"predicting responders to cancer therapy"

Abstract

The present disclosure is based on detecting levels of biomarkers to prophylactically predict subjects with cancer who will respond to treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic agent.

Description

[0001] "Predicting responders to cancer therapy"

[0002] Cross-Reference to Related Applications

[0003] The present application claims priority from Australian Provisional Patent Application No. 2024902599 filed on 20 August 2024, the contents of which are incorporated herein by reference in their entirety.

[0004] The present application claims priority from Australian Provisional Patent Application No. 2024902815 filed on 5 September 2024, the contents of which are incorporated herein by reference in their entirety.

[0005] Reference to Sequence Listing

[0006] The entire content of the electronic submission of the sequence listing is incorporated by reference in its entirety for all purposes.

[0007] Field

[0008] The disclosure is based on the use of biomarkers to predict response of a subject with a gynaecological cancer to treatment with a poly-ADP ribose polymerase (PARP) inhibitor administered either alone or in combination with an immunotherapeutic agent.

[0009] Background

[0010] Gynaecological cancers are cancers of the female reproductive tract and include, cervical, vaginal, vulva, uterine, fallopian tube, primary peritoneal and ovarian cancers. Globally, these cancers account for more than 15% of all cancer incidences in women with over 1 million cases diagnosed annually (Bray F et al., (2013) 1 ; 132(5) : 1133-45). The annual mortality rate is just under 500,000, contributing to 14% of all reported cancer related deaths in women. Uterine, cervical and ovarian cancers are the most prevalent of gynaecological cancers, while vaginal and vulva cancers are rare and contribute to less than 0.6% of the annual cancer incidence in women.

[0011] Prevalence patterns in Australia differ from global trends, which are driven by a high prevalence of cervical cancer in developing countries. On average, 12 Australian women are diagnosed with gynaecological cancers daily, giving a total annual incidence of over 4,500 cases and contributing to just under 10% of all reported cancer cases in women (Report to the nation- gynaecological cancer2012. In: Australia C, editor. Surry Hills, NSW, 2012). Uterine and ovarian cancers are of greatest public health concern in Australia because uterine cancers are the most prevalent, accounting for 44% of gynaecological cancer cases. While ovarian cancers account for 28% of cases, they contribute to over half of the deaths due to gynaecological cancers. Premature deaths caused by gynaecological cancers have a negative effect on the economy. Gynaecological cancers accounted for over 8% of all burden of disease due to cancer in women, with over 22,000 disability-adjusted life years (DALY) in 2012. Within the 2004-2005 financial year, gynaecological cancer hospitalisations cost the nation AU$63 million, with majority of the money spent on ovarian (AU$25 million), uterine (AU$22 million) and cervical (AU$11 million) cancers.

[0012] While ovarian cancer is the 11thmost common cancer among women, it is the fifth most common cause of cancer death in women. More than half of these women currently die within five years of diagnosis (Luvero D et al., (2014) Therapeutic Advances in Medical Oncology 6:229- 239). There are several forms of ovarian cancerwhich include epithelial cancer, germ-line cancer ofthe ovaries and ovarian stromal cancer. Epithelial ovarian cancer represents the most common form of the disease.

[0013] Ovarian cancer is a disease that primarily affects post-menopausal women with the median age for diagnosis at 63 years of age. However, the disease can affect women of all age groups.

[0014] Ovarian cancers tend to be diagnosed at advanced stages and this is due to the topographical location of the primary lesion. Symptoms only manifest once the tumours have developed enough to cause physical discomfort. The survival of patients with ovarian cancer is a function of the stage at which the disease is diagnosed, with 5-year survival decreasing with advanced disease.

[0015] First line treatment of gynaecological cancers such as ovarian cancer involve debulking surgery to remove all macroscopic disease leaving less than 2cm of residual disease. The surgery may involve laproscopic or total hysterectomy, bilateral salpingo-oophorectomy and lymphadenectomy based on the spread of disease. Depending on the stage of the disease, following surgery, adjuvant radiotherapy or chemotherapy with carboplatin and epirubicin for uterine cancer patients or carboplatin and paclitaxel for ovarian cancer, may also be recommended.

[0016] Low dose cyclophosphamide is often used to treat advanced stage and / or recurrent cancers such as recurrent ovarian cancer (Handolias et al. (2013) Asia Pac J Clin Oncol 12(1): e154-e160). However, low dose cyclophosphamide results in clinical benefit for only 25-44% of women with recurrent ovarian cancer (Liu et al. (2010) J Immunother 33:53-59; Gh i ring he II i et al. (2007) Cancer Immunol Immunother 56(5):641-8).

[0017] More recently, Bevacizumab, a humanized anti-vascular endothelial growth factor monoclonal antibody, was approved for use in treating ovarian cancer in the USA in 2018 (O’Malley, D.M., et al (2023) Target Oncology, 18:471-503. In addition, the poly(ADP-ribose) polymerase (PARP) inhibitors olaparib, niraparib, and rucaparib have also been approved for maintenance treatment of ovarian cancer following a response to platinum-based chemotherapy (O’Malley, D.M., et al (2023) Target Oncology, 18:471-503). PARP inhibitors play an important role in DNA repair.

[0018] Given the important role of PARP inhibitors in ovarian cancer as well as other solid cancers including breast cancer, lung cancer, and prostate cancer, it is important to determine who will respond to them. Therefore, it is beneficial to be able to predict subjects that will respond to PARP inhibitor treatment for ovarian cancer as well as other solid tumours, not least because those predicted to not respond could be moved to alternative treatment regimes.

[0019] Accordingly, there is need in the art for methods that can predict subjects with a cancer diagnosis who will respond to treatment with a PARP inhibitor, wither alone or when administered in combination with another agent, such as immunotherapy and / or chemotherapy.

[0020] Summary

[0021] The present disclosure is based on the finding that within the sera of a cancer subject, the concentration or level of certain chemokines that promote lymphocyte migration to the tumour environment (said chemokines being counterintuitively associated with migration of immune- suppressive cancer promoting lymphocyte subsets), can be combined with the concentration or level of certain inflammatory cytokines to selectively identify subjects who will respond to treatment with a PARP inhibitor either administered as a monotherapy or in combination with an immunotherapeutic and / or chemotherapeutic agent.

[0022] Thus, the present disclosure is based on the identification of biomarkers that can predict response to a PARP inhibitor (or an analogue or derivative thereof) either as a monotherapy or in combination with an immunotherapeutic agent, by a subject undergoing treatment for cancer, independently of their homologous recombination deficiency (HRD) status. In particular, the present disclosure is based on the finding that an increase in the chemokine receptor CCR4 can be predicted on lymphocytes associated with beneficial effector functions (e.g. CD4 and CD8 T cells) promoting migration towards chemokines (CCL17 and CCL22) which are abundant in the cancer microenvironment. Once in the cancer environment, lymphocyte function can be effected by inflammatory cytokines (e.g. IL-6, IL-8).

[0023] The present disclosure is also based on the surprising finding that combining the concentration of these chemokines and cytokines in the sera with one or both ofthe concentration or level of Fractalkine and soluble TNF Receptor 2 (sTNFR2) can also be used to selectively identify subjects who will respond to treatment with a PARP inhibitor, either administered as a monotherapy or in combination with an immunotherapeutic and / or chemotherapeutic agent. The biomarkers may be used in prognostic methods to identify responder subjects, (i.e. subjects who will respond to treatment with a PARP inhibitor, either administered alone or in combination with an immunotherapeutic and / or chemotherapeutic agent.

[0024] In one aspect, the present disclosure provides a method for identifying a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, the method comprising detecting a panel of biomarkers in a biological sample obtained from the subject, wherein the panel of biomarkers comprises each of IL-6, IL-8, CCL17 and CCL22.

[0025] In some examples, the panel of biomarkers comprise:

[0026] (a) IL-6 and IL-8;

[0027] (b) CCL17 and CCL22;

[0028] (c) CC17, CC22, IL-6 and IL-8;

[0029] (d) IL-6, IL-8, CCL17, CCL22 and Fractalkine;

[0030] (e) IL-6, IL-8, CCL17, CCL22 and STNFR2; or

[0031] (f) IL-6, IL-8, CCL17, CCL22, Fractalkine and STNFR2.

[0032] In one example, the panel of biomarkers comprise orconsist of IL-6, IL-8, CCL17, CCL22, Fractalkine and sTNFR2.

[0033] In some examples, the detecting comprises measuring a level of each biomarker in the biological sample. For example, the detecting comprises measuring the concentration of each biomarker in the biological sample. The biological sample may be any sample in which a concentration value for each biomarker can be measured. In some examples, the biological sample comprises sera from a subject with cancer. In some examples, the biological sample comprises plasma, blood, saliva or ascites. The concentration may be expressed as pg / mL, but any suitable unit of measure may be used.

[0034] In some examples, the panel of biomarkers is combined with a biomarker for CCR4. In some examples, the panel of biomarkers further comprises detecting CCR4 upregulation on lymphocytes as an additional biomarker. In some examples, the panel of biomakers further comprises detecting methylation of a sequence upstream of the CCR4 gene.

[0035] First embodiment

[0036] In a first embodiment, the method comprises detecting upregulation of expression of CCR4 on lymphocytes, preferably CD3+ T cells. Thus, the method comprises detecting biomarker CCR4 and one or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 in a biological sample obtained from the subject. The method may comprise one or more biological samples, for example one or more biological samples are obtained from a subject with cancer. In some examples, a first biological sample is utilised for CCR4 detection and a second biological sample is utilised for IL-6, IL-8, CCL17 and CCL22 detection.

[0037] Thus, there is provided a method for identifying a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, the method comprising detecting biomarker CCR4 and one or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 in a biological sample obtained from the subject.

[0038] There is also provided a method for identifying a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, alone or in combination with a immunotherapeutic agent, the method comprising detecting biomarker CCR4 and one or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 in a biological sample obtained from the subject.

[0039] In some examples, the detecting comprises measuring a level of expression of CCR4 and the one or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the detecting comprises measuring a level of expression of CCR4 and two or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the detecting comprises measuring a level of expression of CCR4 and three or more additional biomarkers selected from the group consisting of IL-6, IL- 8, CCL17 and CCL22. In some examples, the detecting comprises measuring a level of expression of CCR4 and all of IL-6, IL-8, CCL17 and CCL22.

[0040] In some examples, the detecting comprises measuring a level of expression of CCR4 and the concentration of one or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In one example, the level ofexpression is upregulation of CCR4. In some examples, detecting comprises measuring a level of expression of CCR4 and the concentration of two or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the detecting comprises measuring a level of expression of CCR4 and the concentration of three or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the detecting comprises measuring a level of expression of CCR4 and the concentration of all of IL-6, IL-8, CCL17 and CCL22. In a particular example, the level of expression of CCR4 corresponds to the surface expression of CCR4 on lymphocytes, preferably CD3+ T cells within the biological sample. In a particular example, the concentration of IL-6, IL-8, CCL17 and CCL22 is measured in plasma or serum of the same or further biological sample from the subject.

[0041] In some examples, the method comprises detecting the level of two or more additional biomarkers selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the method comprises detecting the level of three or more additional biomarkers selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the method comprises detecting the level of CCL22, CCL17, IL-6 and IL-8.

[0042] In some examples, the detecting comprises measuring a level of expression (e.g. upregulation) of CCR4 and the concentration of one or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the detecting comprises measuring a level of expression of CCR4 and the concentration of two or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the detecting comprises measuring a level of expression of CCR4 and the concentration of three or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the detecting comprises measuring a level of expression of CCR4 and the concentration of all of IL-6, IL-8, CCL17 and CCL22.

[0043] In some examples, the biomarkers comprise or consist of:

[0044] (i) CCR4 and IL-6;

[0045] (ii) CCR4 and IL-8;

[0046] (Hi) CCR4 and CCL22;

[0047] (iv) CCR4, CCL22 and CCL17

[0048] (v) CCR4, IL-6 and IL-8;

[0049] (vi) CCR4, CCL17 and CCL22; or

[0050] (vii) CCR4, IL-6, IL-8, CCL17 and CCL22.

[0051] In some examples, the biomarkers comprise or consist of:

[0052] (i) CCR4 and IL-8;

[0053] (ii) CCR4, IL-6 and IL-8;

[0054] (Hi) CCR4, IL-6, IL-8, CCL17 and CCL22.

[0055] In some example, the biomarkers comprise or consists of CCR4, IL-6, IL-8, CCL17 and CCL22.

[0056] In some examples, the level of CCR4 is measured following exposure of the biological sample to mafosphamide, ifosfamide or trofosfamide in vitro. In some examples, the level of CCR4 is measured following exposure of the biological sample to mafosphamide or an analogue, or derivative thereof. In some examples, the biological sample is exposed to mafosphamide or an analogue or derivative thereof for a period of time sufficient to upregulate CCR4 on the cell surface, for example, about 72 hours.

[0057] In some examples, detecting the level of CCR4 comprises:

[0058] (i) exposing a cell population to mafosphamide, or an analogue, derivative or active metabolite thereof in vitro;

[0059] (ii) contacting the exposed cell population with a binding agent that binds to CCR4 on the surface of cells; and (iii) measuring the level of expression of CCR4 on the cells.

[0060] Preferably, the cell population is a biological sample from the subject. More preferably, the biological sample comprises cells in which CCR4 expression can be detected and / or measured.

[0061] In some examples, the cell population comprises peripheral blood mononuclear cells (PBMC). In some examples, the cell population comprises lymphocytes. In some examples, the cell population comprises T cells. In some examples, the cell population comprises T effector cells.

[0062] In some examples, the level of CCR4 is detected or measured using an immunoassay, selected from immunofluorescence assay, immunohistochemistry, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), multiplex immunoassay, light emission immunoassay or other assay such as Western blot; fluorescence activated cell sorting (FACS) or flow cytometry analysis or surface plasmon resonance (SPR).

[0063] In some examples, the level of CCR4 is detected or measured using an immunofluorescence assay, ELISA or FACS. In some examples, the level of CCR4 is detected or measured using an immunofluorescence assay (e.g. a BioPlex assay). In some examples, the level of CCR4 is detected or measured using ELISA. In one example, detecting expression of CCR4 on cells is performed by flow cytometry. Measuring the level of CCR4 expression may be qualitative or quantitative. The level of CCR4 expression can be expressed as an absolute value, a ratio or fold change depending on the method used. In some examples, the level of CCR4 expression is expressed as a percentage of positive CCR4 cells in a cell population.

[0064] In some examples, the level of one or more additional biomarkers (e.g. IL-6, IL-8, CCL17 and CCL22) is detected or measured using an assay selected from immunofluorescence assay such as enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), light emission immunoassays, multiplex immunoassay, Western blot, surface plasmon resonance and spectrometry. In some examples, the level of the one or more additional biomarkers is detected or measured using an immunofluorescence assay or ELISA. In some examples, the level of the one or more additional biomarkers is detected or measured using an immunofluorescence assay, preferably a BioPlex assay.

[0065] In some examples, the method comprises using a binding agent that binds one or more of the biomarkers to determine the level of the biomarker, for example, the concentration of biomarker in the biological sample.

[0066] In some examples, the binding agent is selected from one or more of: a binding protein, a binding nucleic acid, and a small molecule, preferably a binding protein. In some examples, the binding protein is an antibody or a fragment thereof. In some examples, the binding agent is detected by a detectable label coupled to the binding agent. In some examples, the detectable label is selected from one or more of: a chromogenic label, an enzyme, a fluorescent label, a luminescent label, a contrast agent, a radio label, a magnetic label, a prosthetic groups, and a contrast agent. In some examples, the detectable label is an enzyme. In some examples, the enzyme is selected from: horseradish peroxidase (HRP), alkaline phosphatase and glucose oxidase. In some examples, the detectable label is a chromogen. In some examples, the chromogen is selected from: 3-Amino-9-Ethylcarbazole (AEC), 3,3’-Diaminobenzidine (DAB), 3,3',5,5'-tetramethylbenzidine (TMB), StayYellow, 5-brom-4-chloro-3'-indolyphosphate p- toluidine salt (BCIP), StayGreen and nitro blue tetrazolium chloride (NBT). In some examples, the detectable label is a prosthetic group. In some examples, the prosthetic group is biotin.

[0067] In some examples, the method further comprises obtaining, or having obtained, a biological sample from the subject, preferably wherein the subject has cancer.

[0068] In some examples, the method comprises detecting and measuring biomarker CCR4 in a biological sample obtained from the subject. In some examples, the biological sample comprises cells, whole blood or a blood fraction. In some examples, the biological sample comprises cells. In some examples, the biological sample comprises peripheral blood mononuclear cells (PBMCs). In some examples, the biological sample comprises lymphocytes. In some examples, the biological sample comprises T cells. In some examples, the T cells are CD4+ and / or CD8+ effector T cells. In some examples, the biological sample comprises T effector cells (CD4+, CD25- T cells). In some examples, the biological sample comprises CD3+ cells. In some examples, the biological sample comprises CD3+CD4+CD25- and / or CD3+CD8+ cells. In some examples, the method further comprises isolating or purifying cells from the biological sample, for example wherein the cells are PMBCs, lymphocytes, T cells or effector T cells. In some examples, the method comprises detecting the percentage of cells expressing CCR4 in a cell population. In some examples, the biological sample may be purified or enriched for lymphocyte cells. For example, sorting procedures (e.g. FACS) may be employed to identify lymphocytes, for example based on forward scatter and side scatter. In some examples, sorting procedures (e.g. FACS) may be employed to remove non desirable cells such as macrophages, dendritic cells and B-cells. In one example, the cells are sorted based on expression of CD3. In another example, the cells may be purified using magnetically labelled beads (e.g. Dynabeads). Advantageously, the inventors have found that the method works effectively on CD3+ expressing T cells without necessarily having to derive T cell subsets to perform the method.

[0069] The biological sample may comprise a heterogeneous population of cells within which at least a proportion of the cells are lymphocytes, more particularly CD3+ expressing T cells. For example, the population of cells may comprise at least 1%, at least 5%, at least 10%, at least 25%, at least 30%, or greater lymphocytes. In another example, the biological sample may comprise a purified or enriched population of lymphocytes. For example, the population of cells may comprise at least 20%, at least 30%, at least 60%, at least 70% or greater lymphocytes.

[0070] In some examples, the method comprises detecting one or more biomarkers in addition to CCR4 selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 in a biological sample obtained from the subject. In some examples, the method comprises detecting the concentration of one or more of IL-6, IL-8, CCL17 and CCL22 in a biological sample obtained from the subject. In some examples, the biological sample comprises cells, whole blood or a blood fraction. In some examples, the biological sample comprises a blood fraction. In some examples, the biological sample comprises serum or plasma. In some examples, the biological sample comprises serum. In some examples, the biological sample comprises saliva.

[0071] Thus, in some examples, CCR4 is measured in PBMCs and IL-6, IL-8, CCL17 and CCL22 are measured in sera from the subject with cancer.

[0072] In some examples, the biological sample is cryopreserved and stored for later analysis.

[0073] In some examples, the method identifies prognostically a subject who will respond to treatment with a PARP inhibitor. In some examples, the method identifies prognostically a subject who will respond to treatment with a PARP inhibitor in combination with an immunotherapeutic agent, for example a check point inhibitor.

[0074] In some examples, the disclosure provides a method for identifying a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, the method comprising detecting of one or more of a cytokine selected from the group consisting of IL-6 and IL-8 and one or more of a chemokine selected from the group consisting of CCL17 and CCL22 in a biological sample obtained from the subject.

[0075] In some examples, the present disclosure provides a method for identifying a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue orderivative thereof, the method comprising detecting all of IL-6, IL-8, CCL17 and CCL22 in a biological sample obtained from the subject. In some examples, the methods identify a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, in combination with an immunotherapeutic agent.

[0076] In some examples, the detecting comprises measuring in a biological sample obtained from the subject, a level of each the chemokines and cytokines to derive a biomarker value for each biomarker. In some examples, the biomarker values for each biomarker correspond to or are derived from the concentration of the biomarker in the biological sample, for example as expressed in pg / mL.

[0077] In some examples, the immunotherapeutic agent is a checkpoint inhibitor.

[0078] In some examples, the method identifies a subject who will respond to one or more doses of a PARP inhibitor in combination with an immunotherapy. Second embodiment

[0079] In a second embodiment, the method comprises detecting methylation in a target site located in a sequence upstream of the promoter for the CCR4 gene (referred to herein as “upstreamCCR4”). Thus, the method comprises detecting upstreamCCR4 and one or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17, CCL22, sTNFR2 and Fractalkine in a biological sample obtained from the subject. In one example, upstreamCCR4 comprises methylation of a CpG site of a target sequence. In some examples, the target sequence comprises (i) a polynucleotide sequence comprising a nucleotide sequence as shown in SEQ ID NO: 9, (ii) a CpG site containing fragment of the nucleotide sequence as shown in SEQ ID NO: 9; or (iii) a nucleic acid (such as a polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 10) complementary to the polynucleotide or fragment of (i)-(ii).

[0080] In some examples, methylation of the CpG site (i.e. upstreamCCR4) is detected in circulating DNA (circDNA). In some examples, methylation of the CpG site (i.e. upstreamCCR4) is detected in circulating and cell free DNA.

[0081] In some examples, detecting methylation ofthe CpG site (e.g. within an upstream CCR4 target sequence) comprises methylation-specific PCR, quantitative methylation-specific PCR, methylation-sensitive DNA restriction enzyme analysis, or bisulphite genomic sequencing PCR, preferably by methylation-sensitive DNA restriction enzyme analysis and PCR.

[0082] In some examples, detecting methylation ofthe CpG site (e.g. within an upstream CCR4 target sequence) comprises:

[0083] (i) extracting circDNA from a biological sample previously obtained from the subject;

[0084] (ii) treating the circDNA with a methylation-specific restriction enzyme and

[0085] (iii) measuring the level of DNA using qtPCR to determine the level of methylated DNA.

[0086] In one example, the methylation-specific restriction enzyme is Hpall.

[0087] In some examples, the level of methylated DNA is compared to total DNA to determine the percentage of methylation. In some examples, the level of total DNA is determined by (i) extracting circDNA from a biological sample previously obtained from a subject; and (ii) measuring the level of DNA using quantitative PCT (qtPCR) to determine the level of total DNA.

[0088] In some examples, the PCR uses one or more primer pairs configured to amplify the region of the circDNA comprising the upstreamCCR4 target sequence. In some examples, at least one of the primers (i) is selected from SEQ ID NO: 11 and SEQ ID NO: 12; and / or (ii) can be used to amplify the same CpG site as the primers of (i). In some examples, at least one ofthe primers hybridizes to a region ofthe circDNA within 100 or 50 or 20 base-pairs of a primer of (i).

[0089] In some examples, hypermethylation of the CpG site indicates that a subject is likely to respond to treatment. In some examples, detecting upstreamCCR4 comprises determining a methylation percentage for the target sequence.

[0090] In some examples, the method further comprises contacting the biological sample with binding agents that independently bind one or more of the biomarkers in the biomarker panel to determine the level of each biomarker. In some examples, the method comprises contacting the biological sample with binding agents that independently bind one or more of the protein biomarkers in the biomarker panel to determine the level of each biomarker. In some examples, the protein biomarkers are selected from IL-6, IL-8, CCL17, CCL22, sTNFR2 and Fractalkine. In some examples, the level of one or more of the biomarkers (e.g. protein biomarkers) is determined using immunofluorescence assay, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), light emission immunoassays or Western blot analysis, preferably an immunofluorescence assay or ELISA. In some examples, the level of one or more of the biomarkers (e.g. protein biomarkers) is determined using a Bioplex assay.

[0091] Thus, there is also provided a method for identifying a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, alone or in combination with a immunotherapy or an immunotherapy and / or chemotherapy, the method comprising detecting a panel of biomarkers in a biological sample obtained from the subject, wherein the panel of biomarkers comprises each of IL-6, IL-8, CCL17 and CCL22, and optionally one or more of Fractalkine, sTNFR2 and upstreamCCR4.

[0092] Thus, in this embodiment, the method comprises detecting a panel of biomarkers in a biological sample obtained from the subject, wherein the panel of biomarkers comprises each of upstreamCCR4, IL-6, IL-8, CCL17 and CCL22, and optionally one or more of Fractalkine and STNFR2.

[0093] In some examples, the biomarkers comprise or consist of:

[0094] (i) IL-6, IL-8, CCL17 and CCL22;

[0095] (ii) IL-6, IL-8, CCL17, CCL22, and Fractalkine;

[0096] (iii) IL-6, IL-8, CCL17, CCL22, and STNFR2;

[0097] (iv) IL-6, IL-8, CCL17, CCL22, STNRF2 and Fractalkine;

[0098] (v) IL-6, IL-8, CCL17, CCL22, and upstreamCCR4;

[0099] (vi) IL-6, IL-8, CCL17, CCL22, Fractalkine and upstreamCCR4;

[0100] (vii) IL-6, IL-8, CCL17, CCL22, STNRF2 and upstreamCCR4; or

[0101] (viii) IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2 and upstreamCCR4.

[0102] In some examples, the biomarkers comprise or consist of:

[0103] (i) upstreamCCR4, IL-6, IL-8, CCL17, and CCL22;

[0104] (ii) upstreamCCR4, IL-6, IL-8, CCL17, CCL22, and Fractalkine;

[0105] (iii) upstreamCCR4, IL-6, IL-8, CCL17, CCL22, and STNRF2; or (iv) upstreamCCR4, IL-6, IL-8, CCL17, CCL22, Fractalkine, and STNFR2.

[0106] In some examples, the detecting comprises measuring the concentration of one or more biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 as described herein.

[0107] In some examples, the method further comprises obtaining or having obtained a biological sample from the subject. In some examples, the biological sample comprises whole blood or a blood fraction. In some examples, the biological sample comprises plasma or serum. In some examples, the biological sample comprises serum. In some examples, the biological sample comprises circDNA.

[0108] In some examples, the method identifies prognostically a subject who will respond to treatment with a PARP inhibitor, e.g. Olaparib. In some examples, the method identifies prognostically a subject who will respond to treatment with a PARP inhibitor (e.g. Olaparib) and an immunotherapeutic (e.g. a checkpoint inhibitor, for example Durvalumab). In some examples, the method identifies prognostically a subject who will respond to treatment with a PARP inhibitor (e.g. Olaparib), an immunotherapeutic (e.g. a checkpoint inhibitor, for example Durvalumab) and a chemotherapeutic (e.g. cyclophosphamide).

[0109] In some examples, the method further comprises or consists of treating the subject with the PARP inhibitor and optionally one or more of a chemotherapeutic and immunotherapeutic.

[0110] In some examples, the method identifies a subject who will respond to one or more doses of a PARP inhibitor in combination with an immunotherapy.

[0111] In some examples the method identifies a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, alone or in combination with a immunotherapy and / or chemotherapeutic, the method comprising detecting a panel of biomarkers in a biological sample obtained from the subject, wherein the panel of biomarkers comprises each of IL-6, IL-8, CCL17 and CCL22, and optionally one or more of Fractalkine, STNFR2 and upstreamCCR4.

[0112] In some examples, the panel of biomarkers comprises:

[0113] (i) IL-6, IL-8, CCL17 and CCL22;

[0114] (ii) IL-6, IL-8, CCL17, CCL22, and Fractalkine;

[0115] (iii) IL-6, IL-8, CCL17, CCL22, and STNFR2;

[0116] (iv) IL-6, IL-8, CCL17, CCL22, STNRF2 and Fractalkine;

[0117] (v) IL-6, IL-8, CCL17, CCL22, and upstreamCCR4;

[0118] (vi) IL-6, IL-8, CCL17, CCL22, Fractalkine and upstreamCCR4;

[0119] (vii) IL-6, IL-8, CCL17, CCL22, STNRF2 and upstreamCCR4; or

[0120] (viii) IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2 and upstreamCCR4.

[0121] In some examples, the panel of biomarkers comprises: (i) IL-6, IL-8, CCL17, CCL22, and upstreamCCR4;

[0122] (ii) IL-6, IL-8, CCL17, CCL22, Fractalkine and upstreamCCR4;

[0123] (Hi) IL-6, IL-8, CCL17, CCL22, STNRF2 and upstreamCCR4; or

[0124] (iv) IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2 and upstreamCCR4;.

[0125] In some examples, the method identifies a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, alone or in combination with an immunotherapeutic and / or a chemotherapeutic, the method comprising detecting a panel of biomarkers in a biological sample obtained from the subject, wherein the panel of biomarkers comprises or consists of:

[0126] (i) IL-6, IL-8, CCL17 and CCL22;

[0127] (ii) IL-6, IL-8, CCL17, CCL22, and Fractalkine;

[0128] (iii) IL-6, IL-8, CCL17, CCL22, and STNFR2;

[0129] (iv) IL-6, IL-8, CCL17, CCL22, STNRF2 and Fractalkine;

[0130] (v) IL-6, IL-8, CCL17, CCL22, and upstreamCCR4;

[0131] (vi) IL-6, IL-8, CCL17, CCL22, Fractalkine and upstreamCCR4;

[0132] (vii) IL-6, IL-8, CCL17, CCL22, STNRF2 and upstreamCCR4;

[0133] (viii) IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2 and upstreamCCR4;

[0134] (ix) Fractalkine;

[0135] (x) STNFR2;

[0136] (xi) upstreamCCR4;

[0137] (xii) CCL17, CCL22, Fractalkine and STNFR2;

[0138] (xiii) Fractalkine, upstreamCCR4, CCL17, and CCL22;

[0139] (xiv) STNFR2, upstreamCCR4, CCL17, CCL22; or

[0140] (xv) Fractalkine, STNFR2, upstreamCCR4, CCL17, CCL18.

[0141] In some examples, the panel of biomarkers comprises or consists of:

[0142] (i) IL-6, IL-8, CCL17 and CCL22;

[0143] (ii) IL-6, IL-8, CCL17, CCL22, and Fractalkine;

[0144] (iii) IL-6, IL-8, CCL17, CCL22, and STNFR2;

[0145] (iv) IL-6, IL-8, CCL17, CCL22, and upstreamCCR4;

[0146] (v) IL-6, IL-8, CCL17, CCL22, STNRF2 and Fractalkine;

[0147] (vi) IL-6, IL-8, CCL17, CCL22, and upstreamCCR4;

[0148] (vii) IL-6, IL-8, CCL17, CCL22, Fractalkine and upstreamCCR4;

[0149] (viii) IL-6, IL-8, CCL17, CCL22, STNRF2 and upstreamCCR4; or

[0150] (ix) IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2 and upstreamCCR4.

[0151] In some examples, the panel of biomarkers comprises or consists of:

[0152] (i) IL-6, IL-8, CCL17, CCL22, and Fractalkine; (ii) IL-6, IL-8, CCL17, CCL22, and STNFR2;

[0153] (Hi) IL-6, IL-8, CCL17, CCL22, and upstreamCCR4;

[0154] (iv) IL-6, IL-8, CCL17, CCL22, STNRF2 and Fractalkine;

[0155] (v) IL-6, IL-8, CCL17, CCL22, Fractalkine and upstreamCCR4;

[0156] (vi) IL-6, IL-8, CCL17, CCL22, STNRF2 and upstreamCCR4; or

[0157] (vii) IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2 and upstreamCCR4.

[0158] In some examples, the panel of biomarkers comprises or consists of:

[0159] (i) IL-6, IL-8, CCL17, CCL22, and upstreamCCR4;

[0160] (ii) IL-6, IL-8, CCL17, CCL22, Fractalkine and upstreamCCR4;

[0161] (Hi) IL-6, IL-8, CCL17, CCL22, STNRF2 and upstreamCCR4; or

[0162] (iv) IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2 and upstreamCCR4.

[0163] In some examples, the panel of biomarkers comprises or consists of IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2 and upstreamCCR4.

[0164] In some examples, the biological sample comprises cells, whole blood ora blood fraction. In some examples, the biological sample comprises a blood fraction. In some examples, the biological sample comprises serum or plasma. In some examples, the biological sample comprises serum. In some examples, the biological sample comprises saliva.

[0165] Deriving a prognostic biomarker value

[0166] The methods described herein preferably provide for the pros=gnostic identification of a subject who will respond to treatment with a PARP inhibitor e.g. Olaparib as a monotherapy or in combination with an immunotherapeutic (e.g. a checkpoint inhibitor, for example Durvalumab) or chemotherapeutic agent (e.g. cyclophosphamide).

[0167] In some examples, the method comprises determining a prognostic value for the subject based on the panel of biomarkers. The prognostic value is indicative of whether the subject will respond to treatment. In some examples, the method comprises determining a prognostic value forthe subject based on the level of biomarker CCR4 and the one or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22.

[0168] In some examples, the method comprises determining a prognostic value forthe subject based on the level of biomarker CCR4 and two or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the method comprises determining a prognostic value for the subject based on the level of biomarker CCR4 and three or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the method comprises determining a prognostic value forthe subject based on the level of biomarker CCR4 and each of IL-6, IL-8, CCL17 and CCL22. In some examples, the method comprises determining a prognostic value for the subject based on the level of biomarker CCR4 (e.g. on lymphocytes) and one or more, two or more, three or more or all of the additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the method comprises determining a prognostic value for the subject based on the level of biomarker CCR4 (e.g. on lymphocytes) and all of the additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the method comprises determining a prognostic value for the subject based on the level of biomarker CCR4 on CD4+CD25-T cells and IL-6.

[0169] In some examples, the methods comprise:

[0170] (i) measuring in a first biological sample obtained from the subject, a level of one or more biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 to derive a biomarker value for each cytokine and chemokine;

[0171] (ii) measuring in a second biological sample obtained from the subject, a level of CCR4 biomarker expression on cells in the sample following stimulation of the cells in the sample with mafosphamide or an analogue or derivative thereof to derive a CCR4 biomarker value;

[0172] (Hi) inputting the CCR4 biomarker value and the cytokine and chemokine biomarker value(s) into a formula whereby the summed biomarker values of one or more of IL-6 and / or IL-8 are subtracted from the summed biomarker value(s) of one or more of CCL17 and / or CCL22 to generate a cytokine-chemokine (CC) value which is then added to the CCR4 biomarker value obtained in step (i) to derive a prognostic value which is indicative of whether the subject will respond to a PARP inhibitor.

[0173] In some examples, the biomarker values are adjusted so that they are on the same scale. Without wishing to be bound by theory, reference herein to “same scale’’ is intended to mean same units of concentration. For example, CCL22 and CCL17 usually are in the range 100-100 ng / ml whereas IL6 and IL8 are usually 5-10 ng / ml so a factor is applied (either via multiplication or division) to bring them into the same range so each carries equal weight.

[0174] In some examples, the methods comprise:

[0175] (i) measuring in a biological sample obtained from the subject, a level of each biomarker in a panel of biomarkers to derive a biomarker value for each biomarker, wherein the panel of biomarkers comprises cytokines IL-6 and IL-8 and chemokines CCL17 and CCL22;

[0176] (ii) inputting the biomarker value(s) into a formula whereby the biomarker values of IL-6 and IL-8 are subtracted from the biomarker values of CCL17 and CCL22 to derive a prognostic value which is indicative of whether the subject will respond to treatment.

[0177] In some examples, the methods comprise: (i) measuring in a first biological sample obtained from the subject, a level of one or more biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 to derive a biomarker value for each cytokine and chemokine;

[0178] (ii) measuring in a second biological sample obtained from the subject a level of CCR4 biomarker expression on cells in the sample following stimulation of the cells in the sample with mafosphamide or an analogue, derivative or active metabolite thereof to derive a CCR4 biomarker value;

[0179] (Hi) inputting the CCR4 biomarker value and the cytokine and chemokine biomarker value(s) into a formula whereby the summed biomarker values of one or more of IL-6 and / or IL-8 are subtracted from the summed biomarker value(s) of one or more of CCL17 and / or CCL22 to generate a cytokine-chemokine (CC) value which is then added to the CCR4 biomarker value obtained in step (i) to derive a prognostic value which is indicative of whether the subject will respond to a PARP inhibitor.

[0180] In some examples, the biomarker values are adjusted so that they are on the same scale.

[0181] In some examples, the method comprises:

[0182] (i) measuring or having measured in a first biological sample obtained from the subject, a level of one or more cytokines selected from the group consisting of IL-6 and IL-8 and one or more chemokines selected from the group consisting of CCL17 and CCL22 to derive a biomarker value for each cytokine and chemokine;

[0183] (ii) inputting the biomarker values into a formula whereby the summed biomarker values of the one or more cytokines are subtracted from the summed biomarker values of the one or more chemokines to derive a prognostic value which is indicative of whether the subject will respond to a PARP inhibitor.

[0184] In some examples, the method comprises:

[0185] (i) measuring or having measured in a first biological sample obtained from the subject, a level of IL-6, IL-8, CCL17 and CCL22 to derive a biomarker value for each cytokine and chemokine;

[0186] (ii) inputting the biomarker values into a formula whereby the summed biomarker values of IL-6 and IL-8 are subtracted from the summed biomarker values of CCL17 and CCL22 to derive a prognostic value which is indicative of whether the subject will respond to a PARP inhibitor .

[0187] In some examples, the method comprises inputting the biomarker values into a formula to derive a prognostic value which is indicative of whether the subject will respond to a PARP inhibitor. In some examples, the summed biomarker values of the cytokine(s) (i.e. IL-6 and IL-8) are subtracted from the summed biomarker values of the chemokines (i.e. CCL17 and CCL22) to derive a prognostic value which is indicative of whether the subject will respond to a PARP inhibitor.

[0188] In some examples, the method comprises determining a prognostic value for the subject based on the level of biomarker CCR4 on lymphocytes and one or more, two or more, three or more or all of the additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the method comprises determining a prognostic value for the subject based on the level of biomarker CCR4 on lymphocytes and all of the additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, the method comprises determining a prognostic value for the subject based on the level of biomarker CCR4 on CD4+CD25-T cells and IL-6.

[0189] In some examples, a higher prognostic value is indicative of a subject who will respond to treatment with a PARP inhibitor. In some examples, a prognostic value higherthan a threshold is indicative of a subject who will respond to treatment with a PARP inhibitor. In some examples, the threshold is the mean or the median for a population of subjects.

[0190] Preferably, the cytokines and chemokines are measured in the serum or plasma of a biological sample obtained from the subject. In one example, the concentration of cytokines and chemokines are measured in the serum or plasma. In a further example, the cytokine and chemokine concentrations are adjusted so that they are on the same scale.

[0191] In some examples, the concentration value for each cytokine is measured and their values added together. Similarly, the concentration value for each chemokine is measured and their values are added together. The summed cytokine concentration value is then subtracted from the summed chemokine value after relevant adjustments are made to convert the chemokine and cytokine values to the same scale. In one example, this is expressed by the following formula: a([CCL17] + [CCL22]) - b([IL-6] + [IL-8]) where a and b are a numerical multiplier value, for example, to adjust the cytokines to the same scale as the chemokines.

[0192] Methods of measuring a concentration value for a cytokine or chemokine in the serum or plasma will be known to persons skilled in the art. These measurements may be made using any standard measuring device (e.g. point of care device or kit) including those available in hospitals or clinics. Examples include enzyme linked immunosorbent assay (ELISA), BioPlex assay, radioimmunoassay (RIA), UV absorbance, spectroscopy, or Western blot. In one example, the concentration of cytokines and chemokines are measured using a BioPlex assay. In a particular example, the cytokine and chemokine values are expressed as pg / ml. In other examples, the methods comprise:

[0193] (i) measuring in a biological sample obtained from the subject, a level of each biomarker in a panel of biomarkers to derive a biomarker value for each biomarker, wherein the panel of biomarkers comprises the cytokines IL-6 and IL-8 and the chemokines CCL17 and CCL22 and one or both of Fractalkine and sTNFR2;

[0194] (ii) inputting the biomarker value(s) into a formula whereby the biomarker values of IL-6 and IL-8 and one or both of Fractalkine and sTNFR2 are subtracted from the biomarker values of CCL17 and CCL22 to derive a prognostic value which is indicative of whether the subject will respond to treatment.

[0195] In some examples, the methods comprise:

[0196] (i) measuring in a biological sample obtained from the subject, a level of a panel of biomarkers to derive a biomarker value for each biomarker, wherein the panel of biomarkers comprises IL-6, IL-8, CCL17 and CCL22 and one or both of Fractalkine and sTNFR2;

[0197] (ii) measuring in a biological sample obtained from the subject a level of methylation of a CpG site of a target sequence located upstream of a promoter for CCR4 (upstreamCCR4) to derive an upstreamCCR4 biomarker value;

[0198] (iii) inputting the upstreamCCR4 biomarker value and the protein biomarker value(s) into a formula whereby the biomarker values of IL-6 and IL-8 and one or both of Fractalkine and sTNFR2 are subtracted from the biomarker values of CCL17, CCL22 and upstreamCCR4 to derive a prognostic value which is indicative of whether the subject will respond to treatment.

[0199] In one example, the upstreamCCR4 biomarker value is derived from circulating DNA (cDNA) in sera of the subject.

[0200] In some examples, a multiplier value is applied to bring the biomarkers in the same scale.

[0201] In some examples the first biological sample and second biological sample are from the same sample or different samples derived from the same subject.

[0202] In some examples, a prognostic value higher than a threshold value indicates a subject that will respond to treatment with a PARP inhibitor. In some examples, a prognostic value higher than a threshold value indicates a subject that will respond to treatment with a PARP inhibitor in combination with an immunotherapeutic and / or chemotherapeutic. In some examples, a prognostic value higher than a threshold value indicates a subject that will respond to treatment with a PARP inhibitor in combination with an immunotherapeutic. In some examples, a prognostic value higherthan a threshold value indicates a subject that will respond to treatment with a PARP inhibitor in combination with an immunotherapeutic and a chemotherapeutic. In some examples, the threshold is calculated based on the mean or median of a subject population, for example as shown in the calculations in Table 3. In other examples, the threshold is calculated based on an algorithm, for example as shown in the calculations in Tables 4 and 7.

[0203] In some examples, the method comprises determining a prognostic value for the subject based on the level of biomarker CCR4 or methylation of upstreamCCR4 cDNA and one or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 and optionally sTNFR2 and / or Fractalkine . In some examples, the method comprises determining a prognostic value for the subject based on the level of biomarker CCR4 or methylation of upstreamCCR4 and two or more additional biomarkers selected from the group consisting of IL- 6, IL-8, CCL17, CCL22, sTNFR2 and Fractalkine . In some examples, the method comprises determining a prognostic value for the subject based on the level of biomarker CCR4 or methylation of upstream CCR4 and three or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17, CCL22, sTNFR2 and Fractalkine . In some examples, the method comprises determining a prognostic value forthe subject based on the level of biomarker CCR4 or upstreamCCR4 and each of IL-6, IL-8, CCL17 and CCL22. In some examples, the method comprises determining a prognostic value forthe subject based on the level of biomarker CCR4 or upstreamCCR4 and each of IL-6, IL-8, CCL17, CCL22, STNFR2 and Fractalkine .

[0204] The prognostic value derived by practice of the methods described herein can inform whether a subject will be a responder or non-responder to PARP inhibitor treatment. Clinically, PARP inhibitors are administered as maintenance treatment to subjects with ovarian cancer or after reoccurrence of ovarian cancer. Accordingly, the methods described herein further comprise treating the subject with a PARP inhibitor if the prognostic value is such that the subject is deemed to be a responder.

[0205] Subjects

[0206] In some examples, the subject has been diagnosed with cancer. In one example, the subject has a solid tumour. In one example, the subject has a solid tumour selected from breast cancer, a gynaecological cancer, lung cancer, colorectal cancer, prostate cancer or melanoma. In some examples, the subject has breast cancer.

[0207] In some examples, the subject has been diagnosed with a gynaecological cancer, for example an ovarian cancer, fallopian tube cancer or primary peritoneal cancer. In some examples, the subject has previously been diagnosed with ovarian cancer, for example asymptomatic platinum-sensitive recurrent ovarian cancer.

[0208] In some examples, the subject has previously received a course or treatment with an immunotherapy and / or chemotherapeutic. In some examples, the subject has previously received platinum-based chemotherapy. In some examples, the subject has CA125 progression after first-line treatment. The subject according to the present disclosure may be a human female. In one example the subject is an adult human subject (e.g. a subject 18 years or older). In one example the subject is a peri-menopausal or post-menopausal women. In one example the subject is a postmenopausal women.

[0209] In some examples, the subject has not previously received treatment with a PARP inhibitor. In some examples, the subject has received previous treatment with a PARP inhibitor and the method identifies a subject who will respond to one or more further doses of the PARP inhibitor.

[0210] PARP inhibitor

[0211] In some examples, the PARP inhibitor is selected from the group consisting of olaparib, talazoparib, rucaparib and niraparib, an analogue or derivative thereof, or a combination thereof. In some examples, the PARP inhibitor is selected from the group consisting of olaparib, rucaparib and niraparib, an analogue or derivative thereof, or a combination thereof. In some examples, the PARP inhibitor is Olaparib or an analogue or derivative thereof.

[0212] In some examples, the PARP inhibitor is used alone (i.e. as a monotherapy), or combined with an immunotherapy and / or chemotherapy.

[0213] In some examples, the PARP inhibitor is used alone, or combined with an immunotherapy. In some examples, the immunotherapy comprises checkpoint inhibitors, cancer vaccines, CAR-T cells, bispecific antibodies, oncolytic viruses, or any combination thereof. In some examples, the immunotherapy comprises a checkpoint inhibitor. In some examples, the checkpoint inhibitor inhibits a checkpoint protein selected from the group consisting of: cytotoxic T-lymphocyte antigen-4 (CTLA4), programmed cell death protein 1 (PD-1), PD-L1 , PD-L2, B7- H3, B7-H4, herpesvirus entry mediator (HVEM), T cell membrane protein 3 (TIM3), galectin 9 (GAL9), lymphocyte activation gene 3 (LAG3), V-domain immunoglobulin (Ig)-containing suppressor of T-cell activation (VISTA), Killer-Cell Immunoglobulin-Like Receptor (KIR), Band T lymphocyte attenuator (BTLA), T cell immunoreceptor with Ig and ITIM domains (TIG IT), and combinations thereof. In some examples, the checkpoint inhibitor inhibits CTLA-4, PD-1 or PD- L1. In some examples, the checkpoint inhibitor is an antibody that blocks the interaction of programmed cell death ligand 1 (PD-L1) with the PD-1 molecule, for example Durvalumab.

[0214] In some examples, the PARP inhibitor is used alone, or combined with chemotherapy. In some examples, the chemotherapy comprises platinum based therapeutics, taxanes or cyclophosphamide or combinations thereof. In another example, the chemotherapeutic agent is selected from the group consisting of paclitaxel, adriamycin, vincristine, doxorubicin, carboplatin, cyclophosphamide, or methotrexate or a combination thereof. In some examples, the chemotherapy comprises paclitaxel and / or carboplatin. In some examples, the chemotherapy comprises cyclophosphamide, for example, low dose cyclophosphamide.

[0215] In some examples, the chemotherapy comprises carboplatin, a paclitaxel or a cyclophosphamide, or a derivative, analogue or active metabolite thereof, or a combination thereof. In some examples, the chemotherapy comprises cyclophosphamide or a derivative, analogue or active metabolite thereof.

[0216] In some examples:

[0217] (i) the PARP inhibitor is used alone,

[0218] (ii) the PARP inhibitor is combined with a Durvalumab;

[0219] (iii) the PARP inhibitor is combined with Durvalumab and low dose cyclophosphamide. In some examples, the PARP inhibitor is Olaparib.

[0220] Treatment methods

[0221] The present disclosure also provides a method for treating cancer in a subject in need thereof, the method comprising:

[0222] (i) identifying a subject who will respond to a treatment according to a method described herein; and

[0223] (ii) administering the PARP inhibitor or an analogue or derivative thereof, optionally in combination with an immunotherapeutic agent, to the subject if the subject is identified as one who will clinically respond to treatment with the PARP inhibitor.

[0224] The present application also provides a method for treating cancer in a subject in need thereof, the method comprising:

[0225] (i) identifying a subject having a prognostic value higher than a threshold according to a method described herein; and

[0226] (ii) administering the PARP inhibitor or an analogue or derivative thereof, optionally in combination with an immunotherapeutic and / or chemotherapeutic, to the subject if the subject is identified as one having a prognostic value higher than the threshold.

[0227] The present disclosure also provides a PARP inhibitor or an analogue or derivative thereof for use or when used in a method of treating cancer in a subject, wherein the subject has been identified or predicted to respond to the PARP inhibitor according to a method as described herein.

[0228] The present disclosure also provides use of a PARP inhibitor oran analogue orderivative thereof forthe manufacture of a medicament fortreating cancer in a subject, wherein the subject has been identified or predicted to respond to the PARP inhibitor according to a method as described herein. The present disclosure also provides a method of treating a cancer subject with a PARP inhibitor, the subject having previously been identified or predicted to respond to the PARP inhibitor according to a method described herein.

[0229] The present disclosure also provides a method of treating an ovarian cancer subject with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic, the subject having been identified or predicted to respond to the PARP inhibitor according to a method described herein.

[0230] The present disclosure also provides a method of treating an ovarian cancer subject with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic, the subject having been identified as having a prognostic value higherthan a threshold according to a method described herein.

[0231] The present disclosure also provides a method of treating cancer in a subject in need thereof, the method comprising administering a PARP inhibitor or an analogue or derivative thereof, alone or in combination with an immunotherapy and / or a chemotherapy to a subject who has been identified as responding to a PARP inhibitor.

[0232] The present disclosure also provides a PARP inhibitorfor use orwhen used in a method of treating ovarian cancer in a subject, the subject having been identified or predicted to respond to the PARP inhibitor according to a method described herein.

[0233] The present disclosure also provides use of PARP inhibitor for the manufacture of a medicament for treating ovarian cancer in a subject, the subject having been identified or predicted to respond to the PARP inhibitor according to a method described herein.

[0234] The duration of treatment will typically be determined by the treating physician. Persons skilled in the art will appreciate that a number of different protocols are available for treating a patient with low dose cyclophosphamide. The scheduling and duration of treatment will generally be at the clinician’s discretion and may depend on factors including the subject’s age and the stage of cancer.

[0235] Kits

[0236] The present disclosure also provides a kit for predicting or identifying a subject who will respond to treatment with a PARP inhibitor, the kit comprising binding reagents that bind to CCR4 and one or more antigens selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the kit comprising binding reagents that bind to CCR4 and two or more antigens selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the kit comprising binding reagents that bind to CCR4 and three or more antigens selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the kit comprising binding reagents that bind to CCR4, CCL22, CCL17, IL-6 and IL-8. In some examples, the kit further comprises one or more binding reagents that bind to an antigen selected from the group consisting of CD3, CD8, CD4, CD25, CCR4 and FoxP3. In some examples, the kit further comprises a container into which the biological sample is collected. In some examples, the kit further comprises instructions for use.

[0237] In some examples, the kit also comprises a surface on which is immobilised capture antibodies which bind to CCR4 and one or more or all of IL-6, IL-8, CCL17 and CCL22. In some examples, the kit also comprises an ELISA plate on which is immobilised capture antibodies which bind to CCR4 and one or more or all of IL-6, IL-8, CCL17 and CCL22. In some examples, the kit also comprises a bead (e.g. microbead or magnetic bead) on which is immobilised capture antibodies which bind to CCR4 and one or more or all of IL-6, IL-8, CCL17 and CCL22.

[0238] In some examples, the kit also provides instructions for the analysis of CCR4 and one or more or all of IL-6, IL-8, CCL17 and CCL22 by a computer generated algorithm. In a further example, a clinical report is generated.

[0239] The present disclosure also provides a kit for predicting or identifying a subject who will respond to treatment with a PARP inhibitor, the kit comprising or consisting of binding reagents that individually bind to CCL22, CCL17, IL-6 and IL-8. In some examples, the kit further comprises a container into which the biological sample is collected. In some examples, the kit further comprises a instructions for use.

[0240] In some examples, the kit also comprises a surface on which is immobilised capture antibodies which individually bind to IL-6, IL-8, CCL17 and CCL22. In some examples, the kit also comprises an ELISA plate on which is immobilised capture antibodies which individually bind to IL-6, IL-8, CCL17 and CCL22. In some examples, the kit also comprises a bead (e.g. microbead or magnetic bead) on which is immobilised capture antibodies which individually bind to IL-6, IL-8, CCL17 and CCL22.

[0241] In some examples, the kit also provides instructions for the analysis of IL-6, IL-8, CCL17 and CCL22 by a computer generated algorithm. In a further example, a clinical report is generated.

[0242] In another aspect, there is provided a kit as described herein together with a software package comprising an algorithm for generating a prognostic value as described herein.

[0243] The present application also provides a kit for predicting or identifying a subject who will respond to treatment with a PARP inhibitor, the kit comprising binding reagents that bind a biomarker in a panel of biomarkers, wherein the panel of biomarkers comprise CCL22, CCL17, IL-6, IL-8, and optionally one or more of Fractalkine and sTNFR2. In one example, the kit further comprises upstreamCCR4. cDNA methylation markers.

[0244] In some examples, the panel of biomarkers comprises

[0245] (i) CCL22, CCL17, IL-6, IL-8, Fractalkine and STNFR2; (ii) CCL22, CCL17, IL-6, IL-8, and Fractalkine; or (Hi) CCL22, CCL17, IL-6, IL-8, and STNFR2.

[0246] In some examples, the kit further comprises one or more reagents for detecting methylation of a CpG site of a target sequence located upstream of a promoter for CCR4 (upstreamCCR4). In some examples, the kit further comprises a container into which the biological sample is collected.

[0247] Compositions

[0248] The present disclosure also provides a composition for predicting or identifying a subject who will respond to treatment with a PARP inhibitor, the composition comprising a binding reagent that binds to CCR4 and one or more binding reagents that bind to an antigen selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the present disclosure also provides a composition when used for predicting or identifying a subject who will respond to treatment with a PARP inhibitor, the composition comprising a binding reagent that binds to CCR4 and one or more binding reagents that bind to an antigen selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the composition comprises a binding reagent that binds to CCR4 and two or more binding reagents that bind to an antigen selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the composition comprises a binding reagent that binds to CCR4 and three or more binding reagents that bind to an antigen selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the composition comprises a binding reagents that bind specifically and individually to CCR4, CCL22, CCL17, IL-6 and IL-8. In some examples, the binding reagents are labelled antibodies.

[0249] The present disclosure also provides a solid support comprising a binding reagent that binds to CCR4 and one or more binding reagents that bind to an antigen selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the solid support comprises a binding reagent that binds to CCR4 and two or more binding reagents that bind to an antigen selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the solid support comprises a binding reagent that binds to CCR4 and three or more binding reagents that bind to an antigen selected from the group consisting of CCL22, CCL17, IL-6 and IL-8. In some examples, the solid support comprises binding reagents that individually and specifically binds to CCR4, CCL22, CCL17, IL-6 and IL-8.

[0250] The present disclosure also provides a composition for predicting or identifying a subject who will respond to treatment with a PARP inhibitor, the composition comprising binding reagents that bind to CCL22, CCL17, IL-6 and IL-8. In some examples, the composition comprises labelled antibodies that specifically bind to CCL22, CCL17, IL-6 and IL-8. The present disclosure also provides a solid support comprising binding reagents that bind to CCL22, CCL17, IL-6 and IL-8.

[0251] The present application also provides a composition for predicting or identifying a subject who will respond to treatment with a PARP inhibitor, the composition comprising binding reagents that bind a biomarker in a panel of biomarkers, wherein the panel of biomarkers comprise CCL22, CCL17, IL-6, IL-8, and optionally one or more of Fractalkine, sTNFR2 and upstreamCCR4.

[0252] The present application also provides a solid support comprising binding reagents that bind:

[0253] (i) CCL22, CCL17, IL-6, IL-8, Fractalkine and STNFR2;

[0254] (ii) CCL22, CCL17, IL-6, IL-8, and Fractalkine; or

[0255] (iii) CCL22, CCL17, IL-6, IL-8, and STNFR2.

[0256] Optionally, any of the methods provided herein may be used in conjunction with any other known methods, particularly a known diagnostic, prognostic, predictive, and / or monitoring method for cancer.

[0257] Description of the Figures

[0258] Figure 1 shows gating strategy used for flow cytometry to characterize %CCR4+ cells within various T-cell subsets.

[0259] Figure 2 shows mafosphamide increases the expression of CCR4 on the surface of CD4+CD25- T cells and CD8+ T cells but not Treg from healthy donors, and increases the ratios of CD4+CD25- T cells / Treg and CD8+ T cells / Treg. Mafosphamide effects were analysed in human peripheral blood mononuclear cells (PBMCs) from healthy donors (N=26). The ratios of A) CD4+CD25- T cells / Treg and B) CD8+ T cells / Treg were increased following 72 hrs incubation with Mafosphamide in comparison to the untreated controls, analysed using flow cytometry. The percentages of CCR4+ T cells in both C) CD4+CD25- T cells and D) CD8+ T cells were increased but not in E) Treg population. The non-parametric paired test, was done using Wilcoxon matched- pairs signed-rank test. **** is P<0.0001 , *** is P<0.001 , ** is P<0.01 and * is P<0.05.

[0260] Figure 3 shows mafosphamide upregulates CCR4 expression on CD4+CD25- T cells and CD8+ T cells but not Treg from Solace2 trial participants (corresponding to all treatment arms A, B and C). Treatment arms were Arm A: Olaparib priming then Durvalomab treatment; Arm B: LDcy+ Olaparib priming then Durvalomab treatment and Arm C Olaparib priming then Olaparib treatment. Mafosphamide also increases the ratios of CD4+CD25- T cells / Treg and CD8+ T cells / Treg. The participants also showed higher levels of circulating IL6 and IL8, the pro- inflammatory cytokines, as well as CCL17 and CCL22, the ligands of CCR4, when compared to healthy controls. T-cell subsets and percentages of CCR4+ expressing cells were measured following 72 hrs incubation with or without Mafosphamide, using flow cytometry, in T cell populations of Solace2 participants across all treatment arms (N=100). The ratio of A) CD4+CD25- T cells / Treg and B) CD8+ T cells / Treg were increased following Mafosphamide incubation. Mafosphamide also increased the percentages of CCR4+ cells within C) CD4+CD25- T cells, D) CD8+ T cells, but not E) Treg populations. The non-parametric paired test, was done using Wilcoxon matched-pairs signed-rank test. **** is P<0.0001 , *** is P<0.001 , ** is P<0.01 and * is P<0.05. The circulating proinflammatory cytokines, IL6 and IL8 were higher in Solace2 participants (N=108) compared to healthy controls (N=29). The CCL17 ligand was higher, while the circulating CCL22 ligand was lower in Solace 2 participants compared to the healthy controls. The Mann-Whitney tests were used to compare the circulating cytokines / chemokines of healthy to cancer patients. **** is P<0.0001 , *** is P<0.001 , ** is P<0.01 and * is P<0.05.

[0261] Figure 4 shows Kaplan-Myer survival curve using CUP as a survival predictor (n=107). A, B , C represent patient arms where All= all arms of the trial, A= Olaparib monotherapy followed by Olaparib plus durvalumab; B= Olaparib plus cyclophosphamide followed by Olaparib plus durvalumab; and C= Olaparib continuous monotherapy. Analysis of CCR4 only in PBMCs.

[0262] Figure 5 shows Kaplan-Myer survival curve using CC as a survival predictor (n=107). A, B , C represent patient arms where All= all arms of the trial, A= Olaparib monotherapy followed by Olaparib plus durvalumab; B= Olaparib plus cyclophosphamide followed by Olaparib plus durvalumab; and C= Olaparib continuous monotherapy. Analysis of CCL17, CCL22, IL-6 and IL- 8 (CC) in sera.

[0263] Figure 6 shows Kaplan-Myer survival curve using CUP-CC as a survival predictor (n=107). A, B , C represent patient arms where All= all arms of the trial, A= Olaparib monotherapy followed by Olaparib plus durvalumab; B= Olaparib plus cyclophosphamide followed by Olaparib plus durvalumab; and C= Olaparib continuous monotherapy. Analysis of CCR4 and CCL17, CCL22, IL-6 and IL-8 (CUP-CC).

[0264] Figure 7 shows the ratios of effector CD4+CD25- and CD8+ T cells to Tregs did not predict the outcomes. T-cell subsets were measured following 72 hrs incubation with Mafosphamide, using flow cytometry (N=100). Using Kaplan-Myer survival analysis, the ratio of A) CD4+CD25- T cells / Treg and B) CD8+ T cells / Treg were not predicting the outcomes. Figure 8 shows higher levels of circulating upstreamCCR4 (methylation at the upstream area of CCR4 gene i.e. upstream of the CCR4 promoter) in the sera from best responders of Solace2 trial participants (corresponding to all Arms A, B and C) in comparison to poor responders.

[0265] Figure 9 shows Kaplan-Myer survival curve using individual biomarkers as a survival predictor (n=107) across all arms A, B and C of SOLACE2 trial participants. A) shows Kaplan-Myer survival using IL-6 and a threshold of 5.295 pg / mL. B) shows Kaplan-Myer survival curve using IL-8 and a threshold of 6.64 pg / mL. C) shows Kaplan-Myer survival curve using CCL22 and a threshold of 307.1 pg / mL. D) shows Kaplan-Myer survival using CCL17 and a threshold of 122.1 pg / mL. E) shows Kaplan-Myer survival curve using Fractalkine and a threshold of 8.35 pg / mL. F) shows Kaplan-Myer survival curve using sTNFR2 and a threshold of 4229 pg / mL. G) shows Kaplan-Myer survival curve using upstreamCCR4 and a threshold of 41.91 % for CCR4 methylation.

[0266] Figure 10 shows Kaplan-Myer survival using a biomarker panel comprising IL-6, IL-8, CCL17 and CCL22 as a survival predictor (n=107) across all arms A, B and C of SOLACE2 trial participants (overall), and for each individual arm where Al l= all arms of the trial, Arm A= Olaparib monotherapy followed by Olaparib plus durvalumab; Arm B= Olaparib plus cyclophosphamide followed by Olaparib plus durvalumab; and Arm C= Olaparib continuous monotherapy.

[0267] Figure 11 shows Kaplan-Myer survival curve using a biomarker panel comprising Fractalkine, STNFR2, IL6, IL8, CCL22 and CCL17 as a survival predictor (n=107) across all arms A, B and C of SOLACE2 trial participants (overall), and for each individual arm where All= all arms of the trial, Arm A= Olaparib monotherapy followed by Olaparib plus durvalumab; Arm B= Olaparib plus cyclophosphamide followed by Olaparib plus durvalumab; and Arm C= Olaparib continuous monotherapy.

[0268] Figure 12 shows Kaplan-Myer survival curve using a biomarker panel comprising, IL6, IL8, CCL22 and CCL17 plus upstreamCCR4 as a survival predictor (n=107) across all arms A, B and C of SOLACE2 trial participants (overall), and for each individual arm where All= all arms of the trial, Arm A= Olaparib monotherapy followed by Olaparib plus durvalumab; Arm B= Olaparib plus cyclophosphamide followed by Olaparib plus durvalumab; and Arm C= Olaparib continuous monotherapy.

[0269] Figure 13 shows Kaplan-Myer survival curve using a biomarker panel comprising Fractalkine, STNFR2, IL6, IL8, CCL17, and CCL22, plus upstreamCCR4 as a survival predictor (n=107) across all arms of A, B and C of SOLACE2 trial participants (overall), and for each individual arm where All= all arms of the trial, Arm A= Olaparib monotherapy followed by Olaparib plus durvalumab; Arm B= Olaparib plus cyclophosphamide followed by Olaparib plus durvalumab; and Arm C= Olaparib continuous monotherapy.

[0270] Figure 14 shows higher levels of circulating upstreamFOXP3 (methylation at the upstream area of FOXP3 gene i.e. upstream of the FOXP3 promoter) in the sera from best responders of Solace2 trial participants (all arms) in comparison to poor responders.

[0271] Figure 15 shows Kaplan-Myer survival curve using circulating upstreamFOXP3 biomarker as a survival predictor (n=107) across all arms of SOLACE2 trial participants.

[0272] Figure 16 shows Kaplan-Myer survival curve using a biomarker panel comprising Fractalkine, STNFR2, IL6, IL8, CCL17, and CCL22, upstreamCCR4 and upstreamFOXP3 as a survival predictor (n=107) across all arms of SOLACE2 trial participants (overall), and for each individual arm where All= All Arms; Arm A= Olaparib monotherapy followed by Olaparib plus durvalumab; Arm B= Olaparib plus cyclophosphamide followed by Olaparib plus durvalumab; and Arm C= Olaparib continuous monotherapy.

[0273] In all of figures 9 to 16, the threshold was set as the mean of the prognostic value for all SOLACE2 trial participants (Arms A, B and C) included in the analysis. High indicates probability of survival for those subjects having a prognostic value greater than the mean. Low indicates probability of survival forthose subjects having a prognostic value lower than the mean.

[0274] Detailed Description

[0275] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this disclosure belongs (e.g., molecular biology, cancer diagnostics, RNA or DNA detection, pharmacology, protein chemistry, and biochemistry). Any materials and methods similar or equivalent to those described herein can be used to practice or test the present disclosure. Practitioners are particularly directed to Ausubel et al., Current Protocols in Molecular Biology, Supplement 47, John Wiley & Sons, New York, 1999; CoIowick and Kaplan, eds., Methods In Enzymology, Academic Press, Inc.; Weir and Blackwell, eds., Handbook of Experimental Immunology, Vols. I-IV, Blackwell Scientific Publications, 1986; Remington's Pharmaceutical Sciences (18th ed., Mack Easton, Pa. (1990)), for definitions and terms of the art and other methods known to the person skilled in the art.

[0276] Throughout this specification, unless specifically stated otherwise, orthe context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. , one or more) of those steps, compositions of matter, group of steps or group of compositions of matter.

[0277] Those skilled in the art will appreciate that the disclosure described herein is susceptible to variations and modifications otherthan those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

[0278] The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally- equivalent products, compositions and methods are clearly within the scope of the disclosure.

[0279] Any example disclosed herein shall be taken to apply mutatis mutandis to any other example unless specifically stated otherwise.

[0280] Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0281] The term "and / or", e.g., "X and / or Y” shall be understood to mean either "X and Y” or "X or Y” and shall be taken to provide explicit support for both means or for either meaning. Furthermore, a list or features including the phrase "and / or" between the second last and last feature means that any one or more of the listed features may be present in any combination.

[0282] Reference to the singular forms "a", "an" and "the" is also understood to imply the inclusion of plural forms unless the context dictates otherwise.

[0283] As used in this disclosure, the term "or" is intended to mean an inclusive "or" rather than an exclusive "or". That is, unless specified otherwise, or clear from context, "X employs A or B" is intended to mean any of the natural inclusive permutations. That is, if X employs A; X employs B; or X employs both A and B, then "X employs A or B" is satisfied under any of the foregoing instances. Further, at least one of A and B and / orthe like generally means A or B or both A and B. As used in this specification and the appended claims, terms in the singular and the singular forms "a," "an" and "the," for example, optionally include plural referents unless the content clearly dictates otherwise.

[0284] As used in this specification and the appended claims, terms in the singular and the singular forms "a," "an" and "the," for example, optionally include plural referents unless the content clearly dictates otherwise.

[0285] As used herein, the term ‘‘about’’, unless stated to the contrary, refers to + / - 10%, more preferably + / - 5%, more preferably + / - 1%, of the designated value. Numerical quantities given herein are approximate, meaning that the term "around", "about" or "approximately" can be inferred if not expressly stated.

[0286] The % identity of a nucleic acid or polypeptide is determined by GAP (Needleman and Wunsch. 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is preferably at least 50 residues in length, and the GAP analysis aligns the two sequences over a region of at least 50 residues. For example, the query sequence is at least 100 residues in length and the GAP analysis aligns the two sequences over a region of at least 100 residues. In one example, the two sequences are aligned over their entire length.

[0287] Any discussion of documents, acts, materials, devices, articles orthe like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.

[0288] All documents cited or referenced herein, and all documents cited or referenced in herein cited documents, together with any manufacturer’s instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference in their entirety.

[0289] Selected definitions and phrases

[0290] The term ‘‘subject’’ as used herein refers to a mammal including human and non-human animals. The subject is a human (including males and females). More particularly, the subject is a female. Terms such as ‘‘subject’’, ‘‘patient’’ or ‘‘individual’’ are terms that can, in context, be used interchangeably in the present disclosure. In certain examples, the subject is an adult subject, more preferably a post-menopausal subject. The term ‘‘adult’’ as used herein is understood to mean a human subject of age 18 years or greater. Preferably, the subject may be an adult human subject of age 40 years or greater, age 45 years or greater, age 50 years or greater, age 55 years of greater, or age 60 years orgreater. The subject may be an adult human female subject between the ages of 60 and 85 years of age. In an embodiment, the subject has been diagnosed with a cancer, more particularly a gynaecological cancer. In an embodiment, the subject has been diagnosed with ovarian cancer. In another example, the subject has received a platinum based chemotherapy.

[0291] The term “respond to treatment’’ as used herein refers to subject who is identified as one who exhibits one or more desirable effects after treatment with a PARP inhibitor. Desirable effects of treatment include decreasing the rate of disease progression, decreased tumor size, ameliorating or palliating the disease state, and remission or improved prognosis. An individual “responds to treatment’’, for example, if one or more symptoms associated with a disease are mitigated or eliminated after administration of the treatment ora course of the treatment. In some examples, an individual responds to treatment if a reduction of evidence of disease is observed in response to administration of the treatment or a course of the treatment.

[0292] A “PARP inhibitor’’ as used herein refers to a cancer drug that targets and blocks the poly ADP ribose polymerase (PARP) enzyme.

[0293] The term “dose’’ as used herein refers to a single administration of a given quantity of an active, such as a PARP inhibitor or an immunotherapeutic agent.

[0294] As used herein, the term "level" in reference to a biomarker described herein refers to a quantitative amount (e.g., weight or moles), a semi-quantitative amount, a relative amount (e.g., weight % or mole %, fraction, percentage within class), a concentration, and the like, and shall be understood to refer to any suitable measure of the level known in the art. The skilled person will be aware of suitable methods of measuring a level, for example an amount, quantity, or concentration. For example, a concentration may be measured by fluorescence intensity, for example as assessed by flow cytometry. In an embodiment, a level is an amount. In an embodiment, a level is a concentration, for example expressed as mass / volume (e.g. pg / mL). In an embodiment, a level is detected relative to a reference value, for example an arbitrary reference value. In an embodiment, a level is detected relative to a pre-exposure value. “Level’’ encompasses absolute or relative amounts or concentrations of a biomarker in a sample.

[0295] As used herein, the term "level" in reference to a biomarker described herein refers to a quantitative amount (e.g., weight or moles), a semi-quantitative amount, a relative amount (e.g., weight % or mole %, fraction, percentage within class), a concentration, and the like, and shall be understood to refer to any suitable measure of the level known in the art. The skilled person will be aware of suitable methods of measuring a level, for example an amount, quantity, or concentration. For example, a concentration may be measured by fluorescence intensity, for example as assessed by flow cytometry. In an embodiment, a level is an amount. In an embodiment, a level is a concentration, for example expressed as mass / volume (e.g. pg / mL). In an embodiment, a level is detected relative to a reference value, for example an arbitrary reference value. In an embodiment, a level is detected relative to a pre-exposure value. “Level” encompasses absolute or relative amounts or concentrations of a biomarker in a sample.

[0296] The term “treatment” or “treating” as used herein refers to clinical intervention designed to alter the natural course of the individual or cell being treated during the course of clinical pathology. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating or palliating the disease state, and remission or improved prognosis. An individual is successfully “treated”, for example, if one or more symptoms associated with a disease are mitigated or eliminated. The treatment is preferably an anti-cancer treatment. Reference herein to "anti-cancer treatment" includes any treatment directed at treating cancer. The treatment may involve surgery, chemotherapy radiation and / or drugs.

[0297] As used herein, the term "treating cancer" is not intended to be an absolute term. In some aspects, the methods of the disclosure seek to reduce the size of a tumour or number of cancer cells, cause a cancer to go into remission, or prevent growth in size or cell number of cancer cells. In some circumstances, “treating cancer” leads to an improved prognosis and / or survival.

[0298] As used herein, “pre-determined” reference to an amount, threshold, level, or other value, means an amount, threshold, level, or other value that is determined independently of a sample or test amount, threshold, level, or other value. For example, by utilising a control amount, threshold, level, or other value, or standardised reference

[0299] As used herein “determine” means to measure, identify, ascertain, or calculate.

[0300] As used herein, the term "prognosis" refers to risk prediction of the severity of disease or of the probable course and clinical outcome associated with a disease, preferably cancer. It encompasses methods by which the skilled person can estimate and / or determine a probability that a given outcome will occur. The outcome to which the prognosis relates may be morbidity and / or mortality. In particular, the prognosis may relate to "progression-free survival" (PFS), which is the length of time that a patient lives with the disease without the disease progressing. Thus, PFS may be the time from the start of therapy to the date of cancer progression, or the time from the end of therapy to the date of cancer progression. The prognosis may relate to overall survival. By "overall survival" (OS) is meant the length of time that a patient lives with the disease before death occurs. Overall survival may, for example, be defined as the time from diagnosis of the cancer, treatment start, or treatment completion, until death. Overall survival is typically expressed as an "overall survival rate", which is the percentage of people in a study or treatment group who are still alive for a certain period of time after they were diagnosed with, or started treatment for, or completed treatment for, a disease, such as cancer. The overall survival rate may, for example, be stated as a five-year survival rate, which is the percentage of people in a study or treatment group who are alive five years after their diagnosis or the start or completion of treatment.

[0301] Statistical information regarding the average (e.g. median, mean or mode) OS and PFS of patients having a particular type of cancer is available to those skilled in the art. A determination whether a subject has, or is likely to have, an increased or decreased OS or PFS compared to such an average may therefore be made.

[0302] As used herein, the term "increased survival" refers to an increase in lifespan or quality of life of a subject suffering from a disease such as cancer. For example, increasing survival also includes promoting cancer remission, preventing tumour invasion, preventing tumour reoccurrence, slowing tumour growth, preventing tumour growth, decreasing tumour size, decreasing total cancer cell counts and the like.

[0303] By "progressing" or "progression" is meant that the disease gets worse, i.e. that the severity increases, for example that the tumour burden increases, that the tumour increases in size and / or weight, that the cancer becomes malignant or more malignant, and / orthat metastasis develops or the incidence and / or rate of metastasis increases.

[0304] By "regressing" or "regression" is meant that the disease improves, i.e. that the severity decreases, for example that the tumour burden decreases, that the tumour decreases in size and / or weight or becomes undetectable, that the cancer becomes less malignant, and / orthat the incidence and / or rate of metastasis decreases.

[0305] The term "predict" or "predicting" as used herein refers to determining the likelihood of a particular outcome.

[0306] As used herein, the term ‘‘detect’’ or ‘‘detecting’’, refers to the identification of marker as described herein in a sample from a subject.

[0307] An ‘‘effective amount’’ refers to at least an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result. An effective amount can be provided in one or more administrations. In some examples of the present disclosure, the term ‘‘effective amount’’ is used to refer to an amount necessary to effect treatment of a disease or condition as hereinbefore described. The effective amount may vary according to the disease or condition to be treated and also according to the weight, age, racial background, sex, health and / or physical condition and other factors relevant to the mammal being treated. Typically, the effective amount will fall within a relatively broad range (e.g. a ‘‘dosage’’ range) that can be determined through routine trial and experimentation by a medical practitioner. The effective amount can be administered in a single dose or in a dose repeated once or several times over a treatment period.

[0308] A ‘‘therapeutically effective amount’’ is at least the minimum concentration required to effect a measurable improvement of a particular disorder (e.g. cancer). A therapeutically effective amount herein may vary according to factors such as the disease state, age, sex, and weight of the patient, and the ability of the cellular composition to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects ofthe composition are outweighed by the therapeutically beneficial effects. In the case of cancer, a therapeutically effective amount can reduce the severity, inhibit or delay progression of cancer and / or relieve to some extent one or more of the symptoms associated with the cancer.

[0309] The term “ovarian cancer’’ as used herein in intended to mean those conditions classified by post-exploratory laparotomy as premalignant pathology, malignant pathology and cancer (FIGO stages 1 -4). Staging and classification of ovarian cancer are described elsewhere herein. “Early-stage ovarian cancer’’ refers to those disease states classified as stage 1 or stage 2 carcinoma. Early detection of ovarian cancer significantly increases 5-year survival rates.

[0310] The term “identify a subject’’ as used herein may be used interchangeably with the term “screening a subject’’. These terms referto strategies to identify subjects who have an increased likelihood of responding to a cancer therapy, such as a PARP inhibitor. The screening methods ofthe disclosure are not intended to definitively diagnose a subject as being a responder or nonresponder. Rather, such methods are intended to identify subjects having an increased likelihood of responding to treatment. Such screening methods may be used in combination with one or more other methods used to definitively diagnose ovarian cancer or gynaecological cancer, including pelvic examination, transvaginal ultrasound, CT scan, MRI, laparotomy, laparoscopy and biopsy of tissue samples.

[0311] The term “biomarker” as used herein refers to any gene or protein whose level of expression in a tissue or cells is altered compared to that of a normal or healthy cell or tissue.

[0312] The term "stratification" or "stratifying" as used herein refers to the division of a population into subpopulations on the basis of a specified criteria. More particularly, it refers to the division of a cohort of subjects or patients into at least two groups on the basis of specific criteria, which in the context of the present application comprises or consists of CCR4 expression in a sample of cells in combination with expression of one or more biomarkers selected from IL-6, IL-8, CCL17 and CCL22.

[0313] The term “upregulated” or “upregulation of expression” as used herein refers to a level of expression of a molecule (such as CCR4) which is significantly or substantially greater when compared to a control, threshold or following exposure to a treatment. More particularly, it refers to a level of protein expression. In some examples, it refers to a level of cell surface protein expression. In some examples, it refers to a level of a chemokine or cytokine in a sample, for example a blood sample.

[0314] The term “stable disease” as used herein means a cancer or tumour that is neither growing or shrinking. The term “progressive disease’’ as used herein means a cancer or tumour that is worsening or spreading.

[0315] The term “Treg” as used herein refers to a population of T cells bearing the cell surface markers CD4+ CD25+ FoxP3+. The term Treg is understood to referto T regulatory cells whose function is in maintaining immune homeostasis and preventing autoimmunity.

[0316] The term “CD4 Teff’ as referred to herein, is understood to referto a population of T cells bearing the cell surface markers CD4+ CD25-.

[0317] The term “CD8 Teff’ as referred to herein, is understood to referto a population of T cells bearing the cell surface marker CD8. These T cells are also known as cytotoxic T cells which are a crucial component of the adaptive immune system, playing a key role in eliminating infected or cancerous cells.

[0318] The term “CD3+ CD25- “ cells as referred to herein refer to a population of T cells that are not activated or are in a resting state.

[0319] The term “CD3” T cell as referred to herein is a pan T cell surface marker.

[0320] The term “Tconventional or Tconv” cells as referred to herein refer to a population of T cells bearing the cell surface marker FoxP3-CD25-CD4+.

[0321] Description of the disclosure

[0322] PARP inhibitors are currently approved as maintenance treatment for patients with ovarian cancer following a response to platinum-based chemotherapy. However, with the increasing number of treatment options for ovarian cancer patients and the often late diagnosis of patients, there is a need to identify which therapies an ovarian cancer patient will likely respond to. The ability to identify patients who will respond to PARP inhibitors would be advantageous since it allows patients who are identified as non-responders to be given alternative beneficial treatment without delay. It may also allow those identified as responders to receive PARP inhibitors at an earlier stage in treatment.

[0323] The present inventors have previously determined that subjects who will respond to treatment with cyclophosphamide can be identified prognostically as having a level of expression of CC chemokine receptor 4 (CCR4) on Teffector cells that increases after in vitro exposure to mafosphamide relative to the level of CCR4 at baseline pre-treatment. The inventors referto this is as the cyclophosphamide immunotherapy patient response prediction or prognostic CUP assay which is described in WO 2018 / 209404.

[0324] Here, the present inventors have modified the CUP assay such that there is no longer a requirement to identify different T cell subsets. This allows for the assay to be performed on total peripheral blood mononuclear cells (PBMCs) and avoids the need for multiparameter staining and sorting of particular T cell subsets. This modified CUP assay has been used in combination with one or more other chemokine and / or cytokine biomarkers to predict responsiveness of a cancer subject to cancertherapy, and in particularto cancertherapy using a PARP inhibitor alone or in combination with an immunotherapeutic agent (referred to as the CUP-CC assay).

[0325] The Examples provided herein provide clear evidence that this unique combination of CCR4 and other biomarkers predicts whether a subject is likely to respond to cancer therapy with a PARP inhibitor. Here, the present inventors have identified a combination of biomarkers that allows, for the first time, for the test to be conducted using soluble biomarkers and without the requirement for cell culture.

[0326] In one embodiment, the inventors have demonstrated that by combining the expression level of CCR4 on cells following in vitro exposure to mafosphamide, or an analogue or derivative thereof, with levels (i.e. the concentration) of one or more biomarkers selected from chemokines and cytokines promoting leukocyte migration into the tumour microenvironment; identifies a subject who will respond to treatment with a PARP inhibitor or with a PARP inhibitor in combination with an immunotherapeutic and / or chemotherapeutic agent.

[0327] In another embodiment, the inventors have demonstrated that the combination IL-6, IL- 8, CCL17 and CCL22, optionally in combination with the levels of one or both of Fractalkine and sTNFR2 can be used to identify subjects who will respond to treatment with a PARP inhibitor or with a PARP inhibitor in combination with an immunotherapeutic and / or chemotherapeutic agent. The present inventors have also demonstrated that the prediction can be further improved by including the level of methylation at a CpG site located upstream of the CCR4 promoter.

[0328] These findings are unexpected since previous research has indicated that high levels of each of IL-6, IL-8, CCL17 and CCL22 contribute to a poor prognosis. In contrast, the inventors have identified that high levels of CCL22 and CCL17 are associated with better prognosis for patients undergoing therapy with a PARP inhibitor. Additionally, the association of hypermethylation of the upstream region from CCR4 with prognostic utility was unexpected, as hypermethylation would at face value be associated with less CCR4 expression, which is a contradictory finding to the beneficial pattern observed in WO 2018 / 209404.

[0329] Biomarkers

[0330] In some examples, the methods and kits of the present disclosure comprise detecting the level of a panel of biomarkers in a biological sample obtained from a subject. The term "biomarker" broadly refers to any detectable compound, such as a protein, a peptide, a proteoglycan, a glycoprotein, a lipoprotein, a carbohydrate, a lipid, a nucleic acid (e.g., DNA, such as cDNA, methylated DNA or amplified DNA, or RNA, such as mRNA), an organic or inorganic chemical, a natural or synthetic polymer, a small molecule (e.g., a metabolite), or a discriminating molecule or discriminating fragment of any of the foregoing, or a measurable indicator, such as a modification, of a detectable compound (such as methylation, phosphorylation, glycosylation, lipidation, proteolytic processing, and the like) that is present in or derived from a sample. "Derived from" as used in this context refers to a compound that, when detected, is indicative of a particular molecule being present in the sample. For example, detection of a particular cDNA can be indicative of the presence of a particular RNA transcript in the sample. As another example, detection of or binding to a particular antibody can be indicative of the presence of a particular antigen (e.g., protein) in the sample. Here, a discriminating molecule or fragment is a molecule or fragment that, when detected, indicates presence or abundance of an above-identified compound. A biomarker can, for example, be isolated from a sample, directly measured in a sample, or detected in or determined to be in a sample. A biomarker can, for example, be functional, partially functional, or non-functional. In specific embodiments, the "biomarkers" include the biomarkers which are described in more detail below.

[0331] CCR4 biomarker detection by flow cytometry

[0332] In some examples, the methods and kits of the present disclosure comprise detecting expression of CCR4 on the surface of cells (e.g. lymphocytes). CCR4 (also referred to as CC chemokine receptor 4 and chemokine (C-C motif) receptor 4) is a G-protein coupled receptor. CCR4 is the receptor for the chemokines - thymus and activation-regulated chemokine (TARC, also referred to as CCL17) and macrophage-derived chemokine (MDC, also referred to as CCL22) CCR4 is predominantly expressed on T-helper cell type 2 (Th2) cells and regulatory T (Treg) cells. Limited expression of CCR4 occurs on other healthy cells and tissues, for example memory CD8+ T cells which secrete a combination of type 1 (interleukin (IL)-2, interferon (IFN)- y and tumour necrosis factor (TNF) and type 2 (IL-4) cytokines (Kondo, T. &Takiguchi, M. (2009). International immunology 21 , 523-532 (2009).

[0333] The CCR4 receptor enables T cells to migrate to sites of inflammation rich in its ligands CCL2, CCL4, CCL5, CCL17 and / or CCL22 (Cronshaw, D.G., Owen, C., Brown, Z. & Ward, S.G. (2004) Journal of immunology 172, 7761-7770). Ovarian cancer cells and macrophages that infiltrate tumour ascites secrete copious amounts of CCL22 (Yigit, R., et al. Cytokine analysis as a tool to understand tumour-host interaction in ovarian cancer. European journal of cancer 47, 1883-1889 (2011)). Without external intervention, suppressive CCR4+ Tregs are preferentially recruited to the tumour microenvironment, rather the beneficial CD8 T cells or TH1 cells (CD4+ effector cells).

[0334] The sequence of human CCR4 is available on published databases. For example, the protein sequence of human CCR4 is available as UniProt reference P51679. A representative sequence is provided in SEQ ID NO: 1. In some examples, the methods and kits of the present disclosure comprise detecting the percentage of CCR4 expressing cells in a cell population (e.g. the detecting the percentage of CCR4 positive lymphocytes in a population of lymphocytes). In some examples, the methods and kits of the present disclosure comprise detecting the percentage of CCR4 expressing cells (e.g. lymphocytes) following in vitro exposure of the cells to mafosphamide, or an analogue, derivative or active metabolite thereof. While reference is made to the percentage of CCR4 expressing cells in a cell population, the person skilled in the art will understand that this also encompasses fraction, ratio and other similar terms. Any method available in the art for the detection of CCR4 expression can be used in the methods of the present disclosure. In one example, expression of CCR4 is detected at a protein level. In some examples, higher levels of CCR4 expressing cells, particularly when used in combination with levels of one or more biomarkers selected from IL-8, IL-6, CCL17 and CCL22, will assist prognostically identifying subjects who will respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, either alone or in combination with an immunotherapeutic.

[0335] The term “upregulation of CCR4” as used herein refers to a level of expression of CCR4 on cells which is greater after in vitro exposure to mafosphamide, or an analogue, derivative or active metabolite thereof, compared to the level of CCR4 expression on the cells pre-exposure or without exposure to mafosphamide, or an analogue, derivative or active metabolite thereof. In some examples, the level of expression of CCR4 on cells is higher after in vitro exposure to mafosphamide, or an analogue, derivative or active metabolite thereof, compared to the level of CCR4 expression on the cells pre-exposure or without exposure to mafosphamide, or an analogue, derivative or active metabolite thereof. In some examples, the level of expression of CCR4 following mafosphamide contact reaches a level that is greater than the mean or median of the level of CCR4 expression on cells pre exposure to mafosphamide.

[0336] In one example, significantly greater refers to a level which is greater than the standard error of the assessment method used. In one example, significantly greater refers to a statistical significance of p<0.05, p<0.01 or p<0.001.

[0337] In some examples, upregulation of CCR4 refers to an expression level of CCR4 which is at least 2 logs greater, at least 3 logs greater, at least 3.5 logs greater or at least 4 logs greater when assessed by flow cytometry.

[0338] In some examples, upregulation of CCR4 expression refers to an increase in the mean fluorescence intensity (MFI) of CCR4 observed by flow cytometry.

[0339] In some examples, upregulation of CCR4 expression refers to an expression level of CCR4 following in vitro exposure to mafosphamide, or an analogue, derivative or active metabolite thereof that is at least 2, 3, 4, 5, 6 or 7-fold or greater than the level of expression of CCR4 prior to or without in vitro exposure to mafosphamide, or an analogue, derivative or active metabolite thereof.

[0340] In some examples, upregulation of CCR4 expression level is at least 5%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 80%, at least 100%, at least 200%, at least 300% or greater following in vitro exposure to mafosphamide, or an analogue, derivative or active metabolite thereof, compared to pre-exposure or without exposure to mafosphamide, or an analogue, derivative or active metabolite thereof.

[0341] In some examples, upregulation of CCR4 expression level is at least 5%, at least 20%, at least 30%, at least 40%, or at least 50% or greater following exposure to mafosphamide compared to pre-exposure exposure or without exposure to mafosphamide, or an analogue, derivative or active metabolite thereof.

[0342] The skilled person will appreciate that the upregulation of CCR4 expression can be expressed a number of ways, including, but not limited to fold change in %CCR4+ cells or ratio of CCR4+ T conv / CCR4+ Tregs.

[0343] In one example, detection of CCR4 is determined by measuring cell surface expression of CCR4 on cells present in a biological sample, e.g. a second biological sample. Typically, the biological sample is obtained from a subject, for example, a subject diagnosed as having a gynaecological cancer. In one example, the expression of CCR4 on lymphocytes is measured. In one example, the expression of CCR4 on T cells is measured. In one example, the expression of CCR4 on CD3+ T cells is measured. In one example, the expression of CCR4 on T effector cells is measured. In one example, the expression of CCR4 on CD4+CD25- and / or CD8+ T cells is measured. In one example, the expression of CCR4 on CD4+CD25- and CD8+ T cells is measured. In one example, the expression of CCR4 on CD4+CD25- is measured. In one example, the expression of CCR4 on CD8+ T cells is measured. An advantage of measuring expression of CCR4 on all lymphocytes is that a flow cytometer is not required to sort cells based on cell surface markers, instead lymphocytes may be identified based on size and complexity or granularity (e.g. based on forward scatter which can indicate the size of the cell and side scatter which can indicate the internal complexity or granularity of the cell). In an alternative example, the expression of CCR4 is measured by flow cytometry. In some examples, expression of CCR4 is determined on cells defined according to the cell surface expression profile discussed above. In one example, detection of CCR4 is determined on CD3+ T cells. In another example, detection of CCR4 expression is determined on cells that are also CD8+ T cells. In another example, detection of CCR4 expression is determined on cells that are CD3+CD8+ T cells. In another example, detection of CCR4 expression is determined on cells that are CD25-CD4+ cells. In another example, detection of CCR4 expression is determined on cells that are FoxP3-CD25- CD4+ cells. In one example, detection of CCR4 is determined on CD4+CD25- and / or CD8+ T cells. In another example, detection of CCR4 expression is also determined on cells that are FoxP3+CD25+CD4+ (i.e. Tregs) to confirm absence of upregulation of CCR4 on these cells.

[0344] In some examples, a threshold level of CCR4 expressing cells above which it is considered to be a suitable indicator of response may be established. Methods for selecting the threshold value include, but are not limited to analysis of ROC plot for CCR4 or analysis of the CCR4 expression level for a normal subject population. As used herein, the term “normal” refers to the level of expression in a corresponding biological sample from a healthy person who is not afflicted with cancer. Such a sample can be present in standardised form. Exemplary threshold or “cut-off’ values include, the mean CCR4 expression level plus two standard deviations, as determined from a population of normal subjects; expression levels selected from the ROC curve that represent the highest value of sensitivity plus specificity; a level of expression of CCR4 that is statistically greater at p<0.05 than the level of CCR4 expression observed pre-treatment. Persons skilled in the art will appreciate that other methods for selecting appropriate threshold expression values can be used to practice the methods disclosed herein. Persons skilled in the art will appreciate that the threshold levels may vary depending on the cell population being analysed.

[0345] Expression of CCR4 can be determined using any technique that can be used to identify and quantify cells expressing CCR4. For example, the amount of CCR4 may be determined by contacting a sample of cells derived from said subject with an antibody that binds to CCR4, subjecting the sample and the antibody to conditions which allow the antibody to bind and determining the amount of CCR4 in said sample. Any appropriate antibody can be used and examples of these are described elsewhere herein. For example, appropriate antibodies to CCR4, or antibodies which recognise particular epitopes thereof, can be prepared by standard techniques, e.g. by immunization of experimental animals, with the appropriate modifications made to the antibodies in terms of labelling etc. Antibodies may be monoclonal or polyclonal but in particular are monoclonal antibodies. The agent (e.g. antibody) may be derived from any source including animal (e.g. hamster, murine, rat, rabbit etc. or human or primate). The antibody may be partly or fully humanised. In one example, the amount of CCR4 may be determined by contacting a sample of cells derived from said subject with any cell surface binding agent such as, for example a Fab, Fab1, F(ab)2, F(ab')2 and variable domain fragment (dAb), variable heavy (VH) and variable light (VL) fragments; a peptide; an aptamer, a nanobody or other non-antibody affinity reagent.

[0346] In certain examples, expression of CCR4 is detected using an antibody. The term “antibody” broadly encompasses naturally occurring forms of antibody and recombinant antibodies such as single-chain antibodies, chimeric and humanised antibodies as well as antigen-binding fragments thereof. In some examples, the antibody is labelled with a detectable substance to facilitate detection in the biological sample. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials and radioactive materials. Examples of suitable enzymes include horse radish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase. Examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin. Examples of suitable fluorescent materials include fluorescein, rhodamine, phycoerythrin, and dansyl chloride.

[0347] In some examples, the methods of the present disclosure are practised using a commercially available antibody that binds to human CCR4. Examples of suitable commercial antibodies that bind to human CCR4 can be purchased from Lifespan BioSciences, Invitrogen, Enzo Lifesciences, Inc, Abeam, Miltenyi Biotec, Bio Legend, BD Biosciences, Santa Cruz Biotechnology, Inc and Abbexa Ltd.

[0348] Examples of methods which may be used to determine expression of CCR4 include, but are not limited to, flow cytometry, immunoprecipitation, immunohistochemistry or staining of cells with antibodies, multiplex bead-based immunoassays, and Enzyme- Linked Immunosorbent Assay (ELISA).

[0349] Detecting methylation of a sequence upstream of CCR4

[0350] The present inventors have unexpectedly found that for subjects in the clinical trial who responded to treatment (as indicated by time on trial of over 12 months) a region upstream of the promoter for CCR4 is hypermethylated compared to the same region of circulating DNA (cDNA) in poor-responders (as indicated by time on trial of between 3 and 6 months) (Figure 8). This region of DNA comprises a CpG site which can be methylated. The present inventors have found that when the methylation of this region is included as a biomarker in the biomarker panel used in the methods described herein, they were better able to identify potential responders in each arm of the clinical trial including ArmC (i.e. Olaparib alone).

[0351] Accordingly, in some examples, the methods of the present disclosure further comprise detecting methylation on a CpG site of a target sequence located upstream of a promoter for CCR4 in a biological sample obtained from the subject. This biomarker is referred to herein as “upstreamCCR4” or“meCCR4”. While upstreamCCR4 is a biomarker, and may form part of the biomarker panels as described herein, it is described separately from the protein biomarkers.

[0352] DNA methylation refers to the process of transferring methyl from S-adenosylmethionine (methyl donor) to specific bases under the catalysis of DNA methyltransferase (DMT). However, DNA methylation in mammals mainly occurs at the C of 5’-CpG-3’, which results in methylated cytosine. These sites are referred to as CpG sites. As used herein a "methylated cytosine’’ refers to a cytosine derivative that comprises a methyl moiety at a position where a methyl moiety is not present in a cytosine. For example, cytosine does not contain a methyl moiety on its pyrimidine ring, but the methylated cytosine, 5- methylcytosine, contains a methyl moiety at position 5 of its pyrimidine ring.

[0353] As used herein, "CpG site" (also referred to as “CpG’’ or "CG") is shorthand for 5'-C- phosphate-G-31(i.e. , cytosine and guanine separated by a single phosphate group) and refers to regions of nucleic acid where a cytosine nucleotide is followed by a guanine nucleotide in the linear sequence of bases along a 5' to 3' direction. The nucleic acid is typically DNA. The cytosine nucleotide can optionally contain a methyl moiety, hydroxymethyl moiety or hydrogen moiety at position 5 of the pyrimidine ring. The term ‘‘CpG site’’ is used interchangeably with "methylation site’’ and is a site in a nucleic acid where methylation has occurred, or has the possibility of occurring. In some examples, the CpG site comprises the sequence (5’->3 ) CCGG.

[0354] The target sequence is located upstream of the promoter for the CCR4 gene. In some examples, the CpG site is shown in bold, italics in the following target sequence:

[0355] 5’ - CCATTCTGAGTAGCATGTTGGAATCTTAGTCATCCCACAGGAGATGTGAATCA TCCCTTTGTCCGGCATATCCATACTGCATATGTTACCTGCCCATTAATCATGG - 3’ (SEQ ID NO: 9).

[0356] In some examples, the CpG site is shown in bold, italics in the following target sequence:

[0357] 5’ - ATCTTAGTCATCCCACAGGAGATGTGAATCATCCCTTTGTCCGGCATATCCAT ACTGCATATGTT - 3’ (SEQ ID NO: 13).

[0358] In some examples, the target sequence comprises (i) a polynucleotide sequence comprising a nucleotide sequence as shown in SEQ ID NO: 9, (ii) a CpG site containing fragment of the nucleotide sequence as shown in SEQ ID NO: 9; or (iii) a nucleic acid (such as a polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 10) complementary to the polynucleotide or fragment of (i)-(ii).

[0359] In some examples, the methods and kits of the present disclosure comprise detecting the methylation level of upstreamCCR4. While reference is made to the methylation level, the person skilled in the art will understand that this can be expressed as a methylated percentage, fraction, ratio or other similar term.

[0360] In some examples, higher methylation levels of upstreamCCR4, particularly when used in combination with the biomarker panels described herein, will assist prognostically identifying subjects who will respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, either alone or in combination with an immunotherapeutic and / or chemotherapeutic. The methylation level of the region upstream of the CCR4 promoter can be analysed by various technologies known in the art. Any technique that can be used to analyse the methylation level of DNA, in particular circulating or circulating, cell free DNA, can be applied to the present disclosure.

[0361] In some examples, detecting methylation of the CpG site comprises methylation-specific PCR, quantitative methylation-specific PCR, methylation-sensitive DNA restriction enzyme analysis, or bisulphite genomic sequencing PCR. Other available technologies include conventional methods in the art such as pyrosequencing, bisulphite conversion sequencing, qPCR, second generation sequencing, whole genome methylation sequencing, DNA enrichment detection, simplified bisulphite sequencing or HPLC, and combined gene group detection. It should be understood that, on the basis of the disclosure herein, these technologies and some technologies to be developed in the art can be applied to the present disclosure.

[0362] In some embodiments, suitable methods comprise two steps. The first step is a methylation specific reaction or separation, such as (i) bisulphite treatment, (ii) methylation specific binding, or (iii) methylation specific restriction enzymes. In some embodiments, the methylation specific reaction is bisulphite treatment. In some embodiments, the methylation specific reaction is The second step involves (i) amplification and detection, or(ii) direct detection, by a variety of methods such as (a) PCR (sequence-specific amplification), (b) DNA sequencing of untreated and bisulphite-treated DNA, (c) sequencing by ligation of dye-modified probes (including cyclic ligation and cleavage), (d) pyrosequencing, (e) single-molecule sequencing, (f) mass spectroscopy, or (g) Southern blot analysis. In some embodiments, the second step comprises PCR. In some embodiments, the second step comprises quantitative PCR. In some embodiments, analysis of DNA obtained from a subject can be performed in accordance with the Examples described herein.

[0363] In some examples, quantitative methylation specific PCR (QMSP) can be used to detect methylation level. QMSP is a continuous optical monitoring method based on fluorescent PCR, which is more sensitive than MSP. It has high throughput and avoids electrophoresis based result analysis.

[0364] In some examples, bisulphite genomic sequencing PCR can be used to detect methylation level. This method comprises treatment of DNA from the biological sample with bisulphite reagent to convert unmethylated cytosines of CpG sites to uracil. As used herein, "bisulphite reagent" refers to a reagent comprising bisulphite, disulfite, hydrogen sulfite, or combinations thereof. Methods of said treatment are described in the art (e.g., WO 2005 / 038051 and WO 2013 / 116375). In some embodiments, the bisulphite reaction comprises treatment with sodium bisulphite. In these embodiments, discrimination of methylated cytosines from nonmethylated cytosines is possible because uracil base pairs with adenine (thus behaving like thymine), whereas 5- methylcytosine base pairs with guanine (thus behaving like cytosine). After PCR and DNA sequencing, the conversion of unmethylated cytosine to uracil is observed as a C to T sequence change. In some examples, circ DNA is reacted with sodium bisulphite to convert unmethylated cytosine to uracil while leaving 5-methylcytosine unchanged. The targeted age- associated CpG sites are amplified by PCR, and the resulting product is optionally isolated and used as a template for DNA sequencing. In some examples, detecting methylation comprises: (a) extracting circDNA from a biological sample obtained from a subject; (b) treating the circDNA of step (a) with bisulphite, so as to convert the un-methylated cytosine in the genomic DNA into uracil; (c) detecting the level of methylated DNA using PCR and DNA sequencing.

[0365] In some examples, detecting methylation of the CpG site comprises methylation-sensitive DNA restriction enzyme analysis and PCR (MSRE-PCR). MSRE-PCR uses a restriction enzyme that is sensitive to DNA methylation state. For example, a restriction enzyme whose activity is blocked or impaired when a particular base in the enzyme’s restriction site is modified. In some examples, the restriction enzyme is Hpall, however other methylation sensitive enzymes which may be used. Hpall cleaves within the C / CGG recognition sequence. The activity of Hapll is impaired when the CCGG sequence is methylated on the cytosine. In these examples, discrimination of methylated cytosines from non-methylated cytosines is possible because cleavage of C / CGG is impaired or blocked by methylation. . After PCR using primers which amplify the target sequence, only those sequences where the CpG site is methylated (and therefore uncleaved) are amplified and detected using quantitative PCR. In this embodiment, the control is not treated with the restriction enzyme prior to quantitative PCR. In some examples, the methylation level is expressed as a percentage of the amount of DNA in the undigested sample. In some examples, detecting methylation comprises: (a) extracting circDNA from a biological sample obtained from a subject; (b) treating the circDNA of step (a) with a methylationsensitive DNA restriction enzyme; and (c) detecting the level of methylated DNA using PCR (e.g. quantitative PCR).

[0366] It should be understood by those in the art that DNA methylation detection is not limited to these methods, and any other DNA methylation detection method can be used. The primers used in PCR amplification are not limited to those described herein or provided in Examples.

[0367] As will be appreciated by a person skilled in the art not all copies of a CpG site in a sample will be methylated or unmethylated. In some embodiments, the methylation status or level can be represented or indicated by a "methylation value" (e.g., a methylation frequency, fraction, ratio, percent, etc.). A methylation value can be generated, for example, by comparing amplification profiles after bisulphite reaction or by comparing sequences of bisulphite-treated and untreated nucleic acids. A methylation value may also be generated by comparing amplification profiles or amount of amplified DNA (as represented by Ct value) with and without prior methylation sensitive restriction enzyme digestion. Accordingly, a methylation value, represents the methylation level and can be used as a quantitative indicator of the level of methylation at a CpG site. This is of particular use when it is desirable to compare the methylation level of a CpG site in a sample to a reference value (e.g. the methylation level the CpG sites in a reference or control population). In some embodiments, the methylation level of a CpG site can be represented as the amount of DNA amplified following restriction enzyme digestion and PCR compared to the amount of DNA amplified following PCR (i.e. without restriction enzyme digestion) using the same set of primers. In some examples, the methylation level may be calculated using the following formula:

[0368] Methylation level (%) = amount of DNA in digested sample x 100 amount of DNA in undigested sample

[0369] In some examples, the methylation level of a CpG site can be represented as the fraction of ‘C’ bases out of ‘C’+ ‘U’ total bases at the CpG site "i" following the bisulphite treatment. In some embodiments, the methylation level of a CpG site can be represented as the fraction of ‘C bases out of ‘C’+ T total bases at the age-associated CpG site "i" following the bisulphite treatment and subsequent PCR.

[0370] In some examples, the CpG site located upstream of the CCR4 promoter is hypermethylated. The term “hypermethylation” or “hypermethylated” refers to high level of methylation, hydroxymethylation, formylcytosine or carboxylcytosine of CpG in a gene sequence. For example, in the case of MSRE-PCR, hypermethylation can be determined based on statistic difference of the methylation level as compared with the control sample or reference value (threshold). In some examples, the control sample is not treated with a restriction enzyme. In some examples, the reference value is the mean or median methylation level from a population of subjects. In some examples, the methylation level is significantly greaterthan a control sample or reference value. In one example, significantly greater refers to a level which is greater than the standard error of the assessment method used. In one example, significantly greater refers to a statistical significance of p<0.05, p<0.03, p<0.01 or p<0.001. In some examples, hypermethylation is at least 5%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 80%, at least 100%, at least 200%, at least 300% or greater for subjects likely to respond to treatment, compared to subjects that are “non-responders”.

[0371] In some examples, a threshold level of methylation above which it is considered to be a suitable indicator of response may be established. Methods for selecting the threshold value include, but are not limited to analysis of ROC plot for methylation level or analysis of the methylation level for a normal subject population. As used herein, the term “normal” refers to the methylation level in a corresponding biological sample from a healthy person who is not afflicted with cancer. Such a sample can be present in standardised form. Exemplary threshold or “cutoff’ values include the mean or median methylation level for a population of subjects. Persons skilled in the art will appreciate that other methods for selecting appropriate threshold expression values can be used to practice the methods disclosed herein. Persons skilled in the art will appreciate that the threshold levels may vary depending on the selected subject population.

[0372] In one example, methylation of a CpG site in a target sequence upstream of the CCR4 promoter is determined by methylation levels in circulating DNA (e.g. circulating, cell free DNA) present in a biological sample. Typically, the biological sample is obtained from a subject, for example, a subject diagnosed as having a gynaecological cancer. In some examples, the biological sample comprises whole blood or a blood fraction. In some examples, the biological sample comprises serum or plasma. In some examples, the biological sample comprises serum. In some examples, the biological sample comprises plasma. circDNA may be extracted from the biological sample using any technique known to the person skilled in the art, for example using proteinase K digestion followed by phenol I chloroform extraction or using a commercially available kit (e.g. Qiagen CNA, Maxwell RSC ccfDNA plasma, and Zymo manual quick ccfDNA kit).

[0373] The methods of the present disclosure may be used to predict whether a subject will respond to treatment with a PARP inhibitor or an analogue, or derivative thereof before commencing treatment with the PARP inhibitor, analogue or derivative thereof, alone or in combination with an immunotherapeutic agent and / or chemotherapeutic agent. For example, the prognostic methods can be performed using circDNA derived from subjects showing the first signs of cancer, the first signs of recurrence, showing sub-clinical recurrence of their cancer, or subjects who have been formally diagnosed as having cancer. Such methods may comprise determining the methylation level of a CpG site in a target sequence upstream of the CCR4 promoter using circDNA isolated from a biological sample. A higher methylation level, for example relative to a control orthreshold level, is a positive indication that the subject will respond to PARP inhibitor treatment, particularly when used in combination with the biomarker panels described herein.

[0374] The present disclosure also provides a method of predicting whether a subject, who has not previously been treated with a PARP inhibitor will respond to treatment with a PARP inhibitor, or an analogue, or derivative thereof (optionally in combination with an immunotherapeutic agent and / orchemotherapeutic agent), the method comprising analysing the methylation level of a CpG site in a target sequence upstream of the CCR4 promoter, wherein a higher methylation level, for example relative to a threshold or control level, identifies a subject who will respond positively to treatment in vivo, particularly when used in combination with the biomarker panels described herein. Detecting methylation of a sequence upstream of FoxP3

[0375] In some examples, methods of the present disclosure further comprise detecting methylation on a CpG site of a target sequence located upstream of a promoter for FoxP3 in a biological sample obtained from the subject. This biomarker is referred to herein as “upstreamFOXP3” or “meFOXP3”.

[0376] In one example, upstreamFOXP3 comprises methylation of a CpG site of a target sequence occurring upstream of the FOXP3 promoter. In some examples, the target sequence comprises (i) a polynucleotide sequence comprising a nucleotide sequence as shown in SEQ ID NO: 16 , (ii) a CpG site containing fragment of the nucleotide sequence as shown in SEQ ID NO: 16; or (iii) a nucleic acid (such as a polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 17) complementary to the polynucleotide or fragment of (i)-(ii).

[0377] In some examples, methylation of the CpG site (i.e. upstreamFOXP3) is detected in circulating DNA (circDNA). In some examples, methylation ofthe CpG site (i.e. upstreamFOXP3) is detected in circulating and cell free DNA.

[0378] In some examples, the target sequence is located upstream of the promoter for the FOXP3 gene. In some examples, the CpG site is shown in bold, italics in the following target sequence:

[0379] 5’ - TCAGCACCTAGAAGCACCATCCTTGCAGGCTCCACTGTGGGGCTGGTGGCCG GGAGCAAGGGTCTCTGTACCTCTTCAGGCAGCCTGCAGTGAGGAAACAGGGAA- 3’ (SEQ ID NO: 16).

[0380] In some examples, the CpG site is shown in bold, italics in the following target sequence:

[0381] 5’ - CCTTGCAGGCTCCACTGTGGGGCTGGTGGCCGGGAGCAAGGGTCTCT GTACCTCTTCAGGCAGCC - 3’ (SEQ ID NO: 21).

[0382] Thus, there is also provided a method for identifying a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, alone or in combination with a immunotherapy or an immunotherapy and / or chemotherapy, the method comprising detecting a panel of biomarkers in a biological sample obtained from the subject, wherein the panel of biomarkers comprises upstreamFOXP3 and one or more of IL-6, IL-8, CCL17, CCL22, and optionally sTNFR2. In some examples, upstreamCCR4 is also included as a biomarker. In some examples, Fractalkine is also included as a biomarker. The method further comprises detecting a panel of biomarkers in a biological sample obtained from the subject, wherein the panel of biomarkers comprises upstreamFOXP3, and each of IL-6, IL-8, CCL17 and CCL22, and optionally STNFR2.

[0383] In some examples, the biomarkers comprise or consist of:

[0384] (i) upstreamFOXP3, IL-6 and IL-8;

[0385] (ii) upstreamFOXP3, CCL17, and CCL22;

[0386] (Hi) upstreamFOXP3, IL-6, IL-8, CCL17, and CCL22;

[0387] (iv) upstreamFOXP3, IL-6, IL-8, CCL17, CCL22, and STNFR2;

[0388] (v) upstreamFOXP3, upstreamCCR4, IL-6, IL-8, CCL17, CCL22, and STNFR2; and

[0389] (vi) upstreamFOXP3, upstreamCCR4, IL-6, IL-8, CCL17, CCL22, STNFR2 and Fractalkine.

[0390] In some examples, the panel of biomarkers comprises or consists of IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2, upstreamCCR4 and upstreamFOXP3.

[0391] In some examples, detecting upstreamFOXP3 and more particularly the methylation status of upstreamFOXP3 is performed as described herein as for upstreamCCR4.

[0392] In some examples, the detecting comprises measuring the concentration of one or more biomarkers selected from the group consisting of IL-6, IL-8, CCL17, CCL22, sTNF and Fractalkine as described herein.

[0393] In some examples, the method identifies prognostically a subject who will respond to treatment with a PARP inhibitor, e.g. Olaparib. In some examples, the method identifies prognostically a subject who will respond to treatment with a PARP inhibitor (e.g. Olaparib) and an immunotherapeutic (e.g. a checkpoint inhibitor, for example Durvalumab). In some examples, the method identifies prognostically a subject who will respond to treatment with a PARP inhibitor (e.g. Olaparib), an immunotherapeutic (e.g. a checkpoint inhibitor, for example Durvalumab) and a chemotherapeutic (e.g. cyclophosphamide).

[0394] In some examples, the method further comprises or consists of treating the subject with the PARP inhibitor and optionally one or more of a chemotherapeutic and immunotherapeutic.

[0395] In some examples, the method identifies a subject who will respond to one or more doses of a PARP inhibitor in combination with an immunotherapy.

[0396] In some examples the method identifies a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, alone or in combination with a immunotherapy and / or chemotherapeutic, the method comprising detecting a panel of biomarkers in a biological sample obtained from the subject, wherein the panel of biomarkers comprises upstreamFOXP3 and each of IL-6, IL-8, CCL17 and CCL22, and optionally one or more of Fractalkine, sTNFR2 and upstreamCCR4. Chemokine and cytokine biomarker detection

[0397] In some examples, the methods of the present disclosure comprise detecting one or more additional biomarkers in a first biological sample obtained from a subject, and detecting biomarker CCR4 in a second biological sample obtained from the subject. As used herein, the terms “biomarker(s)” and “additional biomarker(s)” are used interchangeably depending on the context. In some examples, the methods and kits of the present disclosure comprise detecting the level of a panel of biomarkers in a biological sample obtained from a subject.

[0398] In some examples, the additional biomarker is a chemokine and / or cytokine. In some examples, the additional biomarkers or panel of biomarkers comprise one or more or all of IL-6, IL-8, CCL17 and CCL22. In some examples, the additional biomarkers consist of one or more or all of IL-6, IL-8, CCL17 and CCL22. In some examples, the biomarkers consist of all of IL-6, IL- 8, CCL17 and CCL22.

[0399] In some examples, the additional biomarkers or panel of biomarkers comprise one or more or all of IL-6, IL-8, CCL17, CCL22, Fractalkine and sTNFR2. In some examples, the panel of biomarkers comprises at least the following four biomarkers IL-6, IL-8, CCL17, CCL22, and optionally one or more of Fractalkine and sTNFR2.

[0400] In some examples, the panel of biomarkers comprise at least IL-6, IL-8, CCL17 and CCL22. Further biomarkers that may be included in the panel of biomarkers comprise one or more of sTNFR2 and Fractalkine. In some examples, the panel of biomarkers comprise at least IL-6, IL-8, CCL17, CCL22 and sTNFR2. In some examples, the panel of biomarkers consist of IL-6, IL-8, CCL17, CCL22 and sTNFR2. In some examples, the panel of biomarkers comprise at least IL-6, IL-8, CCL17, CCL22 and Fractalkine. In some examples, the panel of biomarkers consist of IL-6, IL-8, CCL17, CCL22 and Fractalkine. In some examples, the panel of biomarkers comprise at least IL-6, IL-8, CCL17, CCL22, Fractalkine and sTNFR2. In some examples, the panel of biomarkers consist of IL-6, IL-8, CCL17, CCL22, Fractalkine and sTNFR2. i) Interleukin- 6 (IL-6 )

[0401] As used herein “IL-6’’ refers to Interleukin 6. IL-6 is an interleukin that acts as both a pro- inflammatory cytokine and an anti-inflammatory myokine. As a cytokine, it has a wide variety of biological functions in immunity, tissue regeneration, and metabolism (Uciechowski, P., and Dempke, W.C.M., (2020) Oncology 98: 131-137). The sequence of human IL-6 is available on published databases. For example, the protein sequence of human IL-6 is available as UniProt reference P05231. A representative sequence is provided in SEQ ID NO: 2. The sequence may be further processed into a mature form. In an embodiment, IL-6 comprises an amino acid sequence set forth in SEQ ID NO: 2 or a mature form or a fragment thereof, or a sequence at least 70%, at least 80%, at least 85%, at least 90, at least 95%, or at least 98% identical thereto. For example, the sequence is between about 70 to 100% identical thereto. For example, the sequence is between about 80 to 100% identical thereto. For example, the sequence is between about 90 to 100% identical thereto. For example, the sequence is between about 95 to 100% identical thereto. For example, the sequence is between about 98 to 100% identical thereto.

[0402] (ii) Interleukins (ILS)

[0403] As used herein “IL-8” refers to Interleukin 8. IL-8 is a proinflammatory cytokine with proangiogenic, proliferative, and promotility activities. It plays a significant role in various biological functions, for example in inflammation and wound healing, tumor angiogenesis and promotes epithelial-mesenchymal transition (EMT) by influencing the tumor microenvironment (Zou, D., Song, A., and Yong, W. (2023) Frontiers in Oncology, 12: 1176574). IL-8 is secreted by various cell types, such as monocytes, neutrophils, epithelial cells, fibroblasts, endothelial cells, mesothelial cells, and tumor cells and binds to the G-protein-coupled receptors CXCR1 and CXCR2, primarily found in neutrophils, monocytes and endothelial cells (Homes, W.E., et al (1991) Science, 253:1278-80, Murphy, P.M. & Tiffany, H.L., (1991) Science 253:1280-3). The sequence of human IL-8 is available on published databases. For example, the protein sequence of human IL-8 is available as UniProt reference P10145. A representative sequence is provided in SEQ ID NO: 3. The sequence may be further processed into a mature form. In an embodiment, IL-8 comprises an amino acid sequence set forth in SEQ ID NO: 3 or a mature form or a fragment thereof, or a sequence at least 70%, at least 80%, at least 85%, at least 90, at least 95%, or at least 98% identical thereto. For example, the sequence is between about 70 to 100% identical thereto. For example, the sequence is between about 80 to 100% identical thereto. For example, the sequence is between about 90 to 100% identical thereto. For example, the sequence is between about 95 to 100% identical thereto. For example, the sequence is between about 98 to 100% identical thereto.

[0404] (Hi) CC-motif chemokine ligand 17 (CCL17)

[0405] As used herein “CCL17” refers to C-C motif chemokine ligand 17 and is also called TARC (thymus- and activation-regulated chemokine). CCL17 is a chemokine that is produced in the thymus and by macrophages, monocytes and professional antigen-presenting cells in the periphery, such as Langerhans and dendritic cells. CCL17 plays a crucial role in TH2-type immune response. The role of CCL17 in cancer is complex. High levels of CCL17 have been associated poor prognosis in some cancers and an improved outcome in other cancers (Korbecki, J., et. al., (2020). International Journal of Molecular Sciences. 21 : 8412). The sequence of human CCL17 is available on published databases. The sequence of human CCL17 is available on published databases. For example, the protein sequence of human CCL17 is available as UniProt reference Q92583. A representative sequence is provided in SEQ ID NO: 4. The sequence may be further processed into a mature form. In an embodiment, CCL17 comprises an amino acid sequence set forth in SEQ ID NO: 4 or a mature form or a fragment thereof, or a sequence at least 70%, at least 80%, at least 85%, at least 90, at least 95%, or at least 98% identical thereto. For example, the sequence is between about 70 to 100% identical thereto. For example, the sequence is between about 80 to 100% identical thereto. For example, the sequence is between about 90 to 100% identical thereto. For example, the sequence is between about 95 to 100% identical thereto. For example, the sequence is between about 98 to 100% identical thereto.

[0406] (iv) C-C motif chemokine ligand 22 (CCL22)

[0407] As used herein “CCL22” refers to C-C motif chemokine ligand 22. It is also referred to as macrophage-derived chemokine or MDC. Like CCL17, CCL22 is ligand for CCR4. Like CCL17, the role of CCL22 in cancer is complex. CCL17 and CCL22 could exert an anti-cancer effect by causing the infiltration of tumor-infiltrating lymphocytes into the tumor, a process dependent on CCR4 on these cells. However immune-suppressive cell subsets such as regulatory T cells (Treg), and T helper 2 (Th2) cells are the ones that preferentially express CCR4, and therefore CCL22 normally would be expected to attract cells that limit or suppress beneficial anti-tumour responses. In addition, levels of CCL22 are also elevated in some cancers, and cancer cells themselves can produce CCL22 (Korbecki, J., et. al., (2020). International Journal of Molecular Sciences. 21 : 8412). The sequence of human CCL22 is available on published databases. For example, the protein sequence of human CCL22 is available as UniProt reference 000626. A representative sequence is provided in SEQ ID NO: 5. The sequence may be further processed into a mature form. In an embodiment, CCL22 comprises an amino acid sequence set forth in SEQ ID NO: 5 or a mature form or a fragment thereof, or a sequence at least 70%, at least 80%, at least 85%, at least 90, at least 95%, or at least 98% identical thereto. For example, the sequence is between about 70 to 100% identical thereto. For example, the sequence is between about 80 to 100% identical thereto. For example, the sequence is between about 90 to 100% identical thereto. For example, the sequence is between about 95 to 100% identical thereto. For example, the sequence is between about 98 to 100% identical thereto.

[0408] (v) soluble tumour necrosis factor receptor 2 (sTNFR2)

[0409] As used herein “sTNFR2” refers to soluble TNF (Tumour Necrosis Factor) receptor 2 (TNFR2 is also known as also known as TNFRSF1 B, CD120b, and p75). TNF is a pro- inflammatory cytokine that plays a role in inflammatory processes, tumour lysis, apoptosis, immunomodulation, and others. TNFR2 is one of the receptors for TNF and signalling from TNFR2 is responsible for cell survival. TNFR2 (and TNFR1) can be cleaved to from soluble receptors, with the soluble receptor able to act as natural antagonist of TNF action. TNFR1 and TNFR2 are not specific to TNF, they interact also with lymphotoxin alpha (LTa, previously known as TNFP). The sequence of human TNFR2 is available on published databases. For example, the protein sequence of human TNFR2 is available as UniProt reference P20333. A representative sequence is provided in SEQ ID NO: 6. The sequence may be further processed into a mature form. In an embodiment, TNFR2 comprises an amino acid sequence set forth in SEQ ID NO: 6 or a mature form or a fragment thereof, or a sequence at least 70%, at least 80%, at least 85%, at least 90, at least 95%, or at least 98% identical thereto. For example, the sequence is between about 70 to 100% identical thereto. For example, the sequence is between about 80 to 100% identical thereto. For example, the sequence is between about 90 to 100% identical thereto. For example, the sequence is between about 95 to 100% identical thereto. For example, the sequence is between about 98 to 100% identical thereto. sTNFR2 may be produced from the membrane form of the receptor by proteolytic processing, for example after tumor necrosis factor-a converting enzyme (TACE) activation. In an embodiment, sTNFR2 comprises an amino acid sequence set forth in SEQ ID NO: 7 or a fragment thereof, or a sequence at least 70%, at least 80%, at least 85%, at least 90, at least 95%, or at least 98% identical thereto. For example, the sequence is between about 70 to 100% identical thereto. For example, the sequence is between about 80 to 100% identical thereto. For example, the sequence is between about 90 to 100% identical thereto. For example, the sequence is between about 95 to 100% identical thereto. For example, the sequence is between about 98 to 100% identical thereto.

[0410] (vi) Fractalkine

[0411] As used herein “Fractalkine” or “Fractaline ” or “CX3CL1” is a chemokine that acts as a ligand for CX3CR1 and the integrins, ITGAV:ITGB3 and ITGA4:ITGB1. Depending on tissue compartment, signalling from CX3CR1-CX3CL1 may play a role in immune response, inflammation, cell adhesion and chemotaxis (Korbecki J., et al. (2020) Int J Mol Sci. 21 :3723). . Fractalkine can function as a chemoattractant to monocytes, NK cells and T cells via the CX3CR1 receptor (Korbecki J., et al. (2020) Int J Mol Sci. 21 :3723). Fractalkine has been associated with poorer prognosis for some cancer types and improved prognosis in other cancer types (Korbecki J., et al. (2020) Int J Mol Sci. 21 :3723). The sequence of human Fractalkine is available on published databases. Fractalkine exists in a soluble form and a membrane bound form. Cleavage of Fractalkine between amino acids 339-340 (RR) produces the soluble form. For example, the protein sequence of human Fractalkine is available as UniProt reference P78423. A representative sequence is provided in SEQ ID NO: 8. The sequence may be further processed into a mature form. In an embodiment, Fractalkine comprises an amino acid sequence set forth in SEQ ID NO: 8 or a mature form or a fragment thereof, or a sequence at least 70%, at least 80%, at least 85%, at least 90, at least 95%, or at least 98% identical thereto. For example, the sequence is between about 70 to 100% identical thereto. For example, the sequence is between about 80 to 100% identical thereto. For example, the sequence is between about 90 to 100% identical thereto. For example, the sequence is between about 95 to 100% identical thereto. For example, the sequence is between about 98 to 100% identical thereto.

[0412] Biomarker detection

[0413] As described herein, various biomarkers are used to predict whether a subject who has not previously been treated with a PARP inhibitor (i.e. PARP-naTve subject) will respond to treatment with a PARP inhibitor, or an analogue, or derivative thereof, optionally in combination with an immunotherapeutic agent. As the skilled person will appreciated, PARP inhibitors are used as the standard of care in maintenance therapy for patients with ovarian, fallopian tube, or primary peritoneal cancer who have responded to platinum-based chemotherapy. Platinum based chemotherapy include cisplatin, carboplatin and oxaliplatin (Zhang C et al., (2022) Theranostics vol 12(5): 2115-2132).

[0414] In certain examples, the method comprises analysing cells from the subject for expression of CCR4 as described herein, following in vitro exposure of the cells to mafosphamide, or an analogue, derivative or active metabolite thereof, wherein a higher percentage of CCR4 expressing cells, for example relative to a threshold or control level, identifies a subject who will respond positively to treatment with a PARP inhibitor in vivo, particularly when CCR4 is considered in combination with the level of one or more biomarkers selected from IL-6, IL-8, CCL17 and CCL22. In one example, the method comprises detecting the level of IL-6 alone. In one example, the method comprises detecting the level of IL-8 alone. In one example, the method comprises detecting the level of CCL17 alone. In one example, the method comprises detecting the level of CCL22 alone.

[0415] In some examples, the method comprises detecting the level of two or more biomarkers selected from IL-6, IL-8, CCL17 and CCL22. In some examples, the method comprises detecting the level of IL-6 and IL-8. In some examples, the method comprises detecting the level of IL-6 and CCL17. In some examples, the method comprises detecting the level of IL-6 and CCL22. In some examples, the method comprises detecting the level of IL-8 and CCL17. In some examples, the method comprises detecting the level of IL-8 and CCL22. In some examples, the method comprises detecting the level of CCL17 and CCL22.

[0416] In some examples, the method comprises detecting the level of three or more biomarkers selected from IL-6, IL-8, CCL17 and CCL22. In some examples, the method comprises detecting the level of IL-6, IL-8 and CCL17 In some examples, the method comprises detecting the level of IL-6, IL-8 and CCL22. In some examples, the method comprises detecting the level of IL-8, CCL22 and CCL17. In some examples, the method comprises detecting the level of IL-6, CCL22 and CCL17.

[0417] In some examples, the method comprises detecting the level of each of IL-6, IL-8, CCL17 and CCL22.

[0418] In some examples, the methods and kits of the present disclosure comprise detecting the level of one or more cytokines selected from the group consisting of IL-6 and IL-8 and one or more chemokines selected from the group consisting of CCL17 and CCL22. In some examples, the methods and kits of the present disclosure comprise detecting the level of each of IL-6, IL-8, CCL17 and CCL22 in a first biological sample obtained from a subject. In some examples, the methods and kits of the present disclosure do not comprise detecting the percentage of CCR4 expressing cells or level of CCR4.

[0419] In certain examples, the method comprises analysing cells from the subject for the level of one or more biomarkers selected from IL-6, IL-8, CCL17 and CCL22 in the absence of CCR4 detection. In another example, sTNFR2 and / or Fractalkine may also be included in the biomarker panel. Thus, in one example, the biomarker panel comprises or consists of IL-6, IL-8, CCL17, CCL22 and sTNFR2. In one example, the biomarker panel comprises or consists of IL-6, IL-8, CCL17, CCL22 and Fractalkine . In one example, the biomarker panel comprises or consists of IL-6, IL-8, CCL17, CCL22, Fractalkine and STNFR2.

[0420] In some examples, the method comprises detecting the level of each biomarker in a panel of biomarkers as defined herein. In some examples, detecting the level of each biomarker in a panel of biomarkers comprises detecting the protein level of each biomarker in the biomarker panel. In some examples, detecting the level of each biomarker in a panel of biomarkers comprises detecting concentration of each biomarker in a biological sample obtained (or previously obtained) from a subject.

[0421] Methods of detecting the level of one or more biomarkers will be apparent to the skilled person and / or are described herein.

[0422] In an embodiment, the method comprises using a binding agent that binds a marker to determine the level of the marker. As used herein, the term “binds” or “binding” refers to the interaction of a binding agent with an antigen, the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the antigen. For example, a binding agent recognises and binds to a specific protein or nucleotide structure rather than to proteins or nucleic acids generally. If a binding agent binds to epitope “A”, the presence of a molecule containing epitope “A” (or free, unlabelled “A”), in a reaction containing labelled “A” and the binding agent, will reduce the amount of labelled “A” bound to the binding agent. As used herein, the term “specifically binds’’ or “specific for X” shall be taken to mean a binding agent of the disclosure reacts or associates more frequently, more rapidly, with greater duration and / or with greater affinity with a particular antigen or antigens or cell expressing same than it does with alternative antigens or cells. For example, a molecule that specifically binds to an antigen binds that antigen with greater affinity (e.g., 20-fold or 40-fold or 60-fold or 80-fold to 100-fold or 150-fold or200-fold greater affinity), avidity, more readily, and / or with greater duration than it binds to other antigens. It is also understood by reading this definition that, for example, a molecule that specifically binds to a first antigen may or may not specifically bind to a second antigen. Generally, but not necessarily, reference to binding means specific binding, and each term shall be understood to provide explicit support for the other term.

[0423] In an embodiment, the binding agent is selected from: a binding protein, binding polynucleotide and a small molecule. In an embodiment, the binding agent is a binding protein. As used herein, the term “binding protein’’ shall be understood to refer to a protein or part thereof or other region of the protein that is capable of interacting with or specifically binding to an antigen. In an embodiment, the binding protein is an antibody, aptamer, nanobody, heavy-chain immunoglobulin, V-like protein, Adnectin, anticalin, affibody, avimer, or DARPin. In an embodiment, the binding protein is an antibody, for example an antibody as described herein.

[0424] In an embodiment, the binding protein comprises an antigen binding domain. As used herein, the term “antigen binding domain’’ shall be taken to mean a region of an antibody that is capable of specifically binding to an antigen, i.e . , a VH or a VL or an Fv comprising both a VH and a VL. The antigen binding domain need not be in the context of an entire antibody, e.g., it can be in isolation (e.g., a domain antibody) or in another form, e.g., as described herein, such as a scFv. In some embodiments, the binding protein is an antibody or a fragment thereof. As used herein the term “antibody’’ refers to intact monoclonal or polyclonal antibodies, immunoglobulin (IgA, IgD, IgG, IgM, IgE) fractions, humanised antibodies, or recombinant single chain antibodies, nanobodies, as well as fragments thereof, such as, for example Fab, F(ab)2, and Fv fragments.

[0425] For the purposes for the present disclosure, the term “antibody’’ includes a protein capable of specifically binding to one or a few closely related antigens by virtue of an antigen binding domain contained within a Fv. This term includes four chain antibodies (e.g., two light chains and two heavy chains), recombinant or modified antibodies (e.g., chimeric antibodies, humanized antibodies, human antibodies, CDR-grafted antibodies, primatised antibodies, deimmunized antibodies, synhumanised antibodies, half-antibodies, bispecific antibodies). An antibody generally comprises constant domains, which can be arranged into a constant region or constant fragment or fragment crystallizable (Fc). Exemplary forms of antibodies comprise a four-chain structure as their basic unit. Full-length antibodies comprise two heavy chains (~50 to 70 kDa) covalently linked and two light chains (~23 kDa each). A light chain generally comprises a variable region (if present) and a constant domain and in mammals is either a K light chain or a A light chain. A heavy chain generally comprises a variable region and one or two constant domain(s) linked by a hinge region to additional constant domain(s). Heavy chains of mammals are of one of the following types: a, 6, E, y, or p. Each light chain is also covalently linked to one of the heavy chains. For example, the two heavy chains and the heavy and light chains are held together by inter-chain disulfide bonds and by non-covalent interactions. The number of interchain disulfide bonds can vary among different types of antibodies. Each chain has an N-terminal variable region (VH or VL wherein each are ~110 amino acids in length) and one or more constant domains at the C- terminus. The constant domain of the light chain (CL which is ~110 amino acids in length) is aligned with and disulphide-bonded to the first constant domain of the heavy chain (CH1 which is 330 to 440 amino acids in length). The light chain variable region is aligned with the variable region of the heavy chain. The antibody heavy chain can comprise 2 or more additional CH domains (such as, CH2, CH3 and the like) and can comprise a hinge region between the CH1 and CH2 constant domains. Antibodies can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., lgG1 , lgG2, lgG3, lgG4, lgA1 and lgA2) or subclass. In an embodiment, the antibody is a murine (mouse or rat) antibody or a primate (such as, human) antibody. In an embodiment the antibody heavy chain is missing a C-terminal lysine residue. In an embodiment, the antibody is humanized, synhumanized, chimeric, CDR-grafted or deimmunized.

[0426] The terms “full-length antibody’’, “intact antibody’’ or “whole antibody’’ are used interchangeably to refer to an antibody in its substantially intact form, as opposed to an antigen binding fragment of an antibody. Specifically, whole antibodies include those with heavy and light chains including an Fc region. The constant domains may be wild-type sequence constant domains (e.g., human wild-type sequence constant domains) or amino acid sequence variants thereof.

[0427] In one example, the methods described herein comprise contacting a biological sample from a subject with one or more binding agents, wherein each binding agent specifically and independently binds to a biomarker in the panel of biomarkers described herein, for a time and under conditions sufficient for a complex between the binding agent and the biomarker to form and then detecting the complex. In some examples, the binding agent is an antibody. In some examples, the method comprises contacting a biological sample from a subject with a composition that comprises one or more binding agents, wherein each binding agent specifically and independently binds to a biomarker in the panel of biomarkers described herein, for a time and under conditions sufficient for a complex between the binding agent and the protein to form and then detecting the complex. In some examples, the panel of biomarkers comprises two or more biomarkers selected from the group consisting of IL-6, IL-8, CCL17, CCL22, sTNFR2 and Fractalkine. In some examples, the panel of biomarkers comprises three or more biomarkers selected from the group consisting of IL-6, IL-8, CCL17, CCL22, sTNFR2 and Fractalkine. In some examples, the panel of biomarkers comprises IL-6, IL-8, CCL17, CCL22, sTNFR2 and Fractalkine. In some examples, the method comprises contacting a biological sample from a subject with a composition that comprises one or more binding agents, wherein each binding agent specifically and independently binds to a biomarker in a panel of biomarkers.

[0428] In some examples, the composition comprises one or more of an antibody which binds IL-6, an antibody which binds IL-8, an antibody which binds CCL17, an antibody which binds CCL22, an antibody which binds sTNFR2, and an antibody which binds Fractalkine. In some examples, the composition further comprises an antibody which binds Fractalkine. In some examples, the composition further comprises an antibody which binds sTNFR2. In some examples, the composition comprises an antibody which binds IL-6, an antibody which binds IL- 8, an antibody which binds CCL17, an antibody which binds CCL22, an antibody which binds Fractalkine and an antibody which binds sTNFR2. Exemplary antibodies include anti-IL-6 antibody (Biorad, catalog no. 171 BK29MR2), anti-IL-8 antibody (Biorad, catalog no. 171 BK31 MR2), anti-CCL17 antibody (Biorad, catalog no. 171 BK53MR2), anti-CCL22 (Biorad, catalog no. 171 BK41 MR2), anti-sTNFR2 (R&D Systems, catalog no. DY726) and anti- Fractalkine (Biorad, catalog no. 171AK99MR2).

[0429] In one example, the antibody independently and specifically binds one or more biomarkers selected from IL-6, IL-8, CCL17, CCL22, sTNFR2 and Fractalkine.

[0430] Antibodies may be prepared by any of a variety of techniques known to those of ordinary skill in the art, and described, for example in, Harlow 1988 (Harlow, E & Lane, D, (1988) Antibodies: A Laboratory Manual, CSHL Press). In one such technique, an immunogen comprising one or more polypeptides or a fragment thereof is injected into any one of a variety of mammals (e.g., mice, rats, rabbits, sheep, pigs, chickens orgoats). The immunogen is derived from a natural source, produced by recombinant expression means, or artificially generated, such as by chemical synthesis (e.g., BOC chemistry or FMOC chemistry). In this method, one or more of the biomarkers or a fragment thereof may serve as the immunogen without modification. Alternatively, one or more biomarkers or a fragment thereof is joined to a carrier protein, such as, for example bovine serum albumin. In an embodiment, the immunogen comprises IL-6. In an embodiment, the immunogen comprises IL-8. In an embodiment, the immunogen comprises CCL17. In an embodiment, the immunogen comprises CCL22. In an embodiment, the immunogen comprises sTNFR2. In an embodiment, the immunogen comprises Fractalkine. The immunogen and optionally a carrier for the protein is injected into the animal host, preferably according to a predetermined schedule incorporating one or more booster immunisations, and blood collected from the said animals periodically. Optionally, the immunogen is injected in the presence of an adjuvant, such as, for example, Freund’s complete or incomplete adjuvant to enhance the immune response to the immunogen.

[0431] Monoclonal antibodies specific for the antigenic polypeptide of interest may be prepared, for example, using the technique of Kohler et al (Kohler G, Milstein C. Derivation of specific antibody-producing tissue culture and tumor lines by cell fusion. Eur J Immunol. 1976 Jul;6(7):511-9)), and improvements thereto. Briefly, these methods involve the preparation of immortal cell lines capable of producing antibodies having the desired specificity (i.e., reactivity with the polypeptide of interest). Such cell lines may be produced, for example, from spleen cells obtained from an animal immunised as described supra. The spleen cells are immortalised by, for example, fusion with a myeloma cell fusion partner, preferably one that is syngenic with the immunised animal. A variety of fusion techniques may be employed, for example, the spleen cells and myeloma cells may be combined with a non-ionic detergent or electrofused and then grown in a selective medium that supports the growth of hybrid cells, but not myeloma cells. A preferred selection technique uses HAT (hypoxanthine, aminopterin, and thymidine) selection. After a sufficient time, usually about 1 to 2 weeks, colonies of hybrids are observed. Single colonies are selected and growth media in which the cells have been grown is tested for the presence of binding activity against the polypeptide (immunogen). Hybridomas having high reactivity and specificity are preferred.

[0432] Monoclonal antibodies are isolated from the supernatants of growing hybridoma colonies using methods such as, for example, affinity purification as described supra. In addition, various techniques may be employed to enhance the yield, such as injection of the hybridoma cell line into the peritoneal cavity of a suitable vertebrate host, such as a mouse. Monoclonal antibodies are then harvested from the ascites fluid or the blood of such an animal subject. Contaminants are removed from the antibodies by conventional techniques, such as chromatography, gel filtration, precipitation, and / or extraction.

[0433] Alternatively, a monoclonal antibody capable of binding to a form of one or more marker of interest or a fragment thereof is produced using a method such as, for example, a human B- cell hybridoma technique (Kozbor D, and Roder JC. (1983) Immunol Today. 4:72-9), a EBV- hybridoma technique to produce human monoclonal antibodies (Cole, S.P.C., et al (1985) J. Immunol. Meth., 78:271-278), or screening of combinatorial antibody libraries (Huse, W.D., et al., (1989) Science, 246:1275-1281).

[0434] Detection may include methods comprising direct or indirect labelling of a protein or binding of the protein with a binding agent which binds a protein or a fragment thereof forming a protein-binding agent complex. In an embodiment, the binding agent is detectably labelled or capable of binding a detectable label. In an embodiment, the binding agent is linked to an enzyme, enzyme substrate, a fluorescent or fluorescent substrate, chemiluminescent molecule, chemiluminescent substrate, purification tag and / or a solid support. In an embodiment, the binding agent (e.g. antibody) is conjugated to a detectable label. As used herein, the term “conjugate” or “conjugated” shall be understood to encompass both indirect and direct binding. For example, direct conjugation includes chemical conjugation, which can be non-covalent or covalent or genetic conjugation (also referred to as “fusion”). In an embodiment, the conjugation is covalent, e.g., a disulphide bond.

[0435] As used herein, a “detectable label” is a molecular or atomic tag or marker that generates or can be induced to generate an optical or other signal or product that can be detected visually or by using a suitable detector. Detectable labels are well known in the art and include, for example, an enzyme, chromogen-based labels, biotin-based labels, a fluorescent label, a radiolabel, a luminescent label, a bioluminescent label, a magnetic label, a prosthetic group, a contrast agent and an ultrasound agent.

[0436] The skilled person will be aware of suitable chromogen labels, numerous of which are known in the art, including, but not limited to Di-Amino-Benzidine (DAB), Amino-Ethyl-Carbazole (AEC), Bajoran Purple™, Vina Green™, and Fast Red (FR).

[0437] The skilled person will be aware of suitable fluorescent labels, numerous of which are known in the art (see, e.g. Hussaini et al., 2023; Magaki et al., 2019); any suitable fluorescent label known in the art is contemplated by the present application.

[0438] In an embodiment, a detectable label is an enzyme. The enzyme can act on an appropriate substrate to result in production of a detectable dye. Examples of enzymes useful in the disclosure include, without limitation, alkaline phosphatase, horseradish peroxidase and beta-galactosidase. In an embodiment, the enzyme is horseradish peroxidase. In an embodiment, the enzyme is alkaline phosphatase. In an embodiment, the enzyme is betagalactosidase. Alternatively, or in addition, the enzyme can be, for example, luciferase. The enzyme can be linked to the antibody by conventional chemical methods, or it can be expressed together with the antibody as a fusion protein.

[0439] In an embodiment, the antibody is a primary antibody. In some embodiments, the primary antibody is labelled fordirect visualisation. In some embodiments, the primary antibody is labelled with a secondary antibody. In an embodiment, use of a secondary antibody enables signal amplification.

[0440] Radioisotopes useful as detectable labels in the disclosure are well known in the art and can include3H,11C,18F,35S,64Cu,67Ga,68Ga,99mTc,111In,123l,124l,125l, and131l. As used herein, a “binding nucleic acid’’ refers to a nucleic acid, for example a DNA or RNA, or protein nucleic acid (PNA), which binds, for example, another nucleic acid, for example by nucleic acid hybridisation. In an embodiment, the binding nucleic acid is DNA. In an embodiment, the binding nucleic acid is RNA. In an embodiment, the binding nucleic acid is PNA.

[0441] As used herein, a “small molecule’’ refers to a chemical compound or molecule having a molecular weight below 2000 Daltons, preferably below 1500 Daltons, more preferably below 1000 Daltons, still more preferably below 750 daltons, yet more preferably below 500 Daltons. In an embodiment, the small molecule is not a polypeptide.

[0442] It will be apparent to the skilled artisan from the disclosure herein that some binding agents bind to full-length biomarkers (protein), for example full-length or mature IL-6, IL-8, CCL17, CCL22, sTNFR2 and / or Fractalkine, and / or to post-translationally modified forms of, and / orto fragments thereof. Methods for assessing binding to a protein are known in the art, e.g., as described in Scopes, Protein Purification: Principles and Practice 1994, Springer New York, NY. Such a method generally involves immobilising the binding agent and contacting it with labelled antigen. Following washing to remove non-specific bound protein, the amount of label and, as a consequence, bound antigen is detected. Of course, the binding agent can be labelled and the antigen immobilised. Panning-type assays can also be used. Alternatively, or additionally, surface plasmon resonance assays can be used.

[0443] In an embodiment, the method comprises detecting the protein level of each biomarker in a biomarker panel, for example a biomarker panel comprising each of IL-6, IL-8, CCL17 and CCL22, in a biological sample obtained from a subject. In an embodiment, the method comprises detecting the protein level of IL-6, IL-8, CCL17 and CCL22 in a biological sample obtained from a subject. In an embodiment, the method comprises detecting the protein level of IL-6, IL-8, CCL17, CCL22 and Fractalkine in a biological sample obtained from a subject. In an embodiment, the method comprises detecting the protein level of IL-6, IL-8, CCL17, CCL22 and sTNFR2 in a biological sample obtained from a subject. In an embodiment, the method comprises detecting the protein level of IL-6, IL-8, CCL17, CCL22, Fractalkine and sTNFR2 in a biological sample obtained from a subject.

[0444] Methods for detecting the level of biomarkers are known in the art and include, for example, immunohistochemistry, immunofluorescence, an immunoblot, a western blot, a dot blot, an enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay, fluorescence resonance energy transfer (FRET), matrix-assisted laser desorption / ionization time of flight (MALDI-TOF), electrospray ionization (ESI), mass spectrometry (including tandem mass spectrometry, e.g. LC MS / MS), biosensor technology, evanescent fibre-optics technology, bioplex, or protein chip technology. For example, a suitable assay is a semi-quantitative assay and / or a quantitative assay. In an embodiment, the method comprises performing an immunohistochemical assay, in situ hybridisation, flow cytometry, or an enzyme-linked immunosorbent assay, western blot. In an embodiment, the method comprises performing an enzyme-linked immunosorbent assay. In an embodiment, the method comprises performing western blot.

[0445] In an embodiment, the method comprises performing an enzyme-linked immunosorbent assay. Standard solid-phase ELISA or FLISA formats are particularly useful in determining the concentration of a protein from a variety of samples. In one form such an assay involves immobilising a biological sample onto a solid matrix, such as, for example a polystyrene or polycarbonate microwell or dipstick, a membrane, or a glass support (e.g. a glass slide).

[0446] An antibody that specifically binds to a marker as described herein is brought into direct contact with the immobilised biological sample, and forms a direct bond with any of its target protein present in said sample. This antibody is generally labelled with a detectable reporter molecule, such as for example, an enzyme (e.g. horseradish peroxidase (HRP), alkaline phosphatase (AP) or beta-galactosidase) in the case of an ELISA, or alternatively a second labelled antibody can be used that binds to the first antibody; or a fluorescent label (e.g. FITC or Texas Red) or a fluorescent semiconductor nanocrystal (as described in US 6,306,610) in the case of a FLISA Following washing to remove any unbound antibody the label is detected either directly, in the case of a fluorescent label, or through the addition of a substrate, such as for example hydrogen peroxide, TMB, or toluidine, or 5-bromo-4-chloro-3-indol-beta-D- galaotopyranoside (x-gal) in the case of an enzymatic label.

[0447] In an embodiment, the method comprises performing an enzyme-linked immunosorbent assay. Standard solid-phase ELISA or FLISA formats are particularly useful in determining the concentration of a protein from a variety of samples. In one form such an assay involves immobilising a biological sample onto a solid matrix, such as, for example a polystyrene or polycarbonate microwell or dipstick, a membrane, or a glass support (e.g. a glass slide).

[0448] An antibody that specifically binds to a marker as described herein is brought into direct contact with the immobilised biological sample, and forms a direct bond with any of its target protein present in said sample. This antibody is generally labelled with a detectable reporter molecule, such as for example, an enzyme (e.g. horseradish peroxidase (HRP), alkaline phosphatase (AP) or beta-galactosidase) in the case of an ELISA, or alternatively a second labelled antibody can be used that binds to the first antibody; or a fluorescent label (e.g. FITC or Texas Red) or a fluorescent semiconductor nanocrystal (as described in US 6,306,610) in the case of a FLISA Following washing to remove any unbound antibody the label is detected either directly, in the case of a fluorescent label, or through the addition of a substrate, such as for example hydrogen peroxide, TMB, or toluidine, or 5-bromo-4-chloro-3-indol-beta-D- galaotopyranoside (x-gal) in the case of an enzymatic label. Such ELISA or FLISA based systems are suitable for quantification of the amount of a protein in a sample, by calibrating the detection system against known amounts of a protein standard to which the antibody binds, such as for example, an isolated and / or recombinant one or more of the markers as described herein or immunogenic fragment thereof or epitope thereof.

[0449] In another example, an ELISA comprises immobilising an antibody or ligand that specifically binds a marker as described herein on a solid matrix, such as, for example, a membrane, a polystyrene or polycarbonate microwell, a polystyrene or polycarbonate dipstick or a glass support. A sample is then brought into physical relation with said antibody, and said marker within the sample is bound or ‘captured’. The bound protein is then detected using a labelled antibody. Alternatively, a third labelled antibody can be used that binds the second (detecting) antibody.

[0450] It will be apparent to the skilled person that the assay formats described herein are amenable to high throughput formats, such as, for example automation of screening processes or a microarray format. Furthermore, variations of the above-described assay will be apparent to those skilled in the art, such as, for example, a competitive ELISA.

[0451] In another example, western blotting is used to determine the level of a marker as described herein in a sample. In such an assay protein from a sample is separated using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) using techniques known in the art and described in, for example, Scopes, Protein Purification: Principles and Practice 1994, Springer New York, NY. Separated proteins are then transferred to a solid support, such as, for example, a membrane (e.g., a PVDF membrane), using methods known in the art, for example, electrotransfer. This membrane is then blocked and probed with a labelled antibody or ligand that specifically binds to a marker within v polypeptide. Alternatively, a labelled secondary, or even tertiary, binding agent such as an antibody is used to detect the binding of a specific primary antibody. The level of label is then determined using an assay appropriate for the label used.

[0452] An appropriate assay will be apparent to the skilled artisan and include, for example, densitometry. In an embodiment, the intensity of a protein band or spot is normalised against the total amount of protein loaded on a SDS-PAGE gel using methods known in the art. Alternatively, the level of the marker detected is normalised against the level of a control / reference protein. Such control proteins are known in the art, and include, for example, actin, glyceraldehyde 3- phosphate dehydrogenase (GAPDH), (32 microglobulin, hydroxy-methylbilane synthase, hypoxanthine phosphoribosyl-transferase 1 (HPRT), ribosomal protein L13c, succinate dehydrogenase complex subunit A and TATA box binding protein (TBP).

[0453] In some examples, the biomarker as described herein is detected using a radioimmunoassay (RIA). The basic principle of the assay is the use of a radiolabelled antibody or antigen to detect antibody-antigen interactions. A binding agent that specifically binds to a marker as described herein is bound to a solid support and a sample brought into direct contact with said antibody. To detect the level of bound antigen, an isolated and / or recombinant form of the antigen is radiolabelled and brought into contact with the same antibody. Following washing, the level of bound radioactivity is detected. As any antigen in the biological sample inhibits binding of the radiolabelled antigen the level of radioactivity detected is inversely proportional to the level of antigen in the sample. Such an assay may be quantitated by using a standard curve using increasing known concentrations of the isolated antigen.

[0454] As will be apparent to the skilled person, such an assay may be modified to use any reporter molecule, such as, for example, an enzyme or a fluorescent molecule, in place of a radioactive label.

[0455] In some examples, the level of a biomarker in a sample is determined using a biosensor or optical immunosensor system. In general, an optical biosensor is a device that uses optical principles to quantitatively convert the binding of a ligand or antibody to a target polypeptide into electrical signals. These systems can be grouped into four major categories: reflection techniques; surface plasmon resonance; fibre optic techniques and integrated optic devices. Reflection techniques include ellipsometry, multiple integral reflection spectroscopy, and fluorescent capillary fill devices. Fibre-optic techniques include evanescent field fluorescence, optical fibre capillary tube, and fibre optic fluorescence sensors. Integrated optic devices include planer evanescent field fluorescence, input grading coupler immunosensor, Mach-Zehnder interferometer, Hartman interferometer and difference interferometer sensors.

[0456] In some examples, the level of a biomarker in a sample is determined using an immunoassay, such as a multiplex immunoassay. In some examples, the immunoassay is based on Luminex bead-based xMAP technology, for example as described in WO2010 / 054385. In some examples, the level of a biomarker in a sample is determined using a commercially available kit that is capable of detecting one or more of the biomarkers described herein, for example, the Bio-Plex Pro Human Chemokine Assay kit, Bio-Plex Pro Human Chemokine MDC I CCL22 Set, Bio-Plex Pro Human Chemokine TARC / CCL17 Set, Bio-Plex Pro Human Chemokine IL-6 Set, Bio-Plex Pro Human Chemokine IL-8 / CXCL8 Set, Bio-Plex Pro Human Chemokine Fractalkine I CX3CL1 Set and / or the Bio-Plex Pro Human Inflammation Panel 1 STNF-R2, all available from BIO-RAD.

[0457] Prognosis of response to PARP inhibitors (cytokines and chemokines optionally in combination with CCR4)

[0458] As discussed herein, the chemokines and cytokine biomarkers described herein, optionally in combination with CCR4, can be used to prognose whether a subject will response to treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic agent. In particular, the inventors have found that the levels of one or more biomarkers selected from IL- 6, IL-8, CCL22 and CCL17 in combination with the level of CCR4 expressed on cells is useful in prognosing response to treatment with a PARP inhibitor. As established in the Examples below, the level, abundance or expression of CCR4 (for example, after in vitro exposure of a cell population to mafosphamide) in combination with the level, abundance or concentration of one or more biomarkers selected from IL-6, IL-8, CCL17 and CCL22 can be used to predict whether a subject is likely to respond to cancer therapy. In some examples, the biomarker is IL-6. In some examples, the biomarker is IL-8. In some examples, the biomarker is CCL17. In some examples, the biomarker is CCL22. In some examples, the biomarkers are selected from two or more of IL- 6, IL-8, CCL17 and CCL22. In some examples, the biomarkers are selected from three or more of IL-6, IL-8, CCL17 and CCL22. In some examples, the biomarkers are IL-6, IL-8, CCL17 and CCL22.

[0459] In some examples, the method comprises determining a prognostic value for the subject based on the level of one or more biomarkers as described herein, optionally in combination with the level of CCR4. Therefore, in some examples there is provided a method for determining a prognostic value used in assessing a likelihood of a subject with cancer responding to cancer therapy (e.g. treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic), the method comprising, consisting or consisting essentially of: (1) determining a biomarker value for one or more biomarkers in first biological sample obtained from the subject, wherein the one or more biomarkers are selected from the group consisting of IL-6, IL-8, CCL17 and CCL22; (2) determining a biomarker value for CCR4 in a second biological sample obtained from the subject; and (3) determining the prognostic value using the biomarker values obtained in (1) and (2), wherein the prognostic value is at least partially indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor alone or in combination with an immunotherapeutic. In some examples, step (1) comprises or consists of determining a biomarker value for one or more biomarkers in a sample from the subject, wherein the one or more biomarkers are selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, step (1) comprises or consists of determining a biomarker value for two or more biomarkers in a sample from the subject, wherein the two or more biomarkers are selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, step (1) comprises determining a biomarker value for three or more biomarkers in a sample from the subject, wherein the three or more biomarkers are selected from the group consisting of IL-6, IL-8, CCL17 and CCL22. In some examples, step (1) comprises determining a biomarker value for each of IL-6, IL-8, CCL17 and CCL22. In some examples, step (1) consists of determining a biomarker value for each of IL-6, IL-8, CCL17 and CCL22.

[0460] In some examples, the method comprises: (i) measuring in a first biological sample obtained from the subject, a level of one or more biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 to derive a biomarker value for each cytokine and chemokine;

[0461] (ii) measuring in a second biological sample obtained from the subject a level of CCR4 biomarker expression on cells in the sample following stimulation of the cells in the sample with mafosphamide or an analogue, derivative or active metabolite thereof to derive a biomarker value for CCR4 expression;

[0462] (iii) inputting the cytokine and chemokine biomarker value(s) obtained in (i) and the CCR4 biomarker value obtained in (ii) into a formula whereby the summed biomarker values of the one or more cytokine(s) are subtracted from the summed biomarker value(s) of the one or more chemokines to generate a cytokine-chemokine (C-C) value which is then added to the CCR4 biomarker value obtained in step (i) to derive a prognostic value which is indicative of whether the subject will respond to a PARP inhibitor.

[0463] The inventors have also found that the levels of IL-6, IL-8, CCL22 and CCL17 are useful in prognosing response to treatment with a PARP inhibitor, particularly when the combination of the biomarker values for IL-6 and IL-8 are subtracted from the combination of biomarker values for CCL17 and CCL22. As established in the Examples below, when combined in this way, the level, abundance or concentration of IL-6, IL-8, CCL17 and CCL22 can be used to predict whether a subject is likely to respond to cancer therapy.

[0464] In some examples, there is provided a method for determining a prognostic value used in assessing a likelihood of a subject with cancer responding to cancer therapy (e.g. treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic), the method comprising, consisting or consisting essentially of: (1) determining a biomarker value for each of IL-6, IL-8, CCL17 and CCL22 in a first biological sample obtained from a subject; and (2) determining the prognostic value using the biomarker values obtained in (1), wherein the prognostic value is at least partially indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor alone or in combination with an immunotherapeutic.

[0465] In some examples, the method comprises:

[0466] (i) measuring in a first biological sample obtained from the subject, a level of one or more biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 to derive a biomarker value for each cytokine and chemokine;

[0467] (ii) inputting the cytokine and chemokine biomarker value(s) obtained in (i) into a formula whereby the summed biomarker values of the one or more cytokine(s) are subtracted from the summed biomarker value(s) of the one or more chemokines to derive a prognostic value which is indicative of whether the subject will respond to a PARP inhibitor. The term "prognostic value" (also referred to as ‘‘indicator’’) as used herein refers to a result or representation of a result, including any information, number, ratio, signal, sign, mark, or note by which a skilled artisan can estimate and / or determine a likelihood of whether or not a subject suffering from a cancer will respond to a cancer therapy. The "prognostic value" may optionally be used together with other clinical characteristics to arrive at a determination that the subject is or is not likely to respond to cancer therapy. That such an prognostic value is "determined" is not meant to imply that the prognostic value is 100% accurate. The skilled clinician may use the prognostic value together with other clinical indicia to arrive at a conclusion.

[0468] The term "biomarker value" refers to a value measured or derived for at least one corresponding biomarker of a subject and which is typically at least partially indicative of an abundance or concentration of a biomarker in a sample taken from the subject. Thus, the biomarker values could be measured biomarker values, which are values of biomarkers measured forthe subject (e.g. level of the biomarker), or alternatively could be derived biomarker values, which are values that have been derived from one or more measured biomarker values, for example by applying a function to the one or more measured biomarker values. As used herein, biomarkers to which a function has been applied are referred to as "derived biomarkers’’. "Biomarker values can be of any appropriate form depending on the manner in which the values are determined. For example, the biomarker values could be determined using high-throughput technologies such as sequencing platforms, array and hybridization platforms, mass spectrometry, immunoassays, immunofluorescence, flow cytometry, or any combination of such technologies. In one example, the biomarker values relate to a level of abundance or activity of an protein or other measurable molecule, quantified using a technique such as flow cytometry, ELISA, BioPlex and the like. In some examples, the protein is located on the surface of a cell or organelle. In some examples, the protein is in solution. In other examples, the biomarker values are quantified using immunofluorescence of cells containing the protein or having the protein on their surface.

[0469] The biomarker values may be determined in any one of a number of ways that are well known in the art and / or as described herein. For example, a comprehensive description of biomarker value determination can be found in Inti. Pat. Pub. No. WO 2015 / 117204, which is incorporated herein by reference in its entirety. In one example, the process of determining biomarker values can include measuring the biomarker values, for example by performing tests on the subject or on sample(s) obtained from the subject.

[0470] More typically, however, the step of determining the biomarker values includes having an electronic processing device receive or otherwise obtain biomarker values that have been previously measured or derived. This could include for example, retrieving the biomarker values from a data store such as a remote database, obtaining biomarker values that have been manually input, using an input device, or the like. Suitably, the prognostic value may be determined using a combination of a plurality of biomarker values, the prognostic value being at least partially indicative of responsiveness to cancer therapy. Assuming the method is performed using an electronic processing device, an indication of the prognostic value is optionally displayed or otherwise provided to the user.

[0471] In some embodiments, biomarker values are combined, for example by adding, multiplying, subtracting, or dividing biomarker values to determine an prognostic value. This step is performed so that multiple biomarker values can be combined into a single prognostic value, providing a more useful and straightforward mechanism for allowing the prognostic value to be interpreted and hence used in determining the likelihood of a subject responding to cancer therapy.

[0472] It will be understood that in this context, the biomarkers used within the above-described method can define a biomarker profile for cancer therapy responsiveness, which includes a minimal number of biomarkers (e.g., in one example, CCR4 and at least one biomarker selected from IL-6, IL-8, CCL17 and CCL22; in another example, the combination of IL-6, IL-8, CCL17 and CCL22), whilst maintaining sufficient performance to allow the biomarker profile to be used in making a clinically relevant determination. Minimizing the number of biomarkers used minimizes the costs associated with performing diagnostic or prognostic tests and in the case of polypeptide biomarkers, allows the test to be performed utilizing relatively straightforward techniques, and allowing the test to be performed rapidly in a clinical environment. In this regard, the indication provided by the methods described herein could be a graphical or alphanumeric representation of an prognostic value. Alternatively, however, the indication could be the result of a comparison of the prognostic value to predefined thresholds or ranges, or alternatively could be an indication of the likely responsiveness of a subject to cancer therapy.

[0473] Furthermore, producing a single prognostic value allows the results ofthe test to be easily interpreted by a clinician or other medical practitioner, so that test can be used for reliable diagnosis in a clinical environment.

[0474] Solely by way of an illustration, the prognostic value-determining methods suitably include determining at a biomarker value, wherein the biomarker value is a value measured or derived for at least one cancertherapy biomarker ofthe subject and is at least partially indicative of a concentration or abundance of the biomarker in a sample taken from the subject. In the methods described herein, the biomarker values and / or the derived biomarker values are then used to determine the indicator for use in determining the likelihood of a subject responding to cancer therapy, either by using the derived biomarker value as an prognostic value , or by performing additional processing, such as by applying an algorithm to determine the prognostic value. In some examples, the biomarker values or derived biomarker values could be combined using an algorithm such as an additive model; a linear model; a support vector machine; a neural network model; a random forest model; a regression model; a genetic algorithm; an annealing algorithm; a weighted sum; a nearest neighbour model; and a probabilistic model. In some examples, the biomarker values or derived biomarker values could be combined using multiple regression analysis. In some embodiments, the prognostic value is compared to an prognostic value reference, with a likelihood of responsiveness to cancer therapy being determined in accordance with results ofthe comparison. The reference may be derived from prognostic values determined for a number of individuals in a reference population. The reference population typically includes individuals having different characteristics, such as a plurality of individuals of different sexes; and / or ethnicities, with different groups being defined based on different characteristics, with the subject's indicator being compared to references derived from individuals with similar characteristics. The reference population can include a plurality of individuals known to be responsive to cancer therapy (including completely responsive and / or partially responsive), and in particular therapy using a PARP inhibitor; or a plurality of individuals known to be non- responsive to cancer therapy, and in particular therapy using a PARP inhibitor.

[0475] The prognostic value (also referred to as a quantitative score) may be determined using any suitable technique known to the person skilled in the art. In some examples, the prognostic value is determined by the application of a specific algorithm. The algorithm used to calculate the quantitative score in the methods disclosed herein may group the expression level values of a biomarker or groups of biomarkers. The formation of a particular group of biomarkers, in addition, can facilitate the mathematical weighting of the contribution of various expression levels of biomarker or biomarker subsets (e.g. classifier) to the quantitative score. In some examples, IL- 6 and IL-8 form a group or biomarkers, CCL22 and CCL17 form a group of biomarkers and CCR4 forms a group of biomarkers.

[0476] In some examples, the prognostic value is determined using the following algorithm: wherein prognostic value represents the probability that a person will respond to treatment with a cancer therapy. CCCR4 is the level of CCR4 expressed on a cell population obtained from a subject after in vitro exposure of the cell population to mafosphamide as described herein. Typically CCCR4 refers to the % of CCR4 positive cells in a cell population. Each CBM is the concentration of the indicated biomarker in the plasma (or serum) of the subject being tested. In some examples, the log of the concentration is used, for example, for the biomarker concentrations. Typically the concentration is included in pg / mL, however any suitable unit of measurement may be used. Each beta (J3BM) is a coefficient applying to that biomarker in the concentration units in which it is measured. / 3o is an “offset” or “intercept”. Each beta ( / 3BM) may be a positive or negative value or even zero. In some examples, each beta ( / 3BM) may be a positive or negative value.

[0477] In some examples, the biomarkers may be grouped together. In some examples, IL-6 and IL-8 form a group or biomarkers and CCL22 and CCL17 form a group of biomarkers. In some examples, the indicator is determined using the following algorithm:

[0478] Prognostic value = / ?0+ PCCRICCCRI wherein prognostic value represents the probability that a person will respond to treatment with a cancer therapy. Each beta ( / 3BM) is a coefficient applying to that biomarker combination (i.e. IL- 6 and IL-8 or CCL17 and CCL22) in the concentration units in which it is measured.

[0479] In some examples, the prognostic value is determined using the following algorithm:

[0480] Prognostic value = / ?0+ / tIL-6CIL-6+ PIL-8CIL-8+ PccLnCccLi? + PCCLU^CCLII wherein prognostic value represents the probability that a person will respond to treatment with a cancer therapy. Each CBM, beta ( / 3BM) and / 3o is as defined above. Each beta ( / 3BM) may be a positive or negative value or even zero. In some examples, each beta ( / 3BM) may be a positive or negative value. In some examples, each beta ( / 3BM) may adjust the biomarkers to the same scale. For example, typical concentrations of CCL22 and CCL17 average in sera range from 50-1000 pg / ml while IL6 and IL8 concentrations range from 1 to about 20 pg / mL (means and medians are about 3-5 pg / ml). The present inventors found that by adjusting the biomarkers to the same scale (e.g. by multiplication by a constant, division by a constant and / or use of log) the biomarker values could be combined to be informative of prognosis.

[0481] In some examples, the biomarkers may be grouped together. In some examples, IL-6 and IL-8 form a group or biomarkers and CCL22 and CCL17 form a group of biomarkers. In some examples, the indicator is determined using the following algorithm: wherein prognostic value represents the probability that a person will respond to treatment with a cancer therapy. Each beta ( / 3 / L and / or / 3CCL) is a coefficient applying to that biomarker combination (i.e. IL-6 and IL-8 or CCL17 and CCL22) in the concentration units in which it is measured. In some examples, beta (J3IL and / or / 3CCL) adjusts the cytokines and / or chemokines to the same scale.

[0482] As would be appreciated by the person skilled in the art there are other ways in which a combination of biomarker concentrations may be modelled to predict the probability of responding to a PARP inhibitor.

[0483] The algorithms described herein can be used to derive prognostic values of response to treatment with a cancer therapy. In some examples, a quantitative score is derived which may indicate an increased likelihood of responding to treatment with a PARP inhibitor or reduced. The score may then inform treatment management.

[0484] In some embodiments, the methods of the present disclosure may be performed using at least one electronic processing device, such as a suitably programmed computer system or the like. In this case, the electronic processing device typically obtains the measured biomarker values, either by receiving this from a measuring or other quantifying device, or by retrieving these from a database or the like. The processing device then determines the prognostic values by any suitable means, for example, by calculating the prognostic values using the algorithms as described herein. In one aspect, the present invention encompasses an apparatus comprising such electronic processing device(s).

[0485] The processing device can then generate a representation of the prognostic values, for example by generating a sign or alphanumeric indication of the prognostic values, a graphical indication of a comparison of the prognostic values to one or more references or an alphanumeric indication of the likely responsiveness of the subject to the cancer therapy.

[0486] The methods of the present disclosure typically include obtaining one or more samples from a subject who has been diagnosed with cancer, wherein the sample includes a cell population (e.g. as described herein) and / or one or more biomarkers (e.g. as described herein) and quantifying or otherwise assessing CCR4 and / or at least one of the biomarkers within the sample to determine biomarker values. This can be achieved using any suitable technique, and will depend on the nature of the biomarker, as described above. Suitably, an individual measured biomarker value corresponds to the level, abundance or concentration of a cancer therapy biomarker or to a function that is applied to that level or amount.

[0487] As used herein, the “prognostic value’’ is a way of stratifying subjects, for example subjects in a population, wherein a higher prognostic valuereflects a higher risk of responding to treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic. In an embodiment, a low prognostic value indicates reduced risk of responding to treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic. In an embodiment, a high prognostic value indicates an increased risk of survival following treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic. In an embodiment, a low prognostic value indicates a reduced risk of with a PARP inhibitor, alone or in combination with an immunotherapeutic.

[0488] In an embodiment, a high prognostic value indicates increased survival and / or reduced risk of recurrence following treatment with a with a PARP inhibitor, alone or in combination with an immunotherapeutic. For example, a low prognostic value indicates that a subject is at higher risk of reduced survival when treated with a PARP inhibitor, alone or in combination with an immunotherapeutic. For example, a high prognostic value indicates that a subject has decreased risk of progression. For example, a low prognostic value indicates that a subject has increased risk of recurrence.

[0489] In some examples, the prognostic value may be compared to a threshold value. In some examples, a prognostic value higher than the threshold is an indicator of response. In some examples, a prognostic value lower than the threshold is an indicator of response. Methods for selecting the threshold value are known to the person skilled in the art and include, but are not limited to, analysis of ROC plot or analysis of the mean and / or median value for a subject population. Exemplary threshold or “cut-off’ values include, the mean or median prognostic value as determined from a population of subjects; expression levels selected from the ROC curve that represent the highest value of sensitivity plus specificity. Persons skilled in the art will appreciate that other methods for selecting appropriate threshold expression values can be used to practice the methods disclosed herein. Persons skilled in the art will appreciate that the threshold levels may vary depending on the cell population being analysed.

[0490] In an embodiment, the prognostic value is calculated using one, two, three or four biomarkers, in combination with CCR4. For example, using one, two or three or four biomarkers selected from IL-6, IL-8, CCL17 and CCL22, in combination with CCR4. For example, using two, three or four biomarkers selected from IL-6, IL-8, CCL17 and CCL22, in combination with CCR4. For example, using three or four biomarkers selected from IL-6, IL-8, CCL17 and CCL22, in combination with CCR4. For example, using each of IL-6, IL-8, CCL17 and CCL22, in combination with CCR4. In some examples, the biomarker value for one or more of IL-6, IL-8, CCL17 and CCL22 is determined by detecting the level of one or more of IL-6, IL-8, CCL17 and CCL22 in a sample from the subject (e.g. a serum sample). In some examples, the biomarker value for one or more of IL-6, IL-8, CCL17 and CCL22 is the concentration of the biomarker in the sample.

[0491] In an embodiment, the prognostic value is calculated using a biomarker value for IL-6, IL-8, CCL17 and CCL22 (for example, without using a biomarker value for CCR4).

[0492] In some examples, the biomarker value for CCR4 is determined by comparing the level of expression of CCR4 on a cell population after in vitro exposure to mafosphamide to a reference value. Typically, the reference value is the level of expression of CCR4 on a cell population before or without in vitro exposure to mafosphamide, however the level of expression of CCR4 on a cell population may also be compared to a control level. In some examples, the control level may be derived from an established data set including one or more of:

[0493] 1. a data set comprising measurements of CCR4 fora population of subjects known to have a gynaecological cancer (e.g. ovarian cancer);

[0494] 2. a data set comprising measurements of CCR4 for the subject being tested wherein said measurements have been made previously, such as, for example, when the subject was known to be healthy or, in the case of a subject having cancer, when the subject was diagnosed or at an earlier stage in disease progression; and / or

[0495] 3. a data set comprising measurements of CCR4 for a healthy individual or a population of healthy individuals.

[0496] In preferred examples, the biomarker value forCCR4 is determined by calculating the percentage of CCR4 expressing cells in a cell population after in vitro exposure to mafosphamide.

[0497] In some examples, the first biological sample and the second biological sample are the same sample from the same subject. In some examples, the first biological sample and the second biological sample are a different sample from the same subject. In one example, the first biological sample comprises serum or plasma and the second biological sample comprises PMBCs (e.g. lymphocytes). Preferably, the cytokines and chemokines are measured in the serum or plasma of a biological sample obtained from the subject. In one example, the concentration of cytokines and chemokines are measured in the serum or plasma. In a further example, the cytokine and chemokine concentrations are adjusted so that they are on the same scale.

[0498] In one example, the one or more cytokine(s) comprise IL-6 or IL-8. In one example, the one or more cytokine(s) consist of IL-6 and IL-8.

[0499] In one example, the one or more chemokine(s) comprise CCL17 or CCL22. In one example, the one or more chemokine(s) consist of CCL17 and CCL22.

[0500] In some examples according to step (i), the concentration value for each cytokine (i.e. IL- 6 and / or IL-8) is measured and theirvalues added together. Similarly, the concentration value for each chemokine (i.e. CCL22 and / or CCL17) is measured and their values are added together. The summed cytokine concentration value is then subtracted from the summed chemokine value after relevant adjustments are made to convert the chemokine and cytokine values to the same scale.

[0501] In some examples, the concentration values obtained in step (i) and optionally the level of CCR4 obtained in step (ii) may be inputted into a formula to derive a prognostic value. Preferably, the prognostic value is a value that equates to better survival of the subject. Prognosis of response to PARP inhibitors (cytokines and chemokines optionally in combination with methylation of an upstream CCR4 sequence)

[0502] As discussed herein, the biomarker panel described herein, optionally in combination with the methylation level of a CpG site in a target sequence upstream of the CCR4 promoter, can be used to prognose whether a subject will response to treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic agent and / or chemotherapeutic.

[0503] In some examples, the method comprises determining an prognostic value forthe subject based on the level of the biomarkers in a biomarker panel as described herein, optionally in combination with the methylation level of upstreamCCR4. Therefore, in some examples there is provided a method for determining a prognostic value used in assessing a likelihood of a subject with cancer responding to cancer therapy (e.g. treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic), the method comprising, consisting or consisting essentially of: (1) determining a biomarker value for each biomarker in a biomarker panel in a biological sample obtained from the subject, wherein the biomarker panel is as described herein; (2) optionally determining a methylation level for upstreamCCR4 in a biological sample obtained from the subject; and (3) determining the prognostic value using the biomarker values obtained in (1) and optionally (2), wherein the prognostic value is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor alone or in combination with an immunotherapeutic and / or chemotherapeutic.

[0504] In some examples, the method comprises (2) determining a methylation level for upstreamCCR4 in a biological sample obtained from the subject; and (3) determining the prognostic value using the biomarker values obtained in (1) and (2), wherein the prognostic value is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor alone or in combination with an immunotherapeutic and / or chemotherapeutic.

[0505] In some examples, the method comprises:

[0506] (i) measuring in a biological sample obtained from the subject, a level of each biomarker in a biomarker panel to derive a biomarker value for each biomarker; wherein the biomarker panel defined herein;

[0507] (ii) optionally measuring in a biological sample obtained from the subject a methylation level of a CpG site located within a target sequence upstream of the CCR4 promoter to derive a biomarker value for upstreamCCR4;

[0508] (Hi) inputting the biomarker value(s) obtained in (i) and optionally the upstreamCCR4 biomarker value obtained in (ii) into a formula whereby the biomarker values of IL-6, IL-8 and sTNFR2 (if used) and Fractalkine (if used) are subtracted from the biomarker value(s) of CCL22, CCL17 and optionally upstreamCCR4, to derive a prognostic value which is indicative of whether the subject will respond to cancer therapy as defined herein. As would be appreciated by the person skilled in the art, the above method may also be performed by subtracting the biomarker value(s) for CCL22, CCL17 and optionally upstreamCCR4 from the biomarker values for IL-6, IL-8, sTNFR2 (if used) and Fractalkine (if used).

[0509] In some examples, the biomarker panel comprises or consists of IL-6, IL-8, CCL17 and CCL22.

[0510] In some examples, the biomarker panel comprises or consists of:

[0511] (i) IL-6, IL-8, CCL17, CCL22 and Fractalkine;

[0512] (ii) IL-6, IL-8, CCL17, CCL22 and STNFR2; or

[0513] (Hi) IL-6, IL-8, CCL17, CCL22, STNFR2 and Fractalkine.

[0514] In some examples, the biomarker panel comprises or consists of;

[0515] (i) IL-6, IL-8, CCL17, CCL22 and Fractalkine;

[0516] (ii) IL-6, IL-8, CCL17, CCL22 and STNFR2;

[0517] (Hi) IL-6, IL-8, CCL17, CCL22, STNFR2 and Fractalkine;

[0518] (iv) upstreamCCR4, IL-6, IL-8, CCL17, CCL22 and Fractalkine;

[0519] (v) upstreamCCR4, IL-6, IL-8, CCL17, CCL22 and STNFR2;

[0520] (vi) upstreamCCR4, IL-6, IL-8, CCL17, CCL22, STNFR2 and Fractalkine; or

[0521] (vii) IL-6, IL-8, CCL17, CCL22 and upstreamCCR4.

[0522] In some examples, the biomarker panel comprises or consists of;

[0523] (i) IL-6, IL-8, CCL17, CCL22 and Fractalkine;

[0524] (ii) IL-6, IL-8, CCL17, CCL22 and STNFR2;

[0525] (Hi) IL-6, IL-8, CCL17, CCL22, STNFR2 and Fractalkine;

[0526] (iv) upstreamCCR4, IL-6, IL-8, CCL17, CCL22 and Fractalkine;

[0527] (v) upstreamCCR4, IL-6, IL-8, CCL17, CCL22 and STNFR2; or

[0528] (vi) upstreamCCR4, IL-6, IL-8, CCL17, CCL22, STNFR2 and Fractalkine.

[0529] In some examples, the biomarker panel comprises or consists of;

[0530] (i) upstreamCCR4, IL-6, IL-8, CCL17, CCL22 and Fractalkine;

[0531] (ii) upstreamCCR4, IL-6, IL-8, CCL17, CCL22 and STNFR2; or

[0532] (Hi) upstreamCCR4, IL-6, IL-8, CCL17, CCL22, STNFR2 and Fractalkine.

[0533] In some examples, the biomarker panel comprises or consists of;

[0534] (i) upstreamCCR4, IL-6, IL-8, CCL17, CCL22, STNFR2 and Fractalkine.

[0535] The inventors have also found that a biomarker panel comprising IL-6, IL-8, CCL22 and CCL17 is useful in prognosing response to treatment with a PARP inhibitor (optionally in combination with an immunotherapeutic and / or a chemotherapeutic), particularly when the combination of the biomarker values for IL-6 and IL-8 (the cytokines) are subtracted from the combination of biomarker values for CCL17 and CCL22 (the chemokines). As established in the Examples below, when combined in this way, the level, abundance or concentration of IL-6, IL- 8, CCL17 and CCL22 can be used to predict whether a subject is likely to respond to cancer therapy, particularly where the cancer therapy comprises a chemotherapeutic (e.g. cyclophosphamide), a PARP Inhibitor (e.g. Olaparib) and an immunotherapeutic (e.g. Durvalumab).

[0536] In some examples, there is provided a method for determining a prognostic value used in assessing a likelihood of a subject with cancer responding to cancer therapy (e.g. treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic), the method comprising, consisting or consisting essentially of: (1) determining a biomarker value for each IL-6, IL-8, CCL17 and CCL22 in a biological sample obtained from a subject; and (2) determining the prognostic value using the biomarker values obtained in (1), wherein the prognostic value is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor alone or in combination with an immunotherapeutic and / or chemotherapeutic.

[0537] In some examples, the method comprises:

[0538] (i) measuring in a biological sample obtained from the subject, a level of each of IL-6, IL-8, CCL17 and CCL22 to derive a biomarker value for each cytokine and chemokine;

[0539] (ii) inputting the cytokine and chemokine biomarker value(s) obtained in (i) into a formula whereby the summed biomarker values of the one or more cytokine(s) are subtracted from the summed biomarker value(s) of the one or more chemokines to derive a prognostic value which is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor alone or in combination with an immunotherapeutic and / or chemotherapeutic.

[0540] The inventors have also found that a biomarker panel comprising sTNFR2, Fractalkine or upstreamCCR4 is useful in prognosing response to treatment with a PARP inhibitor (optionally in combination with an immunotherapeutic and / or a chemotherapeutic). In some examples, the biomarker panel comprises or consists of sTNFR2. In some examples, the biomarker panel comprises or consists of Fractalkine. In some examples, the biomarker panel comprises or consists of upstreamCCR4. As established in the Examples below, each of these biomarkers can be used to predict whether a subject is likely to respond to cancer therapy, particularly where the cancer therapy comprises a chemotherapeutic (e.g. cyclophosphamide), a PARP Inhibitor (e.g. Olaparib) and an immunotherapeutic (e.g. Durvalumab).

[0541] In some examples, there is provided a method for determining a prognostic value used in assessing a likelihood of a subject with cancer responding to cancer therapy (e.g. treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic), the method comprising, consisting or consisting essentially of: (1) determining a biomarker value forsTNFR2, Fractalkine or upstreamCCR4 in a biological sample obtained from a subject; and (2) determining the prognostic value using the biomarker value obtained in (1), wherein the prognostic value is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor alone or in combination with an immunotherapeutic and / or chemotherapeutic.

[0542] In some examples, the method comprises:

[0543] (i) measuring in a biological sample obtained from the subject, a level of one of sTNFR2, Fractalkine or upstreamCCR4 to derive a biomarker value the biomarker;

[0544] (ii) comparing the biomarker value obtained in (i) to a threshold value, where a biomarker value that is higher than the threshold value is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor alone or in combination with an immunotherapeutic and / or chemotherapeutic. In some examples, the threshold value is a mean or median of a subject population (e.g. mean or mean of the biomarker value the SOLACE2 trial participants). In some examples, the threshold value is a mean of a subject population. In preferred examples, the cancer therapy comprises therapy with a PARP inhibitor in combination with a immunotherapeutic and a chemotherapeutic (e.g. Olaparib in combination with a PF-LI inhibitor, such as Durvalumab, and cyclophosphamide).

[0545] The inventors have also found that a biomarker panel comprising CCL17 and CCL22 and one or more of Fractalkine, sTNFR2, optionally in combination with upstreamCCR4, is useful in prognosing response to treatment with a PARP inhibitor (optionally in combination with an immunotherapeutic and / or a chemotherapeutic). In some examples, the biomarkers comprise or consist of:

[0546] (i) Fractalkine, STNFR2, CCL22 and CCL17;

[0547] (ii) upstreamCCR4, STNFR2, CCL22 and CCL17;

[0548] (iii) Fractalkine, upstreamCCR4, CCL22 and CCL17; or

[0549] (iv) upstreamCCR4; Fractalkine, STNFR2, CCL22 and CCL17;

[0550] For the avoidance of doubt, “upstreamCCR4” refers to the level of methylation at a CpG site located within a target sequence upstream of the CCR4 promoter. As established in the Examples below, each of these biomarker panels can be used to predict whether a subject is likely to respond to cancer therapy, particularly where the cancer therapy comprises a chemotherapeutic (e.g. cyclophosphamide), a PARP Inhibitor (e.g. Olaparib) and an immunotherapeutic (e.g. Durvalumab).

[0551] In some examples, there is provided a method for determining a prognostic value used in assessing a likelihood of a subject with cancer responding to cancer therapy (e.g. treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic), the method comprising, consisting or consisting essentially of: (1) determining a biomarker value forCCL17 and CCL22 and one or both of Fractalkine and sTNFR2 in a biological sample obtained from a subject; (2) optionally determining a methylation level for upstreamCCR4 in a biological sample obtained from the subject; and (3) determining the prognostic value using the biomarker values obtained in (1) and optionally (2), wherein the prognostic value is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor alone or in combination with an immunotherapeutic and / or chemotherapeutic.

[0552] In some examples, the method comprises:

[0553] (i) measuring in a biological sample obtained from the subject, a level of each biomarker in a biomarker panel to derive a biomarker value for each biomarker; wherein the biomarker panel comprises:

[0554] (a) CCL17, CCL22 and Fractalkine;

[0555] (b) CCL17, CCL22 and STNFR2; or

[0556] (c) CCL17, CCL22, STNFR2 and Fractalkine;

[0557] (ii) measuring in a biological sample obtained from the subject a methylation level of a CpG site located within a target sequence upstream of the CCR4 promoter to derive a biomarker value for upstreamCCR4;

[0558] (Hi) inputting the biomarker value(s) obtained in (i) and the upstreamCCR4 biomarker value obtained in (ii) into a formula whereby the biomarker values of sTNFR2 (if used) and Fractalkine (if used) are subtracted from the biomarker value(s) of CCL22, CCL17 and upstreamCCR4 to derive a prognostic value which is indicative of whether the subject will respond to cancer therapy as defined herein. As would be appreciated by the person skilled in the art, the above method may also be performed by subtracting the biomarker value(s) of CCL22, CCL17, sTNFR2 (if used) and Fractalkine (if used) and adding the biomarker values for upstreamCCR4. In preferred examples, the cancer therapy comprises therapy with a PARP inhibitor in combination with a immunotherapeutic and a chemotherapeutic (e.g. Olaparib in combination with a PF-LI inhibitor, such as Durvalumab, and cyclophosphamide).

[0559] The inventors have also found that a biomarker panel comprising IL-8 and IL-6 and one or more of Fractalkine, sTNFR2, optionally in combination with upstreamCCR4, is useful in prognosing response to treatment with a PARP inhibitor (optionally in combination with an immunotherapeutic and / or a chemotherapeutic). In some examples, the biomarkers comprise or consist of:

[0560] (i) Fractalkine, STNFR2, IL-6 and IL-8;

[0561] (ii) upstreamCCR4, STNFR2, IL-6 and IL-8;

[0562] (Hi) Fractalkine, upstreamCCR4, IL-6 and IL-8; or (iv) upstreamCCR4; Fractalkine, STNFR2, IL-6 and IL-8;

[0563] As established in the Examples below, each of these biomarker panels can be used to predict whether a subject is likely to respond to cancer therapy, particularly where the cancer therapy comprises a chemotherapeutic (e.g. cyclophosphamide), a PARP Inhibitor (e.g. Olaparib) and an immunotherapeutic (e.g. Durvalumab).

[0564] In some examples, there is provided a method for determining a prognostic value used in assessing a likelihood of a subject with cancer responding to cancer therapy (e.g. treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic), the method comprising, consisting or consisting essentially of: (1) determining a biomarker value for IL-6 and IL-8 and one or both of Fractalkine and sTNFR2 in a biological sample obtained from a subject; (2) optionally determining a methylation level for upstreamCCR4 in a biological sample obtained from the subject; and (3) determining the prognostic value using the biomarker values obtained in (1) and optionally (2), wherein the prognostic value is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor alone or in combination with an immunotherapeutic and / or chemotherapeutic.

[0565] In some examples, the method comprises:

[0566] (i) measuring in a biological sample obtained from the subject, a level of each biomarker in a biomarker panel to derive a biomarker value for each biomarker; wherein the biomarker panel comprises:

[0567] (a) IL-6, IL-8 and Fractalkine;

[0568] (b) IL-6, IL-8 and STNFR2; or

[0569] (c) IL-6, IL-8, STNFR2 and Fractalkine;

[0570] (ii) measuring in a biological sample obtained from the subject a methylation level of a CpG site located within a target sequence upstream of the CCR4 promoter to derive a biomarker value for upstreamCCR4;

[0571] (iii) inputting the biomarker value(s) obtained in (i) and the upstreamCCR4 biomarker value obtained in (ii) into a formula whereby the biomarker values of IL-6, IL-8, sTNFR2 (if used) and Fractalkine (if used) are subtracted from the biomarker value(s) of upstreamCCR4 to derive a prognostic value which is indicative of whether the subject will respond to cancer therapy as defined herein. As would be appreciated by the person skilled in the art, the above method may also be performed by subtracting the biomarker value(s) of IL-6, IL-8, sTNFR2 (if used) and Fractalkine (if used) and adding the biomarker values for upstreamCCR4. In preferred examples, the cancer therapy comprises therapy with a PARP inhibitor in combination with a immunotherapeutic and a chemotherapeutic (e.g. Olaparib in combination with a PF-LI inhibitor, such as Durvalumab, and cyclophosphamide). In examples of the methods described herein, the prognostic value is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor (e.g. Olaparib). In some examples, the prognostic value is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor in combination with a immunotherapeutic (e.g. Olaparib in combination with a PF-LI inhibitor, such as Durvalumab). In some examples, the prognostic value is indicative of the likelihood of responsiveness to cancer therapy; wherein the cancer therapy comprises therapy with a PARP inhibitor in combination with a immunotherapeutic and a chemotherapeutic (e.g. Olaparib in combination with a PF-LI inhibitor, such as Durvalumab, and cyclophosphamide).

[0572] The term "prognostic value" (also referred to as ‘‘indicator’’) as used herein refers to a result or representation of a result, including any information, number, ratio, signal, sign, mark, or note by which a skilled artisan can estimate and / or determine a likelihood of whether or not a subject suffering from a cancer will respond to a cancer therapy. The "prognostic value" may optionally be used together with other clinical characteristics to arrive at a determination that the subject is or is not likely to respond to cancer therapy. That such an prognostic value is "determined" is not meant to imply that the prognostic value is 100% accurate or determinative. The skilled clinician may use the prognostic value together with other clinical indicia to arrive at a conclusion.

[0573] The term "biomarker value" refers to a value measured or derived for at least one corresponding biomarker of a subject and which is typically indicative of an abundance or concentration of a biomarker in a sample taken from the subject. Thus, the biomarker values could be measured biomarker values, which are values of biomarkers measured for the subject (e.g. level ofthe biomarker), or alternatively could be derived biomarker values, which are values that have been derived from one or more measured biomarker values, for example by applying a function to the one or more measured biomarker values. As used herein, biomarkers to which a function has been applied are referred to as "derived biomarkers’’. "Biomarker values can be of any appropriate form depending on the manner in which the values are determined. For example, the biomarker values could be determined using high-throughput technologies such as sequencing platforms, array and hybridization platforms, mass spectrometry, immunoassays, immunofluorescence, flow cytometry, or any combination of such technologies. In one example, the biomarker values relate to a level of abundance or activity of an protein or other measurable molecule, quantified using a technique such as flow cytometry, ELISA, BioPlex and the like. In some examples, the protein is located on the surface of a cell or organelle. In some examples, the protein is in solution. In other examples, the biomarker values are quantified using immunofluorescence of cells containing the protein or having the protein on their surface. The biomarker values may be determined in any one of a number of ways that are well known in the art and / or as described herein. For example, a comprehensive description of biomarker value determination can be found in Inti. Pat. Pub. No. WO 2015 / 117204, which is incorporated herein by reference in its entirety. In one example, the process of determining biomarker values can include measuring the biomarker values, for example by performing tests on the subject or on sample(s) obtained from the subject.

[0574] More typically, however, the step of determining the biomarker values includes having an electronic processing device receive or otherwise obtain biomarker values that have been previously measured or derived. This could include for example, retrieving the biomarker values from a data store such as a remote database, obtaining biomarker values that have been manually input, using an input device, or the like. Suitably, the prognostic value may be determined using a combination of a plurality of biomarker values, the prognostic value being indicative of responsiveness to cancer therapy. Assuming the method is performed using an electronic processing device, an indication of the prognostic value is optionally displayed or otherwise provided to the user.

[0575] In some embodiments, biomarker values are combined, for example by adding, multiplying, subtracting, or dividing biomarker values to determine an prognostic value. This step is performed so that multiple biomarker values can be combined into a single prognostic value, providing a more useful and straightforward mechanism for allowing the prognostic value to be interpreted and hence used in determining the likelihood of a subject responding to cancer therapy.

[0576] It will be understood that in this context, the biomarkers used within the above-described method can define a biomarker profile for cancer therapy responsiveness, which includes a minimal number of biomarkers, whilst maintaining sufficient performance to allow the biomarker profile to be used in making a clinically relevant determination. Minimizing the number of biomarkers used minimizes the costs associated with performing diagnostic or prognostic tests and in the case of polypeptide biomarkers, allows the test to be performed utilizing relatively straightforward techniques, and allowing the test to be performed rapidly in a clinical environment. In this regard, the indication provided by the methods described herein could be a graphical or alphanumeric representation of an prognostic value. Alternatively, however, the indication could be the result of a comparison of the prognostic value to predefined thresholds or ranges, or alternatively could be an indication of the likely responsiveness of a subject to cancer therapy.

[0577] Furthermore, producing a single prognostic value allows the results ofthe test to be easily interpreted by a clinician or other medical practitioner, so that test can be used for reliable diagnosis in a clinical environment. Solely by way of an illustration, the prognostic value-determining methods suitably include determining at a biomarker value, wherein the biomarker value is a value measured or derived for at least one cancer therapy biomarker of the subject and is indicative of a concentration or abundance of the biomarker in a sample taken from the subject. In the methods described herein, the biomarker values and / or the derived biomarker values are then used to determine the indicator for use in determining the likelihood of a subject responding to cancer therapy, either by using the derived biomarker value as an prognostic value, or by performing additional processing, such as by applying an algorithm to determine the prognostic value.

[0578] In some examples, the biomarker values or derived biomarker values could be combined using an algorithm such as an additive model; a linear model; a support vector machine; a neural network model; a random forest model; a regression model; a genetic algorithm; an annealing algorithm; a weighted sum; a nearest neighbour model; and a probabilistic model. In some examples, the biomarker values or derived biomarker values could be combined using multiple regression analysis. In some embodiments, the prognostic value is compared to an prognostic value reference, with a likelihood of responsiveness to cancer therapy being determined in accordance with results of the comparison. The reference may be derived from prognostic values determined for a number of individuals in a reference population. The reference population typically includes individuals having different characteristics, such as a plurality of individuals of different sexes; and / or ethnicities, with different groups being defined based on different characteristics, with the subject's indicator being compared to references derived from individuals with similar characteristics. The reference population can include a plurality of individuals known to be responsive to cancer therapy (including completely responsive and / or partially responsive), and in particular therapy using a PARP inhibitor; or a plurality of individuals known to be non- responsive to cancer therapy, and in particular therapy using a PARP inhibitor.

[0579] The prognostic value (also referred to as a quantitative score) may be determined using any suitable technique known to the person skilled in the art. In some examples, the prognostic value is determined by the application of a specific algorithm. The algorithm used to calculate the quantitative score in the methods disclosed herein may group the expression level values of a biomarker or groups of biomarkers. The formation of a particular group of biomarkers, in addition, can facilitate the mathematical weighting of the contribution of various expression levels of biomarker or biomarker subsets (e.g. classifier) to the quantitative score. In some examples, IL- 6 and IL-8 form a group or biomarkers, CCL22 and CCL17 form a group of biomarkers.

[0580] In some examples, the prognostic value is determined using the following algorithm:

[0581] Prognostic value — / 30+ PBMI^BMI + PBM2 ^BM2 + •• • + PBMTI^BMTI wherein prognostic value represents the probability that a person will respond to treatment with a cancer therapy. CBMX is the level of biomarker (e.g. concentration or %methylation). Typically for protein biomarkers, each CBMX is the concentration of the indicated biomarker in the plasma (or serum) of the subject being tested. Typically for upstreamCCR4, CBM is the percentage methylation of the CpG site in the target sequence upstream of the CCR4 promoter. In some examples, the log of the concentration is used, for example, for the biomarker concentrations or percentage methylation. Typically the concentration is included in pg / mL, however any suitable unit of measurement may be used. Each beta ( / 3BM) is a coefficient applying to that biomarker in the concentration units in which it is measured. / 3o is an “offset” or “intercept”. Each beta ( / 3BM) may be a positive or negative value or even zero. In some examples, each beta ( / 3BM) may be a positive or negative value. / 3o is an “offset” or “intercept”.

[0582] In some examples, the biomarkers may be grouped together. For example, the concentration value for each cytokine (i.e. IL-6 and / or IL-8) may be measured and their values added together before a beta coefficient is applied to the summed value. Similarly, the concentration value for each chemokine (i.e. CCL22 and / or CCL17) may be measured and their values are added together before a beta coefficient is applied to the summed value. The summed values may be included in the algorithm as a single value. In some examples, the summed cytokine concentration value is then subtracted from the summed chemokine value after relevant adjustments are made to convert the chemokine and cytokine values to the same scale. In some examples, IL-6 and IL-8 form a group or biomarkers and CCL22 and CCL17 form a group of biomarkers.

[0583] In some examples, the prognostic value is determined using the following algorithm: wherein prognostic value represents the probability that a person will respond to treatment with a cancer therapy. Each beta ( / 3BM) is a coefficient applying to that biomarker combination (i.e. IL- 6 and IL-8 or CCL17 and CCL22) in the concentration units in which it is measured.

[0584] In some examples, the prognostic value is determined using the following algorithm:

[0585] Prognostic value

[0586] In some examples, the prognostic value is determined using the following algorithm: Prognostic value

[0587] In other words, the biomarker values for IL-6, IL-8, Fractalkine and sTNFR2 are subtracted from the biomarker values for upstreamCCR4, CCL7 and CCL22. As the person skilled in the art would understand, the opposite sign may also apply (where the biomarker values for upstreamCCR4, CCL7 and CCL22 are subtracted from the biomarker values for IL-6, IL-8, Fractalkine and STNFR2).

[0588] In some examples, the prognostic value is determined using the following algorithm: wherein prognostic value represents the probability that a person will respond to treatment with a cancer therapy. Each CBM, beta ( / 3BM) and / 3o is as defined above. Each beta ( / 3BM) may be a positive or negative value or even zero. In some examples, each beta ( / 3BM) may be a positive or negative value. In some examples, each beta ( / 3BM) may adjust the biomarkers to the same scale. For example, typical concentrations of CCL22 and CCL17 average in sera range from 50-1000 pg / ml while IL6 and IL8 concentrations range from 1 to about 20 pg / mL (means and medians are about 3-5 pg / ml). The present inventors found that by adjusting the biomarkers to the same scale (e.g. by multiplication by a constant, division by a constant and / or use of log) the biomarker values could be combined to be informative of prognosis.

[0589] In some examples, the prognostic value is determined using the following algorithm:

[0590] Prognostic value = / ?0— / tIL-6CIL-6— PIL-8CIL-8+ PccLn^ccLn + PCCL22^CCL22

[0591] In some examples, the biomarkers may be grouped together. In some examples, IL-6 and IL-8 form a group or biomarkers and CCL22 and CCL17 form a group of biomarkers. In some examples, the indicator is determined using the following algorithm:

[0592] Prognostic value = / ?0+ PCCL(CCCLW + (■CCL22) P1L(C1L-6 + ClL-s) wherein prognostic value represents the probability that a person will respond to treatment with a cancer therapy. Each beta ( / 3 / L and / or / 3CCB) is a coefficient applying to that biomarker combination (i.e. IL-6 and IL-8 or CCL17 and CCL22) in the concentration units in which it is measured. In some examples, beta (J3IL and / or / 3CCL) adjusts the cytokines and / or chemokines to the same scale.

[0593] As would be appreciated by the person skilled in the art there are other ways in which a combination of biomarker concentrations may be modelled to predict the probability of responding to a PARP inhibitor.

[0594] The algorithms described herein can be used to derive prognostic values of response to treatment with cancer therapy. In some examples, a quantitative score is derived which may indicate an increased likelihood of responding to treatment with a PARP inhibitor or reduced. The score may then inform treatment management.

[0595] In some embodiments, the methods of the present disclosure may be performed using at least one electronic processing device, such as a suitably programmed computer system or the like. In this case, the electronic processing device typically obtains the measured biomarker values, either by receiving this from a measuring or other quantifying device, or by retrieving these from a database or the like. The processing device then determines the prognostic values by any suitable means, for example, by calculating the prognostic values using the algorithms as described herein. In one aspect, the present invention encompasses an apparatus comprising such electronic processing device(s).

[0596] The processing device can then generate a representation of the prognostic values, for example by generating a sign or alphanumeric indication of the prognostic values, a graphical indication of a comparison of the prognostic values to one or more references or an alphanumeric indication of the likely responsiveness of the subject to the cancer therapy.

[0597] The methods of the present disclosure typically include obtaining one or more samples from a subject who has been diagnosed with cancer, wherein the sample includes circulating DNA (e.g. circulating, cell free DNA) and / or one or more biomarkers (e.g. as described herein) and quantifying or otherwise assessing upstreamCCR4 and / or at least one of the biomarkers within the sample to determine biomarker values. This can be achieved using any suitable technique, and will depend on the nature of the biomarker, as described above. Suitably, an individual measured biomarker value corresponds to the level, abundance or concentration of a cancer therapy biomarker or to a function that is applied to that level or amount.

[0598] As used herein, the “prognostic value’’ is a way of stratifying subjects, for example subjects in a population, wherein a higher prognostic value reflects a higher likelihood of responding to treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic. In an embodiment, a low prognostic value indicates reduced likelihood of responding to treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic. In an embodiment, a high prognostic value indicates an increased likelihood of survival following treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic. In an embodiment, a low prognostic value indicates a reduced likelihood of response to treatment with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic.

[0599] In an embodiment, a high prognostic value indicates increased survival and / or reduced risk of recurrence following treatment with a with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic. For example, a low prognostic value indicates that a subject is at higher risk of reduced survival when treated with a PARP inhibitor, alone or in combination with an immunotherapeutic and / or chemotherapeutic. For example, a high prognostic value indicates that a subject has decreased risk of progression. For example, a low prognostic value indicates that a subject has increased risk of recurrence.

[0600] In some examples, the prognostic value may be compared to a threshold value. In some examples, a prognostic value higher than the threshold is an indicator of response. In some examples, a prognostic value lower than the threshold is an indicator of response. Methods for selecting the threshold value are known to the person skilled in the art and include, but are not limited to, analysis of ROC plot or analysis of the mean and / or median value for a subject population. In some examples, the subject population is a population having cancer, such as ovarian cancer. For example, the subject population may comprise the trial participants in a clinical trial (e.g. the SOLACE2 clinical trial herein). In some examples, the subject population is a healthy population. Exemplary threshold or “cut-off’ values include, the mean or median prognostic value as determined from a population of subjects; expression levels selected from the ROC curve that represent the highest value of sensitivity plus specificity. Persons skilled in the art will appreciate that other methods for selecting appropriate threshold expression values can be used to practice the methods disclosed herein. Persons skilled in the art will appreciate that the threshold levels may vary depending on the cell population being analysed.

[0601] In one example, the one or more cytokine(s) comprise IL-6 or IL-8. In one example, the one or more cytokine(s) consist of IL-6 and IL-8.

[0602] In one example, the one or more chemokine(s) comprise CCL17 or CCL22. In one example, the one or more chemokine(s) consist of CCL17 and CCL22.

[0603] In some examples, the concentration values obtained in step (i) and optionally the level of updtreamCCR4 may be inputted into a formula to derive a prognostic value. Preferably, the prognostic value is a value that equates to better survival of the subject.

[0604] As demonstrated by the Examples, the inventors have found that biomarker panels comprising:

[0605] (i) IL-6, IL-8, CCL17, CCL22, and Fractalkine;

[0606] (II) IL-6, IL-8, CCL17, CCL22, and STNFR2; and

[0607] (Hi) IL-6, IL-8, CCL17, CCL22, STNFR2 and Fractalkine; are particularly useful in prognosing response to treatment with (A) a PARP inhibitor and a PD- Ll antibody, (B) cyclophosphamide, a PARP inhibitor and a PD-LI antibody or (C) a PARP inhibitor. The inventors have found that performance of the method is further improved (for example, across all Arms of the trial) when the methylation level of a CpG site located in a target sequence upstream of the CCR4 promoter is included in the analysis.

[0608] The methods and kits of the present disclosure comprise detecting the level one or more biomarkers as described herein in one or more biological samples obtained from a subject, preferably a cancer subject. A biological sample may be derived from a subject directly or may be a biological sample, including those derived from the tissue or organ, which has been cultured or proceed in some way. By "obtained" is meant to come into possession. Samples so obtained include, for example, nucleic acid extracts or polypeptide extracts isolated or derived from a particular source. For instance, the extract may be isolated directly from a biological fluid ortissue of a subject.

[0609] As used herein, the term ‘‘biological sample’’ or ‘‘sample’’ refers to any type of suitable material obtained from the subject. Biological sample typically encompasses a clinical sample, for example a tissue biopsy, tissue samples, preserved tissue samples, for example paraffin- embedded tissues), biological fluids, for example blood (whole blood and blood fractions), ascites (whole ascites and ascites fractions), live cells, cells in culture, cell supernatants, and cell lysates derived therefrom. In some examples, the biological sample selected from the group consisting of, but not limited to bone marrow, spleen, lymph nodes, Peyer’s patches, mucosal associated lymphoid tissue, gut-associated lymphoid tissue, or blood. In some examples, the biological sample comprises whole blood or fractionated blood. In some examples, the biological sample comprises fractionated blood, for example plasma or serum. In some examples, the biological sample comprises serum.

[0610] In some examples, the biological sample comprises peripheral blood mononuclear cells (PMBCs). In one example, the analysis is performed on a biological sample comprising lymphocytes. In one example, the analysis is performed on a biological sample comprising CD3+ cells. In one example, the analysis is performed on a biological sample comprising T cells. In one example, the analysis is performed on a biological sample comprising Teff cells. In one example, the analysis is performed on a biological sample comprising CD8+ and / or CD4+CD25- cells. In one example, the analysis is performed on a biological sample comprising CD8+ and CD4+CD25- cells. In one example, the analysis is performed on a biological sample comprising CD8+ cells. In one example, the analysis is performed on a biological sample comprising CD4+CD25- cells. The sample can be used as obtained directly from the source or following at least one- processing steps, for example a purification step. It will be apparent to the skilled person that the sample can be prepared in any medium which does not interfere with the method of the disclosure. For example, between 1 and 20, 1 and 10, 10 and 20, or 1 and 5 processing steps may be made. Typically, the sample comprises blood or a blood fraction. A sample may be preserved, for example in a solid (e.g. paraffin embedded; snap frozen), aqueous (e.g. formalin fixed), a combination of these (e.g. formalin fixed and paraffin embedded), or in a biological fluid. The skilled person will be aware of selection and any necessary preparatory steps.

[0611] As will be apparent to the skilled person, the type and size of the biological sample will depend upon the detection means used. For example, protein-based assays require sufficient cells or sample to provide sufficient protein for an antigen-based assay. For example, nucleic acid-based assays require sufficient cells or sample to provide sufficient nucleic acid for an nucleic acid-based assay.

[0612] Biological samples may be obtained from a subject by a variety of techniques including, for example, by venepuncture, by scraping or swabbing an area or by using a needle to aspirate body fluids or tissues. Methods for collecting various biological samples are well known in the art.

[0613] In some examples, the biological sample has been derived previously from the subject. Accordingly, in an embodiment, a method as described herein according to any embodiment additionally comprises providing the biological sample. Additionally, a method as described herein according to any embodiment additionally comprises obtaining or previously obtaining the biological sample.

[0614] In some embodiments, methods of the present disclosure involve extracting or isolating protein fractions from the biological sample. In some embodiments, methods of the present disclosure involve determining the amount of protein or protein fractions in the biological sample. For example, the amount of one or more markers described herein, preferably one or more of IL- 6, IL-8, CCL17, CCL22, Fractalkine and STNFR2.

[0615] In some examples, the biological sample for detecting the level of a panel of biomarkers is referred to as a first biological sample. In some examples, the methods comprise a second biological sample. The first and second biological sample may be the same or different sources or comprises the same or different cells.

[0616] The biological sample is any sample obtained from the subject in which the biomarkers may be present. In some examples, the biological sample is whole blood or blood fractions. In some examples, the biological sample is plasma or serum. In some examples, the biological sample is serum. In some examples, the biological sample is plasma. Serum and plasma may be isolated from whole blood using techniques known to the person skilled in the art. Serum is the liquid fraction of whole blood that is collected after the blood is allowed to clot. In some examples, the clot may be removed by centrifugation and the resulting supernatant (referred to as serum) separated, for example, by using a Pasteur pipette. Plasma is produced by treating whole blood with an anticoagulant (e.g. by collecting whole blood into anticoagulant-treated tubes e.g., EDTA-treated (lavender tops) or citrate-treated (light blue tops) tubes). The cells are then separated by centrifugation and the supernatant (plasma) is removed from the cell pellet, for example, using a Pasteur pipette.

[0617] Detecting CCR4 in a biological sample

[0618] The methods of the present disclosure may comprise detecting and / or measuring expression of CCR4 on cells obtained from a subject. In some examples, the biological sample for detecting and / or measuring expression of CCR4 on cells is referred to as the second biological sample. The biological sample for determining CCR4 expression is any sample obtained from the subject in which lymphocytes, T cells and / or Teff cells (for example CD4+ or CD8+ T cells) are present. Accordingly, in some examples, the biological sample comprises cells. In some example, the cells comprise cells from a whole blood sample. In some examples, the cells are purified. As used herein, “purified” refers to cells that have been at least partially separated from other cell types with which they are normally associated in their naturally occurring state. Typically, the selected cell type is purified when it is at least 50% or 60%, by number, of total cells present. For example, the selected cell type is at least 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91 %, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, by number, of total cells present. The purity of the cells can be checked by flow cytometry and other suitable techniques.

[0619] In some examples, the biological sample is blood. In some examples, the blood is purified to remove red blood cells and neutrophils (for example, by osmotic lysis or positive selection using diverse technologies e.g. separation by Ficoll density gradient, dynabeads, macbeads, or negative selection using diverse technologies e.g. columns) to obtain peripheral blood mononuclear cells (PBMC) or T cells.

[0620] In some examples, the cells comprise PBMCs. PBMCs can include lymphocytes (T cells, B cells, and NK cells), monocytes, and dendritic cells. PBMCs can be isolated from a whole blood sample using any technique known to the person skilled in the art. For example, PBMCs can be isolated via Ficoll density gradient centrifugation, cell preparation tubes (such as the BD Vacutainer® CPT) or SepMate tubes. In some examples, the methods of the present disclosure comprise detecting and / or measuring expression of CCR4 on lymphocytes afterthe lymphocytes have been exposed in vitro to mafosphamide, or an analogue, derivative or active metabolite thereof. In some examples, the PBMCs are cultured with mafosphamide, or an analogue, derivative or active metabolite thereof as described herein before optionally being further purified for analysis. For example, the PBMCs are cultured with mafosphamide, or an analogue, derivative or active metabolite thereof as described herein before being further separated into lymphocytes, T cells or effector T cells and the like. In some examples, the cells are washed after culturing with mafosphamide, or an analogue, derivative or active metabolite thereof and then analysed using (e.g. using flow cytometry) without further purification. In some examples, the cells are further purified using a second Ficoll density gradient step before analysis to remove debri and dead cells.

[0621] In some examples, the cells comprise lymphocytes. Therefore, in some examples, the methods of the present disclosure comprise detecting the level of CCR4 on lymphocytes. In some examples, the methods of the present disclosure comprise detecting and / or measuring expression of CCR4 on lymphocytes after the lymphocytes have been exposed in vitro to mafosphamide, or an analogue, derivative or active metabolite thereof. Lymphocytes are classified into various types depending on differences in the expression and / or function of marker molecules. Lymphocytes can be isolated from a whole blood sample using any technique known to the person skilled in the art. For example, via one or more steps of density gradient centrifugation. The methods of the present disclosure are applicable not only to purified lymphocytes but also to a mixture of plural types of lymphocytes, a cell population containing lymphocytes and other cells, and the like. In some examples, the methods of the present disclosure use a cell population containing lymphocytes and other cells. In some examples, the methods described herein comprise detecting and / or measuring expression of CCR4 on lymphocytes by using flow cytometry to select for lymphocytes based on their side scatter and forward scatter characteristics.

[0622] The three major types of lymphocytes are T cells, B cells and natural killer cells (NK cells). Most mature T cells present in the periphery express either CD4 or CD8 as cell surface marker molecules. T cells expressing CD4 function as helper T cells which induce the functional expression of other T cells or induce differentiation and maturation, and antibody production of B cells. On the other hand, CD8-positive T cells function as cytotoxic T cells which destroy virus- infected cells and the like. In addition, there are NKT cells which have the properties of both NK cells and T cells, and regulatory T cells (also referred to as Treg) which express the CD25 molecule and suppress the activity of other T cells. In recent years, it has been known that there are peripheral T cells that differentiate and mature without going through the thymus gland.

[0623] In B cells, the type of antibody to be produced by each cell is fixed. Each B cell activates and initiates the antibody production only when a pathogen suitable for the antibody type of the B cell appears. In addition, NK cells are a type of cytotoxic lymphocytes that act as a major factor of innate immunity, and are particularly important for the rejection of tumor cells and virus-infected cells.

[0624] The lymphocytes used in the methods described herein may be any lymphocytes as described above. In some examples, the cells are T cells, for example CD3+ T cells. In some examples, the cells are CD4 or CD8-expressing T-cells, for example Effector T cells.

[0625] In some examples, the cells comprise T cells. Therefore, in some examples, the methods of the present disclosure comprise detecting the level of CCR4 on T cells. In some examples, the methods of the present disclosure comprise detecting and / or measuring expression of CCR4 on T cells after the T cells have been exposed in vitro to mafosphamide, or an analogue, derivative or active metabolite thereof.

[0626] In some examples, the T cells are CD3+ T cells.

[0627] The T cells used in the methods described herein may be any T cells as described above. In some examples, the T cells are CD3+ T cells. In some examples, the T cells are CD4 + or CD8+ T cells. In some examples, the T cells are CD4+CD25- and / or CD8+ T cells, for example Effector T cells. In some examples, the T cells are CD4+CD25- T cells.

[0628] The methods of the present disclosure are applicable not only to purified T cells but also to a mixture of plural types of T cells, a cell population containing T cells and other cells, and the like.

[0629] In some examples, the cells comprise T cells. Therefore, in some examples, the methods of the present disclosure comprise detecting and / or measuring expression of CCR4 on effector T cells. In some examples, the methods of the present disclosure comprise detecting and / or measuring expression of CCR4 on T cells after the T cells have been exposed in vitro to mafosphamide, or an analogue, derivative or active metabolite thereof.

[0630] The term “effector T cells’’ refers to T cells that have been activated in response to a stimulus. This class of T cells includes T helper cells and cytotoxic (killer) T cells.

[0631] Cytotoxic (killer) T cells are involved in the destruction of infected and transformed cells and therefore help protect the host from virus infections and cancer. Cytotoxic (killer) T cells have also been implicated in transplant rejection. These cells express the CD8 glycoprotein on their cell surface and are sometimes referred to as CD8+ T cells. Other cell surface markers found on Cytotoxic (killer) T cells include CD3 and ap TCR. They are also positive for EOMES, T-bet and BLIMP1 transcription factors.

[0632] T helper cells (TH) are promote and assist in immune response, in particular they have been described to help the activity of other T cells by releasing T cell cytokines. T helper cells include TH1 , TH2, TH22, TH17, TH9 and TFH. These cells express the surface protein CD4 and are sometimes referred to as CD4+ T cells. Other cell surface markers include CD3 and ap TCR. Additional markers expressed on TH cells include IL-12R, IFNyR, CXCR3, IL-17RB, CCR2, CCR5 and IL-1 R. Accordingly, the Teff cells may also include one of more of these markers.

[0633] In one example, the Teff cells are T helper and / or cytotoxic T cells. In a further example, the Teff cells are CD4+ and CD8+ T cells. In yet a further example, the Teff cells are CD4+CD25- T cells. In still yet a further example, the Teff cells are FoxP3-CD25-CD4+ (Tconventional or Tconv) and CD8+ T cells. In still yet a further example, the Teff cells are CD8+ T cells. In one example, the CD8+ cells are also CD69+. In one example, the Teff cells are also CD3+ T cells.

[0634] In some examples, the methods described herein further comprise detecting the level of CCR4 expression on Regulatory T cells. Regulatory T cells are formerly known as suppressor T cells and refer to a subpopulation of T cells which modulate the immune system, maintain tolerance to self-antigens and prevent auto-immune disease. Their function is to suppress or downregulate induction and proliferation of effector T cells (Bettelli E et al. (2006) Nature 441 (7090):235-238.

[0635] Regulatory T cells are characterised by expression of CD4, CD25 and CD127. Regulatory T cells may also express CD3+FoxP3+CD25+CD4+. Regulatory T cells in human are characterised by a high level of expression of CD25.

[0636] In some examples, the cells are selected based on expression of particular cell-surface markers. In some examples, the cells are selected based on cell-surface markers associated with T cells. In some examples, the cells are selected based on cell-surface expression of CD3 (i.e. CD3+ cells). In other examples, cells are selected based on expression of markers associated with T effector (Teff) cells orwith T regulatory (Treg) cells. In one example, the cells are CD4+ or CD8+ cells. In some examples, the cells are CD25-CD4+ cells. In some examples, the cells are CD8+ cells. In some examples, the cells are CD8+ and CD25-CD4+ cells. In some examples, the cells are CD3+FoxP3-CD25-CD4+ cells. In other examples, the cells are CD3+CD8+ cells. In another example, the cells are CD69+ CD8+. In another example, the cells are CCR4+ CD8+ T cells or CCR4+ CD4+ T cells.

[0637] Cells can be selected based on cell surface expression using any technique known to the person skilled in the art. These techniques can be based on both positive and negative detection. In positive detection techniques the desired cells are labelled with antibodies and quantified. Suitable techniques for selecting cells based on cell surface expression of antigens include, but are not limited to, flow cytometry, immunoadsorption techniques, RosetteSep Whole Blood Based Cell Isolation and the like. In immunoadsorption techniques, cells are selected with monoclonal antibodies and preferentially bound to a surface which can be removed from the remainder of the cells e.g. column of beads, flasks, magnetic particles. Example immunoadsorption techniques include, but are not limited to, Magnetic Antibody Based Cell Isolation such as Life Technologies Dynabeads® and Stemcell Technologies EasySep™, RoboSep™ and StemSep™.

[0638] The cells can be freshly obtained cells or cells that have been stored or cryopreserved. The cells can be cultured in suitable media before or after purification, for example in AIM-V media (Life Technologies, USA) with 5% normal human serum (HS, Sigma-Aldrich, USA) (complete AIM-V media).

[0639] Detecting methylated upstreamCCR4 in a biological sample

[0640] The methods of the present disclosure may comprise detecting the methylation level of a CpG site in a target sequence upstream of the CCR4 promoter in a biological sample obtained from a subject. In some examples, the biological sample for detecting the methylation level is referred to as the second biological sample. However, the same biological sample may be used for detecting the level of both the panel of biomarkers and the methylation level. The biological sample is any sample obtained from the subject in which circulating DNA (e.g. circulating, cell free DNA) may be present. In some examples, the biological sample is whole blood or blood fractions. In some examples, the biological sample is plasma or serum. In some examples, the biological sample is serum. In some examples, the biological sample is plasma. Circulating DNA may then be isolated from the biological sample using any suitable technique known to the person skilled in the art, for example using phenol / chloroform extraction or commercially available kits. In some cases, circulating DNA may be isolated, extracted and prepared using commercially available kits such as the Qiagen Qiamp® Circulating Nucleic Acid Kit protocol.

[0641] Generally, circulating DNA are extracted and isolated by from bodily fluids through a partitioning step in which circulating DNAs, as found in solution, are separated from cells and other non-soluble components of the bodily fluid. Partitioning may include, but is not limited to, techniques such as centrifugation or filtration. In other cases, cells are not partitioned from cell free DNA first, but rather lysed. In this example, the genomic DNA of intact cells is partitioned through selective precipitation. Cell free polynucleotides, including DNA, may remain soluble and may be separated from insoluble genomic DNA and extracted. Generally, after addition of buffers and other wash steps specific to different kits, DNA may be precipitated using isopropanol precipitation. Further clean up steps may be used such as silica based columns to remove contaminants orsalts. General steps may be optimized forspecific applications. Nonspecific bulk carrier polynucleotides, for example, may be added throughout the reaction to optimize certain aspects of the procedure such as yield. Detecting IL-6, IL-8, CCL17 and CCL22 in a biological sample

[0642] The methods of the present disclosure comprise detecting the level of one or more biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 in a biological sample obtained from a subject. In some examples, the biological sample for detecting the level of the one or more chemokines and cytokines is referred to as the first biological sample. The biological sample is any sample obtained from the subject in which the biomarkers may be present. In some examples, the biological sample is whole blood or blood fractions. In some examples, the biological sample is plasma or serum. In some examples, the biological sample is serum. Serum and plasma may be isolated from whole blood using techniques known to the person skilled in the art. Serum is the liquid fraction of whole blood that is collected after the blood is allowed to clot. In some examples, the clot may be removed by centrifugation and the resulting supernatant (referred to as serum) separated, for example, by using a Pasteur pipette. Plasma is produced by treating whole blood with an anticoagulant (e.g. by collecting whole blood into anticoagulant-treated tubes e.g., EDTA-treated (lavender tops) or citrate-treated (light blue tops) tubes). The cells are then separated by centrifugation and the supernatant (plasma) is removed from the cell pellet, for example, using a Pasteur pipette.

[0643] Subjects

[0644] The methods and kits of the present application can be used to identify subjects will respond to treatment with a PARP inhibitor alone or combined with an immunotherapeutic and / or chemotherapeutic, by determining the expression of one or more of the biomarkers described herein which identify a specific combination of elements of the immune system involved in the control of multiple cancer types in an accessible liquid biopsy. In some examples, the subject to be assessed has cancer. As used herein, "cancer" is a collective term for conditions characterised by neoplasia, i.e. the abnormal growth or division of cells. Cancerous cells may thus be referred to as "neoplastic". A collection of cancer cells is often referred to as a "tumour" and the terms "tumour" and "cancer" are used interchangeably herein. A tumour may be benign or malignant. In one example, the subject has malignant cancer.

[0645] The subject’s cancer may include any cancer, such as carcinomas, sarcomas, leukaemia, lymphomas, gliomas and the like. In some embodiments, the cancer is a carcinoma, sarcoma and / or glioma. In some embodiments, the cancer is a carcinoma.

[0646] Examples of suitable cancers include, without limitation, kidney cancer, ovarian cancer, pancreatic cancer, oesophagus cancer, cervical cancer, uterine cancer, bladder cancer, gallbladder cancer, liver cancer, head and neck cancer, squamous cell carcinoma, gastrointestinal cancer, breast cancer, prostate cancer, testicular cancer, lung cancer, non-small cell lung cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukaemia, adult T cell leukaemia, laryngeal cancer, brain cancer, neuroblastoma, stomach cancer, endometrial cancer and melanoma.

[0647] Other cancers include fallopian tube cancer, peritoneal cancer, glioblastoma, cancer of the stomach and oesophagus and kidney cancer for which PARP inhibition may be useful.

[0648] In some embodiments, the subject’s cancer is a gynaecological cancer. As used herein, a “gynaecological cancer” is an uncontrolled growth and spread of abnormal cells that originate from the reproductive organs. Examples of gynaecological cancers include, without limitation, cervical, gestational trophoblastic disease (GTD), primary peritoneal, fallopian tube, placental, ovarian, uterine / endometrial, vaginal and vulval cancers. In some embodiments, the cancer is ovarian cancer, primary peritoneal cancer or fallopian tube cancer. In some embodiments, the cancer is ovarian cancer.

[0649] Preferably, the cancer expresses CCL22. CCL22 (also referred to as macrophage derived chemokine or MDC) is a chemokine that is produced by tumour cells and tumourinfiltrating macrophages. CCL22 binds to CCR4 and is involved in chemotaxis of regulatory T cells (Tregs) into the tumour microenvironment which decreases anticancer immunity. Examples of cancers which express CCL22 include, but are not limited to, pancreatic cancer, hepatocellular carcinoma (HCC), gastric cancer, Lewis cell carcinoma, lung cancer, colorectal cancer, melanoma, prostate cancer, breast cancer and ovarian cancer.

[0650] The methods of the invention as described herein can be carried out on any subject which may suffer from cancer. The methods are generally carried out on mammals such as humans, other primates such as monkeys, laboratory mammals such as mice, rats, rabbits, guinea pigs, livestock mammals such as horses, cattle, sheep, pigs, or domestic pets such as cats, dogs. In some embodiments the subjects are humans. However, in other embodiments, the methods can be used in any appropriate animal model. A subject who is receiving medical attention may be referred to as a "patient". Any reference herein to a "subject" should therefore be understood to include reference to a patient, preferably a human patient.

[0651] In some embodiments, the subject is an adult. In some embodiments, the subject is aged 18 years and over. In some embodiments, the subject is aged 30 years and over. In some embodiments, the subject is aged 40 years and over. In some embodiments, the subject is aged 45 years and over. In some embodiments, the subject is aged 50 years and over. In some embodiments, the subject is aged 55 years and over. In some embodiments, the subject is aged 60 years and over. In some embodiments, the subject has gone through menopause (i.e. postmenopausal).

[0652] In some embodiments, the subject may be showing evidence of relapse. In some embodiments, the subject may be showing evidence of first relapse. In some embodiments, the subject may be showing evidence of sub-clinical recurrence. For example, in the case of ovarian cancer, the subject may have rising CA125 levels in the blood within 6 months post first-line platinum-based chemotherapy (platinum resistant disease) or after 6 months post first-line platinum-based chemotherapy (platinum sensitive disease). Accordingly, the methods of the present disclosure may increase the use of PARP inhibitors upon first relapse. This would offer a powerful treatment option for patients at the first evidence of sub-clinical recurrence.

[0653] The methods and kits of the present application can be used to identify subjects that will respond to treatment before therapy begins ( / n vitro incubation of drug with subject’s blood / cell sample). For example, the subject may have started or be starting treatment with a PARP inhibitor. In some embodiments, the subject to be assessed has not be treated with the PARP inhibitor. In some embodiments, the subject may be being assessed to determine whether treatment with a PARP inhibitor is likely to improve survival. In some embodiments, the subject to be assessed has started therapy, for example, the subject to be assessed is within the first cycle of treatment with a PARP inhibitor.

[0654] Cancers

[0655] Ovarian Cancer

[0656] Ovarian cancer is the growth of abnormal malignant cells that begins in the ovaries. It is often associated with vague and non-specific symptoms such as bloating, pelvic or abdominal pain, difficulty eating and / or feeling full quickly and urinary symptoms. Once ovarian cancer has been diagnosed, cancer staging is performed to decide how far the disease has progressed.

[0657] Typically, staging of ovarian cancer involves taking samples of tissues from different parts of the pelvis and abdomen to determine whether to disease has spread and if so, how far it has spread. Ovarian cancer is staged using the International Federation of Gynaecology and Obstetrics (FIGO) staging system which describes four main stages:

[0658] Stage 1 - The cancer is only found within the ovary (or ovaries) and has not spread to organs and tissues in the abdomen or pelvis, lymph nodes, or to distant sites.

[0659] Stage 2 - The cancer has spread to other organs within the pelvis, for example the uterus, fallopian tubes, bladder, the sigmoid colon, or the rectum. It has not spread to lymph nodes or distant sites.

[0660] Stage 3 - The cancer has spread beyond the pelvis to the lining of the abdomen and / or has spread to lymph nodes in the back of the abdomen (retroperitoneal lymph nodes).

[0661] Stage 4 - The cancer has spread to the inside of the spleen, liver, lungs, or other organs located outside the peritoneal cavity.

[0662] The FIGO stage is an important predictor of long term survival. It is also used to help identify treatment options. Stage 4 is the most advanced form of ovarian cancer and is associated with the lowest five-year survival rate. The methods of the present disclosure can be used in a subject having ovarian cancer at any clinical staging.

[0663] Solid Tumours

[0664] In many solid tumours including ovarian cancer, a high ratio of infiltrating effector T cells (CD4 and CD8 T cells) to regulatory T cells (Treg) is correlated with longer overall and progression free survival. These cancers include endometrial, colon, breast, melanoma, lung cancers. Infiltration by effector T cells coming from the blood into the solid tumour, will depend on their expression of chemokine receptors, which when activated by their cognate chemokine, cause the T cell to migrate towards the chemokine.

[0665] The biomarker signatures described herein are purely based on immune biomarkers and is not specific to any particular mutation present in a cancer. Given it is based on the capability of different T cell subsets to infiltrate tumours that have high levels of CCL17 or CCL22 (the receptors for key marker CCR4), and inflammatory cytokines IL6 and IL6, the inventors posit that any solid tumour that exhibits the same characteristics, that is, a high CD8 or CD4 T effector cell / Treg ratio in the tumour will be beneficial to the patient. Further, a tumour environment rich in CCL22 CCL17, IL6 and / or IL8 will exhibit a similar relationship of tumour infiltration meaning that the biomarker signatures described herein will also be relevant to tumour beyond ovarian and gynaecological cancers.

[0666] Cancers where high effector CD4 or CD8 T cells and low levels of regulatory T cells are associated with better prognosis include endometrial cancer, colorectal cancer, breast cancer, melanoma, lung cancer, kidney cancer, pancreatic cancer, oesophagus cancer, cervical cancer, uterine cancer, bladder cancer, gallbladder cancer, liver cancer, head and neck cancer, squamous cell carcinoma, gastrointestinal cancer, prostate cancer, testicular cancer, lung cancer, non-small cell lung cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukaemia, adult T cell leukaemia, laryngeal cancer, brain cancer, neuroblastoma, and stomach cancer.

[0667] In a particular example, the cancer is selected from breast, colorectal and lung cancer.

[0668] Accordingly, the methods described herein are also applicable to cancers beyond colorectal cancer.

[0669] PARP inhibitor

[0670] Methods of the present disclosure can be used to identify subjects who will respond to PARP inhibitors or an analogue or derivative thereof. The methods of the present disclosure can also be used to predict whether a subject who has not previously received PARP inhibitors will respond to PARP inhibitors. Poly-ADP-ribose proteins (PARP) are a family of proteins that are essential for several cellular processes including DNA repair, replication fork stability and genomic stability (Chaudhuri, A.R and Nussenzweig A, (2017) Nat Rev Mol Cell Biol. 18:610-621). The successful introduction of PARP inhibitors has established a new treatment approach for ovarian cancer. There are currently several PARP inhibitors being tested in phase III trials, including olaparib, rucaparib, niraparib, veliparib, pamiparib and talazoparib. Olaparib, rucaparib and niraparib behave been approved by the Food and Drug Administration (FDA) and European Medicines Agency (EMA) for use in ovarian cancer (OC) in the clinic (Bound, N.T. et al., (2022) Front Genet. 13:886170). PARP inhibitors are known to the person skilled in the art. Examples of PARP inhibitors are described in W02004 / 080976, US2005 / 0059663, US2008 / 0200469A1 , W02005 / 053662, W02005 / 012305, W02008 / 084261 , WO2010 / 017055, WO2012 / 054698 and WO2018 / 183354. Additional PARP inhibitors are described for example in US6,635,642, US5,587,384, W02003080581 , W02003070707, W02003055865, W02003057145,

[0671] W02003051879, US6,514,983, W02003007959, US6,426,415, W02003007959,

[0672] W02002094790, W02002068407, US6,476,048, W02001090077, W02001085687,

[0673] W02001085686, W02001079184, W02001057038, W02001023390, W02001021615,

[0674] W02001016136, W02001012199, WO1995024379, Banasik et al. J. Biol. Chem., 267:3, 1569- 75 (1992), Banasik et al. Molec. Cell. Biochem. 138:185-97 (1994)), Cosi (2002) Expert Opin. Ther. Patents 12 (7), and Southan & Szabo (2003) Curr Med Chem 10 321-340 and references therein.

[0675] In some examples, the PARP inhibitor is selected from olaparib, rucaparib, niraparib, veliparib, pamiparib and talazoparib, or an analogue or derivative thereof. In some examples, the PARP inhibitor is selected from olaparib, rucaparib, niraparib and talazoparib, or an analogue or derivative thereof. In some examples, the PARP inhibitor is selected from olaparib, rucaparib and niraparib. Unless the context indicates otherwise, references to PARP inhibitors also includes references to hydrates, solvates, or prodrugs thereof.

[0676] In some examples, the PARP inhibitor is Olaparib, a hydrate, solvate or prodrug thereof. As used herein, “olaparib” refers to 4-[(3-{[4-(cyclopropane-carbonyl)piperazine-1-yl]carbonyl}-4- fluorophenyl)methyl]-2H-phthalazin-1-one, or a hydrate, solvate, or prodrug thereof. 4-[(3-{[4- (cyclopropane-carbonyl)piperazine-1-yl]carbonyl}-4-fluorophenyl)methyl]-2H-phthalazin-1 -one, having the following structure, is disclosed in W02004 / 080976 A1 , incorporated by reference herein.

[0677] In some examples, olaparib is administered to a subject identified as responding to treatment with a PARP inhibitor using the methods described herein. In some examples, olaparib is preferably administered in the form of a pharmaceutical composition. In some examples, olaparib is administered in a therapeutically effective amount. The therapeutically effective amount of olaparib has been previously established and can be determined by the administering physician. In certain embodiments, the therapeutically effective amount of olaparib is in the range of about 400 to 800 mg per day. For example, in certain embodiments, olaparib is administered in an amount of about 600 mg daily (e.g., about 300 mg taken twice daily).

[0678] In some examples, the PARP inhibitor is rucaparib, a hydrate, solvate or prodrug thereof. As used herein, “rucaparib” refers to 8-fluoro-2-{4-[(methylamino)methyl]phenyl}-1 ,3,4,5- tetrahydro-6H-azepino[5,4,3-cd]indol-6-one, or a hydrate, solvate, or prodrug thereof. 8-fluoro-2- {4-[(methylamino)methyl]phenyl}-1 ,3,4,5-tetrahydro-6H-azepino[5,4,3-cd]indol-6-one, has the following structure:

[0679] Rucaparib, and methods of making it, are described, e.g., in US6,495,541 and US7,323,562. US6,495,541 describes salts of rucaparib in general, solid dosage forms and broad dose ranges. Certain salts and polymorphs of rucaparib are disclosed in US7.351 ,701 , US7,351 ,530 and US7,268,126, and in US2004-0248879. US7,351 ,701 and US7,351 ,530 describe the use of the phosphate salt of rucaparib. US8,754,072 discloses solid dosage forms of rucaparib maleate and rucaparib camsylate. US10,130,636 discloses high dosage forms of rucaparib camsylate.

[0680] In some examples, the PARP inhibitor is niraparib, a hydrate, solvate or prodrug thereof. As used herein, “niraparib” refers to 2-{4-[(3S)-piperidin-3-yl]phenyl}-2H-indazole-7-carboxamide and has the structure:

[0681] Niraparib and pharmaceutically acceptable salts thereof, are disclosed in W02007 / 113596 and EP2007733B 1 ; W02008 / 084261 and USS, 071 , 623; and W02009 / 087381 and US8,436,185. Methods for preparation of niraparib include those described in WO2014 / 088983; WO2014 / 088984; USS, 071 , 623; US8,436,185; US62 / 489.415 filed April 24, 2017; and Jones et al., J. Med. Chem., 52:7170-7185, 2009. Methods to treat cancer with niraparib and pharmaceutically acceptable salts thereof are disclosed in U.S. Provisional Patent Application Nos. 62 / 356,461 , 62 / 402,427, 62 / 470,141 , and PCT / US17 / 40039. Methods of administering niraparib to cancer patients are also described in WO2018 / 005818. Compositions comprising niraparib are described in WO2019 / 067634. The contents of each of the foregoing references are incorporated herein by reference in their entirety. In some examples, the PARP inhibitor is niraparib tosylate monohydrate (2-{4-[(3S)-piperidin-3-yl]phen 2H-indazole 7-carboxamide 4- methylbenzenesulfonate hydrate).

[0682] In some examples, the PARP inhibitor is talazoparib, a hydrate, solvate or prodrug thereof. As used herein, “talazoparib” refers to 5-Fluoro-8-(4-fluorophenyl)-9-(1-methyl-1 H-1 ,2,4- triazol-5-yl)-8,9-dihydro-2H-pyrido[4,3,2-de]phthalazin-3(7H)-one and has the structure:

[0683] Talazoparib, analogues, derivatives and pharmaceutically acceptable salts thereof, are disclosed in US8,012,976, US8,420,650, US8,735,392, US9,820,985, US10,189,837 and US10,780,088.

[0684] Analogues or derivatives of the above-mentioned PARP inhibitors may also be used in the methods described herein.

[0685] Suitable PARP inhibitors are either commercially available or may be synthesized by known methods from starting materials that are known. Suitable PARP inhibitors may also be synthesised using methods disclosed in the patent and non-patent literature, such as those described above. The methods of the present disclosure can also be used to predict whether a subject who has not previously received a PARP inhibitor will respond to a PARP inhibitor.

[0686] Oxazaphosphorine

[0687] The methods of the present disclosure may comprise detecting CCR4 expression on cells after stimulation of the cells in culture with a oxazaphosphorine, an analogue, derivative or active metabolite thereof. Oxazaphosphorines, which include cyclophosphamide, ifosfamide, and trofosfamide, constitute a class of alkylating agents that have long been used for treating cancer. Most oxazaphosphorines are prodrugs that are metabolized in vivo to generate active alkylating moieties. One active metabolite of cylcophosmaide is mafosphamide. In some examples, the methods of the present disclosure comprise detecting CCR4 expression on cells after stimulation of the cells in culture with mafosphamide, or an analogue, derivative or active metabolite thereof. Accordingly, in some examples, the cells obtained from a subject are exposed in vitro to mafosphamide, or an analogue, derivative or active metabolite thereof, prior to detecting CCR4 expression. In some examples, the level of CCR4 expression post exposure is compared to the level of CCR4 expression before or without exposure to mafosphamide, or an analogue, derivative or active metabolite thereof. In some examples, the level of CCR4 expression post exposure is compared to a threshold level. In some examples, the level of CCR4 expression post exposure is expressed as a percentage of the level of CCR4 expression pre-exposure.

[0688] Mafosphamide is an analogue of the pharmacologically active liver metabolite of cyclophosphamide and has the structure:

[0689] It is also described as a synthetic metabolite of cyclophosphamide. It is more active and stable by itself and does not need to be metabolically converted to an active compound. Analogues or derivatives of mafosphamide, as well as compounds that are capable of being metabolised into mafosphamide, such as cyclophosphamide or analogues or derivatives thereof, may be used in the methods described herein.

[0690] In some examples, the compound is mafosphamide. Mafosphamide is an oxazaphosphorine. Other oxazaphosphorines may also be used in the methods described herein. Suitable compounds include, but are not limited to, cyclophosphamide, 4- hydroxycyclophosphamide, aldophosphamide, phosphoramide mustard, acrolein, 4- hydroperoxycyclophosphamide, ifosfamide, trofosfamide and the like.

[0691] Any suitable concentration of mafosphamide may be used. In some examples, the concentration of mafosphamide included in the culture media is between 0.1 and 10 pg / ml, for example, between 1 and 5 pg / ml , between 1 and 4 pg / ml, or 1 and 3 pg / ml. In some examples, the concentration of mafosphamide included in the culture media is 1.5 pg / ml or 3 pg / ml. In some examples, the concentration of mafosphamide included in the culture media is 1 .5 pg / ml. In some examples, the concentration of mafosphamide included in the culture media is 3 pg / ml.

[0692] In some examples, the cells may be exposed to mafosphamide for at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 42 hours, at least 48 hours, at least 54 hours, at least 60 hours, at least 66 hours or at least 72 hours. In some examples, the cells may be exposed to mafosphamide for at between 6 and 100 hours. In some examples, the cells may be exposed to mafosphamide for at between 60 and 84 hours, for example 72 hours.

[0693] Immune Checkpoint Inhibitors

[0694] Methods of the present disclosure can be used to identify subjects who will respond to PARP inhibitors or an analogue or derivative thereof. The PARP inhibitors may optionally be administered in combination with a further therapeutic agent. In some examples, the further therapeutic agent is an immune checkpoint inhibitor.

[0695] In some embodiments, the methods further comprise administering an immune checkpoint inhibitor. The checkpoint inhibitor can be administered to the subject either prior to, substantially simultaneously with, or after treatment with the PARP inhibitor. In some embodiments, PARP inhibitor is administered prior to the checkpoint inhibitor. In some embodiments, the checkpoint inhibitor is administered prior to the PARP inhibitor.

[0696] As used herein, “checkpoint inhibitors’’ include any agent that blocks or inhibits in a statistically significant manner, the inhibitory pathways of the immune system. For example, checkpoint inhibitors can affect Treg function. Checkpoint inhibitors include antibodies, or antigen binding fragments thereof, other binding proteins, biologic therapeutics or small molecules. In some embodiments, checkpoint inhibitors bind to and block or inhibit immune checkpoint receptors. In some embodiments, checkpoint inhibitors bind to and block or inhibit immune checkpoint receptor ligands. In some embodiments, checkpoint inhibitors may target for blocking or inhibition CTLA-4, PDL1 , PDL2, PD1 , B7-H3, B7-H4, BTLA, HVEM, GAL9, LAG3, TIM3, VISTA, KIR, 2B4 (belongs to the CD2 family of molecules and is expressed on all NK, yd, and memory CD8+ (ap) T cells), CD160 (also referred to as BY55), CGEN-15049, CHK 1 and CHK2 kinases, A2aR and various B-7 family ligands and a combination thereof. B7 family ligands include, but are not limited to, B7- 1 , B7-2, B7-DC, B7-H1 , B7-H2, B7-H3, B7-H4, B7-H5, B7-H6 and B7-H7. In some embodiments, the checkpoint inhibitor interacts with a ligand of a checkpoint protein which may be CTLA-4, PDLI, PDL2, PDI, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK 1 , CHK2, A2aR, B-7 family ligands or a combination thereof. Checkpoint protein ligands include, but are not limited to, PD-LI, PD-L2, B7-H3, B7-H4, CD28, CD86 and TIM-3.

[0697] In some embodiments, the checkpoint inhibitor inhibits a checkpoint protein selected from the group consisting of: cytotoxic T-lymphocyte antigen-4 (CTLA4), programmed cell death protein 1 (PD-1), PD-L1 , PD-L2, B7-H3, B7-H4, herpesvirus entry mediator (HVEM), T cell membrane protein 3 (TIM3), galectin 9 (GAL9), lymphocyte activation gene 3 (LAG3), V-domain immunoglobulin (Ig)-containing suppressor of T-cell activation (VISTA), Killer-Cell Immunoglobulin-Like Receptor (KIR), Band T lymphocyte attenuator (BTLA), T cell immunoreceptor with Ig and ITIM domains (TIGIT), and combinations thereof. In some embodiments, the checkpoint inhibitor inhibits CTLA-4, PD-1 or PD-L1. In some embodiments, checkpoint inhibitors may target for blocking or inhibition PD1 and / or PD-L1 .

[0698] In some embodiments, the checkpoint inhibitor is a biologic therapeutic or a small molecule. In some embodiments, the checkpoint inhibitor is a monoclonal antibody, a humanized antibody, a fully human antibody, a fusion protein or a combination thereof. In some embodiments, checkpoint inhibitors include antibodies, or antigen binding fragments thereof, other binding proteins, biologic therapeutics or small molecules, that bind to and block or inhibit the activity of one or more of CTLA-4, PDL1 , PDL2, PD1 , BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD 160 and CGEN- 15049. Examples of checkpoint inhibitors include, but are not limited to, Tremelimumab (anti-CTLA-4 antibody), anti-OX40, PD-LI monoclonal Antibody (Anti-B7-HI; MEDI4736), MK-3475 (PD-1 blocker), Nivolumab (anti-PDI antibody), CT- 011 (anti- PDI antibody), BY55 monoclonal antibody, AMP224 (anti-PDLl antibody), BMS- 936559 (anti- PDLI antibody), MPLDL3280A (anti-PDLl antibody), MSB0010718C (anti- PDLI antibody) and Yervoy / ipilimumab (anti-CTLA-4 antibody). In some embodiments, checkpoint inhibitors include antibodies, or antigen binding fragments thereof, other binding proteins, biologic therapeutics or small molecules, that bind to and block or inhibit the activity of PD1 and / or PD-L1 .

[0699] In some examples, the checkpoint inhibitor targets the PD-1 / PD-L1 pathway. The terms “Programmed Death 1’’, “Programmed Cell Death 1 ’’, “Protein PD-1’’ “PD-1’’ and “PD1” are used interchangeably, and include variants, isoforms, species homologs of human PD-1 , and analogs having at least one common epitope with PD-1. The complete PD-1 sequence can be found under GenBank Accession No. U64863. In some examples, the checkpoint inhibitor targets the PD-1 / PD-L1 pathway and may comprise Nivolumab, Pembrolizumab, Pidilizumab, lambrolizumab, AMP-224, BMS-936559, MEDI-4736, MPDL33280A, MIHI, Atezolizumab, Durvalumab and Avelumab. In some examples, the checkpoint inhibitor is an anti-PD-L1 antibody or antigen binding fragments thereof. Examples of anti-PD-L1 antibodies include atezolizumab (Tecentriq), durvalumab (Imfinzi), and avelumab (Bavencio). In some examples, the checkpoint inhibitor is durvalumab. Durvalumab sold under the brand name Imfinzi, is an FDA-approved immunotherapy for cancer, developed by Medimmune / AstraZeneca. It is a human immunoglobulin G1 kappa (IgGl K) monoclonal antibody that blocks the interaction of programmed cell death ligand 1 (PD-L1) with the PD-1 (CD279). In some examples, the checkpoint inhibitor is an anti-PD1 antibody or antigen binding fragments thereof. These include, but are not limited to, Keytruda (pembrolizumab), Opdivo (nivolumab), Pidilizumab and lambrolizumab.

[0700] In some examples, the checkpoint inhibitor targets the CTLA-4 pathway. The terms “cytotoxic T lymphocyte-associated antigen-4,’’ “CTLA-4,’’ “CTLA4,” and “CTLA-4 antigen’’ are used interchangeably, and include variants, isoforms, species homologs of human CTLA-4, and analogs having at least one common epitope with CTLA-4. The complete CTLA-4 nucleic acid sequence can be found under GenBank Accession No. L15006. CTLA-4 checkpoint inhibitors include, without limitation, ipilimumab (a fully human CTLA-4 blocking antibody presently marketed under the name Yervoy® (Bristol-Myers Squibb)), tremelimumab (referenced in Ribas et al., J. Clin. Oncol. 31 :616-622 (2013)), antibodies disclosed in U.S. Patent Application Publication Nos. 2005 / 0201994, 2002 / 0039581 , and 2002 / 086014, the contents of each of which are incorporated herein by reference, and antibodies disclosed in U.S. Pat. Nos. 5,811 ,097, 5,855,887, 6,051 ,227, 6,984,720, 6,682,736, 6,207,156, 5,977,318, 6,682,736, 7,109,003 and 7,132,281 , the contents of each of which are incorporated herein by reference.

[0701] Additional therapeutic agents

[0702] The methods of the present disclosure can be used to identify subjects who will respond to PARP inhibitors or an analogue or derivative thereof. The PARP inhibitors may be alone or in combination with an additional therapeutic agent. In some examples, the additional therapeutic agent is an immunotherapy, a chemotherapy or other agent. The additional therapeutic agent can be administered to the subject either prior to, substantially simultaneously with, or after treatment with the PARP inhibitor. In some embodiments, the PARP inhibitor is administered priorto the additional therapeutic agent. In some embodiments, the additional therapeutic agent is administered priorto the PARP inhibitor.

[0703] Immunotherapy

[0704] In some embodiments, the PARP inhibitor is administered in combination with immunotherapy. In some embodiments, the immunotherapy comprises checkpoint inhibitors, cancer vaccines, CAR-T cells, bispecific antibodies, oncolytic viruses, or any combination thereof.

[0705] In some embodiments, the methods further comprise administering a vaccine. The vaccine can be administered to the subject either prior to, substantially simultaneously with, or after treatment with the PARP inhibitor. In some embodiments, the PARP inhibitor is administered priorto the vaccine. In some embodiments, the vaccine is administered priorto the PARP inhibitor.

[0706] Any suitable vaccine may be used. As used herein, vaccines include, but are not limited to, cancer vaccines. As used herein, a “cancer vaccine’’ refers to a vaccine which primes the immune system to attack cancer cells in the body. Accordingly, instead of preventing disease, a cancer vaccine stimulates the immune system (for example by inducing CD8 T cells and / or CD4 T cells) to attack a disease that already exists. In some embodiments, a cancer vaccine can use cancer cells, parts of cells, or pure antigens to increase the immune response against cancer cells that are already in the body. Non-limiting examples of cancer vaccines include tumour cell vaccines, antigen vaccines, dendritic cell vaccines, DNA or RNA vaccines, and vector based vaccines.

[0707] In some embodiments, the vaccine is an antigen vaccine comprising an antigen and an adjuvant and optionally a carrier. Examples of suitable adjuvants include Montanide ISO720, Alum etc. Antigen vaccines boost the immune system by using one or more antigens, in contrast to whole tumour cells that contain many thousands of antigens. These antigens can be peptides, proteins, mRNA or DNA. Antigen vaccines may be specific for a certain type of cancer because each tumour type may be identified by specific antigen profiles. In order to maximize the efficacy of these vaccines, it may be beneficial to combine multiple antigens in the vaccine depending on the antigen profile of a specific cancer.

[0708] In some embodiments, cancer vaccines can be made from actual cancer cells that have been removed from a subject. Once removed, the cancer cells are modified in the lab, typically with radiation, or via generation of a cancer cell lysate so they cannot form more cancer. The cancer cells can be further modified, for example, by adding chemicals or new genes, to make the cells more likely to be seen as foreign by the subject’s immune system. The modified cells are then injected back into the subject. The immune system is able to recognize the antigens on these cells and through natural physiological processes seeks out and attacks / kills cells that express the intended antigen.

[0709] In some embodiments, the cancer vaccine comprises a dendritic cell vaccine. Dendritic cell vaccines are often autologous vaccines, and must often be made individually for each subject. The process used to create them is complex and expensive. For example, immune cells are removed from the blood of the subject and exposed to cancer cells or cancer antigens, as well as to other chemicals that turn them into dendritic cells and help them grow. The dendritic cells are then injected back into the subject, where they should provoke an immune response to cancer cells in the body.

[0710] In some embodiments, the cancer vaccine comprises a DNA and / or RNA vaccine.

[0711] Non-limiting examples of cancer vaccines include DCVax is Sipuleucel-T (orProvenge®). DCVax is a platform technology that uses activated dendritic cells and is designed to reinvigorate and educate the immune system to attack cancers. DCVax uses many active agents to hit many targets on the cancer (Liau, LM et al. Journal of Neurosurgery 90:1115-1124, 1999; Prins RM et al. J Immunother. 2013 Feb; 36(2):152-7). Sipuleucel-T is a dendritic cell vaccine that is used to treat advanced prostate cancer that is not treatable by traditional chemotherapeutic or hormone therapies. For this vaccine, the subject's own immune cells are isolated from the subject and the immune cells are then exposed to chemicals to convert them into dendritic cells. The dendritic cells are exposed to prostatic acid phosphatase (PAP) which, when reintroduced into the subject, produces an immune response against prostate cancer.

[0712] In some embodiments, the methods further comprise administering a checkpoint inhibitor, for example those as described herein. The checkpoint inhibitor can be administered to the subject either prior to, substantially simultaneously with, or after treatment with the PARP inhibitor. In some embodiments, the PARP inhibitor is administered prior to the checkpoint inhibitor. In some embodiments, the checkpoint inhibitor is administered prior to the PARP inhibitor.

[0713] In some embodiments, the methods further comprise administering an immunomodulatory agent. The immunomodulatory agent can be administered to the subject either prior to, substantially simultaneously with, or after treatment with the PARP inhibitor. In some embodiments, the PARP inhibitor is administered priorto the immunomodulatory ag...

Claims

1. CLAIMS:1 . A method for identifying a cancer subject who will clinically respond to treatment with a PARP inhibitor, or an analogue or derivative thereof, the method comprising detecting a panel of biomarkers in a biological sample obtained from the subject, wherein the panel of biomarkers comprises each of IL-6, IL-8, CCL17 and CCL22.

2. The method according to claim 1 , wherein the biomarkers comprise or consist of:(a) IL-6 and IL-8;(b) CCL17 and CCL22;(c) CC17, CC22, IL-6 and IL-8;(d) IL-6, IL-8, CCL17, CCL22 and Fractalkine;(e) IL-6, IL-8, CCL17, CCL22 and STNFR2; or(f) IL-6, IL-8, CCL17, CCL22, Fractalkine and STNFR2.

3. The method according to claim 1 or 2, wherein the biomarkers comprise or consist of:(a) IL-6, IL-8, CCL17, CCL22 and Fractalkine;(b) IL-6, IL-8, CCL17, CCL22 and STNFR2; or(c) IL-6, IL-8, CCL17, CCL22, Fractalkine and STNFR2.

4. The method according to any one of claims 1 to 3, wherein the biomarkers comprise or consist of IL-6, IL-8, CCL17, CCL22, Fractalkine and STNFR2.

5. The method according to any one of claims 1 to 4, wherein detecting comprises measuring the concentration of each biomarker in the biological sample.

6. The method according to any one of claims 1 to 5, further comprising detecting CCR4.

7. The method according to claim 6, wherein the method comprises detecting the level of cell surface expression of CCR4 on cells in the biological sample and measuring the concentration of one or more additional biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22.

8. The method according to claim 6 or 7, wherein the method comprises detecting the level of cell surface expression of CCR4 on cells in the biological sample and measuring the concentration of:(i) two or more additional biomarkers selected from the group consisting of CCL22, CCL17, IL-6 and IL-8; or(ii) three or more additional biomarkers selected from the group consisting of CCL22, CCL17, IL-6 and IL-8.

9. The method according to any one of claims 6 to 8, wherein the method comprises or consists ofdetecting the level of cell surface expression of CCR4 on cells in the biological sample, and measuring the concentration of CCL22, CCL17, IL-6 and IL-8.

10. The method according to any one of claims 6 to 9, wherein the biological sample is exposed to mafosphamide or an analogue or derivative thereof.

11. The method according to claim 10, wherein the biological sample is exposed to mafosphamide for a period of time sufficient to upregulate CCR4 on the cells.

12. The method according to any one of claims 6 to 10, wherein the method comprises:(i) exposing the biological sample to mafosphamide, or an analogue, derivative or active metabolite thereof in vitro;(ii) contacting the exposed biological sample with a binding agent that binds to CCR4 on the surface of cells; and(Hi) measuring the level of expression of CCR4 on the cells in the biological sample.

13. The method according to any one of claims 6 to 12, wherein the level of CCR4 is detected or measured using an immunoassay selected from an immunofluorescence assay, immunohistochemistry, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), multiplex immunoassay, light emission immunoassay or other assay such as Western blot; fluorescence activated cell sorting (FACS), flow cytometry analysis or surface plasmon resonance (SPR).

14. The method according to any one of claims 1 to 13, wherein the level of IL-6, IL-8, CCL17, CCL22, sTNFR and Fractalkine is detected or measured using an assay selected from immunofluorescence assay such as enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), light emission immunoassays, multiplex immunoassay, Western blot, surface plasmon resonance and spectrometry15. The method according to any one of claims 1 to 14, wherein the method comprises binding agents that bind to IL-6, IL-8, CCL17, CCL22, Fractalkine and STNFR2.

16. The method according to any one of claims 1 to 15, wherein the biological sample comprises cells, whole blood or a blood fraction (e.g. sera), ascites, or saliva from the subject.

17. The method according to any one of claims 6 to 16, wherein the level of CCR4 is detected or measured in peripheral blood mononuclear cells (PBMCs) and IL-6, IL-8, CCL17, CCL22, Fractalkine and sTNFR2 are measured in sera, plasma or saliva.

18. The method according to any one of claims 6 to 17, wherein the PBMCs comprise T cells.

19. The method according to any one of claims 1 to 6, comprising detecting upstreamCCR4 in the biological sample obtained from the subject, wherein the upstreamCCR4 comprises methylation of a CpG site of a target sequence located upstream of the promoter for CCR4.

20. The method according to claim 19, wherein the target sequence comprises (i) a polynucleotide sequence comprising a nucleotide sequence as shown in SEQ ID NO: 9, (ii) a CpG site containing fragment of the nucleotide sequence as shown in SEQ ID NO: 9; or (Hi) a nucleic acid (such as a polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 10) complementary to the polynucleotide or fragment of (i)-(ii).

21. The method according to claim 19 or 20, wherein methylation of the CpG site is detected in circulating DNA (circDNA) in the biological sample.

22. The method according to any one of claims 19 to 21 , wherein detecting upstreamCCR4 comprises methylation-specific PCR, quantitative methylation-specific PCR, methylationsensitive DNA restriction enzyme analysis, or bisulphite genomic sequencing PCR.

23. The method according to any one of claims 19 to 22, wherein detecting upstreamCCR4 comprises:(i) extracting circDNA from a biological sample obtained from the subject;(ii) treating the circDNA with a methylation-specific restriction enzyme; and(iii) measuring the level of DNA using qtPCR to determine the level of methylated DNA.

24. The method according to 23, wherein the level of methylated DNA is compared to total DNA within the upstream CCR4 sequence to determine the percentage of methylation.

25. The method according to any one of claims 22 to 24, wherein the PCR comprises one or more primer pairs configured to amplify the region of the circDNA comprising the upstream CCR4 target sequence.

26. The method of claim 25, wherein at least one of the primers (i) is selected from SEQ ID NO: 11 and SEQ ID NO: 12; and / or (ii) can be used to amplify the same CpG site as the primers of (i).

27. The method of claim 26, wherein at least one of the primers hybridizes to a region of the circDNA within 100 or 50 or 20 base-pairs of a primer of (i).

28. The method according to any one of claims 19 to 27, wherein hypermethylation of the CpG site indicates that a subject is likely to respond to treatment.

29. The method according to any one of claims 6 to 28, wherein the biomarkers comprise or consist of:(i) IL-6, IL-8, CCL17 and CCL22;(ii) IL-6, IL-8, CCL17, CCL22, and Fractalkine;(Hi) IL-6, IL-8, CCL17, CCL22, and STNFR2;(iv) IL-6, IL-8, CCL17, CCL22, STNRF2 and Fractalkine;(v) IL-6, IL-8, CCL17, CCL22, and upstreamCCR4;(vi) IL-6, IL-8, CCL17, CCL22, Fractalkine and upstreamCCR4;(vii) IL-6, IL-8, CCL17, CCL22, STNRF2 and upstreamCCR4; or(viii) IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2 and upstreamCCR4.

30. The method according to any one of claims 6 to 28, wherein the panel of biomarkers comprises:(a) IL-6, IL-8, CCL17, CCL22, and upstreamCCR4;(b) IL-6, IL-8, CCL17, CCL22, Fractalkine and upstreamCCR4;(c) IL-6, IL-8, CCL17, CCL22, STNRF2 and upstreamCCR4; or(d) IL-6, IL-8, CCL17, CCL22, Fractalkine, STNFR2 and upstreamCCR4;.31 . The method according to any one of claims 1 to 30, further comprising obtaining or having obtained a biological sample from the subject.

32. The method according to any one of claims 1 to 31 , wherein the method prognostically identifies a subject who will respond to treatment with a PARP inhibitor.

33. The method according to any one of claims 1 to 32, wherein the subject has cancer.

34. The method according to claim 33, wherein the cancer is a solid tumour.

35. The method according to claim 33 or 34, wherein the cancer is selected from breast cancer, a gynaecological cancer, lung cancer, colorectal cancer, prostate cancer and melanoma.

36. The method according to any one of claims 1 to 35, wherein the subject has a gynaecological cancer.

37. The method according to claim 36, wherein the gynaecological cancer is selected from the group consisting of ovarian cancer, fallopian tube cancer and primary peritoneal cancer.

38. The method according to claim 36 or 37, wherein the subject has ovarian cancer.

39. The method according to any one of claims 1 to 38, wherein the PARP inhibitor is selected from the group consisting of olaparib, talazoparib, rucaparib and niraparib or a combination thereof.

40. The method according to any one of claims 1 to 39, wherein the PARP inhibitor is Olaparib.

41. The method according to any one of claims 1 to 40, wherein the subject has not previously received treatment with a PARP inhibitor.

42. The method according to any one of claims 1 to 41 , wherein the subject has received previous treatment with a PARP inhibitor and the method identifies a subject who will respond to one or more further doses of the PARP inhibitor.

43. The method according to any one of claims 1 to 42, wherein the PARP inhibitor is used as a monotherapy, or combined with an immunotherapy and / or chemotherapy.

44. The method according to claim 43, wherein the immunotherapy comprises checkpoint inhibitors, cancer vaccines, CAR-T cells, bispecific antibodies, oncolytic viruses, or any combination thereof.

45. The method according to claim 43 or 44, wherein the immunotherapy comprises a checkpoint inhibitor.

46. The method according to claim 45, wherein the checkpoint inhibitor inhibits a checkpoint protein selected from the group consisting of: cytotoxic T-lymphocyte antigen-4 (CTLA4), programmed cell death protein 1 (PD-1), PD-L1 , PD-L2, B7-H3, B7-H4, herpesvirus entry mediator (HVEM), T cell membrane protein 3 (TIM3), galectin 9 (GAL9), lymphocyte activation gene 3 (LAG3), V-domain immunoglobulin (Ig)-containing suppressor of T-cell activation (VISTA), Killer-Cell Immunoglobulin-Like Receptor (KIR), Band T lymphocyte attenuator (BTLA), T cell immunoreceptor with Ig and ITIM domains (TIGIT), and combinations thereof.

47. The method according to claim 45 or 46, wherein the checkpoint inhibitor inhibits CTLA- 4, PD-1 or PD-L1.

48. The method according to claim 43, wherein the chemotherapy comprises carboplatin, a paclitaxel or a cyclophosphamide, or a derivative, analogue or active metabolite thereof, or a combination thereof.

49. The method according to any one of claims 1 to 48, wherein:(i) the PARP inhibitor is used alone,(ii) the PARP inhibitor is combined with a Durvalumab;(iii) the PARP inhibitor is combined with Durvalumab and low dose cyclophosphamide; wherein the PARP inhibitor is Olaparib.

50. The method according to any one of claims 1 to 49 wherein the method further comprises or consists of treating the subject with the PARP inhibitor and optionally one or more of a chemotherapeutic and immunotherapeutic.

51. The method according to any one of claims 1 to 50, wherein the method comprises determining a prognostic value for the subject based on the panel of biomarkers.

52. The method according to claim 51 , the method comprising:(i) measuring in a first biological sample obtained from the subject, a level of one or more biomarkers selected from the group consisting of IL-6, IL-8, CCL17 and CCL22 to derive a biomarker value for each cytokine and chemokine;(ii) measuring in a second biological sample obtained from the subject a level of CCR4 biomarker expression on cells in the sample following stimulation of the cells in the sample with mafosphamide or an analogue, derivative or active metabolite thereof to derive a CCR4 biomarker value;(Hi) inputting the CCR4 biomarker value and the cytokine and chemokine biomarker value(s) into a formula whereby the summed biomarker values of one or more of IL-6 and / or IL- 8 are subtracted from the summed biomarker value(s) of one or more of CCL17 and / or CCL22 to generate a cytokine-chemokine (CC) value which is then added to the CCR4 biomarker value obtained in step (i) to derive a prognostic value which is indicative of whether the subject will respond to a PARP inhibitor.

53. The method according to claim 51 , the method comprising:(i) measuring in a biological sample obtained from the subject, a level of each biomarker in a panel of biomarkers to derive a biomarker value for each biomarker, wherein the panel of biomarkers comprises cytokines IL-6 and IL-8 and chemokines CCL17 and CCL22;(ii) inputting the biomarker value(s) into a formula whereby the biomarker values of IL-6 and IL-8 are subtracted from the biomarker values of CCL17 and CCL22 to derive a prognostic value which is indicative of whether the subject will respond to treatment.

54. The method according to claim 51 , the method comprising:(i) measuring in a biological sample obtained from the subject, a level of each biomarker in a panel of biomarkers to derive a biomarker value for each biomarker, wherein the panel of biomarkers comprises the cytokines IL-6 and IL-8 and the chemokines CCL17 and CCL22 and one or both of Fractalkine and sTNFR2;(ii) inputting the biomarker value(s) into a formula whereby the biomarker values of IL-6 and IL-8 and one or both of Fractalkine and sTNFR2 are subtracted from the biomarker values of CCL17 and CCL22 to derive a prognostic value which is indicative of whether the subject will respond to treatment.

55. The method according to claim 51 , the method comprising:(i) measuring in a biological sample obtained from the subject, a level of a panel of biomarkers to derive a biomarker value for each biomarker, wherein the panel of biomarkers comprises IL-6, IL-8, CCL17 and CCL22 and one or both of Fractalkine and sTNFR2;(ii) measuring in a biological sample obtained from the subject a level of methylation of a CpG site of a target sequence located upstream of a promoter for CCR4 (upstreamCCR4) to derive an upstreamCCR4 biomarker value;(Hi) inputting the upstreamCCR4 biomarker value and the protein biomarker value(s) into a formula whereby the biomarker values of IL-6 and IL-8 and one or both of Fractalkine and sTNFR2 are subtracted from the biomarker values of CCL17, CCL22 and upstreamCCR4 to derive a prognostic value which is indicative of whetherthe subject will respond to treatment.

56. The method according to any one of claims 51 to 55, wherein a prognostic value higher than a threshold value indicates a subject that will respond to treatment with a PARP inhibitor.

57. A method for treating cancer in a subject in need thereof, the method comprising:(i) identifying a subject who will respond to a treatment according to the method of any one of claims 1 to 56; and(ii) administering the PARP inhibitor or an analogue or derivative thereof, optionally in combination with an immunotherapeutic and / or chemotherapeutic, to the subject if the subject is identified as one who will clinically respond to treatment with the PARP inhibitor.

58. A method of treating cancer subject with a PARP inhibitor, the subject having previously been identified or predicted to respond to the PARP inhibitor according to a method of any one of claims 1 to 56.

59. A method for treating cancer in a subject in need thereof, the method comprising:(i) identifying a subject having a prognostic value higher than a threshold using the method of any one of claims 51 to 56; and(ii) administering the PARP inhibitor or an analogue or derivative thereof, optionally in combination with an immunotherapeutic and / or chemotherapeutic, to the subject if the subject is identified as one having a prognostic value higher than the threshold.

60. The method according to any one of claims 57 to 59, wherein the cancer is ovarian cancer.

61. A kit for predicting or identifying a subject who will respond to treatment with a PARP inhibitor, the kit comprising binding reagents that bind to CCR4 or upstreamCCR4 and antigens selected from the group consisting of CCL22, CCL17, IL-6 and IL-8 or selected from the group consisting of CCL22, CCL17, IL-6, IL-8, and optionally one or more of Fractalkine and sTNFR2.

62. The kit according to claim 61 , comprising one or more reagents for detecting methylation of a CpG site of a target sequence located upstream of a promoter for CCR4 (upstreamCCR4).

63. The kit according to claim 61 or 62, wherein the reagents bind to IL-6, IL-8, CCL17, CCL22, Fractalkine, and STNFR2.

64. A composition for predicting or identifying a subject who will respond to treatment with a PARP inhibitor, the composition comprising a binding reagent that binds to CCR4 and one or more binding reagents that bind to an antigen selected from the group consisting of CCL22, CCL17, IL-6 and IL-8.

65. A composition for predicting or identifying a subject who will respond to treatment with a PARP inhibitor, the composition comprising binding reagents that bind to upstreamCCR4 and one or more binding reagents that bind to an antigen selected from the group consisting of CCL22, CCL17, IL-6, IL-8 and optionally one or more of Fractalkine, and STNFR2.

66. The kit according to any one of claims 61 to 63, or the composition according to claim 64 or 65, wherein the binding reagents that bind to upstreamCCR4 are primers.

Images