In some examples, Ui is R, U2 is G, and U3 is P. In some examples, Ui is R, U2 is L, and U3 is L. In some examples, Ui is R, U2 is L, and U3 is P.

[0102] In some examples, the composition comprises an amino acid sequence according to any one of SEQ ID NOs: 27-42. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 27. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 28. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 29. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 30. In some examples, the composition comprises the amino acidsequence of SEQ ID NO: 31. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 32. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 33. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 34. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 35. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 36. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 37. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 38. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 39. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 40. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 41. In some examples, the composition comprises the amino acid sequence of SEQ ID NO: 42.

[0103] Table 2. Compositions for Increasing Pain Sensitivity

[0104] In some examples, the composition consists of an amino acid sequence according to any one of SEQ ID NOs: 27-42. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 27. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 28. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 29. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 30. In some examples, the composition consists of the amino acidsequence of SEQ ID NO: 31. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 32. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 33. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 34. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 35. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 36. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 37. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 38. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 39. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 40. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 41. In some examples, the composition consists of the amino acid sequence of SEQ ID NO: 42.

[0105] In some examples, the composition is phosphorylated. In some examples, the amino acid sequence is phosphorylated.Lipid Moiety

[0106] In some examples, the lipid moiety is conjugated to the N-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the C-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the amino acid sequence through a linker. In some examples, the linker comprises a Gly / Ser linker.

[0107] In some examples, the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (Cu) group, a palmitoyl (Cie) group, or a stearoyl (Cis) group. In some examples, the lipid moiety comprises an octanoyl (Cs) group. In some examples, the lipid moiety comprises a lauroyl (C12) group. In some examples, the lipid moiety comprises a myristoyl (C14) group. In some examples, the lipid moiety comprises a palmitoyl (Cie) group. In some examples, the lipid moiety comprises a stearoyl (Cis) group.

[0108] In some examples, Ui is K, U2 is A, U3 is L, and the lipid moiety comprises a myristoyl (C14) group. In some examples, Ui is K, U2 is A, U3 is L, the lipid moiety is conjugated to the N-terminus of the amino acid sequence, and the lipid moiety comprises a myristoyl (C 14) group. In some examples, the amino acid sequence comprises the amino acid sequence of SEQ ID NO: 27, the lipid moiety is conjugated to the N-terminus of the amino acid sequence, and the lipid moiety comprises a myristoyl (C14) group. In some examples, the amino acid sequenceconsists of the amino acid sequence of SEQ ID NO: 27, the lipid moiety is conjugated to the N- terminus of the amino acid sequence, and the lipid moiety is a myristoyl (C 14) group.

[0109] In some examples, the amino acid sequence is no more than 30 amino acid residues in length. In some examples, the amino acid sequence is no more than 25 amino acid residues in length. In some examples, the amino acid sequence is no more than 20 amino acid residues in length. In some examples, wherein the amino acid sequence is no more than 15 amino acid residues in length.

[0110] In some examples, the composition is a pharmaceutical composition and the composition further comprises a pharmaceutically acceptable excipient.

[0111] In some examples, the amino acid sequence is a synthetic amino acid sequence. In some examples, the amino acid sequence comprises an unnatural amino acid residue. In some examples, the unnatural amino acid residue comprises a D-amino acid residue. In some examples, the amino acid sequence comprises one or more post-translational modifications. Methods for Treating Conditions Associated with Pain Loss

[0112] Disclosed herein, in some examples, are methods for treating a condition associated with pain loss in a subject in need thereof comprising administering to the subject the composition according to certain examples disclosed herein.

[0113] Disclosed herein, in some examples, are methods for treating a condition associated with pain loss in a subject in need thereof comprising administering to the subject a composition that comprises an amino acid sequence that comprises the sequence according to NQU1DU2VU3PRRAIERE (SEQ ID NO: 26), wherein Ui is selected from K and R; U2is selected from A, V, G, and L; and U3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle. In some examples, Ui is K. In some examples, Ui is R. In some examples, U2 is selected from A, V, and G. In some examples, U2 is selected from A and V. In some examples, U2 is A. In some examples, U2is V. In some examples, U2 is G. In some examples, U2 is L. In some examples, U3 is L. In some examples, U3 is P. In some examples, Ui is K and U2 is A. In some examples, Ui is K and U2 is V. In some examples, Ui is K and U2 is G. In some examples, Ui is K and U2 is L. In some examples, Ui is R and U2 is A. In some examples, Ui is R and U2 is V. In some examples, Ui is R and U2 is G. In some examples, Ui is R and U2 is L. In some examples, Ui is K and U3 is L. In some examples, Ui is K and U3 is P. Insome examples, Ui is R and U3 is L. In some examples, Ui is R and U3 is P. In some examples, U2 is A and U3 is L. In some examples, U2 is A and U3 is P. In some examples, U2 is V and U3 is L. In some examples, U2 is V and U3 is P. In some examples, U2 is G and U3 is L. In some examples, U2 is G and U3 is P. In some examples, U2 is L and U3 is L. In some examples, Ui is K, U2 is A, and U3 is L. In some examples, Ui is K, U2 is A, and U3 is P. In some examples, Ui is K, U2 is V, and U3 is L. In some examples, Ui is K, U2 is V, and U3 is P. In some examples, Ui is K, U2 is G, and U3 is L. In some examples, Ui is K, U2 is G, and U3 is P. In some examples, Ui is K, U2 is L, and U3 is L. In some examples, Ui is K, U2 is L, and U3 is P. In some examples, Ui is R, U2 is A, and U3 is L. In some examples, Ui is R, U2 is A, and U3 is P. In some examples, Ui is R, U2 is V, and U3 is L. In some examples, Ui is R, U2 is V, and U3 is P. In some examples, Ui is R, U2 is G, and U3 is L. In some examples, Ui is R, U2 is G, and U3 is P. In some examples, Ui is R, U2 is L, and U3 is L. In some examples, Ui is R, U2 is L, and U3 is P. In some examples, the composition comprises an amino acid sequence according to any one of SEQ ID NOs: 27-42.

[0114] In some examples, the composition is phosphorylated. In some examples, the amino acid sequence is phosphorylated. In some examples, the lipid moiety is conjugated to the N-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the C-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the amino acid sequence through a linker. In some examples, the linker comprises a Gly / Ser linker. In some examples, the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (C14) group, a palmitoyl (Cie) group, or a stearoyl (Cis) group. In some examples, the lipid moiety comprises an octanoyl (Cs) group. In some examples, the lipid moiety comprises a lauroyl (C12) group. In some examples, the lipid moiety comprises a myristoyl (C14) group. In some examples, the lipid moiety comprises a palmitoyl (Cie) group. In some examples, the lipid moiety comprises a stearoyl (Cis) group.

[0115] In some examples, the condition associated with pain loss comprises congenital insensitivity to pain (CIP), a hereditary sensory neuropathy, or a hereditary sensory autonomic neuropathy (HSAN). In some examples, the administering to the subject increases the subject’s sensitivity to pain.

[0116] In some examples, the composition is administered to the subject using any known method and route including, but not limited to, oral, parenteral, intrathecal, subcutaneous, intraperitoneal, intrapulmonary, intranasal, intracranial, topical, or transdermal administration. Insome examples, parenteral administration includes, but is not limited to, intramuscular, intravenous, intraarterial, intraperitoneal, and subcutaneous administration. In some examples, the composition is administered to the subject using needless administration.

[0117] In some examples, the effect of the composition is exhibited by the individual for 0.25-120 hours (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including all integers and decimals to the 100th place and all ranges therebetween, following administration to the individual.Methods for Treating Conditions Associated with NMDA NR1C2

[0118] Disclosed herein, in some examples, are methods for treating a condition associated with NMDA NR1C2in a subject in need thereof comprising administering to the subject the composition according to certain examples disclosed herein.

[0119] Disclosed herein, in some examples, are methods for treating a condition associated with NMDA NR1C2in a subject in need thereof comprising administering to the subject a composition that comprises an amino acid sequence that comprises the sequence according to NQU1DU2VU3PRRAIERE (SEQ ID NO: 26), wherein Ui is selected from K and R; U2 is selected from A, V, G, and L; and U3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle. In some examples, Ui is K. In some examples, Ui is R. In some examples, U2 is selected from A, V, and G. In some examples, U2 is selected from A and V. In some examples, U2 is A. In some examples, U2 is V. In some examples, U2 is G. In some examples, U2 is L. In some examples, U3 is L. In some examples, U3 is P. In some examples, Ui is K and U2 is A. In some examples, Ui is K and U2 is V. In some examples, Ui is K and U2 is G. In some examples, Ui is K and U2 is L. In some examples, Ui is R and U2 is A. In some examples, Ui is R and U2 is V. In some examples, Ui is R and U2 is G. In some examples, Ui is R and U2 is L. In some examples, Ui is K and U3 is L. In some examples, Ui is K and U3 is P. In some examples, Ui is R and U3 is L. In some examples, Ui is R and U3 is P. In some examples, U2 is A and U3 is L. In some examples, U2 is A and U3 is P. In some examples, U2 is V and U3 is L. In some examples, U2 is V and U3 is P. In some examples, U2 is G and U3 is L. In some examples, U2 is G and U3 is P. In some examples, U2 is L and U3 is L. In some examples, Ui is K, U2 is A, and U3 is L. In some examples, Ui is K, U2 is A, and U3 is P. In some examples, Ui is K, U2 is V, and U3 is L. In some examples, Ui is K, U2 is V, and U3 is P. In some examples, Ui isK, U2 is G, and U3 is L. In some examples, Ui is K, U2 is G, and U3 is P. In some examples, Ui is K, U2 is L, and U3 is L. In some examples, Ui is K, U2 is L, and U3 is P. In some examples, Ui is R, U2 is A, and U3 is L. In some examples, Ui is R, U2 is A, and U3 is P. In some examples, Ui is R, U2 is V, and U3 is L. In some examples, Ui is R, U2 is V, and U3 is P. In some examples, Ui is R, U2 is G, and U3 is L. In some examples, Ui is R, U2 is G, and U3 is P. In some examples, Ui is R, U2 is L, and U3 is L. In some examples, Ui is R, U2 is L, and U3 is P. In some examples, the composition comprises an amino acid sequence according to any one of SEQ ID NOs: 27-42.

[0120] In some examples, the composition is phosphorylated. In some examples, the amino acid sequence is phosphorylated. In some examples, the lipid moiety is conjugated to the N-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the C-terminus of the amino acid sequence. In some examples, the lipid moiety is conjugated to the amino acid sequence through a linker. In some examples, the linker comprises a Gly / Ser linker. In some examples, the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (C14) group, a palmitoyl (Cie) group, or a stearoyl (Cis) group. In some examples, the lipid moiety comprises an octanoyl (Cs) group. In some examples, the lipid moiety comprises a lauroyl (C12) group. In some examples, the lipid moiety comprises a myristoyl (C14) group. In some examples, the lipid moiety comprises a palmitoyl (Cie) group. In some examples, the lipid moiety comprises a stearoyl (Cis) group.

[0121] In some examples, the condition associated with NMDA NR1C2comprises stroke, Alzheimer's Disease, attention-deficit hyperactivity disorder (ADHD), schizophrenia, bipolar disorder, epilepsy, Huntington's disease, Parkinson's disease, Amyotrophic lateral sclerosis, chronic fatigue syndrome, anxiety, depression, post-traumatic stress disorder, obsessive compulsive disorder, or a phobia.

[0122] In some examples, the composition is administered to the subject using any known method and route including, but not limited to, oral, parenteral, intrathecal, subcutaneous, intraperitoneal, intrapulmonary, intranasal, intracranial, topical, epidural, or transdermal administration. In some examples, parenteral administration includes, but is not limited to, intramuscular, intravenous, intraarterial, intraperitoneal, and subcutaneous administration. In some examples, the composition is administered to the subject using needless administration.

[0123] In some examples, the effect of the composition is exhibited by the individual for 0.25-120 hours (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including allintegers and decimals to the 100th place and all ranges therebetween, following administration to the individual.Pain Perception

[0124] Perception of pain can be determined, e.g., by description from the subject based on pain assessments using a variety of validated pain measurement tools (e.g., visual analog pain scale (VAS), numeric rating pain (NRS), categorical verbal rating pain scale (VRS), multidimensional scales assessing the sensory components and also cognitive and psychological dimensions of pain, health-related quality-of-life assessment, pain-related functional assessments). Non-limiting examples of pain measurement tools include the VAS, NRS, VRS, the McGill Pain Questionnaire (MPQ) and its Short Form, The Brief Pain Inventory (BPI), Neuropathic Pain Score (NPS), The Pain Self-Efficacy Questionnaire, Patient Global Impression of Change scale, The European Quality of Life Instrument (EQ 5D), Pain Disability Index (PDI), The Oswestry Disability Index (ODI), the Beck Depression Inventory and Profile of Mood States, the Wong-Baker faces pain scale, the FLACC scale (face, legs, activity, cry, and consolability), the CRIES scale (crying, requires 02 for SaO2 <95%, increased vital signs (BP and HR), expression, sleepless), the COMFORT scale, Mankoski pain scale, descriptor differential scale of pain intensity, and combinations thereof.

[0125] The decrease in perception of pain can be qualified when the pain is treated or prevented when it is at least partially ameliorated. Likewise, the method does not require complete anesthesia. For example, the treatment or decrease of perception of pain is considered anesthetically effective when the subject’s mechanical / tactile sensitivity is at least partially decreased. The subject’s mechanical / tactile sensitivity may be determined subjectively or objectively by the subject and / or a medical professional such as a surgeon, other doctor or other clinician. The anesthesia may be local or central.

[0126] A subject’s pain may be ameliorated when the subject’s pain (e.g., pain perception) is decreased. In example, a subject’s pain is ameliorated when the subject’s pain (e.g., pain perception) is at a desired level (e.g., the pain is not uncomfortable).Production of Peptides

[0127] In some examples, the amino acid sequence of any one of the examples disclosed herein is produced recombinantly or synthetically.

[0128] In some examples, the amino acid sequence is produced via solid phase peptide synthesis (SPPS). In some examples, the amino acid sequence is produced using Fmoc-based chemistry or Boc-based chemistry. In such examples, various solid supports or resins and activators may be used. Non-limiting examples of solid supports or resins include Rank Amine resins, PAL resins, Sieber Amide resins, Wang resins, trityl resins, chlorotrityl resins, and the like. Other resins known in the art are considered within the scope of the present disclosure. An exemplary activator is carbodiimide activator. Non-limiting examples of activators include diisopropylcarbodiimide (DIC), 1 -hydroxybenzotriazole (HOBt), l-hydroxy-7-azabenzotriazole (HOAt), 2-(lH-benzotriazol-l-yl)-l,l,3,3-tetramethyluronium hexafluorophosphate (HBTU), 1- [Bis(dimethylamino)methylene]-1H-l,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU), and the like, and combinations thereof. Cleavage of the amino acid sequence from the solid support (e g., resin) may be achieved using methods known in the art. In some examples, cleavage of the amino acid sequence from the solid support comprises contacting the amino acid sequence with a cleavage cocktail. For Fmoc-based chemistry, the cleavage cocktail may comprise trifluoroacetic acid (TFA). The cleavage cocktail may further comprise a silane (e.g., triisopropyl silane (TIS)) and water. Other non-limiting examples of cleavage cocktails include Reagent K, Reagent L, and Reagent R. Following cleavage from the resin, the cleaved amino acid sequence may be concentrated and precipitated from the concentrated solution using, for example, cold anhydrous ether.

[0129] The precipitated sequence may be pelleted and purified using purification methods known in the art. For example, purification may be carried out using high performance liquid chromatography (HPLC) or other similar methods. HPLC may be reverse phase HPLC where acetonitrile (with or without TFA) and water (with or without TFA) is the mobile phase. Various other mobile phases are known in the art and are within the scope of the present disclosure. The aqueous fractions containing the purified amino acid sequence may be concentrated using methods known in the art. For example, in some examples, the aqueous fractions are lyophilized.

[0130] An exemplary method for synthesizing peptides via solid phase synthesis method involves a stepwise incorporation of amino acids in vitro in a C- to N-terminal direction (opposite to the direction of protein synthesis in biological systems in vivo). Synthesis is based on the formation of a peptide bond between two amino acids in which the carboxyl group of oneamino acid is coupled to the amino group of another amino acid. This process is repeated until the desired peptide sequence is obtained. The side chains of all amino acids are capped with specific “permanent” groups that could withstand continuous chemical treatment throughout the cyclical phases of synthesis and are cleaved just prior to the purification of nascent peptide chain. Additionally, the N-terminal of each incoming amino acid is protected with 9- fluorenylmethoxycarbonyl (Fmoc) groups, which are removed by a mild base in each cycle to allow for the incorporation of the next amino acid to the chain. These Fmoc groups prevent nonspecific reactions during synthesis that would lead to changes in length or branching of the peptide chain. Deprotection usually results in the production of cations with the potential to alkylate the functional groups on the peptide chain. Therefore, scavengers such as water, anisol or thiol derivatives are added during deprotection on to block free reactive species.

[0131] For optional phospho-threonine peptides, threonine is protected by trityl ethers [Fmoc-Thr(Trt)-OH]. The trityl -protected derivatives can be selectively deprotected on resin, which is useful for preparing phosphothreonine-containing peptides by global phosphorylation methodology. Global phosphorylation involves selective phosphitylation of the appropriate hydroxyl threonine on the solid phase, with a protected phosphoramidite, followed by oxidation of the resultant P(III) triester to the P(V) triester. Finally, myristoylation was achieved by N- myristoyltransferase, the enzyme that catalyzes protein N-myristoylation (at the N-terminus).Substrate Conjugation

[0132] In some examples, the amino acid sequence of any one of the examples disclosed herein is further conjugated to a substrate. In some examples, the substrate increases an ability of the amino acid sequence to pass through the blood brain barrier. In some examples, the substrate is a nanoparticle. In some examples, the amino acid sequence is conjugated to a nanoparticle.Additional Agents

[0133] In some examples, the composition of any one of the examples disclosed herein may further include one or more additional agents. In some examples, the composition may include an agent that inhibits expression of the NMDA NR1C2subunit. In some examples, the agent inhibits persistence of mRNA encoding the NMDA receptor or inhibits translation of the mRNA that encodes the NMDA receptor. In some examples, the agent comprises an RNA interference (RNAi) agent, said agent being any of an antisense oligonucleotide, siRNA, a microRNA, a small hairpin RNA (shRNA), or a ribozyme. RNAi-mediating agents may beadministered to an individual using any suitable approach. In examples, one or more expression vectors may be used and may comprise viral vectors. Viral expression vectors may be used as naked polynucleotides, or may comprise any of viral particles, including but not limited to defective interfering particles or other replication defective viral constructs, and virus-like particles. In some examples, the expression vector comprises a modified viral polynucleotide, such as from an adenovirus, a herpesvirus, or a retrovirus. In some examples, a recombinant adeno-associated virus (AAV) vector may be used. In certain examples, the expression vector is a self-complementary adeno-associated virus (scAAV).

[0134] In various examples, an RNAi agent may be delivered in the absence of a protein or peptide of the present disclosure (e.g., a protein having a sequence according to SEQ ID NO:1 or SEQ ID NO:26 or any species falling within the genus of SEQ ID NO: 1 or SEQ ID NO:26).In various examples, the RNAi agent may be made in vivo and a composition administered to an individual in need of treatment may comprise the RNAi agent or the material to allow for the production of the RNAi material in vivo. In various examples, the RNAi material is shRNA. The shRNA may have the following sequence: GTACAGAACCTGAGCCATATrCAAGAGATATGGCTCAGGTTCTGTAC (SEQ ID NO:51) or a sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto. In various example, the material administered to the subject is material to allow for the production of GTACAGAACCTGAGCCATA77GA4GAGATATGGCTC AGGTTCTGTAC (SEQ ID NO:51) or a sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto in vivo.

[0135] In some examples, the composition of any one of the examples disclosed herein further comprises an analgesic agent (e.g., nonsteroidal anti-inflammatory drug (NSAID)), an anesthetic agent, and / or an anti-inflammatory agent (e.g., glucocorticoid). Non-limiting examples of analgesics include acetaminophen, aspirin, ibuprofen, naproxen, meloxicam, ketorolac, diclofenac, ketoprofen, piroxicam, and metamizole. Non-limiting examples of anesthetic agents include bupivacaine, etidocaine, levobupivacaine, lidocaine, mepivacaine, prilocaine, ropivacaine, procaine, chloroprocaine, hydrocortisone, triamcinolone, methylprednisolone.

[0136] In some examples, the composition of any one of the examples disclosed herein comprises an agent (e.g., an RNAi agent or a protein / peptide) and a pharmaceutically acceptable carrier or excipient. In some examples, the composition of any one of the examples disclosed herein is a pharmaceutical composition that comprises an agent (e.g., an RNAi agent or a protein / peptide) and a pharmaceutically acceptable carrier or excipient. In some examples, the composition of any one of the examples disclosed herein is pharmaceutical composition that comprises a pharmaceutically acceptable carrier or excipient and protein / peptide and / or RNAi agent and, optionally, an analgesic agent (e.g., nonsteroidal anti-inflammatory drug (NSAID)) and / or an anesthetic agent and / or an anti-inflammatory agent (e.g., glucorticoid).Pharmaceutically Acceptable Excipients

[0137] In some examples, the composition of any one of the examples disclosed herein includes one or more pharmaceutically acceptable carriers or excipients. Non-limiting examples of pharmaceutically-acceptable excipients include: sugars such as lactose, glucose, and sucrose; starches such as com starch and potato starch; cellulose including sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil, and soybean oil; glycols such as polypropylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. In some examples, the composition of any one of the examples disclosed herein includes minor amounts of wetting or emulsifying agents, or pH buffering agents. Additional non-limiting examples of pharmaceutically acceptable carriers can be found in: Remington: The Science and Practice of Pharmacy (2012) 22nd Edition, Philadelphia, PA. Lippincott Williams & WilkinsAdministration and Formulation

[0138] In some examples, the composition of any one of the examples disclosed herein is administered to the subject using any known method and route including, but not limited to, oral, parenteral, intrathecal, subcutaneous, intraperitoneal, intrapulmonary, intranasal, intracranial, topical, or transdermal administration. In some examples, parenteral administration includes, butis not limited to, intramuscular, intravenous, intraarterial, intraperitoneal, and subcutaneous administration. In some examples, the composition is administered to the subject using needless administration. In some examples, RNAi agents are administered directly into the nerve(s). In some examples, the composition is administered during a surgical procedure or labor / childbirth.

[0139] Using techniques and carriers known to those of skill in the art (e.g., Remington: The Science and Practice of Pharmacy (2012) 22nd Edition, Philadelphia, PA. Lippincott Williams & Wilkins), the composition of any one of the examples disclosed herein can be formulated as, for example, intramuscular, intravenous, intraarterial, intradermal, intrathecal, subcutaneous, intraperitoneal, intrapulmonary, intranasal and intracranial injections or compositions. They can also be formulated as, for example, oral, buccal, or sublingual compositions, suppositories, topical creams, or transdermal patches.

[0140] Non-limiting examples of compositions include solutions, suspensions, emulsions, solid injectable compositions that are dissolved or suspended in a solvent before use, and the like. The injections may be prepared by dissolving, suspending, or emulsifying one or more of the active ingredients in a diluent. Examples of diluents, include, but are not limited to distilled water for injection, physiological saline, vegetable oil, alcohol, and a combination thereof. Further, the injections may contain stabilizers, solubilizers, suspending agents, emulsifiers, soothing agents, buffers, preservatives, and the like. The injections may be sterilized in the final formulation step or prepared by sterile procedure. The composition of the present disclosure may also be formulated into a sterile solid preparation, for example, by freeze-drying, and can be used after sterilized or dissolved in sterile injectable water or other sterile diluent(s) immediately before use.

[0141] In some examples, the amino acid sequence of any one of the examples disclosed herein is administered to the subject alone, or in combination with an analgesic and / or anesthetic and / or anti-inflammatory agent. Examples of analgesic, anesthetic, and anti-inflammatory agents are known in the art. When administered in combination, the administration may occur simultaneously or sequentially (in any order). Any of the foregoing may be formulated in a combined formulation or in separate formulations.Subject

[0142] In some examples, the subject is a human or a non-human mammal. Non-human mammals may include ungulates such as bovines. Additional non-limiting examples of non-human mammals include pigs, mice, rats, rabbits, cats, dogs, or other agricultural mammals, pet, or service animals, and the like.Kit

[0143] In some examples, the composition of any one of the examples disclosed herein may be provided in a kit. In some examples, the kit includes one or more agents such as an RNAi agent, analgesic agent, anesthetic agent, and / or anti-inflammatory agent. In some examples, the kit comprises a package (e.g., a closed or sealed package) that contains a pharmaceutical composition such as, for example, one or more closed or sealed vials, bottles, blister (bubble) packs, or any other suitable packaging for the sale, distribution, or use of the pharmaceutical composition.

[0144] In some examples, the kit further comprises printed material. In some examples, the printed material includes printed information. In some examples, the printed information is provided on a label, or on a paper insert or printed on the packaging material itself. The printed information may include information that, for example, identifies the composition in the package, the amounts and types of other active and / or inactive ingredients, and instructions for taking the composition, such as, for example, the number of doses to take over a given period of time and / or information directed to a pharmacist and / or a health care provider (such as a physician) or a patient. In an example, the product includes a label describing the contents of the container and providing indications and / or instructions regarding use of the contents of the container.

[0145] The following Statements provide examples of the present disclosure. They are not intended to be limiting in any way.Statement 1. A composition that comprises an amino acid sequence that comprises the sequence NQX1DX2VX3PRRAIERE (SEQ ID NO: 1), wherein Xi is selected from K and R; X2 is selected from T, S, E, and D; and X3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle. In various examples, the amino acid sequence has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with a protein or peptide sequence (e.g., SEQ ID NO: 1) of the present disclosure.Statement 2. A composition of Statement 1, wherein Xi is K.Statement 3. A composition of Statement 1, wherein Xi is R.Statement 4. A composition of any one of Statements 1-3, wherein X2 is selected from T, S and E.Statement 5. A composition of any one of Statements 1-3, wherein X2 is selected from T and S.Statement 6. A composition of any one of Statements 1-3, wherein X2 is T.Statement 7. A composition of any one of Statements 1-3, wherein X2 is S.Statement 8. A composition of any one of Statements 1-3, wherein X2 is E.Statement 9. A composition of any one of Statements 1-3, wherein X2 is D.Statement 10. A composition of any one of Statements 1-9, wherein X3 is L.Statement 11. A composition of any one of Statements 1-9, wherein X3 is P.Statement 12. A composition of any one of Statements 1 and 10-11, wherein Xi is K and X2 is T.Statement 13. A composition of any one of Statements 1 and 10-11, wherein Xi is K and X2 is S.Statement 14. A composition of any one of Statements 1 and 10-11, wherein Xi is K and X2 is E.Statement 15. A composition of any one of Statements 1 and 10-11, wherein Xi is K and X2 isD.Statement 16. A composition of any one of Statements 1 and 10-11, wherein Xi is R and X2 is T.Statement 17. A composition of any one of Statements 1 and 10-11, wherein Xi is R and X2 is S.Statement 18. A composition of any one of Statements 1 and 10-11, wherein Xi is R and X2 is E.Statement 19. A composition of any one of Statements 1 and 10-11, wherein Xi is R and X2 isD.Statement 20. A composition of any one of Statements 1 and 4-9, wherein Xi is K and X3 is L.Statement 21. A composition of any one of Statements 1 and 4-9, wherein Xi is K and X3 is P.Statement 22. A composition of any one of Statements 1 and 4-9, wherein Xi is R and X3 is L.Statement 23. A composition of any one of Statements 1 and 4-9, wherein Xi is R and X3 is P.Statement 24. A composition of any one of Statements 1-3, wherein X2 is T and X3 is L.Statement 25. A composition of any one of Statements 1-3, wherein X2 is T and X3 is P.Statement 26. A composition of any one of Statements 1-3, wherein X2 is S and X3 is L.Statement 27. A composition of any one of Statements 1-3, wherein X2 is S and X3 is P.Statement 28. A composition of any one of Statements 1-3, wherein X2 is E and X3 is L.Statement 29. A composition of any one of Statements 1-3, wherein X2 is E and X3 is P.Statement 30. A composition of any one of Statements 1-3, wherein X2 is D and X3 is L.Statement 31. A composition of any one of Statements 1-3, wherein X2 is D and X3 is P.Statement 32. A composition of Statement 1, wherein Xi is K, X2 is T, and X3 is L.Statement 33. A composition of Statement 1, wherein Xi is K, X2 is T, and X3 is P.Statement 34. A composition of Statement 1, wherein Xi is K, X2 is S, and X3 is L.Statement 35. A composition of Statement 1, wherein Xi is K, X2 is S, and X3 is P.Statement 36. A composition of Statement 1, wherein Xi is K, X2 is E, and X3 is L.Statement 37. A composition of Statement 1, wherein Xi is K, X2is E, and X3 is P.Statement 38. A composition of Statement 1, wherein Xi is K, X2 is D, and X3 is L.Statement 39. A composition of Statement 1, wherein Xi is K, X2 is D, and X3 is P.Statement 40. A composition of Statement 1, wherein Xi is R, X2 is T, and X3 is L.Statement 41. A composition of Statement 1, wherein Xi is R, X2 is T, and X3 is P.Statement 42. A composition of Statement 1, wherein Xi is R, X2 is S, and X3 is L.Statement 43. A composition of Statement 1, wherein Xi is R, X2 is S, and X3 is P.Statement 44. A composition of Statement 1, wherein Xi is R, X2 is E, and X3 is L.Statement 45. A composition of Statement 1, wherein Xi is R, X2 is E, and X3 is P.Statement 46. A composition of Statement 1, wherein Xi is R, X2 is D, and X3 is L.Statement 47. A composition of Statement 1, wherein Xi is R, X2 is D, and X3 is P.Statement 48. A composition of Statement 1, wherein the amino acid sequence comprises a sequence according to any one of SEQ ID NOs: 2-25.Statement 49. A composition of any one of the preceding Statements, wherein the composition is Statement phosphorylated.Statement 50. A composition of any one of the preceding Statements, wherein the amino acid Statement sequence is phosphorylated.Statement 51. A composition of any one of the preceding Statements, wherein position X2 of the amino acid sequence is phosphorylated.Statement 52. A composition of Statement 51, wherein X2 is T, and T is phosphorylated.Statement 53. A composition of Statement 51, wherein X2 is S, and S is phosphorylated.Statement 54. A composition of any one of Statements 1-53, wherein the lipid moiety is conjugated to the N-terminus of the amino acid sequence.Statement 55. A composition of any one of Statements 1-53, wherein the lipid moiety is conjugated to the C-terminus of the amino acid sequence.Statement 56. A composition of any one of Statements 1-55, wherein the lipid moiety is conjugated to the amino acid sequence through a linker.Statement 57. A composition of Statement 56, wherein the linker comprises a Gly / Ser linker.Statement 58 A composition of any one of Statements 1-57, wherein the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (C14) group, a palmitoyl (Cie) group, or a stearoyl (Cis) group.Statement 59. A composition of any one of Statements 1-58, wherein the lipid moiety comprises an octanoyl (Cs) group.Statement 60. A composition of any one of Statements 1-58, wherein the lipid moiety comprises a lauroyl (C12) group.Statement 61. A composition of any one of Statements 1-58, wherein the lipid moiety comprises a myristoyl (C14) group.Statement 62. A composition of any one of Statements 1-58, wherein the lipid moiety comprises a palmitoyl (Cie) group.Statement 63. A composition of any one of Statements 1-58, wherein the lipid moiety comprises a stearoyl (Cis) group.Statement 64. A composition of any one of the preceding Statements, wherein the amino acid sequence is no more than 30 amino acid residues in length.Statement 65. A composition of any one of the preceding Statements, wherein the amino acid sequence is no more than 25 amino acid residues in length.Statement 66. A composition of any one of the preceding Statements, wherein the amino acid sequence is no more than 20 amino acid residues in length.Statement 67. A composition of any one of the preceding Statements, wherein the amino acid sequence is no more than 15 amino acid residues in length.Statement 68. A composition of any one of the preceding Statements, wherein the composition is a pharmaceutical composition and the composition further comprises a pharmaceutically acceptable excipient.Statement 69. A composition of any one of the preceding Statements, wherein the amino acid sequence is a synthetic amino acid sequence.Statement 70. A composition of any one of the preceding Statements, wherein the amino acid sequence comprises an unnatural amino acid residue.Statement 71. A composition of Statement 70, wherein the unnatural amino acid residue comprises a D-amino acid residue.Statement 72. A method for treating pain in a subject in need thereof comprising administering to the subject the composition according to any one of Statement 1-71.Statement 73. A method of Statement 72, wherein the subject does not take opioids, does not tolerate opioids well, suffers from opioid addiction, or is at risk of relapse for opioid addiction.Statement 74. A method of Statement 73, wherein the risk of relapse for opioid addiction is determined subjectively or objectively by the subject or a medical professional.Statement 75. A method of Statement 72, wherein the pain comprises nociceptive pain.Statement 76. A method of Statement 72, wherein the pain comprises neuropathic pain.Statement 77. A method of Statement 72, wherein the pain is a symptom of a disease, condition, or an injury.Statement 78. A method of Statement 77, wherein the injury comprises a spinal cord injury, a nerve injury, a somatic injury, or a bum.Statement 79. A method of Statement 77, wherein the disease comprises a chronic disease.Statement 80. A method of Statement 79, wherein the chronic disease comprises complex regional pain syndrome, diabetes, Herpes zoster, major depressive disorder, fibromyalgia, migraine, arthritis, cancer, multiple sclerosis, inflammatory bowel disease, or HIV / AIDS.Statement 81. A method of Statement 77, wherein the disease comprises chronic inflammation.Statement 82. A method of Statement 81, wherein the disease that comprises chronic inflammation comprises carpal tunnel syndrome.Statement 83. A method of Statement 72, wherein the pain is associated with chemotherapy, radiation, Morton’s neuroma, mechanical stress, thermal stress, allodynia, hyperalgesia, complex regional pain syndrome (CRPS), post-herpetic neuralgia, trigeminal neuralgia, HIV-associated neuropathy, phantom limb pain, vasculitis-associated pain, or brachial / lumbosacral plexopathy.Statement 84. A method of Statement 83, wherein the allodynia or hyperalgesia is mechanical, thermal, or associated with movement.Statement 85. A method of Statement 83, wherein the hyperalgesia is opioid-induced hyperalgesia.Statement 86. A method of Statement 72, wherein the pain comprises post-surgical pain.Statement 87. A method of any one of Statements 72-86, wherein the composition is administered to the subject prophylactically.Statement 88. A method of any one of Statements 72-86, wherein the composition is administered to the subject prophylactically prior to surgery, laparoscopy, chemotherapy, dental work, radiation, or childbirth.Statement 89. A method of Statement 72, wherein the pain is chronic pain or acute pain.Statement 90. A method of Statement 89, wherein the chronic pain comprises pain that lasts at least 12 weeks.Statement 91. A method of Statement 89, wherein the chronic pain comprises pain that extends beyond an expected period of healing.Statement 92. A method of Statement 89, wherein the acute pain comprises sharp pain.Statement 93. A method of Statement 89, wherein the acute pain comprises pain associated with surgery, laparoscopy, broken bones, dental work, burns, cuts, childbirth labor, or childbirth.Statement 94. A composition that comprises an amino acid sequence that comprises the sequence according to NQU1DU2VU3PRRAIERE (SEQ ID NO: 26), wherein Ui is selected from K and R; U2 is selected from A, V, G, and L; and U3 is selected from L and P; and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle. In various examples, the amino acid sequence has at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with a protein or peptide sequence (e.g., SEQ ID NO:26) of the present disclosure.Statement 95. A composition of Statement 94, wherein Ui is K.Statement 96. A composition of Statement 94, wherein Ui is R.Statement 97. A composition of any one of Statements 94-96, wherein U2 is selected from A, V, and G.Statement 98. A composition of any one of Statements 94-96, wherein U2 is selected from A andV.Statement 99. A composition of any one of Statements 94-96, wherein U2 is A.Statement 100. A composition of any one of Statements 94-96, wherein U2 is V.Statement 101. A composition of any one of Statements 94-96, wherein U2 is G.Statement 102. A composition of any one of Statements 94-96, wherein U2 is L.Statement 103. A composition of any one of Statements 94-102, wherein U3 is L.Statement 104. A composition of any one of Statements 94-102, wherein U3 is P.Statement 105. A composition of any one of Statements 94 and 103-104, wherein Ui is K andU2is A.Statement 106. A composition of any one of Statements 94 and 103-104, wherein Ui is K andU2is V.Statement 107. A composition of any one of Statements 94 and 103-104, wherein Ui is K andU2is G.Statement 108. A composition of any one of Statements 94 and 103-104, wherein Ui is K andU2is L.Statement 109. A composition of any one of Statements 94 and 103-104, wherein Ui is R and U2is A.Statement 110. A composition of any one of Statements 94 and 103-104, wherein Ui is R and U2is V.Statement 111. A composition of any one of Statements 94 and 103-104, wherein Ui is R and U2is G.Statement 112. A composition of any one of Statements 94 and 103-104, wherein Ui is R and U2is L.Statement 113. A composition of any one of Statements 94 and 97-102, wherein Ui is K and U3 is L.Statement 114. A composition of any one of Statements 94 and 97-102, wherein Ui is K and U3 is P.Statement 115. A composition of any one of Statements 94 and 97-102, wherein Ui is R and U3 is L.Statement 116. A composition of any one of Statements 94 and 97-102, wherein Ui is R and U3 is P.Statement 117. A composition of any one of Statements 94-96, wherein U2is A and U3 is L.Statement 118. A composition of any one of Statements 94-96, wherein U2is A and U3 is P.Statement 119. A composition of any one of Statements 94-96, wherein U2 is V and U3 is L.Statement 120. A composition of any one of Statements 94-96, wherein U2 is V and U3 is P.Statement 121. A composition of any one of Statements 94-96, wherein U2 is G and U3 is L.Statement 122. A composition of any one of Statements 94-96, wherein U2 is G and U3 is P.Statement 123. A composition of any one of Statements 94-96, wherein U2 is L and U3 is L.Statement 124. A composition of any one of Statements 94-96, wherein U2 is L and U3 is P.Statement 125. A composition of Statement 94, wherein Ui is K, U2 is A, and U3 is L.Statement 126. A composition of Statement 94, wherein Ui is K, U2 is A, and U3 is P.Statement 127. A composition of Statement 94, wherein Ui is K, U2 is V, and U3 is L.Statement 128. A composition of Statement 94, wherein Ui is K, U2 is V, and U3 is P.Statement 129. A composition of Statement 94, wherein Ui is K, U2 is G, and U3 is L.Statement 130. A composition of Statement 94, wherein Ui is K, U2 is G, and U3 is P.Statement 131. A composition of Statement 94, wherein Ui is K, U2 is L, and U3 is L.Statement 132. A composition of Statement 94, wherein Ui is K, U2 is L, and U3 is P.Statement 133. A composition of Statement 94, wherein Ui is R, U2 is A, and U3 is L.Statement 134. A composition of Statement 94, wherein Ui is R, U2 is A, and U3 is P.Statement 135. A composition of Statement 94, wherein Ui is R, U2 is V, and U3 is L.Statement 136. A composition of Statement 94, wherein Ui is R, U2 is V, and U3 is P.Statement 137. A composition of Statement 94, wherein Ui is R, U2 is G, and U3 is L.Statement 138. A composition of Statement 94, wherein Ui is R, U2 is G, and U3 is P.Statement 139. A composition of Statement 94, wherein Ui is R, U2 is L, and U3 is L.Statement 140. A composition of Statement 94, wherein Ui is R, U2 is L, and U3 is P.Statement 141. A composition of Statement 94, wherein the composition comprises an amino acid sequence according to any one of SEQ ID NOs: 27-42.Statement 142. A composition of any one of Statements 94-141, wherein the composition is phosphorylated.Statement 143. A composition of any one of Statements 94-142, wherein the lipid moiety is conjugated to the N-terminus of the amino acid sequence.Statement 144. A composition of any one of Statements 94-142, wherein the lipid moiety is conjugated to the C-terminus of the amino acid sequence.Statement 145. A composition of any one of Statements 94-144, wherein the lipid moiety is conjugated to the amino acid sequence through a linker.Statement 146. A composition of Statement 145, wherein the linker comprises a Gly / Ser linker.Statement 147. A composition of any one of Statements 94-146, wherein the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (C14) group, a palmitoyl (Cie) group, or a stearoyl (Cis) group.Statement 148. A composition of any one of Statements 94-147, wherein the lipid moiety comprises an octanoyl (Cs) group.Statement 149. A composition of any one of Statements 94-147, wherein the lipid moiety comprises a lauroyl (C12) group.Statement 150. A composition of any one of Statements 94-147, wherein the lipid moiety comprises a myristoyl (C14) group.Statement 151. A composition of any one of Statements 94-147, wherein the lipid moiety comprises a palmitoyl (Cie) group.Statement 152. A composition of any one of Statements 94-147, wherein the lipid moiety comprises a stearoyl (Cis) group.Statement 153. A composition of any one of Statements 94-152, wherein the amino acid sequence is no more than 30 amino acid residues in length.Statement 154. A composition of any one of Statements 94-153, wherein the amino acid sequence is no more than 25 amino acid residues in length.Statement 155. A composition of any one of Statements 94-154, wherein the amino acid sequence is no more than 20 amino acid residues in length.Statement 156. A composition of any one of Statements 94-155, wherein the amino acid sequence is no more than 15 amino acid residues in length.Statement 157. A composition of any one of Statements 94-156, wherein the composition is a pharmaceutical composition and the composition further comprises a pharmaceutically acceptable excipient.Statement 158. A composition of any one of Statements 94-157, wherein the amino acid sequence is a synthetic amino acid sequence.Statement 159. A composition of any one of Statements 94-158, wherein the amino acid sequence comprises an unnatural amino acid residue.Statement 160. A composition of Statement 159, wherein the unnatural amino acid residue comprises a D-amino acid residue.Statement 161. A method for treating a condition associated with pain loss in a subject in need thereof comprising administering to the subject the composition according to any one of Statements 94-160.Statement 162. A method of Statement 161, wherein the condition associated with pain loss comprises congenital insensitivity to pain (CIP), a hereditary sensory neuropathy, or a hereditary sensory autonomic neuropathy (HSAN).Statement 163. A method of Statement 161, wherein the administering to the subject increases the subject’s sensitivity to pain.Statement 164. A method for treating a condition associated with NMDA NR1C2in a subject in need thereof comprising administering to the subject the composition according to any one of Statements 94-160.Statement 165. A method of Statement 164, wherein the condition associated with NMDA NR1C2comprises stroke, Alzheimer's Disease, attention-deficit hyperactivity disorder (ADHD), schizophrenia, bipolar disorder, epilepsy, Huntington's disease, Parkinson's disease,Amyotrophic lateral sclerosis, chronic fatigue syndrome, anxiety, depression, post-traumatic stress disorder, obsessive compulsive disorder, or a phobia.Statement 166. A method for treating pain in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a composition comprising administering an RNAi agent that reduces expression of Magi2 and / or NR1C2. In various examples, the RNAi agent acts on Magi-2 and / or NR1C2.Statement 167. A method according to Statement 166, wherein the RNAi agent is shRNA.Statement 168. A method according to Statement 167, wherein the shRNA has the following sequence: GTACAGAACCTGAGCCATA7 / G4 4GNG.4TATGGCTCAGGTTCTGTAC (SEQ ID NO:51) or a sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.Statement 169. A method according to any one of Statements 166-168, wherein the pain comprises nociceptive pain.Statement 170. A method according to any one of Statements 166-168, wherein the pain comprises neuropathic pain.Statement 171. A method according to any one of Statements 166-170, wherein the pain is a symptom of a disease, condition, or an injury.Statement 172. A method according to Statement 171, wherein the injury comprises a spinal cord injury, a nerve injury, a somatic injury, or a bum.Statement 173. A method according to Statement 171, wherein the disease comprises a chronic disease and / or chronic inflammation.Statement 174. A method according to Statement 173, wherein the chronic disease comprises complex regional pain syndrome, diabetes, Herpes zoster, major depressive disorder, fibromyalgia, migraine, arthritis, cancer, multiple sclerosis, inflammatory bowel disease or HIV / AIDS.Statement 172. A method according to Statement 173, wherein the disease that comprises chronic inflammation comprises carpal tunnel syndrome.Statement 173. A method according to any one of Statements 166-172, wherein the pain is associated with chemotherapy, radiation, Morton’s neuroma, mechanical stress, thermal stress, allodynia, hyperalgesia, complex regional pain syndrome (CRPS), post-herpetic neuralgia, trigeminal neuralgia, HIV-associated neuropathy, phantom limb pain, vasculitis-associated pain, or brachial / lumbosacral plexopathy.Statement 174. A method according to any one of Statements 166-173, wherein the composition is administered to the subject prophylactically.Statement 174. A method according to any one of Statements 166-174, wherein the composition is administered to the subject prophylactically prior to surgery, laparoscopy, chemotherapy, dental work, radiation, or childbirth.

[0146] The following Statements provide various examples of the present disclosure. They are not intended to be limiting in any way.Statement A. A protein or peptide of the present disclosure, wherein the protein or peptide comprises the following sequence: NQKDX1VX3PRRX2IERE (SEQ ID NO: 43), wherein Xi is T, E, S, Y, D, G, or V, or a phosphorylated variant of T, E, S, Y, or D, X2 is a hydrophobic residue, X3 is L or P, and the N-terminus or C-terminus of the peptide is conjugated with to a lipid group, or a protein or peptide having at least 75% identity (e.g., at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, or at least 99% identity, thereto.Statement B. A protein or peptide according to Statement 1, wherein the hydrophobic residue is G, A, S, V, L, or I.Statement C. A protein or peptide according to Statement 1 or Statement 2, wherein the C- terminus is an amide.Statement D. A protein or peptide according to Statement 1 or Statement 2, wherein the C- terminus is a carboxylic acid or carboxylate.Statement E. A protein or peptide according to any one of the preceding Statements, wherein the protein or peptide is phosphorylated at Xi.Statement F. A protein or peptide according to any one of the preceding Statements, wherein the lipid group is a CR to Ci6 lipid group.Statement G. A protein or peptide according to any one of the preceding Statements, wherein the lipid group is a C14 lipid group (a myristoyl group).Statement H. A protein or peptide according to any one of the preceding Statements, wherein the protein or peptide is conjugated to a nanoparticle.Statement I. A protein or peptide according to any one of the preceding Statements, wherein the protein or peptide has the following sequence: NQKDTVLPRRAIERE (SEQ ID NO: 2), wherein the T is phosphorylated.Statement J. A protein or peptide according to Statement 9, wherein the lipid group conjugated to the N-terminus is a myristoyl group.Statement K. A composition comprising a protein or peptide according to any one of the preceding Statements and a pharmaceutically acceptable carrier.Statement L. A composition according to Statement 11, further comprising one or more analgesic agent and / or one or more anesthetic agent.Statement M. A method for decreasing or increasing the perception of pain in a subject comprising administering a therapeutically effective amount of a protein or peptide according to any one of Statements 1 to 10 or a composition according to Statement 11 or Statement 12.Statement N. A method for treating a disease or indication associated with NMDA NR1C2comprising administering a therapeutically effective amount of a protein or peptide according to any one of Statements 1 to 10 or a composition according to Statement 11 or Statement 12.Statement 0. A method according to Statement 14, wherein the disease or indication is a stroke, Alzheimer’s Disease, ADHD, schizophrenia, bipolar disorder, pain, fibromyalgia, epilepsy, Huntington’s disease, Parkinson’s disease, Amyotrophic lateral sclerosis, chronic fatigue syndrome, migraine, anxiety, depression, post-traumatic stress disorder, obsessive compulsive disorder, phobias, or any combination thereof.Statement P. A method of increasing cognition comprising administering to a subject a therapeutically effective amount of NQKDAVX3PRRAIERE (SEQ ID NO: 44), wherein the N- terminus or C-terminus is conjugated to a lipid group, wherein X3 is L or P.Statement Q. A method according to Statement 16, wherein the lipid group is a C12 to Ci6 lipid group.Statement R. A method according to Statement 16 or Statement 17, wherein the lipid group is a C14 lipid group (a myristoyl group). Statement S. A method according to any one of Statements 16 to 18, wherein the N-terminus is conjugated to a lipid group.Statement T. A method according to any one of Statements 16 to 19, wherein X3 is L.

[0147] The following Sequences are used throughout the present disclosure.

[0148] The following example is presented to illustrate the present disclosure. It is not intended to be limiting in any way.EXAMPLE

[0149] This example provides a description of proteins and peptides of the present disclosure and uses for same.

[0150] Much is understood about the structure and gating properties of NMDA receptors (NMD AR), but the function of the carboxy -terminal splice variant of the NR1 subunit, NR1C2 has never been identified. By studying the scaffolding protein Magi-2 in animal models of inflammatory pain, it was discovered how NR1C2 protein is specifically regulated by the ubiquitin ligase, Nedd4-1 and the synaptic scaffolding protein, Magi-2. It was found that Magi-2 deficiency resulted in decreased pain behavior and a concomitant reduction in NR1C2 protein. Magi-2 contains WW domains markedly similar to those utilized by ubiquitin ligases for substrate recognition. An atypical WW-binding motif was identified within NR1C2 which conferred susceptibility to Nedd4-1 ubiquitin-ligase dependent degradation. Finally, lipidated peptidomimetics derived from the NR1C2 sequence was used to pharmacologically disrupt inflammatory pain in mice. NR1C2is uniquely sensitive to Nedd4-1 -dependent degradation and NMDA receptors containing this subunit can be pharmacologically targeted by lipidated peptidomimetics.

[0151] NMDA receptors (NMD AR) contribute to pain transmission. A better understanding of NMD AR activity, and importantly a more specific NMD AR antagonism approach may improve clinical success in pain relief treatment.

[0152] A functional NMD AR is a heterotetramer composed of two obligate NR1 subunits and two NR2 (and in some cases NR3 subunits). There are 8 splice isoforms of NR1, each of which are expressed in the spinal cord. The last stretch of the NR1 C-terminal domain consists of the C2 cassette. Alternative splicing of the C2 cassette produces two distinct C- termini called C2 and C2’. The C2’ isoform contains a PDZ binding motif shown to bind to PSD-95 and associated postsynaptic density proteins. The C2 isoform does not contain a PDZ binding motif, and the function has yet to be resolved. Functional NMDA receptors containing only the NR1C2subunit will have a total of 4 PDZ binding motifs, as each of the two NR2 subunits also possess a PDZ binding motif. By extension, NMD AR containing only the NR1C2subunit will have 2 PDZ binding motifs, half the number found in NMD AR with NR1C2, presumably reducing their affinity for the postsynaptic density. Magi-2 is a scaffold protein which was first discovered by its ability to bind to NMD AR. Like PSD-95, Magi-2 contains multiple PDZ binding domains and a catalytically inactive guanylate kinase-like (GUK) domain. Unlike PSD-95, Magi proteins additionally contain two WW domains. WW domains are typically found in ubiquitin ligases and are used to recognize substrates for ubiquitination andsubsequent degradation. The sequence of the first WW domain of Magi-2 is like the WW domains of the ubiquitin ligase Nedd4-1. By competing with ubiquitin ligases for substrate recognition, Magi protein-WW domains confer substrate protection from ubiquitin ligasedependent degradation.

[0153] Protein ubiquitination acts as a signal for the sorting, trafficking, and endocytosis of membrane proteins. Multiple ubiquitin ligases are known to specifically regulate the functions of ion channels, transporters, and signaling receptors. The Nedd4 E3 ubiquitin ligases specifically translocate to the membrane in response to calcium. Furthermore, dendritic proteasomal function is essential for synaptic homeostasis and plasticity. Here a Group III WW- binding motif comprising a proline-arginine (-L / PPR-) was identified in NR1C2. It was shown how this site is important for Nedd4-1 -dependent degradation of NR1C2. It was demonstrated that Magi-2 deficiency results in reduced NR1C2levels which attenuates inflammatory pain behaviors. Using lipidated peptidomimetics derived from the NR1C2sequence, it was demonstrated that NMD AR trafficking can be pharmacologically modulated.

[0154] Magi-2 deficiency is associated with NMDAR hypofunctioning. The study relates to the putative role of Magi-2 in inflammatory pain signaling (Fig. 1 A). The spinal cord dorsal horn (SCDH) is canonically subdivided into anatomically defined laminae, delineated by the class of sensory neurons that terminate within them. Magi-2 immunohistochemistry was performed using a monoclonal antibody recognizing Magi-2 comparing the expression pattern to the molecular marker PKCy, which is found exclusively at the border of lamina 2i and 3o (Fig. IB). This antibody was validated by immunocytochemistry during heterologous expression of Magi-2 (Fig. 7). Magi-2 expression was observed superficial to the band formed by PKCy immunoreactivity (Fig. IB) suggesting Magi-2 is present in second order neurons receiving input from high threshold nociceptors including C-fibers. This finding was recapitulated using a previously validated polyclonal antibody against Magi-2, where both immunohistochemistry and Western analysis confirmed Magi-2 expression within the SCDH (Figs 6 & 8).

[0155] A Magi-2 floxed mouse line was used in this study (Figs. 9A, 9B) which had previously been used to study Magi-2 in kidney podocyte formation. Magi-2 protein analysis however, revealed that the homozygous floxed mice (hereafter referred to as AMagi-2) had endogenously reduced levels of Magi-2 alpha and beta isoforms when compared to wildtype (WT) and heterozygotic littermates, and were devoid of the gamma isoform (Figs. 1C & D, Figs.9C, 9D). This endogenous global Magi-2 deficiency was used to test for potential pain behavior phenotypes. Baseline evoked thermal (Hargreaves) and light touch (von Frey) responses were normal across genotypes (Figs. 9E, 9F) however, AMagi2 mice lacked formalin-induced nocifensive behaviors (licks and lifts directed at the injected paw) associated with the second, inflammatory phase of this assay (Figs. IE & F).

[0156] Multiple studies have shown the involvement of SCDH NMD AR as necessary for formalin-induced inflammatory pain behaviors. Consequently, study was carried to probe for any alterations in NMD AR levels in the crude synaptosomal fraction of SCDH lysates collected from WT, heterozygous, and AMagi-2 mice (Figs. 2A, B). GluN2A has been shown to be the dominant isoform in the adult central nervous system and GluN2B is the isoform primarily responsible for synaptic transmission in lamina 1. However, no changes were found in either NR2A or NR2B when comparing lysates from WT, heterozygous or AMagi-2 mice (Figs. 2A & B). Conditional deletion of the NR1 subunit in the SCDH, while not altering basal pain behavior, reduced formalin-induced pain. Other studies have also shown a reduction in nocifensive behaviors in the second phase of the formalin assay during targeted deletion of NR1 in the dorsal horn. In WT mice, NR1 was co-immunoprecipitated with Magi-2 from dorsal horn lysates (Fig. 2C). In AMagi-2 mice, a gene-copy number-dependent reduction in NR1 protein levels (Fig. 2B) was also found. With this approach, the study was unable to distinguish between NMD AR located postsynaptically in dorsal horn neurons from those located on the presynaptic terminals of primary afferents. Whole-cell voltage-clamp recordings was therefore performed on second order neurons in lamina 1 of the SCDH to determine whether the reduction in NR1 protein levels affected postsynaptic NMDA-evoked current densities. A recent study showed that the synaptic pool of NMD AR was unaffected by a genetic loss of NR1 due to a compensatory shift in NMD AR from extrasynaptic to synaptic sites. Consequently, N-Methyl-D-Aspartate (NMD A) was applied followed by washout and found an overall reduction in NMDA-induced currents in dorsal horn neurons (Figs. 2D-G). In contrast, no differences was observed in spontaneous excitatory postsynaptic current amplitude, frequency, nor Tau of decay of averaged events and saw no protein level changes in either of the AMP A receptor (AMP AR) subunits GluAl or GluA2 (Fig. 10). Results from the AMagi-2 mouse strain suggested that Magi-2 deficiency affected inflammatory pain through its regulation of NR1 subunit protein levels.

[0157] Magi-2 knockdown in wildtype mice regulates NR1C2protein expression and decreases pain behavior. To avoid any confounding developmental effects present in the AMagi-2 mouse line, a viral Magi-2-shRNA knockdown approach was used in wildtype mice. AAV2 / 9-GFP-U6-m-Magi-2-shRNA was administered intrathecally into the lumbar dorsal horn of male and female WT C57B1 / 6 mice (Fig. 3A) to assess the effect of Magi-2 knockdown in the Complete Freunds’ Adjuvant (CFA) model of chronic inflammatory pain. The Magi-2 shRNA sequence was previously validated. It was first confirmed of viral transduction of the dorsal horn via immunohistochemical staining for GFP (Fig. 11). Intrathecal injection of Magi-2-shRNA led to a reduction in all three isoforms of Magi-2 as measured by Western analysis from lumbar SCDH lysates collected 2 weeks following injection (Figs. 3B&C; Fig. 11). In the CFA inflammatory pain assay, Magi-2 knockdown mice exhibited increased thermal paw withdrawal latencies (PWL) compared to scrambled control (AAV2 / 9-GFP-U6-m-scram) treated mice (Fig. 3D). Baseline PWL prior to CFA injection was unaffected by Magi-2 knockdown (Fig. 12). Both male and female mice were tested in this experiment and while slight differences in the dynamics of CFA-induced thermal hyperalgesia were observed, there were no direct sex-dependent differences in PWL (Fig. 12). Using the Dynamic Weight Bearing assessment, it was observed that mice injected with the scrambled shRNA exhibited a significant reduction in the percentage of time spent placing weight on the CFA-injected hindpaw, but this decrease was absent in Magi- 2 knockdown mice (Figs. 3E & F).

[0158] Dorsal horn lysates was then collected 48 hours after unilateral intraplantar CFA injection from mice receiving either scrambled control or Magi-2-shRNA intrathecally two weeks prior. Control mice showed an increase in NR1 levels in the dorsal horn ipsilateral to the injected paw, as in prior studies. In contrast, mice that had received Magi-2 shRNA showed no difference in dorsal horn NR1 levels when comparing ipsilateral and contralateral sides. (Figs 3G & J). The study next sought to determine if this increase in NR1 was specific to either of the C- terminal splice isoforms of NR1. Using the same lysates, NR1C2and NR1C2levels were probed using isoform specific antibodies. NR1C2levels were unchanged in either the scrambled shRNA condition or the Magi-2 shRNA condition. On the other hand, NR1C2was specifically increased in the ipsilateral dorsal hom of mice that received scrambled shRNA and there was a significant decrease in the mice that had received Magi-2 shRNA (Figs. 3H, 3K, 31, 3L). These results suggest that the increase in NR1 seen in CFA is specific to the NR1C2splice isoform and thisincrease is dependent on the presence of Magi-2. To further address the specific effect of Magi-2 on NR1C2levels, we re-examined the lysates from the AMagi-2 SCDH lysates and found that the loss of NRI was specific to the NR1C2isoform, with no differences in NR1C2(Fig. 13) further supporting a role for Magi-2 in specifically regulating NR1C2protein levels.

[0159] A WW binding motif within NR1C2confers sensitivity to Nedd4-l-dependent degradation. The results showed that overall NR1C2abundance is dependent upon Magi-2 expression. It was therefore hypothesized that NR1C2is likely regulated by ubiquitin ligase activity. The WW domain-containing E3 ubiquitin ligase Nedd4-1 canonically recognizes substrates containing Group I, (-L / PPXY-) WW binding motifs, with X referring to any amino acid. Group III WW binding motifs containing a proline-arginine (-L / PPR-) have also been characterized. Indeed, Nedd4-1 has been shown to interact with non-PY ( i.e. Group III) - containing WW-binding motifs. Within the C-terminal sequence of the NR1C2variant, we identified an -LPR- motif (Fig. 4A). Interestingly, NR1C2is only found in mammals, and the - LPR- motif is highly conserved within mammalian species (Fig. 14). It was hypothesized that the -LPR- motif allows regulation by Nedd4-1. To test this, Chinese Hamster Ovary (CHO) cells were co-transfected with NR1C2and Nedd4-1 and observed a significant reduction in NR1C2protein levels (Figs. 4B, 4C). The effect of Nedd4-1 on NR1C2was reversed by treatment of transfected cells with the proteasome inhibitor MG- 132 as well as the lysosome inhibitor Bafilomycin Al (Fig. 15), suggesting that ubiquitin-dependent degradation was partly responsible for the loss of NR1C2protein in this assay. Additionally, NR1C2were coimmunoprecipitated with Nedd4-1 indicating the two proteins interact with each other (Fig. 15F). To demonstrate that this specific sequence motif bestows susceptibility to ubiquitin-dependent degradation, we mutated the proline within this motif to an alanine (Fig. 4A). The NR1C2- P918A mutation prevented Nedd4-1 dependent degradation of NR1C2(Fig. 4B, 4D). Moreover, degradation was specific to the C2 variant as Nedd4-1 was unable to degrade NR1C2protein (Fig 4B, 4E). Furthermore, Nedd4-1 -dependent ubiquitination of wildtype NR1C2but not the NR1C2WW-binding motif mutant was discovered, when both proteins were immunoprecipitated and blotted for ubiquitin (Fig. 4G).

[0160] It was further examined if Nedd4-1 acts on the NR2 subunits, NR2A and NR2B. Neither NR2A nor NR2B protein levels were reduced when co-expressed in CHO cells with Nedd4-1. NR2B, however, was reduced in the presence of Nedd4-2, an E3-ubiquitin ligase of thesame family (Fig. 16). Interestingly, in fully formed NMD AR, when NR1C2and NR2B are coexpressed, both NR1C2and NR2B displayed sensitivity to Nedd4-1. Yet, in the presence of Nedd4-2, NR2B was still degraded but NR1C2remained insensitive to Nedd4-2. These results suggest thatNRlC2specifically confers Nedd4-1 susceptibility on fully formed NMD AR in vitro (Figs. 4H-L).

[0161] Given the presence of WW-domains in Magi -2, it was reasoned that the WW- binding motif of NR1C2may be the site of interaction for Magi-2. To test this, coimmunoprecipitation with two myc-tagged constructs was performed, one containing full-length Magi-2 and the other comprising just the two WW-domains of Magi-2 (Fig. 17). NR1C2could be co-immunoprecipitated with full-length Magi-2 as well as the WW-domain construct (Fig. 17). Furthermore, the experiments were unable to detect the WW-motif mutant NR1C2-P918A during co-immunoprecipitation with either of these myc-tagged Magi-2 constructs (Fig. 17).

[0162] NRlC2-based peptidomimetics bidirectionally regulate pain behavior. The results suggest that a competition for the NR1C2WW-binding motif between the WW domains of Nedd4-1 and Magi-2 exists to regulate NR1C2levels and membrane expression. Consequently, several peptides were developed based on the C-terminal amino acid sequence of NR1C2, derived specifically from the region immediately surrounding, and including the WW-binding motif (Fig. 4F). Peptides were myristoylated at the N-termini to make them cell-penetrable and membrane delimited. It has shown that the phosphorylation state of mimetic peptides targeting the ubiquitination of membrane proteins can have opposing effects on protein levels. Threonine 915 is the only phosphorylatable residue within the C2 sequence near the WW binding motif (Fig. 4F). It was reasoned that the threonine at position 915 in the NR1C2carboxy terminal could be phosphorylated to either promote or prevent ubiquitin ligase interaction. Two other mimetic peptides were therefore used: one with the threonine phosphorylated and the other with threonine substituted with alanine to prevent potential endogenous phosphorylation of the peptide and explored the potential of these peptides to produce analgesia during inflammatory pain (Fig. 5).

[0163] NR1C2WW-binding motif mimetic peptides were intrathecally administered after established CFA inflammatory pain in mice (Fig. 5A). Thermal PWL of male and female mice were first measured for two days prior to CFA injection into the right paw. At 24 hours after CFA injection, PWL was measured to validate sensitization. Immediately following PWL assessments, mimetic peptides and the scrambled control peptide were intrathecally injected andPWL was measured at various timepoints after injection. The wildtype NR1C2sequence peptide did not affect pain behavior, however, intrathecal injection of the phosphorylated peptide rapidly reversed CFA-induced inflammatory pain in both males and females (Fig. 5B-C). The phosphorylated peptide reduced hyperalgesia to baseline for the duration of the thermal sensitivity assay and attenuated dynamic weight bearing deficits (Fig. 5G). The alaninesubstituted peptide prolonged thermal hyperalgesia, preventing the natural recovery observed in scrambled controls (Fig. 5B-D). Contralateral measurements revealed no differences amongst the peptides demonstrating that peptides exert their effect are specifically during increased SCDH activity due to pain (Fig. 18). These results suggest that these peptides possess the ability to bidirectionally control pain behavior by targeting the interaction of NR1C2with either Magi -2 or Nedd4-ubiquitin ligases.

[0164] The results with CFA suggested that the phosphorylated peptide has analgesic potential. Subsequently, the phosphorylated peptide or the scrambled control peptide were intrathecally administered 24 hours prior to intraplantar injection of 20 L of 5% formalin (Fig. 19). Mice treated with the phosphorylated peptide exhibited a significant reduction in cumulative inflammatory Phase 2 nocifense scores with no difference in the initial, acute Phase 1 nocifense score (Fig. 19B, 19C). These results resembled the deficiency of nocifensive behavior observed in the Magi-2 deficient mice (Figs. IE, IF).

[0165] By initially studying Magi-2 and using biochemical, electrophysiological, and behavioral approaches, the experiments have identified the function of the NR1C2subunit. It functions to confer susceptibility to ubiquitin ligases, answering a long-held question on the significance of this NR1 isoform.

[0166] It was found that Magi-2 deficiency was associated with a specific reduction in NR1C2protein, whereas the other NMD AR subunits NR1C2’, NR2A, and NR2B were unchanged. It was reasoned that ubiquitin ligase-mediated NR1C2degradation was enhanced during Magi-2 deficiency based on our prior work with Magi-1 and Navi.8 voltage-dependent sodium channels in dorsal root ganglion neurons. It was reported that Magi-1 deficiency resulted in a loss of NavE 8 protein and reduced inflammatory pain behavior as Navl.8 is susceptible to E3 ubiquitin ligase-mediated degradation. Within the C-terminal of the NR1C2subunit there is no Group I WW binding motif, however, a Group III WW binding motif was identified. It was subsequently demonstrated that NRlC2is sensitive to Nedd4-1 -dependent degradation. Therefore, NMD ARthat contain NR1C2are a labile pool of NMD AR with specific sensitivity to the Nedd4-1 UL. Indeed, it has been shown that in the basal state, NR1C2abundance is, depending upon the brain region, anywhere from a fifth to a tenth of that of the alternatively spliced NR1C2. It is likely that the constant ubiquitin pressure maintains this ratio of NR1 C-terminal isoforms. During high activity states, this ratio may be altered affecting NMD AR trafficking and membrane expression. Several studies have shown NRlC2to be dynamic, exhibiting altered levels of abundance following neuronal activity, but this was not shown for NR1C2.

[0167] The study also reinforced the unique function of the Magi scaffold protein family: to protect proteins against UL-dependent degradation. PSD-95 remains the canonical post- synaptic density protein for excitatory synapses, principally involved in synaptic plasticity. For example, during nerve-injury induced-neuropathic pain, it was observed that thermal hyperalgesia, mechanical allodynia, and cold allodynia were all virtually absent in PSD-95 null mice. Although quite surprisingly, inflammatory pain behaviors, such as those produced by the CFA or formalin assay, were unaffected by PSD-95 deficiency. Indeed, in Magi-2 deficient mice we observed no changes in AMP AR subunits or activity (Fig. 10). These results would suggest that inflammatory pain signaling in the SCDH is dependent upon Magi-2 and NMD AR plasticity. Moreover, since Magi-2 is necessary for NR1C2protein expression during UL degradative pressure, the Magi-2-NRlC2interaction represents an attractive target for novel analgesics.

[0168] Studies has previously demonstrated the efficacy of peripherally administered lipidated peptides, designed to disrupt protein-protein interactions, in providing prolonged analgesia. This is consistent with a slow neuronal membrane phospholipid turnover and lipidated peptide metabolism. Here a similar approach was used with lipidated NR1C2derived peptides delivered by intrathecal injection and found that pain behavior can be bidirectionally regulated for many days after a single injection (Fig. 5). The phosphorylation status of the mimetic peptides targeting the WW motif of Navi.8 bidirectionally controlled pain behavior by modulating the degradation of these channels. Similarly, when the NR1C2mimetic peptides were used to regulate pain behavior, the phosphorylation status of the threonine adjacent to the -LPR- motif bidirectionally modified CFA-induced pain behavior. This suggests that the amino acids flanking the WW binding domains are also relevant to a specific WW-domain interaction. The phosphorylated peptide provided robust analgesia with effects that are pain specific (Fig. 5), ascontralateral measurements did not differ from baseline (Fig. 18). It was speculated that this phosphorylated peptide competes with NR1C2containing NMD AR for Magi-2 binding exposing endogenous NRlC2to ubiquitination and subsequent degradation. It remains to be seen whether native NMD AR containing the NR1C2subunit are endogenously phosphorylated at T915. Surprisingly, a T915A mutated peptide was hyperalgesic for the duration of the CFA inflammatory pain assay. It was speculated that the alanine-based peptide increases the stability of NR1C2-containing NMD AR, protecting NR1C2from ubiquitination and / or internalization during elevated neuronal activity. It has been shown that Nedd4-1 activity is regulated by phosphorylation. It should be emphasized; the alanine peptide CFA pain behavioral data seems mainly driven by the effects in females. CFA inflammatory pain in males and females differed in response to afferent activity manipulation; female inflammatory pain appears to have more of a central component. This data corroborates those findings and is consistent with the sex differences in pain observed in humans.

[0169] AMP AR lability in the context of synaptic plasticity is a well-documented phenomenon. The movement and turnover of AMP AR are orchestrated by NMD AR which are often thought of as being static during synaptic plasticity. In studies done in retinal ganglion cells, NMD AR, unlike AMP AR, were shown to reside outside the postsynaptic density. An antibody that recognizes only the NR1C2isoform was used in this study. Prior work on NMD AR surface dynamics at the neuronal plasma membrane have shown that NMD AR at the postsynaptic density exhibit confined diffusion with anchoring of receptors but high diffusion with low confinement in the extrasynaptic membrane. These differing NMD AR pools, synaptic vs extrasynaptic, mobile vs immobile, might depend on whether NMD AR contain the NR1C2or NR1C2subunit. As the data suggests, the C2 cassette appears to confer the ability of a subset of NMD AR to traffic in and out of the plasma membrane via Nedd4-1 -dependent regulation. This NMD AR trafficking is highly relevant, because extrasynaptic NMD AR control synaptic currents and the intrinsic excitability of neurons. The study showed that this NMD AR trafficking can also be pharmacologically targeted opening novel therapeutic strategies to treat neurological disorders beyond pain, including neurogenerative diseases such as Alzheimer’s disease and psychiatric disorders such as schizophrenia.

[0170] Animals. All animal care, experiments, and procedures were conducted with approval from the University at Buffalo Institutional Animal Care and Use Committee (IACUC)in accordance with the guidelines set forth by the National Institutes of Health. Wild type C57B1 / 6 mice were purchased from Envigo (Indianapolis, IN) and were used in Magi-2 viral knockdown and peptide experiments. Sperm from Magi-2 deficient mice were a kind gift from Dr. Katsuhiko Nishimori (Fukushima Medical University) and was sent to the Roswell Park Comprehensive Cancer Center Gene Targeting and Transgenic Shared Resource (Buffalo, NY) for in vitro fertilization of female WT C57B1 / 6 mice. After breeding to obtain homozygous floxed mice, they were then backcrossed for several generations to obtain male and female mice heterozygotic for the floxed allele which were used for breeding in this study.

[0171] Genotyping of Magi-2 fl / fl mice. A small segment of the tail was taken from pups at postnatal day 21 and stored at -20° C. Tails were then placed in a solution of 25mM Sodium Hydroxide / 0.2mM EDTA ‘DNA extraction buffer’ and incubated at 98° C for Ihr. Following this, an equal volume of 40mM Tris-HCl (pH 5.5) was added to precipitate the gDNA, and the sample was placed on ice. Genomic DNA was PCR amplified using the following primers: forward 5’-AATAAAAATAGCTGTTTGAGGACAGGGAG-3’ (SEQ ID NO: 45), reverse 1 : 5’-GTCAAATAGAACCCACAGGGATGACAAAGA-3’ (SEQ ID NO:46), reverse 2: 5’- CATCGATTTTTTCCCAGCCATATGGAAGCT-3’ (SEQ ID NO: 47) and resulting amplified DNA was visualized via gel electrophoresis (Fig. 9B).

[0172] Immunofluorescence. Wildtype C57B1 / 6 mice were deeply anesthetized via intraperitoneal injection of Img / kg pentobarbital and then transcardially perfused with ice cold, filter-sterilized Phosphate Buffered Saline (PBS) followed by 4% Paraformaldehyde (PF A). Following fixation, lumbar spinal cord was removed and postfixed overnight in 4% PFA at 4° C and then allowed to equilibrate in sequential overnight incubations in 15% and then 30% sucrose at 4° C. Tissue was then embedded in Optimal Cutting Temperature (OCT) media, frozen, and stored at -80° C before slicing. 15-micron spinal cord slices were taken on a Leica CM1900 cryostat and attached to charged Superfrost microscope slides (Fisherbrand) and stored at -80° C. Prior to immunostaining, slides were thawed to room temp for 30 minutes. OCT media was then removed with a 5-minute wash in ice cold Tris-Buffered Saline (TBS) with 0.4% Triton-X-100. Antigen retrieval was then performed by incubating the slices in 0.3% w / v (pH 2.0 in ddH2O) Pepsin (Fischer, Nazareth, PA) at 37° C for 10 minutes. Slides were then washed 3X in 0.4% Triton-X-100 TBS for 5 minutes before blocking at room temperature for 2 hours in a solution of 10% Normal Goat Serum (Abeam), 3% BSA (Fisher) and 0.025% Triton-X-100 (BlockingBuffer). Following blocking, slides were quenched for 30 minutes with lOmM NH4CI. Slides were next gently rocked in a humidity chamber overnight at 4° C with Blocking Buffer containing either mouse antibody recognizing Magi-2 (1 :250, Abnova) and guinea pig antibody reognizing-PKCy (1 :500, Nittobo Medical) or chicken antibody recognizing GFP (1 :500 Abeam). Following this, slides were rinsed three times with 0.4% Triton-X-100 TBS and then incubated overnight with the secondary antibody. The secondary antibodies were diluted in blocking buffer as follows: goat antibody recognizing mouse Alexa Fluor 488 (1 : 750, Abeam); donkey antibody recognizing guinea pig Alexa Fluor 594 (1 :750, Abeam) or goat antibody recognizing chicken Alexa Flour 488 (1:750, Abeam). Following the secondary antibody incubation, slides were rinsed three times for 5 minutes with 0.4% Triton-X-100 TBS and mounted using VectaShield® Hardset ™ Antifade Mounting Medium with DAPI (Vector Laboratories, California). Slides were then left alone to set for at least 48 hours at 4° C and imaged on a Leica DMi8 Confocal Microscope.

[0173] Formalin Behavior. Male and Female WT, Heterozygous and AMagi-2 littermates were first acclimated to the testing room for a period of 30 minutes. Mice then received a unilateral intraplantar injection of 20 / zL of 5% Formalin diluted in PBS and were placed into a clear plexiglass recording chamber. Mice were video recorded using Active Webcam Software for 60 minutes following injection. After completion of all mice, videos were scored by blinded observers who counted the number of licks directed at- and lifts of- the injected hindpaw on separate views. These behaviors were counted for 1 -minute bins, every fifth minute for the total recording period of 60 minutes. For the testing of peptidomimetics in the formalin assay, mice were injected intrathecally with 100 / / M peptide in 0.2% DMSO in PBS 24 hours prior to Formalin injection.

[0174] Complete Freund’s Adjuvant Model of Inflammatory Pain. Baseline Thermal and Dynamic Weight Bearing Assessments were performed prior to all CFA injections. 20 / zL of Imject® Complete Freund’s Adjuvant (Fisher) was administered via intraplantar injection into the right hindpaw of mice under isoflurane anesthesia. Mice were monitored following awakening from anesthesia and were left in their homecage until further behavioral testing was performed. We utilized the Imject® Complete Freund’s Adjuvant due to their storage in sealed glass ampules to ensure consistency of activity across experiments.

[0175] Hargreaves Thermal Paw Withdrawal Latency. Mice were acclimated to the testing room first for a period of 15 minutes followed by placement in a clear plexiglass chamber on a raised platform for an additional 15-minute acclimation period. For testing of thermal paw withdrawal latency, an automatic Hargreaves Apparatus (Ugo Basil, Italy) was placed under the plantar surface and turned up to an intensity of 160mW / cm2for a maximum of 15 seconds. Withdrawal latencies were calculated as the average of four applications to each hindpaw and each application was done with at least a five-minute interval.

[0176] Dynamic Weight Bearing Assessment. For testing of weight distribution on the hind limbs, mice were first acclimated to the testing room for a period of 15 minutes and then placed within the Dynamic Weight bearing Apparatus (BIOSEB, France). The Dynamic Weight Bearing apparatus was placed behind a red plexiglass panel to ensure a uniform environment. Following a two-minute latency, mice were recorded for a period of 5 minutes during which time mice were able to freely roam the testing chamber which consisted of a platform made of small sensors that measure the weight borne by each paw. For each acquisition, the BIOSEB DWB software matched each sensor activation to the paws and a blinded observer manually validated these paw assignments.

[0177] Lumbar Spinal Cord Magi-2 Knockdown. Wildtype C57B1 / 6 mice (Envigo) at 6 weeks of age were placed under isoflurane anesthesia and shaved over the lumbar section of the spinal cord. The spinal column was held in place with thumb and forefinger and the pelvic girdle was identified to locate the L3-L5 vertebrae. A small RN luer Hamilton syringe with 12.7mm, type-2 needle was then penetrated through the skin and placed between the vertebrae at an angle of -45° until resistance was felt. The angle of the syringe was then lowered to -30° and was then slid into the intrathecal space indicated by a tail flick response of the anesthetized mouse. 5 L of 2.0xl013titer AAV2 / 9-GFP-U6-m-Magi-2-shRNA or AAV2 / 9-GFP-U6-m-scrmb-shRNA scrambled control (Custom, Vector BioSystems, Malvern, PA) was injected at a rate of about 0.1 j L / sec and then held in place for an additional 15 seconds before removing the needle and placing the mouse back in its homecage for postsurgical observation. The sequence for the Magi- 2 shRNA was based on prior findings {34). To confirm transduction of the lumbar dorsal horn, we performed immunohistochemical verification of GFP expression as described in "Immunofluorescence ’. The antibodies used to probe for GFP was chicken antibody recognizing GFP (1 :500, Abeam; ab 13970) and Goat antibody recognizing chicken Alexafluor 488 (1 :750,Abeam; ab 157169). The lumbar dorsal horn of a naive, uninjeced mouse was used as a negative control. To verify knockdown of Magi-2, lumbar SCDH tissue was collected, and protein levels were determined as described in ‘Ex-vivo Western analysis’.

[0178] Ex-vivo Western Analysis. Total protein was obtained from lumbar spinal cord dorsal horn tissue. Following dorsal laminectomy and excision of the spinal cord from the spinal column, the lumbar spinal cord was isolated and cut along the midline to segregate the right and left spinal cord. The hemisected spinal cord was then cut along the dorsal / ventral axis to isolate and collect the dorsal horn. Tissue was homogenized in ice cold HEPES-buffered sucrose with protease inhibitors and centrifuged at 1000G for 15 minutes. The supernatant was then collected and re-centrifuged for 30 min at 10,000Gto isolate the cytosolic (supernatant) and crude synaptic fraction (pellet). The pellet was resuspended in 1% SDS Radio Immunoprecipitation Assay (RIP A) buffer and stored at -20° C All samples were resolved on 4-20% Mini-PROTEAN TGX Precast Gels (BioRad) and transferred to 0.45 pm nitrocellulose membranes. The membranes were then blocked in 5% milk in Tris Buffered Saline with 1% Tween (TBS-T) overnight at 4° C before being probed overnight at 4° C with Rabbit antibody recognizing Magi- 2 (1 : 1000, Sigma M4221); Mouse antibody recognizing NR1 (1 : 1000, Abeam abl34308);Mouse antibody recognizing NR2A (1 : 1000, Abeam ab 124913); Rabbit antibody recognizing NR2B (1 : 1000, Abeam ab254356); Rabbit antibody recognizing NR1-C2 (1: 1000, PhosphoSolutions 1506-C2); Rabbit antibody recognizing NR 1-C2’ (1: 1000, PhosphoSolutions 1507-C2’); or Rabbit antibody recognizing actin (1 :5000, Sigma a2066). Membranes were then washed 3x with TBS-T and incubated for 2 hours at room temperature with either rabbit HRP (1 :5000, Promega W4011) or mouse HRP (1 :5000, PromegaW4021). Protein bands were visualized with Immobolin Forte Western HRP substrate (Sigma, WBLUF0100) and imaged with a ChemiDoc Imaging System (BioRad). Densitometric analysis was performed to quantify protein abundance relative to Actin using ImageJ software (NIH.gov). For all Western analysis experiments, each individual sample lysate was run in triplicate (three consecutive bands, technical replicates). The protein-to-actin ratio of the three bands was then averaged and represents a single sample contributing to the overall n-value for each experiment (biological replicates).

[0179] Co-Immunoprecipitation. SCDH Lysates were collected as described for “ex-vivo Western Protein Analysis”. Following collection of the lysates and isolation of the crudesynaptosomal fraction, antibody recognizing Magi-2 antibody (Sigma) was added to half of the lysate and incubated at 4° C overnight with end over ending rocking. The next day, 50 )1L of Protein G Sepharose 4 Fast Flow affinity resin (Cytiva) was added to both lysates and incubated at 4° C for 3 hours. Complexed protein was then isolated following centrifugation and rinsing followed by denaturation and resolution via SDS-PAGE. Immunoblotting forNRl was performed as described for “ex-vivo Western Analysis”. For in vitro co-immunoprecipitation of heterologous myc-tagged Magi-2 constructs’ transfected CHO cell lysates were added to Pierce™ magnetic beads recognizing c-myc for Ihr at room temperature. The myc-tagged Magi- 2 construct was a gift from (Dr. Yutaka Hata, Toyko Medical and Dental University, had kindly provided us with all his myc-tagged Magi-2 constructs previously described. Following several washes according to the manufacturer’s protocol, elution of co-immunoprecipitated proteins was done by incubation of the beads at 95° C in 6X Loading Dye (see Tn vitro heterologous protein degradation assay and site-directed mutagenesis’) containing lOOuM DTT for 10 minutes. Additionally, co-immunoprecipitation of Nedd4-1 was performed by first conjugating rabbit antibody recognizing Nedd4-1 (ThermoFisher 21698) to magnetic dynabeads using the Dynabeads™ Protein G Immunoprecipitation Kit (ThermoFisher 10007D). Immunoblotting for transfected NR1C2was done using mouse antibody recognizing NR1 (Abeam 134308). Analysis of ubiquitination in Figure 4G was done with mouse antibody recognizing ubiquitin (1 : 1000, Abeam ab303664).

[0180] Spinal Cord Slice Electrophysiology. Male and Female WT, Heterozygous, and AMagi-2 littermates aged 2-4 weeks were placed under deep anesthesia following an intraperitoneal injection of Img / kg pentobarbital. Mice were transcardially perfused with ice- cold cutting Ringer containing the following (in mM) 250 Sucrose, 2.5 KC1, 25 NaHCCh, 1 NaftPCh, 6 MgCh, 0.5 CaCh, and 25 Glucose constantly bubbled with carbogen (95% Ch, 5% CO2). Following laminectomy, the lumbar region of the spinal cord was isolated, and all dorsal and ventral roots were removed except for the right L3-L5 dorsal roots. Parasagittal slices (350 pm) with dorsal roots attached were taken using a LeicaVT1200S vibratome and transferred for 20 minutes into a recovery solution of the following contents (in mM) 92 N-methyl-D- glucamine, 2.5KC1, 1.2 NaftPCh, 30 NaHCCh, 20 HEPES, 25 Glucose, 2 Sodium Ascorbate, 2 Thiourea, 3 Sodium Pyruvate, 10 MgSCh, and 0.5 CaCh bubbled constantly with carbogen (95% O2, 5% CO2). Slices were then allowed to recover for 1 hour in aCSF containing (in mM) 125NaCl, 2.5 KC1, 25 NaHCO3, 1.0 NaH2PO4, 25 Glucose, 1 MgCl2, 2 CaCl2bubbled constantly with carbogen (95% O2, 5% CO2). Slices were then transferred to a recording chamber (ALA Scientific) and visualized under a Zeiss Axioskop 2 FS Plus with a 40X water immersion lens equipped with DAGE MTI IR1000 differential contrast and interference system.

[0181] Patch electrodes were created from 4in thin wall borosilicate glass (TW 150F-4, World Precision Instruments) and pulled with a Narishige Model PC-10 were filled with the following (in mM) 10.5 Cs-gluconate, 17.5 CsCl, 10 EGTA, 10 HEPES, 2MgATP, 0.5 Na2GTP, pH 7.25, 295 mOsm.

[0182] Whole-cell patch-clamp recordings were then taken from dorsal horn neurons that were located superficial to the translucent band delineating the substantia gelatinosa. Currents were amplified with a Multiclamp 700B amplifier and digitized with a Digidata 1440 Series. During recordings, slices were constantly bathed in room temperature CSF additionally containing 500nM Tetrodotoxin, 10 pM Cadmium, 10 pM Strychnine, and 10 pM Bicuculline to block voltage gated sodium channels, voltage gated calcium channels as well as glycine and GABA receptors, respectively. Neurons were held at -70mV to record spontaneous EPSCs for 1 min. After this, lOuM NBQX was added to the bath to block AMPA-mediated currents. Once spontaneous EPSCs were halted from bath application of NBQX, the neuron was slowly stepped up to +40mV. Membrane Current was recorded for one minute followed by bath application of 50 pM NMDA for an additional 1 minute followed by a three-minute washout to ensure recovery. Neurons were then once again slowly stepped up to +60mV and recorded for one minute followed by a 1-minute bath application of 50 pM NMDA and a three-minute washout. Only one neuron was recorded per slice to ensure there was no effect of bath applied NMDA prior to recording a neuron.

[0183] Currents were filtered at 5kHz and analyzed using pClamplO software. Peak NMDA-induced currents recorded at +40mV and +60mV were taken and divided by the cell capacitance to determine total current density. Spontaneous EPCS current amplitudes and Frequencies were analyzed using Easy Electrophysiology Software (London).

[0184] In vitro heterologous protein degradation assay and site-directed mutagenesis. Chinese Hamster Ovary cells cultured at 37° C with 5% CO2in IMDM (Iscove’s Modified Dulbeccos Medium) containing 1% Hypoxanthine-Thymidine Supplement, 1% Penicillin- Streptomycin and 10% Fetal Bovine Serum. Cells were plated in six well plates and grown for24 hours. CHO cells were then transiently transfected with 0.5 [ig of NR1C2, NR1C2or NR1C2'P918Aand 0.5 / zg Nedd4-l or pcDNA using lipofectamine 2000. 48 hours later, cells were lysed in ice cold 1% RIPA Buffer containing protease Inhibitor cocktail. Samples were then frozen for western analysis of NR1 protein levels. Prior to western analysis, samples were mixed at a 1 : 1 : 1 : 1 ratio of sample: 8M Urea: 100 pM DTT: 6X loading dye (0.06% w / v Tris-HCl, 0.06% w / v SDS, 0.05% v / v Glycerol, 0.1% v / v beta-mercaptoethanol, and bromoblue) in order to ensure proper denaturation and reduction of the NR1 subunit and ensure that single monomers were resolved via SDS-PAGE (61). NR1C2and NR1C2plasmids were a gift from Dr. Gabriella Popescu, SUNY-Buffalo. The NR1C2'P918Awas created via site-directed mutagenesis using the QuickChange Site-directed Mutagenesis Kit (Agilent Technologies). NR1C2plasmid and mutation primers were reacted with PfU turbo and then digested with Dpnl . The primer sequences for the mutation primers are F:5’- GAGTTATCGCGCAGCGCGGTCGTCGTGACACAGAAAAAC-3 (SEQ ID NO: 48) and R: 5’- GTTTTTCTGTGTCACGACGACCGCGCTGCGCGATAACAC-3’ (SEQ ID NO:49). Resulting PCR products were then transformed into One-Shot Top Ten Competent cells (ThermoFischer) and cultured overnight. Plasmid DNA was extracted using the Qiagen Maxiprep kit and frozen in aliquots for later use in transient transfection experiments. All plasmids used underwent full Plasmid sequencing through Plasmidsaurus to confirm identity (Eugene OR). Sequences available upon request.

[0185] In-vivo Intrathecal Peptide Injections. Male and Female WT C57B1 / 6 mice were first tested for baseline thermal withdrawal latency and dynamic weight bearing hind limb distribution for two days. Immediately after behavioral testing on the second day, mice were injected with 20 / zL of CFA into the right hindpaw under isoflurane anesthesia. Twenty -four hours later, thermal withdrawal latency and dynamic weight bearing was assessed. After behavioral testing mice were placed under isoflurane anesthesia and shaved over the lumbar section of their spinal cord. As with the intrathecal virus injections, the spinal column was held in place with thumb and forefinger and the pelvic girdle was identified to locate the L3-L5 vertebrae a small RN luer Hamilton syringe with 12.7mm, type-2 needle was then penetrated through the skin and placed between the vertebrae at an angle of -45° until resistance was felt. The angle of the syringe was then lowered to -30° and was then slid into the intrathecal space. N- terminal-myristoylated peptides based were on based on the C-terminal sequence of the mouseNR1C2and custom ordered from GenScript. The wildtype sequence was NQKDTVLPRRAIERE (SEQ ID NO: 2). The phosphorylated peptide was NQKDTPVLPRRAIERE (SEQ ID NO: 3)and the alanine replacement peptide was NQKD A VLPRRAIERE (SEQ ID NO: 27). The scrambled peptide sequence was NARLIRDEQKTVRPE (SEQ ID NO: 50). All peptides were made up as previously described. 5 L of 100 / zM peptide solution dissolved in 0.2% DMSO in PBS was then injected slowly at a rate of about 0.1 / zL per second. Once the total volume was injected, the needle was held in place for an additional 15 seconds and removed. The mice were then observed post-operatively and tested behaviorally again at 48 and 72 hours relative to the CFA injection and again on days 5,7, 10, and 14. A total of 12 mice (6 male and 6 female) were tested per peptide.

[0186] Statistics. All statistical analyses were performed using GraphPad Prism Version 9. All data is represented as mean + / - SEM. Statistical significance was determined by setting a p-value threshold of p<0.05 for all experiments. Simple between-group comparisons were done using unpaired students t-test where appropriate. All multiple comparisons were analyzed via one- or two-way ANOVA with Tukey post hoc test or Bonferroni correction, respectively for comparison between groups. pClamplO software, Easy Electrophysiology and Origin 8 were used to analyze all electrophysiology data. Densitometric analysis was performed using ImageJ software.

[0187] While preferred examples of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such examples are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the examples of the disclosure described herein may be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

Claims:

1. A composition that comprises an amino acid sequence that comprises the sequence NQX1DX2VX3PRRAIERE (SEQ ID NO: 1), whereinXi is selected from K and R; X2is selected from T, S, E, and D; and X3is selected from L and P; or an amino acid sequence having at least 80% identity to SEQ ID NO: 1, and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle.

2. The composition of claim 1, wherein the amino acid sequence comprises a sequence of any one of SEQ ID NOs: 2-25.

3. The composition of claim 1, wherein the amino acid sequence is phosphorylated.

4. The composition of claim 3, wherein position X2of the amino acid sequence is phosphorylated.

5. The composition of claim 4, wherein X2is T, and T is phosphorylated.

6. The composition of claim 4, wherein X2is S, and S is phosphorylated.

7. The composition of claim 1, wherein the lipid moiety is conjugated to the N-terminus of the amino acid sequence, and, optionally, the lipid moiety is conjugated to the N-terminus through a linker.

8. The composition of claim 1, wherein the lipid moiety is conjugated to the C-terminus of the amino acid sequence, and, optionally, the lipid moiety is conjugated to the C-terminus through a linker.

9. The composition of claim 1, wherein the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (C14) group, a palmitoyl (Cis) group, or a stearoyl (Cis) group.

10. The composition of claim 9, wherein the lipid moiety comprises a myristoyl (C14) group.

11. The composition of claim 1, wherein the composition is a pharmaceutical composition, and the composition further comprises a pharmaceutically acceptable excipient, and, optionally, the composition further comprises one or more analgesic agent and / or one or more anesthetic agent.

12. A method for treating pain in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the composition according to claim 1.

13. The method of claim 12, wherein the pain comprises nociceptive pain.

14. The method of claim 12, wherein the pain comprises neuropathic pain.

15. The method of claim 12, wherein the pain is a symptom of a disease, condition, or an injury.

16. The method of claim 15, wherein the injury comprises a spinal cord injury, a nerve injury, a somatic injury, or a burn.

17. The method of claim 15, wherein the disease comprises a chronic disease and / or chronic inflammation.

18. The method of claim 17, wherein the chronic disease comprises complex regional pain syndrome, diabetes, Herpes zoster, major depressive disorder, fibromyalgia, migraine, arthritis, cancer, multiple sclerosis, inflammatory bowel disease or HIV / AIDS.

19. The method of claim 17, wherein the disease that comprises chronic inflammation comprises carpal tunnel syndrome.

20. The method of claim 12, wherein the pain is associated with chemotherapy, radiation, Morton’s neuroma, mechanical stress, thermal stress, allodynia, hyperalgesia, complex regionalpain syndrome (CRPS), post-herpetic neuralgia, trigeminal neuralgia, HIV-associated neuropathy, phantom limb pain, vasculitis-associated pain, or brachial / lumbosacral plexopathy.

21. The method of claim 12, wherein the composition is administered to the subject prophylactically.

22. The method of claim 21, wherein the composition is administered to the subject prophylactically prior to surgery, laparoscopy, chemotherapy, dental work, radiation, or childbirth.

23. A composition that comprises an amino acid sequence that comprises the sequence NQUIDU2VU3PRRAIERE (SEQ ID NO: 26), whereinUi is selected from K and R;U2is selected from A, V, G, and L; andU3is selected from L and P; or an amino acid sequence having at least 80% identity to SEQ ID NO:26 and wherein the amino acid sequence is conjugated to a heterologous group selected from one or more of a lipid moiety, a phosphate group, or a nanoparticle.

24. The composition of claim 23, wherein the composition comprises an amino acid sequence of any one of SEQ ID NOs: 27-42.

25. The composition of claim 23, wherein the composition is phosphorylated.

26. The composition of claim 25, wherein the lipid moiety is conjugated to the N-terminus of the amino acid sequence, and, optionally, the lipid moiety is conjugated to the N-terminus through a linker.

27. The composition of claim 25, wherein the lipid moiety is conjugated to the C-terminus of the amino acid sequence, and, optionally, the lipid moiety is conjugated to the C-terminus through a linker.

28. The composition of claim 23, wherein the lipid moiety comprises an octanoyl (Cs) group, a lauroyl (C12) group, a myristoyl (C14) group, a palmitoyl (Cis) group, or a stearoyl (Cis) group.

29. The composition of claim 28, wherein the lipid moiety comprises a myristoyl (C14) group.

30. The composition of claim 23, wherein the composition is a pharmaceutical composition and the composition further comprises a pharmaceutically acceptable excipient.

31. The composition of claim 23, wherein the amino acid sequence is a synthetic amino acid sequence.

32. A method for treating a condition associated with pain loss in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the composition according to claim 23.

33. The method of claim 32, wherein the condition associated with pain loss comprises congenital insensitivity to pain (CIP), a hereditary sensory neuropathy, or a hereditary sensory autonomic neuropathy (HSAN).

34. The method of claim 32, wherein the administering to the subject increases the subject’s sensitivity to pain.

35. A method for treating a condition associated with NMDA NR1C2in a subject in need thereof comprising administering to the subject the composition according to claim 23.

36. The method of claim 35, wherein the condition associated with NMDA NR1C2comprises stroke, Alzheimer's Disease, attention-deficit hyperactivity disorder (ADHD), schizophrenia, bipolar disorder, epilepsy, Huntington's disease, Parkinson's disease, Amyotrophic lateral sclerosis, chronic fatigue syndrome, anxiety, depression, post-traumatic stress disorder, obsessive compulsive disorder, or a phobia.

37. A method for treating pain in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a composition comprising administering an RNAi agent that acts on Magi-2 and / or NR1C2.

38. The method according to claim 37, wherein the RNAi agent is shRNA.

39. The method according to claim 37, wherein the shRNA has the following sequence: GTACAGAACCTGAGCCATATTCAAGAGATATGGCTCAGGTTCTGTAC (SEQ ID NO:51) or a sequence having at least 80% identity thereto.

Images