TGFB2 therapeutics for cancer with survival markers
By employing antisense oligonucleotides to suppress TGFB2, IRF9, and LGALS9, and IFI27, guided by biomarkers, the method addresses the limitations of conventional cancer therapies, enhancing efficacy and reducing toxicity, particularly in non-immunogenic tumors.
Patent Information
- Application Number
- PCT/US2025/045662
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-12
- Filing Date
- 2025-09-10
- Publication Date
- 2026-03-19
AI Technical Summary
Conventional cancer therapies exhibit limited efficacy, significant side effects, and high toxicity, necessitating the development of agents and methods that enhance therapeutic effectiveness while minimizing adverse effects through synergistic strategies involving TGFB2, IRF9, LGALS9, and IFI27 suppression, guided by tumor-associated biomarkers.
The use of agents, such as antisense oligonucleotides, to suppress the expression of TGFB2, IRF9, LGALS9, and IFI27, combined with chemotherapy and guided by biomarkers like TGFB2, IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F, to increase efficacy and reduce toxicity in cancer treatment.
The approach enhances cancer treatment efficacy, reduces toxic side effects, and improves survival rates by selectively targeting elevated TGFB2 and IRF9, LGALS9, and IFI27, particularly in non-immunogenic tumors, with compositions stable at 37°C and compatible with standard care treatments.
Smart Images

Figure US2025045662_19032026_PF_FP_ABST
Abstract
Description
Docket No. 018988-021W01TGFB2 THERAPEUTICS FOR CANCER WITH SURVIVAL MARKERSSEQUENCE LISTING
[0001] This application includes a sequence listing submitted electronically as an ST.26 file created on September 9, 2025, named 018988-021 WO 1_SL. xml, which is 82,602 bytes in size.TECHNICAL FIELD
[0002] This invention relates to agents, uses, and methods for treating cancer with synergistic therapeutic strategies involving one or more agents for suppressing expression of TGFB2, IRF9, LGALS9, and IFI27, along with guiding use of tumor- associated biomarkers. Biomarkers can be used to select subjects who benefit from the methods, agents or uses, including TGFB2, IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB 1, HLA-DRB 1, and HLA-F. The agents and compositions can be used along with chemotherapy and other standard-of-care therapies.BACKGROUND
[0003] Cancer is a complex pathology involving multiple variant cellular pathways. Because of this complexity, many anti -cancer drugs have limited or partial therapeutic effectiveness.
[0004] Drawbacks of conventional therapies include lack of efficacy as determined by overall survival.
[0005] Further drawbacks of conventional therapies include significant unwanted side effects such as killing healthy cells in addition to killing cancer cells.
[0006] Additional drawbacks of anti-cancer agents include high toxicity at required levels of therapeutic administration.
[0007] What is needed are methods, agents and uses for cancer diseases to increase efficacy, and reduce toxicity and unwanted side effects.
[0008] Therapeutic compositions of different agents are needed to supply significant antitumor effects and cancer immunotherapeutic effects and which can reduce side effects and adverse health effects. There is an urgent need for improved guidance for use of such compositions by using appropriate biomarkers to select synergistic effects of the compositions.Docket No. 018988-021W01BRIEF SUMMARY
[0009] This invention relates to agents, uses, and methods for treating cancer with synergistic therapeutic strategies involving one or more agents for suppressing expression of TGFB2, IRF9, LGALS9, and IFI27, along with guiding use of tumor- associated biomarkers. Biomarkers can be used to select subjects who benefit from the methods, agents or uses, including TGFB2, IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB 1, HLA-DRB 1, and HLA-F.
[0010] This disclosure further encompasses use of biomarkers to select subjects who benefit from the methods, agents or uses disclosed herein, including any of TGFB2, IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB 1, HLA-DRB 1, and HLA-F.
[0011] Anti-cancer agents and compositions of this disclosure can also be used in combination with chemotherapy and other standard of care therapies for cancer.
[0012] In some embodiments, methods and therapeutic strategies of this invention can increase efficacy, as well as reduce toxic side effects and adverse health effects in cancer treatment.
[0013] In further embodiments, methods and therapeutic strategies of this invention can improve guidance of the therapy using appropriate biomarkers to select synergistic effects of the compositions.
[0014] Embodiments of this invention include the following:
[0015] A composition comprising an agent for suppressing expression of TGF-P2 for treating or ameliorating the symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 elevated and (b) one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA- DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0016] A composition comprising an agent for suppressing expression of TGF-P2 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 elevated and (b) one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0017] A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressingDocket No. 018988-021W01 expression of TGFB2; and administering a therapeutically sufficient amount of the composition to the subject, wherein the subject is selected who has (a) TGF-P2 elevated and (b) one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0018] The composition or method above, wherein the cancer is pancreatic cancer.
[0019] The composition or method above, wherein the cancer is characterized by non- immunogenic tumors.
[0020] The composition or method above, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0021] The composition or method above, wherein the agent for suppressing expression of TGF-P2 is c*G*G*c*A*T*G*T*c*T*A*T*T*T*T*G*T*A SEQ ID NO:67 (OT-101) or CGGCATGTCTATTTTGTA SEQ ID NO:75.
[0022] The composition or method above, wherein the composition comprises a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.
[0023] The composition above, wherein the composition is substantially free of excipients.
[0024] The composition or method above, wherein the composition is stable for at least 14 days in carrier at 37°C.
[0025] The composition or method above, wherein the subject after the administration has reduced TGF-P2 mRNA expression.
[0026] The composition or method above, wherein the administration increases survival rate at month 6, 12, 18, 24, 30, or 36.
[0027] The composition or method above, wherein the administration of the composition is combined with a standard of care treatment for cancer, wherein the standard of care treatment comprises chemotherapy or radiation therapy.
[0028] An agent for suppressing expression of IRF9 for treating or ameliorating the symptoms of cancer in a subject.
[0029] A composition comprising an agent for suppressing expression of IRF9 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.
[0030] A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising:Docket No. 018988-021W01 preparing a pharmaceutical composition comprising an agent for suppressing expression of IRF9; and administering a therapeutically sufficient amount of the composition to the subject.
[0031] The composition or method above, wherein the cancer is pancreatic cancer.
[0032] The composition or method above, wherein the cancer is characterized by non- immunogenic tumors.
[0033] The composition or method above, wherein the subject is selected who has (a) IRF9 elevated and (b) one or more of TGF-P2, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0034] The composition or method above, wherein the agent, medicament or administration comprises one or more IRF9-specific antisense oligonucleotides complementary to a IRF9 transcript and 15-30 nucleotides in length.
[0035] The composition or method above, wherein the agent, medicament or administration comprises one or more IRF9-specific antisense oligonucleotides complementary to a IRF9 pre- RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.
[0036] The composition or method above, wherein the agent, medicament or administration comprises one or more IRF9-specific antisense oligonucleotides complementary to a IRF9 transcript as in Table 1.
[0037] The composition or method above, wherein the agent, medicament or administration comprises IRF9-specific antisense oligonucleotides CAATGTCTGAATGGACTGCT SEQ ID NO:8 or C*A*A*T*G*T*C*T*G*A*A*T*G*G*A*C*T*G*C*T SEQ ID NO: 1.
[0038] The composition or method above, comprising an IRF9-specific antisense oligonucleotide as in Table 1 having one or more nucleotides chemically modified as a phosphorothioate internucleoside linkage, a methoxypropylphosphonate intemucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-OMe ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’ -4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5- methylcytodine base.
[0039] The composition or method above, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.
[0040] The composition or method above, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.Docket No. 018988-021W01
[0041] The composition or method above, wherein the agent, medicament or administration is substantially free of excipients.
[0042] The composition or method above, wherein the agent, medicament or administration is stable for at least 14 days in carrier at 37°C.
[0043] The composition or method above, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.
[0044] The composition or method above, wherein the agent or medicament is administered by infusion or injection.
[0045] The composition or method above, wherein the agent, medicament or administration increases survival rate of subjects at month 6, 12, 18, 24, 30, or 36.
[0046] An agent for suppressing expression of LGALS9 for treating or ameliorating the symptoms of cancer in a subject.
[0047] A composition comprising an agent for suppressing expression of LGALS9 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.
[0048] A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of LGALS9; and administering a therapeutically sufficient amount of the composition to the subject.
[0049] The agent, composition or method above, wherein the cancer is pancreatic cancer.
[0050] The agent, composition or method above, wherein the cancer is characterized by non- immunogenic tumors.
[0051] The agent, composition or method above, wherein the subject is selected who has (a) LGALS9 elevated and (b) one or more of TGF-P2, IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0052] The agent, composition or method above, wherein the agent, medicament or administration comprises one or more LGALS9-specific antisense oligonucleotides complementary to a LGALS9 transcript and 15-30 nucleotides in length.
[0053] The agent, composition or method above, wherein the agent, medicament or administration comprises one or more LGALS9-specific antisense oligonucleotides complementary to a LGALS9 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.Docket No. 018988-021W01
[0054] The agent, composition or method above, wherein the agent, medicament or administration comprises one or more LGALS9-specific antisense oligonucleotides complementary to a LGALS9 transcript as in Table 2.
[0055] The agent, composition or method above, wherein the agent, medicament or administration comprises LGALS9-specific antisense oligonucleotides CTTGAATAGTCCCAGAAAAG SEQ ID NO: 28 or C*T*T*G*A*A*T*A*G*T*C*C*C*A*G*A*A*A*A*G SEQ ID NO:24.
[0056] The agent, composition or method above, comprising a LGALS9-specific antisense oligonucleotide as in Table 2 having one or more nucleotides chemically modified as a phosphorothioate internucleoside linkage, a methoxypropylphosphonate intemucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-OMe ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’ -4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5- methylcytodine base.
[0057] The agent, composition or method above, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.
[0058] The agent, composition or method above, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.
[0059] The agent, composition or method above, wherein the agent, medicament or administration is substantially free of excipients.
[0060] The agent, composition or method above, wherein the agent, medicament or administration is stable for at least 14 days in carrier at 37°C.
[0061] The agent, composition or method above, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.
[0062] The agent, composition or method above, wherein the agent is administered by infusion or injection.
[0063] The agent, composition or method above, wherein the agent, medicament or administration increases survival rate of subjects at month 6, 12, 18, 24, 30, or 36.
[0064] An agent for suppressing expression of IFI27 for treating or ameliorating the symptoms of cancer in a subject.
[0065] A composition comprising an agent for suppressing expression of IFI27 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.Docket No. 018988-021W01
[0066] A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of IFI27; and administering a therapeutically sufficient amount of the composition to the subject.
[0067] The agent, composition or method above, wherein the cancer is pancreatic cancer.
[0068] The agent, composition or method above, wherein the cancer is characterized by non- immunogenic tumors.
[0069] The agent, composition or method above, wherein the subject is selected who has (a) IFI27 elevated and (b) one or more of TGF-P2, IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0070] The agent, composition or method above, wherein the agent, medicament or administration comprises one or more IFI27-specific antisense oligonucleotides complementary to a IFI27 transcript and 15-30 nucleotides in length.
[0071] The agent, composition or method above, wherein the agent, medicament or administration comprises one or more IFI27-specific antisense oligonucleotides complementary to a IFI27 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.
[0072] The agent, composition or method above, wherein the agent, medicament or administration comprises one or more IFI27-specific antisense oligonucleotides complementary to a IFI27 transcript as in Table 3.
[0073] The agent, composition or method above, wherein the agent, medicament or administration comprises IFI27-specific antisense oligonucleotides GTATATTTGGGATAGTTGGC SEQ ID NO:61 or G*T*A*T*A*T*T*T*G*G*G*A*T*A*G*T*T*G*G*C SEQ ID NO:47.
[0074] The agent, composition or method above, comprising a IFI27-specific antisense oligonucleotide as in Table 3 having one or more nucleotides chemically modified as a phosphorothioate internucleoside linkage, a methoxypropylphosphonate intemucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-OMe ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’ -4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5- methylcytodine base.
[0075] The agent, composition or method above, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.Docket No. 018988-021W01
[0076] The agent, composition or method above, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.
[0077] The agent, composition or method above, wherein the agent, medicament or administration is substantially free of excipients.
[0078] The agent, composition or method above, wherein the agent, medicament or administration is stable for at least 14 days in carrier at 37°C.
[0079] The agent, composition or method above, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.
[0080] The agent, composition or method above, wherein the agent or medicament is administered by infusion or injection.
[0081] The agent, composition or method above, wherein the agent, medicament or administration increases survival rate of subjects at month 6, 12, 18, 24, 30, or 36.
[0082] A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IRF9 for use in treating or ameliorating symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 and IRF9 elevated and (b) one or more of LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA- DRB1, and HLA-F reduced.
[0083] A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IRF9 for use in the preparation of a medicament for treating or ameliorating symptoms of a cancer in a subject, wherein the subject is selected who has (a) TGF-P2 and IRF9 elevated and (b) one or more of, LGALS9, IFI27, MARCO, CD74, HLA- DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0084] A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: selecting the subject who has (a) TGF-P2 and IRF9 elevated and (b) one or more of LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced; administering an agent for suppressing expression of TGF-P2; and administering an agent for suppressing expression of IRF9; wherein the agent for suppressing expression of TGF-P2 and the agent for suppressing expression of IRF9 are administered concurrently, simultaneously, sequentially, or separately in time.
[0085] The composition or method above, wherein the cancer is pancreatic cancer.Docket No. 018988-021W01
[0086] The composition or method above, wherein the cancer is characterized by non- immunogenic tumors.
[0087] The composition or method above, wherein the composition or medicament is administered by infusion or injection.
[0088] The composition or method above, wherein the TGF-P2 and the one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F have an mRNA level elevated above a median of a control group of subjects having the same cancer.
[0089] The composition or method above, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0090] The composition or method above, wherein the agent for suppressing expression of TGF-P2 is (OT-101) C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO:67 or CGGCATGTCTATTTTGTA SEQ ID NO:75.
[0091] The composition or method above, wherein the agent for suppressing expression of IRF9 is selected from Table 1, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0092] The composition or method above, wherein the agent for suppressing expression of IRF9 is C*A*A*T*G*T*C*T*G*A*A*T*G*G*A*C*T*G*C*T SEQ ID NO: 1 or CAATGTCTGAATGGACTGCT SEQ ID NO: 8.
[0093] The composition or method above, wherein the compositions comprise a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.
[0094] The composition or method above, wherein the composition is substantially free of excipients.
[0095] The composition or method above, wherein the composition is stable for at least 14 days in carrier at 37°C.
[0096] The composition or method above, wherein the subject after the administration or use has a reduced TGF-P2 expression.
[0097] The composition or method above, wherein the administration or use increases survival rate at month 6, 12, 18, 24, 30, or 36.
[0098] A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of LGALS9 for use in treating or ameliorating symptoms ofDocket No. 018988-021W01 cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 and LGALS9 elevated and (b) one or more of IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0099] A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of LGALS9 for use in the preparation of a medicament for treating or ameliorating symptoms of a cancer in a subject, wherein the subject is selected who has (a) TGF-P2 and LGALS9 elevated and (b) one or more of IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0100] A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: selecting the subject who has (a) TGF-P2 and LGALS9 elevated and (b) one or more of IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced; administering an agent for suppressing expression of TGF-P2; and administering an agent for suppressing expression of LGALS9; wherein the agent for suppressing expression of TGF-P2 and the agent for suppressing expression of LGALS9 are administered concurrently, simultaneously, sequentially, or separately in time.
[0101] The composition or method above, wherein the cancer is pancreatic cancer.
[0102] The composition or method above, wherein the cancer is characterized by non- immunogenic tumors.
[0103] The composition or method above, wherein the composition or medicament is administered by infusion or injection.
[0104] The composition or method above, wherein the TGF-P2 and the one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F have an mRNA level elevated above a median of a control group of subjects having the same cancer.
[0105] The composition or method above, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0106] The composition or method above, wherein the agent for suppressing expression of TGF-P2 is (OT-101) C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO:67 or CGGCATGTCTATTTTGTA SEQ ID NO:75.Docket No. 018988-021W01
[0107] The composition or method above, wherein the agent for suppressing expression of LGALS9 is selected from Table 2, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0108] The composition or method above, wherein the agent for suppressing expression of LGALS9 is CTTGAATAGTCCCAGAAAAG SEQ ID NO:28 or C*T*T*G*A*A*T*A*G*T*C*C*C*A*G*A*A*A*A*G SEQ ID NO:24.
[0109] The composition or method above, wherein the agents or compositions comprise a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.
[0110] The composition or method above, wherein the composition is substantially free of excipients.
[0111] The composition or method above, wherein the composition is stable for at least 14 days in carrier at 37°C.
[0112] The composition or method above, wherein the subject upon the administration or use has a reduced TGF-P2 expression.
[0113] The composition or method above, wherein the administration or use increases survival rate at month 6, 12, 18, 24, 30, or 36.
[0114] A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IFI27 for use in treating or ameliorating symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 and IFI27 elevated and (b) one or more of IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA- DRB1, and HLA-F reduced.
[0115] A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IFI27 for use in the preparation of a medicament for treating or ameliorating symptoms of a cancer in a subject, wherein the subject is selected who has (a) TGF-P2 and IFI27 elevated and (b) one or more of IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0116] A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: selecting the subject who has (a) TGF-P2 and IFI27 elevated and (b) one or more of IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced; and administering an agent for suppressing expression of TGF-P2; andDocket No. 018988-021W01 administering an agent for suppressing expression of IFI27; wherein the agent for suppressing expression of TGF-P2 and the agent for suppressing expression of IFI27 are administered concurrently, simultaneously, sequentially, or separately in time.
[0117] The composition or method above, wherein the cancer is pancreatic cancer.
[0118] The composition or method above, wherein the cancer is characterized by non- immunogenic tumors.
[0119] The composition or method above, wherein the composition or medicament is administered by infusion or injection.
[0120] The composition or method above, wherein the TGF-P2 and the one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F have an mRNA level elevated above a median of a control group of subjects having the same cancer.
[0121] The composition or method above, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0122] The composition or method above, wherein the agent for suppressing expression of TGF-P2 is (OT-101) C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO:67 or CGGCATGTCTATTTTGTA SEQ ID NO:75.
[0123] The composition or method above, wherein the agent for suppressing expression of IFI27 is selected from Table 3, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0124] The composition or method above, wherein the agent for suppressing expression of IFI27 is GTATATTTGGGATAGTTGGC SEQ ID NO:61 or G*T*A*T*A*T*T*T*G*G*G*A*T*A*G*T*T*G*G*C SEQ ID NO:47.
[0125] The composition or method above, wherein the composition comprises a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.
[0126] The composition or method above, wherein the composition is substantially free of excipients.
[0127] The composition or method above, wherein the composition is stable for at least 14 days in carrier at 37°C.
[0128] The composition or method above, wherein the subject after the administration or use has a reduced TGF-P2 expression.Docket No. 018988-021W01
[0129] The composition or method above, wherein the administration or use increases survival rate at month 6, 12, 18, 24, 30, or 36.
[0130] A method for collecting data, the method comprising: obtaining data relating to a group of subjects to generate a dataset comprising mRNA or protein levels for at least two biomarkers comprising TGF-P2 and one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F.
[0131] The method above, comprising obtaining one or more clinical parameters from the subjects selected from age, sex, race / ethnicity, medical history, alcohol, and smoking.
[0132] A method for diagnosing or prognosing pancreatic cancer in an individual subject, the method comprising: obtaining data relating to a control group of subjects to generate a dataset comprising mRNA or protein levels for at least two biomarkers comprising TGF-P2 and one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F; obtaining data relating to an individual subject to generate a dataset comprising mRNA or protein levels for at least two biomarkers comprising TGF-P2 and one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F; comparing the dataset obtained from the individual subject to the dataset of the control group; and determining differences between the individual subject and the control group exceeding a threshold for indicating pancreatic cancer in the individual subject.
[0133] The method above, comprising obtaining one or more clinical parameters from the subjects selected from age, sex, race / ethnicity, medical history, alcohol, and smoking.
[0134] The method above, comprising diagnosing or prognosing pancreatic cancer in the subject.
[0135] The method above, comprising treating the subject for pancreatic cancer by administering an anti-cancer drug.BRIEF DESCRIPTION OF THE DRAWINGS
[0136] FIG. 1 A shows TGFB2 mRNA levels have a significant negative prognostic impact at low macrophage levels in PDAC tumors for all PDAC patients (A. N=177).Docket No. 018988-021W01
[0137] FIG. IB shows TGFB2 mRNA levels have a significant negative prognostic impact at low macrophage levels in PDAC tumors for all PDAC patients with low macrophage populations (B. N=68).
[0138] FIG. 1C shows TGFB2 mRNA levels have a significant negative prognostic impact at low macrophage levels in PDAC tumors for PDAC patients with low macrophage and low neoantigen levels (C. N=47).
[0139] FIG. 2 shows PDAC patients with low levels of TGFB2 and low levels of IRF9 mRNA expression exhibited improved OS times than patients with high levels of TGFB2 or IRF9 mRNA expression.
[0140] FIG. 3 shows PDAC patients with low levels of TGFB2 and low levels of IFI27 mRNA expression exhibited improved OS times than patients with high levels of TGFB2 or IFI27 mRNA expression.
[0141] FIG. 4A shows PDAC patients with high levels of IFNAR1 mRNA expression exhibited significantly increased hazard ratios in multivariate Cox proportional hazards model considering age, and TGFB2 levels.
[0142] FIG. 4B shows PDAC patients with high levels of STATU mRNA expression exhibited significantly increased hazard ratios in multivariate Cox proportional hazards model considering age, and TGFB2 levels.
[0143] FIG. 4C shows PDAC patients with high levels of IRF9 mRNA expression exhibited significantly increased hazard ratios in multivariate Cox proportional hazards model considering age, and TGFB2 levels.
[0144] FIG. 4D shows PDAC patients with high levels of IFI27 mRNA expression exhibited significantly increased hazard ratios in multivariate Cox proportional hazards model considering age, and TGFB2 levels.
[0145] FIG. 5A shows a comparison generated of normal versus tumor tissue samples for genes exhibiting significant prognostic impacts on OS from the multivariate Cox regression models.
[0146] FIG. 5B shows a comparison generated of normal versus tumor tissue samples for genes exhibiting significant prognostic impacts on OS from the multivariate Cox regression models.Docket No. 018988-021W01
[0147] FIG. 6A shows OS curves calculated from the multivariate Cox proportional hazards models demonstrating the prognostic impact of TGFB2 mRNA levels at low levels mRNA of TAM markers and IRF9.
[0148] FIG. 6B shows OS curves calculated from the multivariate Cox proportional hazards models demonstrating the prognostic impact of TGFB2 mRNA levels at low levels mRNA of TAM markers and IRF9.
[0149] FIG. 6C shows OS curves calculated from the multivariate Cox proportional hazards models demonstrating the prognostic impact of TGFB2 mRNA levels at low levels mRNA of TAM markers and IRF9.
[0150] FIG. 6D shows OS curves calculated from the multivariate Cox proportional hazards models demonstrating the prognostic impact of TGFB2 mRNA levels at low levels mRNA of TAM markers and IRF9.
[0151] FIG. 6E shows OS curves calculated from the multivariate Cox proportional hazards models demonstrating the prognostic impact of TGFB2 mRNA levels at low levels mRNA of TAM markers and IRF9.
[0152] FIG. 6F shows OS curves calculated from the multivariate Cox proportional hazards models demonstrating the prognostic impact of TGFB2 mRNA levels at low levels mRNA of TAM markers and IRF9.
[0153] FIG. 6G shows OS curves calculated from the multivariate Cox proportional hazards models demonstrating the prognostic impact of TGFB2 mRNA levels at low levels mRNA of TAM markers and IRF9.
[0154] FIG. 6H shows OS curves calculated from the multivariate Cox proportional hazards models demonstrating the prognostic impact of TGFB2 mRNA levels at low levels mRNA of TAM markers and IRF9.
[0155] FIG. 7 shows TGFB2 and components of the Interferon type I response mRNA levels prognostically impact OS outcomes in LGG patients.
[0156] FIG. 7 illustrates a model for the Interferon type-I (IFN-I) stimulated gene (ISG) transcription mediated by STAT1 / STAT2 / IRF9 complexes.
[0157] FIG. 8A shows the prognostic impact of high levels of TGFB2 mRNA expression was independent of age in PDAC patients in both univariate and multivariate Cox proportional hazards models.Docket No. 018988-021W01
[0158] FIG. 8B shows the prognostic impact of high levels of TGFB2 mRNA expression was independent of age in PDAC patients in both univariate and multivariate Cox proportional hazards models.
[0159] FIG. 9A shows high TGFB2 mRNA expression in PDAC patients was independently associated with higher hazard ratios when age and interaction terms were considered in a Cox proportional hazards model investigating TGFB1 or TGFB3.
[0160] FIG. 9B shows high TGFB2 mRNA expression in PDAC patients was independently associated with higher hazard ratios when age and interaction terms were considered in a Cox proportional hazards model investigating TGFB1 or TGFB3.
[0161] FIG. 10A shows high TGFB2 mRNA expression in PDAC patients was independently associated with higher hazard ratios when age and interaction terms are considered in a Cox proportional hazards model investigating receptors for TGFB ligands.
[0162] FIG. 10B shows high TGFB2 mRNA expression in PDAC patients was independently associated with higher hazard ratios when age and interaction terms are considered in a Cox proportional hazards model investigating receptors for TGFB ligands.
[0163] FIG. 10C shows high TGFB2 mRNA expression in PDAC patients was independently associated with higher hazard ratios when age and interaction terms are considered in a Cox proportional hazards model investigating receptors for TGFB ligands.
[0164] FIG. 11A shows prognostic impact of TGFB 1 mRNA levels at low macrophage levels.
[0165] FIG. 11B shows prognostic impact of TGFB 1 mRNA levels at low macrophage levels.
[0166] FIG. 11C shows prognostic impact of TGFB 1 mRNA levels at low macrophage levels.
[0167] FIG. 12A shows prognostic impact of TGFB3 mRNA levels at low macrophage levels.
[0168] FIG. 12B shows prognostic impact of TGFB3 mRNA levels at low macrophage levels.Docket No. 018988-021W01
[0169] FIG. 12C shows prognostic impact of TGFB3 mRNA levels at low macrophage levels.
[0170] FIG. 13 shows comparison of normal versus tumor tissue samples for genes exhibiting significant prognostic impacts on OS from the multivariate Cox regression models.DETAILED DESCRIPTION OF THE DISCLOSURE
[0171] As used herein, the term agent can refer to one or more active compounds, a combination of active compounds, or a composition containing one or more active compounds and a carrier, and / or a solvent, and / or any number of excipients. In some embodiments, the composition may be a pharmaceutical composition. In certain embodiments, the composition may be a pharmaceutical composition containing a therapeutically effective amount of one or more active compounds. Some examples of excipients are given in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 1975, and Liberman, H. A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980. Methods for determining a therapeutically effective amount of a compound are known in the art.
[0172] In some embodiments, methods and therapeutic strategies of this invention can increase efficacy, as well as reduce toxic side effects and adverse health effects in cancer treatment.
[0173] In further embodiments, methods and therapeutic strategies of this invention can improve guidance of the therapy using appropriate biomarkers to select synergistic effects of the compositions.
[0174] As used herein, for simplicity gene names do not appear in italics.Human IRF9-specific antisense oligodeoxynucleotides
[0175] Embodiments of this invention further include pharmaceutical compositions for suppressing expression of IRF9, or for treating or ameliorating the symptoms of cancer in a human or animal. The pharmaceutical compositions may contain a pharmaceutically acceptable salt form, an ester form, or a polymorph or stereoisomer of any active agent of this disclosure, as well as a carrier. The IRF9 agent may be selected from IRF9-specific antisense oligonucleotides. The carrier may be sterile water for injection, saline, isotonic saline, or a combination thereof.Docket No. 018988-021W01
[0176] IRF9 antisense may be chemically-modified in the same manner as described below for TGF-beta-2 antisense.
[0177] Based on reference sequence Homo sapiens interferon regulatory factor 9 (IRF9), transcript variant 1, mRNA. NCBI Reference Sequence: NM_001385400.1.LOCUS NM_001385400 1780 bp mRNA linear PRI 19- AUG-2024. VERSION NM_00 1385400.1.
[0178] Examples of agents of this disclosure for suppressing expression of IRF9 include IRF9-specific antisense oligonucleotides given in Table 1 (SEQ ID NOs: 1-23).Table 1 : IRF9-specific antisense oligonucleotides
[0179] In some embodiments, the following criteria can be used for an antisense oligonucleotide:
[0180] A) 40% <= GC % <= 60%;Docket No. 018988-021W01
[0181] B) No GGGG in the target sequence;
[0182] C) Average unpaired probability for target site nucleotides >= 0.5;
[0183] D) For each peak in the accessibility profile that can be above the threshold probability of 0.5, all sites targeted to this same peak may be ranked by their average unpaired probability (the higher the better) and at most n sites can be selected for each peak, where n is determined by max([width of peak / site length], 2);
[0184] E) Among sites satisfying criteria A-D, the top 20 unique ones with the highest average unpaired probability may be listed.
[0185] In certain embodiments, the average unpaired probability can be used in filter criteria C, D and E to cut down the number of reported sites in order to make the disruption energy calculation as manageable.
[0186] The IRF9 antisense sequences can be chemically-modified to provide active variants thereof, LNA variants thereof, as well as gapmer variants thereof, as known in the art. The sequences can be used in any combination as active agents, such as pooling combinations.
[0187] In some embodiments, the IRF9 antisense sequences can be n-M-n RNA(2’- 0Me)*-DNA*-RNA(2’-0Me)* gapmers, where n is from 3-7 and M is from 6-12. In certain embodiments, the IRF9 antisense sequences can be 3-10-3 or 5-10-5 LNA*- DNA*-LNA* or cEt*-DNA*-cEt* gapmers.
[0188] It is understood that additional antisense oligonucleotides in various formats can be constructed based on the IRF9 gene sequence.
[0189] Any of the unmodified antisense oligonucleotides herein can have any number and order of nucleotides modified with phosphorothioate linkages. In some embodiments, all nucleotides can be modified with phosphorothioate linkages.
[0190] In some embodiments, as discussed herein, the IRF9 antisense sequences can be gapmers formed by adding 1 to 5 protected ribo-nucleotides on each flank of the phosphorothioate deoxy-nucleotide sequences in Table 1. For example, the ribonucleotides can be protected with 2’-0Me, 2’-OEt, or 2’-0-M0E substituents, or with LNA, cMOE, or cEt bridges, as well as phosphorothioate linkages.Docket No. 018988-021W01Human LGALS9-specific antisense oligodeoxynucleotides
[0191] Embodiments of this invention further include pharmaceutical compositions for suppressing expression of LGALS9, or for treating or ameliorating the symptoms of cancer in a human or animal. The pharmaceutical compositions may contain a pharmaceutically acceptable salt form, an ester form, or a polymorph or stereoisomer of any active agent of this disclosure, as well as a carrier. The LGALS9 agent may be selected from LGALS9-specific antisense oligonucleotides. The carrier may be sterile water for injection, saline, isotonic saline, or a combination thereof.
[0192] LGALS9 antisense may be chemically-modified in the same manner as described below for TGF-beta-2 antisense.
[0193] Based on reference sequence Homo sapiens galectin 9 (LGALS9), transcript variant 1, mRNA. NCBI Reference Sequence: NM_009587.3.LOCUS NM_009587 1724 bp mRNA linear PRI 28-AUG-2024. VERSION NM 009587.3.
[0194] Examples of agents of this disclosure for suppressing expression of LGALS9 include LGALS9-specific antisense oligonucleotides given in Table 2 (SEQ ID NOs: 24-46).Table 2: LGALS9-specific antisense oligonucleotidesDocket No. 018988-021W01
[0195] In some embodiments, the following criteria can be used for an antisense oligonucleotide:
[0196] A) 40% <= GC % <= 60%;
[0197] B) No GGGG in the target sequence;
[0198] C) Average unpaired probability for target site nucleotides >= 0.5;
[0199] D) For each peak in the accessibility profile that can be above the threshold probability of 0.5, all sites targeted to this same peak may be ranked by their average unpaired probability (the higher the better) and at most n sites can be selected for each peak, where n is determined by max([width of peak / site length], 2);
[0200] E) Among sites satisfying criteria A-D, the top 20 unique ones with the highest average unpaired probability may be listed.
[0201] In certain embodiments, the average unpaired probability can be used in filter criteria C, D and E to cut down the number of reported sites in order to make the disruption energy calculation as manageable.
[0202] The LGALS9 antisense sequences can be chemically-modified to provide active variants thereof, LNA variants thereof, as well as gapmer variants thereof, as known in the art. The sequences can be used in any combination as active agents, such as pooling combinations.
[0203] In some embodiments, the LGALS9 antisense sequences can be n-M-n RNA(2’-OMe)*-DNA*-RNA(2’-OMe)* gapmers, where n is from 3-7 and M is from 6- 12. In certain embodiments, the LGALS9 antisense sequences can be 3-10-3 or 5-10-5 LNA*-DNA*-LNA* or cEt*-DNA*-cEt* gapmers.Docket No. 018988-021W01
[0204] It is understood that additional antisense oligonucleotides in various formats can be constructed based on the LGALS9 gene sequence.
[0205] Any of the unmodified antisense oligonucleotides herein can have any number and order of nucleotides modified with phosphorothioate linkages. In some embodiments, all nucleotides can be modified with phosphorothioate linkages.
[0206] In some embodiments, as discussed herein, the LGALS9 antisense sequences can be gapmers formed by adding 1 to 5 protected ribo-nucleotides on each flank of the phosphorothioate deoxy-nucleotide sequences in Table 2. For example, the ribonucleotides can be protected with 2’-0Me, 2’-OEt, or 2’-0-M0E substituents, or with LNA, cMOE, or cEt bridges, as well as phosphorothioate linkages.Human IFI27-specific antisense oligodeoxynucleotides
[0207] Embodiments of this invention further include pharmaceutical compositions for suppressing expression of IFI27, or for treating or ameliorating the symptoms of cancer in a human or animal. The pharmaceutical compositions may contain a pharmaceutically acceptable salt form, an ester form, or a polymorph or stereoisomer of any active agent of this disclosure, as well as a carrier. The IFI27 agent may be selected from IFI27-specific antisense oligonucleotides. The carrier may be sterile water for injection, saline, isotonic saline, or a combination thereof.
[0208] IFI27 antisense may be chemically-modified in the same manner as described below for TGF-beta-2 antisense.
[0209] Based on reference sequence Homo sapiens interferon alpha inducible protein 27 (IFI27), transcript variant 1, mRNA; nuclear gene for mitochondrial product. NCBI Reference Sequence: NM_001130080.3.LOCUS NM_001 130080 652 bp mRNA linear PRI 02-APR-2024. VERSION NM_001 130080.3.
[0210] Examples of agents of this disclosure for suppressing expression of IFI27 include IFI27-specific antisense oligonucleotides given in Table 3 (SEQ ID NOs: 47- 66).Table 3 : IFI27-specific antisense oligonucleotidesDocket No. 018988-021W01
[0211] In some embodiments, the following criteria can be used for an antisense oligonucleotide:
[0212] A) 40% <= GC % <= 60%;
[0213] B) No GGGG in the target sequence;
[0214] C) Average unpaired probability for target site nucleotides >= 0.5;
[0215] D) For each peak in the accessibility profile that can be above the threshold probability of 0.5, all sites targeted to this same peak may be ranked by their average unpaired probability (the higher the better) and at most n sites can be selected for each peak, where n is determined by max([width of peak / site length], 2);
[0216] E) Among sites satisfying criteria A-D, the top 20 unique ones with the highest average unpaired probability may be listed.
[0217] In certain embodiments, the average unpaired probability can be used in filter criteria C, D and E to cut down the number of reported sites in order to make the disruption energy calculation as manageable.Docket No. 018988-021W01
[0218] The IFI27 antisense sequences can be chemically-modified to provide active variants thereof, LNA variants thereof, as well as gapmer variants thereof, as known in the art. The sequences can be used in any combination as active agents, such as pooling combinations.
[0219] In some embodiments, the IFI27 antisense sequences can be n-M-n RNA(2’- OMe)*-DNA*-RNA(2’-OMe)* gapmers, where n is from 3-7 and M is from 6-12. In certain embodiments, the IRI27 antisense sequences can be 3-10-3 or 5-10-5 LNA*- DNA*-LNA* or cEt*-DNA*-cEt* gapmers.
[0220] It is understood that additional antisense oligonucleotides in various formats can be constructed based on the IFI27 gene sequence.
[0221] Any of the unmodified antisense oligonucleotides herein can have any number and order of nucleotides modified with phosphorothioate linkages. In some embodiments, all nucleotides can be modified with phosphorothioate linkages.
[0222] In some embodiments, as discussed herein, the IFI27 antisense sequences can be gapmers formed by adding 1 to 5 protected ribo-nucleotides on each flank of the phosphorothioate deoxy-nucleotide sequences in Table 3. For example, the ribonucleotides can be protected with 2’-0Me, 2’-OEt, or 2’-0-M0E substituents, or with LNA, cMOE, or cEt bridges, as well as phosphorothioate linkages.Human TGF-B2-specific phosphorothioate antisense oligodeoxynucleotide
[0223] An antisense oligonucleotide (ASO) can be a single-stranded deoxyribonucleotide, which may be complementary to an mRNA target. The antisense therapy may downregulate a molecular target, which may be achieved by induction of RNase H endonuclease activity that cleaves the RNA-DNA heteroduplex with a significant reduction of the target gene translation. Other ASO mechanisms can include inhibition of 5’ cap formation, alteration of splicing process such as splice-switching, and steric hindrance of ribosomal activity.
[0224] Antisense therapeutic strategies can utilize single-stranded DNA oligonucleotides that inhibit protein production by mediating the catalytic degradation of a target mRNA, or by binding to sites on mRNA needed for translation. Antisense oligonucleotides can be designed to target the viral RNA genome or viral transcripts.Docket No. 018988-021W01Antisense oligonucleotides can provide an approach for identifying potential targets, and therefore represent potential therapeutics.
[0225] Antisense oligonucleotides can be small synthetic pieces of single-stranded DNA that may be 15-30 nucleotides in length. An ASO may specifically bind to a complementary DNA / RNA sequence by Watson-Crick hybridization and once bound to the target RNA, inhibit the translational processes either by inducing cleavage mechanisms or by inhibiting mRNA maturation. An ASO may selectively inhibit gene expression with specificity. Chemical modifications of DNA or RNA can be used to increase stability.
[0226] For example, modifications can be introduced in the phosphodiester bond, the sugar ring, and the backbone. ASO antiviral agents may block translational processes either by (i) ribonuclease H (RNAse H) or RNase P mediated cleavage of mRNA or (ii) by sterically (non- bonding) blocking enzymes that are involved in the target gene translation. Human TGF-P2-specific phosphorothioate antisense oligodeoxynucleotide (OT-101; AP 12009; Trabedersen), hereafter referred to as OT-101 or AP 12009, is intended to reduce the level of TGF-P2 protein in malignant gliomas, and thereby delay the progression of disease.
[0227] Antisense oligodeoxynucleotides are short strings of DNA that are designed to downregulate gene expression by interfering with the translation of a specific encoded protein at the mRNA level. OT-101 is a synthetic 18-mer phosphorothioate oligodeoxynucleotide (S-ODN) where all 3 ’-5’ linkages are modified to phosphorothioates. The molecular formula is Ci77H208NeoNai7094Pi7Si7 and the molecular weight 6,143 g / mol. OT-101 was designed to be complementary to a specific sequence of human TGF-P2 mRNA following expression of the gene.
[0228] OT-101 can be supplied as a lyophilized powder in 50 mL glass vials in three different quantities. Each vial is identified by the name of the investigational product, trial number, dosing group, mode of application, quantity of OT-101 contained (in mg), total volume after dissolving (in mL) and resulting concentration (in pM), name of sponsor, name of manufacturer, batch number, vial number, storage temperature, and expiry date. The study medication can be provided in closed units, packaged separately for each concentration. The packages may contain the appropriate vial(s) and all necessary components of the application system (i.e., syringes, tube, and filter). OT-101Docket No. 018988-021W01 lyophilized powder is dissolved in isotonic (0.9%) aqueous sodium chloride prior to use. A leaflet can be enclosed in the packaging with instructions on how to prepare the product for administration of the desired concentration.
[0229] Examples of agents of this disclosure for inhibiting or suppressing expression of TGF-P2 include TGF-P2-specific antisense oligonucleotides given in SEQ ID NOs:67-82 in Table 4.
[0230] In one embodiment, (OT-101) is represented by SEQ ID NO:67.Table 4: TGF-P2-specific antisense oligonucleotides
[0231] The sequences of Table 4 can be chemically-modified to provide active variants thereof, LNA variants thereof, as well as gapmer variants thereof, as known in the art. The sequences of Table 4 can be used in any combination as active agents, such as pooling combinations.
[0232] It is understood that additional antisense oligonucleotides of this disclosure can be constructed based on the TGF-P2 gene sequence.
[0233] In some embodiments, an agent of antisense sequences can be gapmers formed by adding 1 to 5 protected ribo-nucleotides on each flank of the phosphorothioate deoxy-nucleotide sequences in Table 4. For example, the riboDocket No. 018988-021W01 nucleotides can be protected with 2’-0Me, 2’-OEt, or 2’-0-M0E substituents, or with LNA, cMOE, or cEt bridges, as well as phosphorothioate linkages.
[0234] In some embodiments, an agent of antisense sequences can be a n-M-n RNA(2’-OMe)*-DNA*-RNA(2’-OMe)* gapmer, where n is from 3-7 and M is from 6- 12. In certain embodiments, the gapmer can be a 3-10-3 or 5-10-5 LNA*-DNA*-LNA* or cEt*-DNA*-cEt* gapmer (* designates phosphorothioate linkages).
[0235] Embodiments of this invention further include pharmaceutical compositions for inhibiting or suppressing expression of TGF-P, or for treating or ameliorating the symptoms of cancer in a human or animal. The pharmaceutical compositions may contain a TGF-P inhibitor, artemisinin, pharmaceutically acceptable salts forms, esters, polymorphs or stereoisomers thereof, and any combination thereof, as well as a carrier. The TGF-P inhibitor may be selected from TGF-P2-specific antisense oligonucleotides. The carrier may be sterile water for injection, saline, isotonic saline, or a combination thereof.
[0236] A composition of this disclosure may be substantially free of excipients. Compositions of this invention which are substantially free of excipients have been found to be surprisingly stable in a carrier. In some embodiments, the composition may be stable for at least 14 days, or at least 21 days, or at least 28 days in a carrier at 37°C.
[0237] In additional embodiments, a pharmaceutical composition for infusion may contain less than 1% by weight of excipients, or less than 0.5% by weight of excipients, or less than 0.1% by weight of excipients.
[0238] As used herein, the terms TGF-P2 and TGFB2 have the same meaning.QT-101 antisense oligonucleotide drug product
[0239] The API trabedersen / OT-101 is a synthetic 18-mer S-ODN consisting of the bases adenine (A), thymine (T), guanine (G), and cytosine (C), with all 3'-5' linkages modified to phosphorothioates. This sulfur modification makes the drug more resistant to degradation, resulting in an increased stability in vitro and in vivo. Its molecular structure (nucleotide sequence) was designed to be complementary to a specific sequence of human transforming growth factor-beta 2 (TGF-P2) mRNA. This sequence was selected among related molecules for its superior chemical and structural properties,Docket No. 018988-021W01 biological activity, and specificity to achieve the best antisense effects in vitro and in vivo.
[0240] The chemical structure, exemplary of the phosphorothioate moieties (C-A-G), and the physical characteristics of trabedersen are shown in Table 5.Table 5 : Chemical and Physical Characteristics of Trabedersen
[0241] The IMP is supplied as a sterile lyophilizate for solution for infusion in 50H glass vials (primary container) containing 7.37 mg trabedersen (intratumoral treatment) and in 20R glass vials (primary container) containing 250 mg trabedersen (intravenous treatment), respectively. No excipients are in the finished drug product. These glass vials are commonly used for parenterals. Sterile rubber stoppers appropriate for lyophilization seal the glass vial. The stopper is sealed with a crimping capsule that includes a colored flip-off cap. For clinical use, each vial is provided within a white-colored folding box to protect the vials from light exposure and damage during transport. Both, the glass vials and the folding boxes are labeled according to local requirements. The primary as well as secondary containers of the closure system fulfill international quality standards for the packaging of sterile solid drug products for injections.Docket No. 018988-021W01Cancer therapeutic strategies
[0242] Some therapeutic strategies of this invention are set forth below.
[0243] In some embodiments, when TGFB2 is elevated in pancreatic cancer tumor tissue, then overall survival (OS) can be improved when the mRNA levels of one or more of ten tumor-associated macrophage (TAM) markers are reduced along with TGF- P2 being reduced.
[0244] A therapeutic strategy may have the goal to reach a patient disease state in which all markers are suppressed because when TGF-P2 and one or more of ten tumor- associated macrophage (TAM) markers are both reduced, overall survival can be surprisingly improved.
[0245] As used herein, TAM markers can refer to IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB 1, and HLA-F.
[0246] In some embodiments, patients can be selected who have TGF-P2 elevated, and other TAM markers reduced. If the patient has the other TAM markers reduced, but TGF-P2 elevated, then suppressing TGF-P2 surprisingly improves overall survival. Thus, selecting patients for therapy who have TGF-P2 elevated and TAM markers reduced, and treating such patients with a TGF-P2 antisense agent such as OT-101 can surprisingly improve overall survival.
[0247] In further embodiments, patients can be selected who have IRF9 elevated, but TGFB2 and TAM markers reduced. Elevated IRF9 can be a validated target for the cancer. If the patient has TGFB2 and TAM markers reduced, but IRF9 elevated, then suppressing IRF9 can surprisingly improve overall survival. Thus, selecting patients for therapy who have IRF9 elevated and TGFB2 and TAM markers reduced, and treating such patients with an IRF9 antisense agent can surprisingly improve overall survival.
[0248] In additional embodiments, patients can be selected who have LGALS9 elevated, and TGFB2 and TAM markers reduced. If the patient has TGFB2 and TAM markers reduced, but LGALS9 elevated, then suppressing LGALS9 surprisingly improves overall survival. Thus, selecting patients for therapy who have LGALS9 elevated and TGFB2 and TAM markers reduced, and treating such patients with an LGALS9 antisense agent can surprisingly improve overall survival.
[0249] In certain embodiments, patients can be selected who have IFI27 elevated, and TGFB2 and TAM markers reduced. If the patient has TGFB2 and TAM markersDocket No. 018988-021W01 reduced, but IFI27 elevated, then suppressing IFI27 surprisingly improves overall survival. Thus, selecting patients for therapy who have IFI27 elevated and TGFB2 and TAM markers reduced, and treating such patients with an IFI27 antisense agent can surprisingly improve overall survival.
[0250] In some embodiments, a combination therapy can include selecting patients who have IRF9 and TGFB2 elevated, and TAM markers reduced. If the patient has TAM markers reduced, but IRF9 and TGFB2 elevated, then suppressing IRF9 and TGFB2 surprisingly improves overall survival. Thus, selecting patients for therapy who have IRF9 and TGFB2 elevated and TAM markers reduced, and treating such patients with an IRF9 antisense agent and TGFB2 antisense agent (OT-101) can surprisingly improve overall survival.
[0251] In further embodiments, a combination therapy can include selecting patients who have LGALS9 and TGFB2 elevated, and TAM markers reduced. If the patient has TAM markers reduced, but LGALS9 and TGFB2 elevated, then suppressing LGALS9 and TGFB2 surprisingly improves overall survival. Thus, selecting patients for therapy who have LGALS9 and TGFB2 elevated and TAM markers reduced, and treating such patients with an LGALS9 antisense agent and TGFB2 antisense agent (OT-101) can surprisingly improve overall survival.
[0252] In additional embodiments, a combination therapy can include selecting patients having IFI27 and TGFB2 elevated, and TAM markers reduced. If the patient has TAM markers reduced, but IFI27 and TGFB2 elevated, then suppressing IFI27 and TGFB2 surprisingly improves overall survival. Thus, selecting patients for therapy who have IFI27 and TGFB2 elevated and TAM markers reduced, and treating such patients with an IFI27 antisense agent and TGFB2 antisense agent (OT-101) can surprisingly improve overall survival.
[0253] The above-outlined therapeutic embodiments together can include for active treatment all patients with active cancer because:(a) If TGFB2 alone is elevated, then TGFB2 antisense agent (OT-101) can be used.(b) If TGFB2 is elevated, and another target is also elevated, a combination therapy can suppress TGFB2 and the other elevated target.(c) If TGFB2 is reduced, and a different target is elevated, an active agent can suppress the different target.Docket No. 018988-021W01
[0254] When TGFB2 is not elevated and no TAM marker is elevated, then therapy is not required, and such patients may not be treated.
[0255] In some embodiments, TGF-P2 is elevated when TGF-P2 mRNA is elevated above median of a control group or above median of non-disease tissue.
[0256] In some embodiments, a biomarker such as one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB 1, and HLA-F is reduced when its mRNA is reduced below median of a control group or below median of non-disease tissue.
[0257] In some embodiments, a biomarker such as one or more of IRF9, LGALS9, and IFI27 is elevated when its mRNA is elevated above median of a control group or above median of non-disease tissue.Additional anti-cancer methods and compositions
[0258] Any of the foregoing therapies may be combined with a standard of care treatment for cancer. Anti-cancer therapies and agents can be administered by infusion, injection, or intracranial continuous infusion.
[0259] Any of the foregoing therapies may be combined with one or more additional medicaments comprising a targeted cancer drug, a cancer growth blocker, or an EGFR inhibitor, erlotinib, gefitinib, afatinib, osimertinib, dacomitininb, and combinations thereof.
[0260] In some embodiments, any of the foregoing therapies may be combined with one or more additional medicaments which are targeted cancer drugs selected from bevacizumab, everolimus, belzutifan, dabrafenib, trametinib, and combinations thereof.
[0261] In further embodiments, any of the foregoing therapies may be combined with one or more additional medicaments which are cancer growth blockers selected from an angiogenesis inhibitor, a histone deacetylase inhibitor, a hedgehog blocker, an mTOR inhibitor, a p53 inhibitor, a PARP inhibitor, a proteasome inhibitor, a tyrosine kinase inhibitor, and combinations thereof.
[0262] In certain embodiments, any of the foregoing therapies may be combined with one or more additional medicaments for treatment of glioma selected from TMZ, radiation, and bevacizumab, or comprising any one or more additional medicaments forDocket No. 018988-021W01 treatment of pancreatic cancer selected from paclitaxel, gemcitabine, 5FU, leucovrin, nal-Irinotecan, FOLFOX, FOLFIRI, FOLFIRINOX, and nal-FIRINOX.
[0263] Numbered embodiments of this invention include the following:
[0264] (1) A composition comprising an agent for suppressing expression of TGF-P2 for treating or ameliorating the symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 elevated and (b) one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0265] (2) A composition comprising an agent for suppressing expression of TGF-P2 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 elevated and (b) one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0266] (3) A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of TGFB2; and administering a therapeutically sufficient amount of the composition to the subject, wherein the subject is selected who has (a) TGF-P2 elevated and (b) one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0267] (4) The composition or method of any of embodiments 1-3, wherein the cancer is pancreatic cancer.
[0268] (5) The composition or method of any of embodiments 1-4, wherein the cancer is characterized by non-immunogenic tumors.
[0269] (6) The composition or method of any of embodiments 1-5, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0270] (7) The composition or method of any of embodiments 1-6, wherein the agent for suppressing expression of TGF-P2 is (OT-101) C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO: 67 or CGGCATGTCTATTTTGTA SEQ ID NO: 75.
[0271] (8) The composition or method of any of embodiments 1-7, wherein the composition comprises a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.Docket No. 018988-021W01
[0272] (9) The composition or method of any of embodiments 1-8, wherein the composition is substantially free of excipients.
[0273] (10) The composition or method of any of embodiments 1-9, wherein the composition is stable for at least 14 days in carrier at 37°C.
[0274] (11) The composition or method of any of embodiments 1-10, wherein the subject after the administration has reduced TGF-P2 mRNA expression.
[0275] (12) The composition or method of any of embodiments 1-11, wherein the administration increases survival rate at month 6, 12, 18, 24, 30, or 36.
[0276] (13) The composition or method of any of embodiments 1-12, wherein the administration of the composition is combined with a standard of care treatment for cancer, wherein the standard of care treatment comprises chemotherapy or radiation therapy.
[0277] (14) An agent for suppressing expression of IRF9 for treating or ameliorating the symptoms of cancer in a subject.
[0278] (15) A composition comprising an agent for suppressing expression of IRF9 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.
[0279] (16) A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of IRF9; and administering a therapeutically sufficient amount of the composition to the subject.
[0280] (17) The agent, composition or method of any of embodiments 14-16, wherein the cancer is pancreatic cancer.
[0281] (18) The agent, composition or method of any of embodiments 14-17, wherein the cancer is characterized by non-immunogenic tumors.
[0282] (19) The agent, composition or method of any of embodiments 14-18, wherein the subject is selected who has (a) IRF9 elevated and (b) one or more of TGF-P2, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0283] (20) The agent, composition or method of any of embodiments 14-19, wherein the agent, medicament or administration comprises one or more IRF9-specific antisense oligonucleotides complementary to a IRF9 transcript and 15-30 nucleotides in length.
[0284] (21) The agent, composition or method of any of embodiments 14-20, wherein the agent, medicament or administration comprises one or more IRF9-specific antisenseDocket No. 018988-021W01 oligonucleotides complementary to a IRF9 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.
[0285] (22) The agent, composition or method of any of embodiments 14-21, wherein the agent, medicament or administration comprises one or more IRF9-specific antisense oligonucleotides complementary to a IRF9 transcript as in Table 1.
[0286] (23) The agent, composition or method of any of embodiments 14-22, wherein the agent, medicament or administration comprises IRF9-specific antisense oligonucleotides CAATGTCTGAATGGACTGCT SEQ ID NO: 8 or C*A*A*T*G*T*C*T*G*A*A*T*G*G*A*C*T*G*C*T SEQ ID NO: 1.
[0287] (24) The agent, composition or method of any of embodiments 14-23, comprising an IRF9-specific antisense oligonucleotide as in Table 1 having one or more nucleotides chemically modified as a phosphorothioate internucleoside linkage, a methoxypropylphosphonate intemucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-OMe ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’-4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5-methylcytodine base.
[0288] (25) The agent, composition or method of any of embodiments 14-24, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.
[0289] (26) The agent, composition or method of any of embodiments 14-25, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.
[0290] (27) The agent, composition or method of any of embodiments 14-26, wherein the agent, medicament or administration is substantially free of excipients.
[0291] (28) The agent, composition or method of any of embodiments 14-27, wherein the agent, medicament or administration is stable for at least 14 days in carrier at 37°C.
[0292] (29) The agent, composition or method of any of embodiments 14-28, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.
[0293] (30) The agent, composition or method of any of embodiments 14-29, wherein the agent or medicament is administered by infusion or injection.Docket No. 018988-021W01
[0294] (31) The agent, composition or method of any of embodiments 14-30, wherein the agent, medicament or administration increases survival rate of subjects at month 6, 12, 18, 24, 30, or 36.
[0295] (32) An agent for suppressing expression of LGALS9 for treating or ameliorating the symptoms of cancer in a subject.
[0296] (33) A composition comprising an agent for suppressing expression of LGALS9 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.
[0297] (34) A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of LGALS9; and administering a therapeutically sufficient amount of the composition to the subject.
[0298] (35) The composition or method of any of embodiments 32-34, wherein the cancer is pancreatic cancer.
[0299] (36) The agent, composition or method of any of embodiments 32-35, wherein the cancer is characterized by non-immunogenic tumors.
[0300] (37) The agent, composition or method of any of embodiments 32-36, wherein the subject is selected who has (a) LGALS9 elevated and (b) one or more of TGF-P2, IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0301] (38) The agent, composition or method of any of embodiments 32-37, wherein the agent, medicament or administration comprises one or more LGALS9-specific antisense oligonucleotides complementary to a LGALS9 transcript and 15-30 nucleotides in length.
[0302] (39) The agent, composition or method of any of embodiments 32-38, wherein the agent, medicament or administration comprises one or more LGALS9-specific antisense oligonucleotides complementary to a LGALS9 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.
[0303] (40) The agent, composition or method of any of embodiments 32-39, wherein the agent, medicament or administration comprises one or more LGALS9-specific antisense oligonucleotides complementary to a LGALS9 transcript as in Table 2.
[0304] (41) The agent, composition or method of any of embodiments 32-40, wherein the agent, medicament or administration comprises LGALS9-specific antisense oligonucleotidesDocket No. 018988-021W01CTTGAATAGTCCCAGAAAAG SEQ ID NO: 28 OF C*T*T*G*A*A*T*A*G*T*C*C*C*A*G*A*A*A*A*G SEQ ID NO:24.
[0305] (42) The agent, composition or method of any of embodiments 32-41, comprising a LGALS9-specific antisense oligonucleotide as in Table 2 having one or more nucleotides chemically modified as a phosphorothioate intemucleoside linkage, a methoxypropylphosphonate internucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-OMe ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’ -4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5-methylcytodine base.
[0306] (43) The agent, composition or method of any of embodiments 32-42, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.
[0307] (44) The agent, composition or method of any of embodiments 32-43, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.
[0308] (45) The agent, composition or method of any of embodiments 32-44, wherein the agent, medicament or administration is substantially free of excipients.
[0309] (46) The agent, composition or method of any of embodiments 32-45, wherein the agent, medicament or administration is stable for at least 14 days in carrier at 37°C.
[0310] (47) The agent, composition or method of any of embodiments 32-46, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.
[0311] (48) The agent, composition or method of any of embodiments 32-47, wherein the agent is administered by infusion or injection.
[0312] (49) The agent, composition or method of any of embodiments 32-48, wherein the agent, medicament or administration increases survival rate of subjects at month 6, 12, 18, 24, 30, or 36.
[0313] (50) An agent for suppressing expression of IFI27 for treating or ameliorating the symptoms of cancer in a subject.
[0314] (51) A composition comprising an agent for suppressing expression of IFI27 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.
[0315] (52) A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising:Docket No. 018988-021W01 preparing a pharmaceutical composition comprising an agent for suppressing expression of IFI27; and administering a therapeutically sufficient amount of the composition to the subject.
[0316] (53) The agent, composition or method of any of embodiments 50-52, wherein the cancer is pancreatic cancer.
[0317] (54) The agent, composition or method of any of embodiments 50-53, wherein the cancer is characterized by non-immunogenic tumors.
[0318] (55) The agent, composition or method of any of embodiments 50-54, wherein the subject is selected who has (a) IFI27 elevated and (b) one or more of TGF-P2, IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0319] (56) The agent, composition or method of any of embodiments 50-55, wherein the agent, medicament or administration comprises one or more IFI27-specific antisense oligonucleotides complementary to a IFI27 transcript and 15-30 nucleotides in length.
[0320] (57) The agent, composition or method of any of embodiments 50-56, wherein the agent, medicament or administration comprises one or more IFI27-specific antisense oligonucleotides complementary to a IFI27 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.
[0321] (58) The agent, composition or method of any of embodiments 50-57, wherein the agent, medicament or administration comprises one or more IFI27-specific antisense oligonucleotides complementary to a IFI27 transcript as in Table 3.
[0322] (59) The agent, composition or method of any of embodiments 50-58, wherein the agent, medicament or administration comprises IFI27-specific antisense oligonucleotides GTATATTTGGGATAGTTGGC SEQ ID NO: 61 orG*T*A*T*A*T*T*T*G*G*G*A*T*A*G*T*T*G*G*C SEQ ID NO:47.
[0323] (60) The agent, composition or method of any of embodiments 50-59, comprising a IFI27-specific antisense oligonucleotide as in Table 3 having one or more nucleotides chemically modified as a phosphorothioate internucleoside linkage, a methoxypropylphosphonate intemucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-OMe ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’-4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5-methylcytodine base.Docket No. 018988-021W01
[0324] (61) The agent, composition or method of any of embodiments 50-60, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.
[0325] (62) The agent, composition or method of any of embodiments 50-61, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.
[0326] (63) The agent, composition or method of any of embodiments 50-62, wherein the agent, medicament or administration is substantially free of excipients.
[0327] (64) The agent, composition or method of any of embodiments 50-63, wherein the agent, medicament or administration is stable for at least 14 days in carrier at 37°C.
[0328] (65) The agent, composition or method of any of embodiments 50-64, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.
[0329] (66) The agent, composition or method of any of embodiments 50-65, wherein the agent or medicament is administered by infusion or injection.
[0330] (67) The agent, composition or method of any of embodiments 50-66, wherein the agent, medicament or administration increases survival rate of subjects at month 6, 12, 18, 24, 30, or 36.
[0331] (68) A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IRF9 for use in treating or ameliorating symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 and IRF9 elevated and (b) one or more of LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA- DRB1, and HLA-F reduced.
[0332] (69) A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IRF9 for use in the preparation of a medicament for treating or ameliorating symptoms of a cancer in a subject, wherein the subject is selected who has (a) TGF-P2 and IRF9 elevated and (b) one or more of, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0333] (70) A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: selecting the subject who has (a) TGF-P2 and IRF9 elevated and (b) one or more of LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced;Docket No. 018988-021W01 administering an agent for suppressing expression of TGF-P2; and administering an agent for suppressing expression of IRF9; wherein the agent for suppressing expression of TGF-P2 and the agent for suppressing expression of IRF9 are administered concurrently, simultaneously, sequentially, or separately in time.
[0334] (71) The composition or method of any of embodiments 68-70, wherein the cancer is pancreatic cancer.
[0335] (72) The composition or method of any of embodiments 68-71, wherein the cancer is characterized by non-immunogenic tumors.
[0336] (73) The composition or method of any of embodiments 68-72, wherein the composition or medicament is administered by infusion or injection.
[0337] (74) The composition or method of any of embodiments 68-73, wherein the TGF-P2 and the one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA- DQB1, HLA-DRB1, and HLA-F have an mRNA level elevated above a median of a control group of subjects having the same cancer.
[0338] (75) The composition or method of any of embodiments 68-74, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0339] (76) The composition or method of any of embodiments 68-75, wherein the agent for suppressing expression of TGF-P2 is (OT-101) C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO: 67 or CGGCATGTCTATTTTGTA SEQ ID NO: 75.
[0340] (77) The composition or method of any of embodiments 68-76, wherein the agent for suppressing expression of IRF9 is selected from Table 1, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0341] (78) The composition or method of any of embodiments 68-77, wherein the agent for suppressing expression of IRF9 is C*A*A*T*G*T*C*T*G*A*A*T*G*G*A*C*T*G*C*T SEQ ID NO: 1 or CAATGTCTGAATGGACTGCT SEQ ID NO: 8.
[0342] (79) The composition or method of any of embodiments 68-78, wherein the compositions comprise a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.
[0343] (80) The composition or method of any of embodiments 68-79, wherein the composition is substantially free of excipients.Docket No. 018988-021W01
[0344] (81) The composition or method of any of embodiments 68-80, wherein the composition is stable for at least 14 days in carrier at 37°C.
[0345] (82) The composition or method of any of embodiments 68-81, wherein the subject after the administration or use has a reduced TGF-P2 expression.
[0346] (83) The composition or method of any of embodiments 68-82, wherein the administration or use increases survival rate at month 6, 12, 18, 24, 30, or 36.
[0347] (84) A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of LGALS9 for use in treating or ameliorating symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 and LGALS9 elevated and (b) one or more of IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0348] (85) A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of LGALS9 for use in the preparation of a medicament for treating or ameliorating symptoms of a cancer in a subject, wherein the subject is selected who has (a) TGF-P2 and LGALS9 elevated and (b) one or more of IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0349] (86) A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: selecting the subject who has (a) TGF-P2 and LGALS9 elevated and (b) one or more of IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced; administering an agent for suppressing expression of TGF-P2; and administering an agent for suppressing expression of LGALS9; wherein the agent for suppressing expression of TGF-P2 and the agent for suppressing expression of LGALS9 are administered concurrently, simultaneously, sequentially, or separately in time.
[0350] (87) The composition or method of any of embodiments 84-86, wherein the cancer is pancreatic cancer.
[0351] (88) The composition or method of any of embodiments 84-87, wherein the cancer is characterized by non-immunogenic tumors.
[0352] (89) The composition or method of any of embodiments 84-88, wherein the composition or medicament is administered by infusion or injection.Docket No. 018988-021W01
[0353] (90) The composition or method of any of embodiments 84-89, wherein the TGF-P2 and the one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA- DQB1, HLA-DRB1, and HLA-F have an mRNA level elevated above a median of a control group of subjects having the same cancer.
[0354] (91) The composition or method of any of embodiments 84-90, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0355] (92) The composition or method of any of embodiments 84-91, wherein the agent for suppressing expression of TGF-P2 is (OT-101) C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO: 67 or CGGCATGTCTATTTTGTA SEQ ID NO: 75.
[0356] (93) The composition or method of any of embodiments 84-92, wherein the agent for suppressing expression of LGALS9 is selected from Table 2, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0357] (94) The composition or method of any of embodiments 84-93, wherein the agent for suppressing expression of LGALS9 is CTTGAATAGTCCCAGAAAAG SEQ ID NO:28 or C*T*T*G*A*A*T*A*G*T*C*C*C*A*G*A*A*A*A*G SEQ ID NO:24.
[0358] (95) The composition or method of any of embodiments 84-94, wherein the agents or compositions comprise a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.
[0359] (96) The composition or method of any of embodiments 84-95, wherein the composition is substantially free of excipients.
[0360] (97) The composition or method of any of embodiments 84-96, wherein the composition is stable for at least 14 days in carrier at 37°C.
[0361] (98) The composition or method of any of embodiments 84-97, wherein the subject upon the administration or use has a reduced TGF-P2 expression.
[0362] (99) The composition or method of any of embodiments 84-98, wherein the administration or use increases survival rate at month 6, 12, 18, 24, 30, or 36.
[0363] (100) A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IFI27 for use in treating or ameliorating symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 and IFI27 elevated and (b) one or more of IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA- DQB1, HLA-DRB1, and HLA-F reduced.Docket No. 018988-021W01
[0364] (101) A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IFI27 for use in the preparation of a medicament for treating or ameliorating symptoms of a cancer in a subject, wherein the subject is selected who has (a) TGF-P2 and IFI27 elevated and (b) one or more of IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
[0365] (102) A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: selecting the subject who has (a) TGF-P2 and IFI27 elevated and (b) one or more of IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced; and administering an agent for suppressing expression of TGF-P2; and administering an agent for suppressing expression of IFI27; wherein the agent for suppressing expression of TGF-P2 and the agent for suppressing expression of IFI27 are administered concurrently, simultaneously, sequentially, or separately in time.
[0366] (103) The composition or method of any of embodiments 100-102, wherein the cancer is pancreatic cancer.
[0367] (104) The composition or method of any of embodiments 100-103, wherein the cancer is characterized by non-immunogenic tumors.
[0368] (105) The composition or method of any of embodiments 100-104, wherein the composition or medicament is administered by infusion or injection.
[0369] (106) The composition or method of any of embodiments 100-105, wherein the TGF- P2 and the one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA- DQB1, HLA-DRB1, and HLA-F have an mRNA level elevated above a median of a control group of subjects having the same cancer.
[0370] (107) The composition or method of any of embodiments 100-106, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0371] (108) The composition or method of any of embodiments 100-107, wherein the agent for suppressing expression of TGF-P2 is (OT-101)C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO:67 or CGGCATGTCTATTTTGTA SEQ ID NO:75.Docket No. 018988-021W01
[0372] (109) The composition or method of any of embodiments 100-108, wherein the agent for suppressing expression of IFI27 is selected from Table 3, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
[0373] (110) The composition or method of any of embodiments 100-109, wherein the agent for suppressing expression of IFI27 is GTATATTTGGGATAGTTGGC SEQ ID NO:61 or G*T*A*T*A*T*T*T*G*G*G*A*T*A*G*T*T*G*G*C SEQ ID NO:47.
[0374] (111) The composition or method of any of embodiments 100-110, wherein the composition comprises a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.
[0375] (112) The composition or method of any of embodiments 100-111, wherein the composition is substantially free of excipients.
[0376] (113) The composition or method of any of embodiments 100-112, wherein the composition is stable for at least 14 days in carrier at 37°C.
[0377] (114) The composition or method of any of embodiments 100-113, wherein the subject after the administration or use has a reduced TGF-P2 expression.
[0378] (115) The composition or method of any of embodiments 100-114, wherein the administration or use increases survival rate at month 6, 12, 18, 24, 30, or 36.
[0379] (116) A method for collecting data, the method comprising: obtaining data relating to a group of subjects to generate a dataset comprising mRNA or protein levels for at least two biomarkers comprising TGF-P2 and one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F.
[0380] (117) The method of embodiment 116, comprising obtaining one or more clinical parameters from the subjects selected from age, sex, race / ethnicity, medical history, alcohol, and smoking.
[0381] (118) A method for diagnosing or prognosing pancreatic cancer in an individual subject, the method comprising: obtaining data relating to a control group of subjects to generate a dataset comprising mRNA or protein levels for at least two biomarkers comprising TGF-P2 and one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F; obtaining data relating to an individual subject to generate a dataset comprising mRNA or protein levels for at least two biomarkers comprising TGF-P2 and one or more ofDocket No. 018988-021W01IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F; comparing the dataset obtained from the individual subject to the dataset of the control group; and determining differences between the individual subject and the control group exceeding a threshold for indicating pancreatic cancer in the individual subject.
[0382] (119) The method of embodiment 118, comprising obtaining one or more clinical parameters from the subjects selected from age, sex, race / ethnicity, medical history, alcohol, and smoking.
[0383] (120) The method of any of embodiments 118-119, comprising diagnosing or prognosing pancreatic cancer in the subject.
[0384] (121) The method of any of embodiments 118-120, comprising treating the subject for pancreatic cancer by administering an anti -cancer drug.Additional embodiments.
[0385] This invention also contemplates a composition, therapeutic use, medicament or method comprising any combination, whether co-formulated or utilized individually in a combined therapy, of the agents described in numbered embodiments 1-115. This invention further contemplates that such compositions, therapeutic uses, medicaments and methods utilize any combination of the biomarkers, parameters and features described in numbered embodiments 1-115.
[0386] All publications including patents, patent application publications, and nonpatent publications referred to in this description, as well as the sequence listing are each expressly incorporated herein by reference in their entirety for all purposes.
[0387] Although the foregoing disclosure has been described in detail by way of example for purposes of clarity of understanding, it will be apparent to the artisan that certain changes and modifications are comprehended by the disclosure and may be practiced without undue experimentation within the scope of the appended claims, which are presented by way of illustration not limitation. This invention includes all such additional embodiments, equivalents, and modifications. This invention includes any combinations or mixtures of the features, materials, elements, or limitations of the various illustrative components, examples, and claimed embodiments.Docket No. 018988-021W01
[0388] The designations of agents, compounds and structures of this disclosure are meant to encompass all possible isomers, stereoisomers, diastereomers, enantiomers, and / or optical isomers that would be understood to exist for the specified structure, including any mixture, racemic or otherwise, thereof.EXAMPLES
[0389] Example 1: This example shows TGFB2 mRNA levels have a significant negative prognostic impact at low macrophage levels in PDAC tumors. OS survival data correlated with mRNA expression for PDAC patients were depicted as Kaplan- Meier curves to determine the prognostic impact of TGFB2 ligand (TGFB2 median expression cut-off values for high versus low mRNA expression patient sub-groupings).
[0390] FIG. 1 A shows TGFB2 mRNA levels have a significant negative prognostic impact at low macrophage levels in PDAC tumors. OS survival data correlated with mRNA expression for PDAC patients were depicted as Kaplan-Meier curves to determine the prognostic impact of TGFB2 ligand (TGFB2 median expression cut-off values for high versus low mRNA expression patient sub-groupings) for all PDAC patients (A. N=177). The median OS time for 88 patients from the TGFB21ow group (20.5 (95% CI: 17.2 - NA, Events = 43) months)) was not significantly different from the TGFB2high group (N=89, Median OS = 19.9 (95% CI: 16 - 24.4, Events = 49) months; Log-rank Chi-Square = 1.91, P = 0.167) of PDAC patients.
[0391] FIG. IB shows TGFB2 mRNA levels have a significant negative prognostic impact at low macrophage levels in PDAC tumors. OS survival data correlated with mRNA expression for PDAC patients were depicted as Kaplan-Meier curves to determine the prognostic impact of TGFB2 ligand (TGFB2 median expression cut-off values for high versus low mRNA expression patient sub-groupings) for all PDAC patients with low macrophage populations (B. N=68). PDAC patients with low macrophage burden exhibited a significantly improved OS outcome in the TGFB21ow group of patients (N=34; Median = 72.7 (95% CI: 17.7 - NA, Events = 13) months) compared with the TGFB2high group (N=34; Median = 15.3 (95% CI: 9.3 - NA, Events = 21) months; Log-rank Chi-Square = 9.12, P = 0.00252).
[0392] FIG. 1C shows TGFB2 mRNA levels have a significant negative prognostic impact at low macrophage levels in PDAC tumors. OS survival data correlated with mRNA expression for PDAC patients were depicted as Kaplan-Meier curves toDocket No. 018988-021W01 determine the prognostic impact of TGFB2 ligand (TGFB2 median expression cut-off values for high versus low mRNA expression patient sub-groupings) for PDAC patients with low macrophage and low neoantigen levels (C. N=47). In PDAC patients with decreased macrophage and neoantigen levels, the TGFB21ow PDAC group (N=24, Median = 72.7 (95% CI: 72.7 - NA, Events = 5) months) experienced significantly longer OS times than the TGFB2high group of patients (Median = 23, Median = 15.3 (95% CI: 9.2 - NA, Events = 15) months; Log-rank Chi-Square = 15.66, P < 0.001).
[0393] Example 2: FIG. 2 shows PDAC patients with low levels of TGFB2 and low levels of IRF9 mRNA expression exhibited improved OS times than patients with high levels of TGFB2 or IRF9 mRNA expression.
[0394] The median survival times for four different groups of patients are as follows: for 48 patients in group TGFB21ow / IRF91ow, the median survival time was 72 months (95% CI: 43.8 - NA, Events = 14); for 40 patients in group TGFB21ow / IRF9high, the median survival time was 16 months (95% CI: 12 - 20.2, Events = 27); for 40 patients in group TGFB2high / IRF91ow, the median survival time was 19 months (95% CI: 13.8 - 24.3, Events = 25); and, for 49 patients in group TGFB2high / IRF9high, the median survival time was 20 months (95% CI: 15.1 - 30, Events = 26). TGFB21ow / IRF91ow group of patients exhibited significantly longer survival times compared to all combinations of TGFB2 and IRF9 expression levels (P-value = 0.0003, 0.0004, and 0.0005 for TGFB21ow / IRF9high, TGFB2high / IRF91ow and TGFB2high / IRF9high respectively.
[0395] Example 3: FIG. 3 shows PDAC patients with low levels of TGFB2 and low levels of IFI27 mRNA expression exhibited improved OS times than patients with high levels of TGFB2 or IFI27 mRNA expression.
[0396] Results of the OS examination for each group are as follows: 48 patients from TGFB21ow / IFI271ow had a median survival time of 72 months (95% CI: 21.4 - NA, Events = 15). 40 patients from TGFB21ow / IFI27high had a median survival time of 16 months (95% CI: 12.9 - 37.1, Events = 26). 40 patients from TGFB2high / IFI271ow had a median survival time of 19 months (95% CI: 15.1 - 30, Events = 25). Finally, 49 patients from TGFB2high / IFI27high had a median survival time of 20 months (95% CI: 15.1 - 22.8, Events = 26). TGFB21ow / IFI271ow group of patients exhibited significantlyDocket No. 018988-021W01 longer survival times compared to all combinations of TGFB2 and IFI27 expression levels (P-value = 0.004 for all comparisons).
[0397] Example 4 : FIG. 4 shows PDAC patients with high levels of IFNAR1 / STAT1 / IRF9 / IFI27 mRNA expression exhibited significantly increased hazard ratios in multivariate Cox proportional hazards model considering age, and TGFB2 levels.
[0398] Multivariate analyses of the potential prognostic impact of TGFB2 mRNA expression levels paired with IFNAR1 (A), STAT1 (B), IRF9 (C), and IFI27 (D) mRNA expression levels on OS were determined using the multivariate Cox proportional hazards model to adjust for age, and TGFB2 interaction with IFNAR1 / STAT1 / IRF9 / IFI27. High levels of TGFB2 exhibited significant increases in HR for models with IFNAR1 (HR (95% CI range) = 2.27 (1.18-4.36); P = 0.014), IRF9 (HR (95% CI range) = 3.32 (1.71-6.47); P < 0.001) and IFI27 (HR (95% CI range) = 2.74 (1.42-5.28) and P = 0.003). IFNAR1 (HR (95% CI range) = 2.22 (1.17-4.22); P = 0.015), STAT1 (HR (95% CI range) = 2 (1.08-3.71); P = 0.029), IRF9 (HR (95% CI range) = 3.5 (1.82-6.72); P < 0.001) and IFI27 (HR (95% CI range) = 2.56 (1.34-4.87) and P = 0.004) showed significant increases in models that included TGFB2 expression controlling for age at diagnosis and interaction terms. *** indicates P < 0.01, ** indicates P < 0.01, and * indicates P < 0.05.
[0399] Example 5: FIG. 5A shows a comparison generated of normal versus tumor tissue samples for genes exhibiting significant prognostic impacts on OS from the multivariate Cox regression models. Multivariate analyses of the potential effect of TGFB2 in combination with macrophage markers (CD68 (Ml), MRC1 / CD206 (M2), and 17 identified from single-cell RNA seq experiments), TGFB1, IFNAR1, IFI27, and IRF9 levels on OS were determined using the multivariate Cox proportional hazards model adjusted for age. [A] The table shows the calculated HRs for: (i) The mRNA expression level for TGFB2 as a categorical variable comparing high (N=89) versus low (N=88) TGFB2 mRNA expression levels (50% cut-off for the range of TPM values), (ii) The mRNA expression level for the companion gene, Gene 2 as a categorical variable comparing high (N=89) versus low (N=88) Gene 2 mRNA expression levels (50% cutoff for the range of TPM values), (iii) Age at Diagnosis as a linear covariate, and an interaction term (TGFB2 x Gene2) included in the model. The table is orderedDocket No. 018988-021W01 according to descending order of TGFB2 expression impact on OS. Nine genes exhibited significant increases in HR for TGFB2 expression, Gene 2 expression, and a significant interaction term (C1QA, CD74, HLA-DQB1, HLA-DRB 1, HLA-F, IFI27, IRF9, LGALS9, MARCO).
[0400] FIG. 5B shows a comparison generated of normal versus tumor tissue samples for genes exhibiting significant prognostic impacts on OS from the multivariate Cox regression models. Multivariate analyses of the potential effect of TGFB2 in combination with macrophage markers (CD68 (Ml), MRC1 / CD206 (M2), and 17 identified from single-cell RNA seq experiments), TGFB1, IFNAR1, IFI27, and IRF9 levels on OS were determined using the multivariate Cox proportional hazards model adjusted for age. [B] Gene expression levels were compared reported for 178 PDAC patients versus 167 pancreatic tissue samples. This resource reports results from the UCSC Toil RNAseq recompute compendium, which is a standardized realigned and recalculated gene and transcript expression data set for all TCGA, and GTEx samples that enables users to contrast gene and transcript expression between TCGA "tumor" samples and corresponding GTEx "normal" samples. Depicted is a cluster figure of the mRNA expression levels for Macrophage markers, TGFB1 / 2, interferon-alpha receptor 1 (IFNAR1) activated receptors and the corresponding downstream signaling molecules (IRF9), and the transcriptional product, Interferon Alpha Inducible Protein 27 (IFI27) mean centered to the corresponding mRNA expression levels in normal tissue. The cluster figure shows the log2-transformed fold-change values (blue represents underexpression, and the red color represents overexpression in samples from PDAC patients). Examination of the dendrogram showed that the expression of CCL8 was distinct from the other genes, IFNAR1 was co-regulated with ADM, CD40, and IRF9. IFI27 was coregulated with MARCO, CD68, and APOCI . TGFB2 was co-regulated with TGFB1, MRC1 / CD206, TLR8, SPI1, C1QA, HLA-F and LGALS9. LGALS9 presents itself as a potential target to develop immune checkpoint inhibitors against the production of Gal-9 protein in PDAC TME as it exhibits a 16.5-fold increase in tumor tissues (P<0.0001).
[0401] Example 6: FIG. 6A shows OS curves calculated from the multivariate Cox proportional hazards models demonstrating the prognostic impact of TGFB2 mRNA levels at low levels mRNA of TAM markers and IRF9.Docket No. 018988-021W01
[0402] The predicted survival proportion was calculated from the Cox proportional hazards regression model parameters that included the interaction term for combinations of TGFB2high (black line) versus TGFB21ow (blue line) groups of PDAC patients in the context of the macrophage marker groups' high and low mRNA expression (mean diagnosis age for this cohort of patients was set at 64.5 years to run the models for N=177 and 92 death events for each model A-H).
[0403] The four most significantly impacted increases in HR for the effect of high levels of TGFB2 mRNA are presented for the paired analysis (see Figure 5) with HLA-F (A, B), CD74 (C, D), LGALS9 (E, F), and IRF9 (G, H). These four macrophage markers exhibited significant interaction effects in the multivariate model in which the negative prognostic effect of high TGFB2 levels occurred at low levels of the macrophage marker. The impact of the significant interaction term in the models is presented as improvements in OS at low levels of TGFB2 mRNA when there are low levels of the paired marker genes (A, C, E, G). At high TAM markers and IRF9 levels, the TGFB21ow group of PDAC patients did not exhibit improvements in median OS (B, D, F, H).
[0404] Example 7: FIG. 7 shows TGFB2 and components of the Interferon type I response mRNA levels prognostically impact OS outcomes in LGG patients.
[0405] FIG. 7 illustrates a model for the Interferon type-I (IFN-I) stimulated gene (ISG) transcription mediated by STAT1 / STAT2 / IRF9 complexes. IFN-I was recognized by a dimeric receptor composed of IFNAR1 and IFNAR2 subunits (blue, light blue subunits) [Paul 2018; Rengachari 2018; Michalska 2018], After IFN binding and receptor dimerization, the juxtaposition of JAK1 (pink box) and TYK2 (orange box) increases kinase activity via transphosphorylation and subsequent STAT 1 (light brown ellipse) and STAT2 (brown ellipse) and IRF9 (yellow ellipse) protein recruitment. STAT1 / STAT2 / IRF9 complexes proteins are successively phosphorylated (blue circles), dimerized, and translocated to the nucleus, where ISG transcription is initiated after binding interferon-sensitive response element (ISRE) to produce mRNA for Interferon Alpha Inducible Protein 27 (IFI27; orange ellipse) [Ullah 2021], Activation of the Transforming growth factor receptor is depicted by TGFB2 dimer binding to a tetrameric receptor structure composed of TGFBR1 (2 dark red subunits) and TGFBR2 (2 red subunits). Significant prognostic indicators that exhibited an increase in HR forDocketNo. 018988-021W01OS outcomes are indicated by red outlines (TGFB2, IFNAR1, STAT1, IRF9, and IFI27). This figure was adapted from This figure was adapted from Qazi et al. (2024a, b)
[0406] Example 8: FIG. 8 shows the prognostic impact of high levels of TGFB2 mRNA expression was independent of age in PDAC patients in both univariate and multivariate Cox proportional hazards models.
[0407] Univariate Cox proportional hazards models were used to assess the prognostic impact of TGFB ligands (TGFB1 / 2 / 3; N=177), receptors (TGFBR1 / 2; N=177), and Age (N=178) on the OS of PDAC patients.
[0408] A. There were significant increases in HR for the TGFB2high group of patients (HR (95% CI range) = 1.58 (1.03-2.43); P = 0.035) and age at diagnosis as a linear co-variate (HR (95% CI range) = 1.0279 (1.007-1.0492); P = 0.009). The prognostic impact for TGFBR1 showed an increase in HR that was borderline significant (HR (95% CI range) = 1.45 (0.96-2.19); P = 0.08). Patients with high levels of TGFB 1, TGFB3, TGFBR2, and TGFBR3 mRNA did not significantly impact OS (HR ranged from 0.9 to 1.01).
[0409] B. High levels of TGFB2 (greater than or equal to the median cut-off value) and Age as a linear co-variate indicated significant effects on OS outcomes in the univariate analysis and were further investigated in a multivariate model that included age as a confounding variable. Testing age at diagnosis as a linear covariate with TGFB2high group of patients using the Multivariate Cox proportional hazards model showed the HR (95% CI) for TGFB2high group of patients was 1.68 (1.10 - 2.58; P = 0.017). The effect of TGFB2 mRNA was independent of the confounding effect of age at diagnosis for this cohort of PDAC patients. Testing age at diagnosis as a linear covariate showed that this variable's HR (95% CI) was 1.029 (1.009 - 1.05; P = 0.0051).
[0410] Example 9: FIG. 9 shows high TGFB2 mRNA expression in PDAC patients was independently associated with higher hazard ratios when age and interaction terms were considered in a Cox proportional hazards model investigating TGFB 1 or TGFB3.
[0411] Multivariate analyses were conducted to determine the impact of TGFB2 and levels of other TGFB ligands, TGFB1 or TGFB2, on OS. The Cox proportional hazards model accounted for age at diagnosis and a TGFB2 x TGFB 1 / 3 interaction term factored into the model. Three variables were considered to assess the independent effects of these variables: mRNA expression levels for TGFB2 and TGFB 1 / 3 (high / low; high cut-Docket No. 018988-021W01 off at 50 percentile for the range of TPM values) and age at diagnosis. Forest plots were used to visualize hazard ratios for OS outcomes.
[0412] [A] Testing the effect of interaction between TGFB 1 and TGFB2 showed that patients in theTGFB2high group experienced a statistically significant increase in HR (HR (95% CI range) = 2.73 (1.52-4.9); P = 0.001). However, patients in theTGFBlhigh group did not exhibit a significant increase in HR (HR (95% CI range) = 1.49 (0.78- 2.84); P = 0.23) controlling for the diagnosis age group of patients (P = 0.005) and significant effect of the interaction term (HR (95% CI range) = 0.39 (0.18-0.85); P = 0.018).
[0413] [B] A statistically significant increase in the hazard ratio (HR) was observed in patients with high TGFB2 expression (HR = 2.1, 95% CI 1.16-3.8, P = 0.015). However, in patients with high TGFB3 expression, no significant increase in HR was observed (HR = 1.03, 95% CI 0.55-1.93, P = 0.931) controlling for the significant effect of age at diagnosis (HR = 1.03, 95% CI 1.01-1.05, P = 0.004). Furthermore, no significant effect of the interaction term was observed (HR = 0.69, 95% CI 0.3-1.59, P = 0.381).
[0414] Example 10: FIG. 10 shows high TGFB2 mRNA expression in PDAC patients was independently associated with higher hazard ratios when age and interaction terms are considered in a Cox proportional hazards model investigating receptors for TGFB ligands.
[0415] Multivariate analyses were conducted to determine the impact of TGFB2 and TGFB receptors, TGFBR1 / 2 / 3 on OS. The Cox proportional hazards model accounted for age at diagnosis, and a TGFB2 x TGFBR1 / 2 / 3 interaction term factored into the model. Three variables were considered to assess the independent effects of these variables: mRNA expression levels for TGFB2 and TGFBR1 / 2 / 3 (high / low; high cut-off at 50th percentile for the range of TPM values) and age at diagnosis. Forest plots were used to visualize hazard ratios for OS outcomes.
[0416] [A] The study's findings revealed an increase in the hazard ratio (HR) that was borderline not significant for patients with high expression of TGFB2. (HR (95% CI range) = 1.81 (0.96-3.42), P = 0.065). Similarly, the HR (95% CI range) was 1.64 (0.88-3.04) with a non-significant p-value of 0. 117 for the patients with high expression of TGFBR1. However, a significant increase in HR was noted for factoring in age atDocket No. 018988-021W01 diagnosis (HR (95% CI range) = 1.03 (1.01-1.05); P = 0.003) and no interaction effect (HR (95% CI range) = 0.74 (0.32-1.72), P = 0.485).
[0417] [B] There was a significant increase in HR for TGFB2high group of patients (HR (95% CI range) = 2.09 (1.14-3.83); P = 0.017 ), but not for TGFBR2high group of patients (HR (95% CI range) = 1.37 (0.72-2.6); P = 0.333 ), accounting for a significant age effect (HR (95% CI range) = 1.03 (1.01-1.05); P = 0.005 ) and non-significant interaction term (HR (95% CI range) = 0.62 (0.26-1.45); P = 0.269 ).
[0418] [C] Similarly, there was a significant increase in HR for TGFB2high group of patients (HR (95% CI range) = 2.16 (1.2-3.89); P = 0.011 ) in the multivariate model that included TGFBR3 that showed a non-significant effect on HR forTGFBR3high group of patients (HR (95% CI range) = 1.05 (0.56-1.95); P = 0.877 ), while taking into account a significant effect of age at diagnosis (HR (95% CI range) = 1.03 (1.01-1.05); P = 0.004) and a non-significant interaction effect (HR (95% CI range) = 0.62 (0.27- 1.43); P = 0.263 )
[0419] Example 11: FIG. 11 shows prognostic impact of TGFB 1 mRNA levels at low macrophage levels.
[0420] OS survival data correlated with mRNA expression for PDAC patients were depicted as Kaplan-Meier curves to determine the prognostic impact of TGFB 1 median expression cut-off values for high versus low mRNA expression patient sub-groupings) for all PDAC patients (A. N=177), PDAC patients with low macrophage populations (B. N=68), and PDAC patients with low macrophage and low neoantigen levels (C. N=47) (http: / / kmplot.com / analysis / index.php?p=service&cancer=pancancer_rnaseq accessed 23rd May 2024).
[0421] A. Comparing the median OS time for 88 patients from the TGFB llow group (Median = 19.8 (95% CI: 16.2 - 37.7, Events = 50) months) with the TGFB lhigh group (N=89, Median OS = 23 (95% CI: 18.9 - NA, Events = 42) months) showed that TGFB 1 mRNA levels did not significantly impact OS (Log-rank Chi-Square = 0.111, P-value = 0.739).
[0422] B. Examination of patients with low macrophage levels showed the median OS time for 34 TGFB llow patients was 22 (95% CI: 17 - NA, Events = 16) months and was not significantly different from the TGFB lhigh group of patients (N=34, Median =Docket No. 018988-021W0120.2 (95% CI: 10.3 - NA, Events = 18) months; Log-rank Chi-Square = 1.73, P = 0.188).
[0423] C. PDAC patients with low macrophage and neoantigen levels did not achieve statistical significance when comparing TGFB llow (N=24, Median = NA, Events = 9) versus TGFB lhigh (N=23, Median = 22.8 (95% CI: 15.3 - NA, Events = 11) months; Log-rank Chi-Square = 0.93, P-value = 0.336) groups
[0424] Example 12: FIG. 12 shows prognostic impact of TGFB3 mRNA levels at low macrophage levels.
[0425] OS survival data correlated with mRNA expression for PDAC patients were depicted as Kaplan-Meier curves to determine the prognostic impact of TGFB3 median expression cut-off values for high versus low mRNA expression patient sub-groupings) for all PDAC patients (A. N=177), PDAC patients with low macrophage populations (B. N=68), and PDAC patients with low macrophage and low neoantigen levels (C. N=47) (http: / / kmplot.com / analysis / index.php?p=service&cancer=pancancer_rnaseq accessed 23rd May 2024).
[0426] A. Comparing the median OS time for 88 patients from the TGFB31ow group (Median = 20.1 (95% CI: 15.33 - NA, Events = 46) months) with the TGFB3high group (N=89, Median OS = 20.2333333 (95% CI: 18.9 - 24.4, Events = 46) months) showed that TGFB3 mRNA levels did not significantly impact OS (Log-rank Chi-Square = 0.0209612, P = 0.885).
[0427] B. Examination of patients with low macrophage levels showed that the median OS time for 34 TGFB31ow patients was 17 (95% CI: 13.1 - NA, Events = 18) months and was not significantly different from that of the TGFB3high group of patients (N=34, Median = 22.8 (95% CI: 17.3 - NA, Events = 16) months; P = 0.996).
[0428] C. PDAC patients with low macrophage and neoantigen levels did not achieve statistical significance when comparing TGFB31ow (N=24, Median = 72.7 (95% CI: 15.8 - NA, Events = 9) months versus TGFB3high (N=23,) Median = 20.2 (95% CI:15.3 - NA, Events = 11) months; Log-rank Chi-Square = 1.32, P = 0.25) groups.
[0429] Example 13: FIG. 13 shows comparison of normal versus tumor tissue samples for genes exhibiting significant prognostic impacts on OS from the multivariate Cox regression models.Docket No. 018988-021W01
[0430] Select genes were evaluated as biomarkers using a comparative analysis of mRNA levels for macrophage markers, including TGFB1, TGFB2, CD68, and MRC1, in both normal and tumor tissues obtained from the UCSC Xena web platform. The log2 transformed TPM values are presented as bar charts (mean ± SEM) between normal pancreatic tissue (N=167; depicted in light grey) and pancreatic cancer tissue samples (N=178; depicted in dark grey), ordered according to expression levels in tumor tissue samples. All 24 genes exhibited fold changes greater than 2 (P<0.0001 for all comparisons). Sixteen of the macrophage markers were upregulated greater than 10-fold in tumor compared to normal tissues: CCL18, MARCO, APOCI, CD68, HLA-DRA, HLA-DQB 1, CD74, CCL5, HLA-DRB 1, EGLN3, C1QA, LGALS9, HHLA2, HLA-F, TLR8, SPI1. Of these 16 genes, TLR8 was expressed at very low levels in tumor tissue (< 1 TPM). In normal tissues, TGFB2, MRC1, MARCO, CCL8, CCL5,and EGLN3 were expressed at very low levels. The highest levels of expression in tumor tissue were observed for CD74 (Mean ± SEM = 10.94 ± 0.08), IFI27 (Mean ± SEM = 9.63 ± 0.12), and HLA-DRA (9.3 ± 0.1).
[0431] Example 14: Pancreatic cancer is one of the most devastating cancer types. It is expected to be the second leading cause of cancer-related mortality by 2030, and its 5-year survival rate is less than 10%. More than 50% of pancreatic cancer patients are diagnosed with advanced stages, where the course of the disease is very fast, and the median survival time from the diagnosis is 4-10 months. As for treatment options, surgery is the most common treatment, but unfortunately, only 15-20% of PDAC patients are amenable to resection. Chemotherapy, radiation therapy, immunotherapy, targeted therapy, and palliative care are also used in the treatment of pancreatic cancer. However, the outcomes of combined treatment are still not very promising. Thus, there is an urgent need for novel agents that could be combined with the current standard treatment to improve patients' overall survival.
[0432] One of the emerging treatment options is targeting Transforming growth factor-P (TGF-P), a potent and pleiotropic cytokine that plays a complex role in pancreatic cancer. TGF-P signaling is one of the 12 core signaling pathways involved in pancreatic cancer. While targeting TGFpR2-mutant tumors exposes vulnerabilities to stromal TGFp blockade in pancreatic cancer, canonical TGFp signaling suppresses epithelial pancreatic cancer (PDA) cell proliferation, and as a result, inhibiting TGFPDocket No. 018988-021W01 has not been successful. Given the complex role of TGF-P signaling in pancreatic cancer, with both tumor-suppressive and tumor-promoting effects, this study identified the biomarkers associated with this cytokine and the overall survival of patients to establish better combination regimens to target pancreatic cancer cells.
[0433] While the full spectrum of key signaling pathways affecting macrophages, ductal cells, and fibroblasts in pancreatic cancer remains elusive, the reports on macrophages show TGFP signaling contributes to the tumor-enhancing attributes of macrophages in pancreatic ductal adenocarcinoma (PDAC). Tumor-associated macrophages (TAMs) promote PDAC progression by inducing epithelial-to- mesenchymal transition. TAMs, myeloid-derived suppressor cells (MDSCs), dendritic cells (DCs), and the TGF-P cytokine are critical in altering the proportion of infiltrating immune cells in PDAC. Macrophages play a key role in PDAC growth and metastasis. In the early stage of cancer, TGF-P reduces the tumorigenic tumor microenvironment by regulating macrophage polarization from Ml to M2 phenotype. However, in the late stage of cancer, TGF-P promotes tumor progression by inducing macrophage polarization from M0 / M1 to M2 phenotype. Vaccination with TGFP-derived peptides increases the tumoral-infiltration of CD8+ T cells. It polarizes tumor-associated macrophages from an M2-like to an Ml -like phenotype, which reduces fibrosis and generates a pro-inflammatory tumor microenvironment.
[0434] Single-cell RNA-seq experiments have further enhanced understanding of the heterogeneity, functional roles, and metabolic programs of TAMs in pancreatic tumors. Such studies have identified novel macrophage subsets, metabolic markers, and signaling pathways that contribute to TAM polarization and their interactions within the TME. Tumor-associated macrophages (TAMs) identified by molecular markers such as SPP1+, C1Q+, FCN1+, and CCL18+ play crucial roles in cancer progression. SPP1+TAMs significantly increase in the tumor microenvironment, are associated with poor prognosis, and promote tumor metastasis and immunosuppression. They secrete cytokines such as VEGFA, PDGF, and angiopoietin, facilitating tumor angiogenesis. Additionally, they interact with endothelial cells to foster angiogenesis and promote epithelial -mesenchymal transition (EMT), aiding in tumor invasion. C1Q+TAMs are involved in immune regulation and immunosuppression, exhibiting high expression of markers like APOE and TREM2, and are linked with CD8+T cell suppression andDocket No. 018988-021W01 dysfunctional immune circuits. These TAMs are found in various cancers and are associated with poor clinical outcomes. FCN1+TAMs are inflammatory macrophages associated with tumor-adjacent tissues and angiogenesis. They are derived from monocytes, express markers like FCN1, APOCI, and SPP1, and are precursors of C1Q+ TAMs. CCL18+TAMs are immunosuppressive and participate in tumor proliferation, angiogenesis, and lymphangiogenesis. They are enriched in M2-like genes and are associated with poor prognosis in neoplastic tumors. CCL18+TAMs function through signaling pathways involving CCL18, which promotes tumor metastasis by interacting with receptors like PITPNM3 on tumor cells. They also influence EMT and the tumor immune response. A comprehensive pancancer meta-analysis of TAM populations attempted to elucidate molecular signatures for TAM sub-clusters from singe-cell RNA- seq studies, and based on their signature genes in mouse and human assays, transcription factor profile, and predicated function, TAM subsets are classified as interferon-primed TAMs (IFN-TAMs expressing IFN-regulated genes, such as CXCL10, PDL1, and CD86), immune regulatory TAMs (Reg-TAMs expressing ARG1, MRC1, and CX3CR1), inflammatory cytokine-enriched TAMs (Inflam-TAMs expressing IL1B, CXCL1 / 2 / / 8, CCL3, and CCL3L1), lipid-associated TAMs (LA-TAMs expressing APOCI, APOE, ACP5, and FABP5), pro-angiogenic TAMs (Angio-TAMs expressing VEGFA and SPP1 or other angiogenic factors, such as VCAN, FCN1, and THBS1), RTM-like TAMs (RTM-TAMs expressing LYVE1, HES1, and FOLR2), and proliferating TAMs (Prolif-TAMs expressing MKI67 and CDK1). Examination of TAM sub-clusters from the analysis of treatment-naive tumors derived from colorectal cancer patients exhibited mRNA upregulation of immune suppressive genes that included TGFB2, CD274, CCL2, and IL 10. In addition, these colorectal TAMs exhibited the high expression of MHC and immune co-stimulating genes such as CD80 and CD86 typically markers for Ml-like macrophages, showing the emergence of TAM with mixed M1 / M2 marker expression in TME.
[0435] Applicants herein have discovered that the dual action of TGF-P in pancreatic cancer may lie within the action of macrophages. It may be contingent on the stage of cancer as a molecularly diverse set of TAMs emerge through the progression of the tumor. Hence, targeting TGF-P and pro-tumor TAMs as a therapeutic strategy forDocket No. 018988-021W01 pancreatic cancer may require a more complete understanding of their roles in PDAC, especially in the TGF-P interaction with TAM sub-populations in the PDAC tumor.
[0436] Another component that may be hypothesized to have a role in cross-talk with TAMs is the function of interferon-alpha (IFN-a), which binds to specific IFN-a receptors (IFNAR) receptors on the surface of macrophages and the formation of Interferon-stimulated gene (ISGF3) complex via IRF9. When activated, IRF9 forms a complex with other transcription factors, such as Signal Transducer And Activator Of Transcription 1 (STAT1) and Signal Transducer And Activator Of Transcription 2 (STAT2) to initiate downstream cellular responses. This complex binds to specific DNA sequences and regulates the expression of interferon-stimulated genes (ISGs), which are critical for antiviral defense. This interaction is essential for controlling viral replication and promoting immune defense against viral infections in the normal immune response. In the context of pancreatic cancer, this pathway may mediate radioresistance, inhibit immune responses, and activate survival signaling pathways. Type I Interferon (IFN-I) constitutively produced by cancer cells sustains prosurvival responses and resistance to DNA-damaging therapies in pancreatic cancer. The IFN- JAK-STAT axis may play a role in bridging radiotherapy to immunotherapy in pancreatic cancer. Conversely, radioresistant pancreatic cancer cells can activate the STAT1-IRF1 axis, which prevents phagocytosis of stressed tumor cells by macrophages. The similarity in the way these components work and the function of TGF-P signaling pathways in cancer, along with established positive cross-talk between IFN-I and TGF- beta signaling, with activation of both pathways observed in preneoplastic rat liver, can give us a clue as to such components can be related.
[0437] This example clarifies the role of TGFB2 mRNA as a prognostic indicator in PDAC patients in the multivariate context with IFN-I activation, as well as gene expression markers for TAMs in the TME. TGFB2 mRNA was a significant negative prognostic indicator in low macrophage environments. TGFB2 mRNA levels can impact OS independently of TAMS in the TME. The function of TGF-P may be correlated with Interferon Alpha 1 (IFN-a), possibly through Interferon Regulatory Factor 9 (IRF9) as a factor for eliciting the tumorogenic activity of IFN-a, and other members of the STAT family, and targeting these molecules simultaneously can helpDocket No. 018988-021W01 find more treatment options for pancreatic cancer. This example showed that PDAC tumors co-opt this mechanism to impact patient overall survival.
[0438] Overall, these findings show that abrogating Interferon Type I pathway, IFN-I (IFN-a: interferon-alpha receptor 1 (IFNAR1), as well as their corresponding downstream signaling molecules, such as STAT1, IRF9, and Interferon Alpha Inducible Protein 27 (IFI27) can be used in treatment with TGF-P inhibitors, based on the observed impact on overall survival in PDAC patients. Furthermore, TGFB2 mRNA expression levels impact OS independently of 54 out of 81 TAM markers as determined utilizing multivariate Cox proportional hazards models.
[0439] Nine genes exhibited significant increases in HR for TGFB2 expression, TAM gene expression, and a significant interaction term between TGFB2 and TAM gene expression (C1QA, CD74, HLA-DQB 1, HLA-DRB1, HLA-F, IFI27, IRF9, LGALS9, MARCO), showing that the impact on OS for TGFB2high group of PDAC patients is modified by the TAM marker gene expression and components of the IFN-I pathway via the expression of IRF9 and IFI27, whereby the negative prognostic impact of high TGFB2 mRNA levels becomes more significant at low levels expression of these nine genes.
[0440] Notably LGALS9 mRNA coding for Gal-9 immune checkpoint protein shows that this protein can be targeted along with TGFB2 mRNA for prognostic and therapeutic purposes. Of these 9 genes, the highest levels of expression in tumor tissue were observed for CD74 (Mean ± SEM = 10.94 ± 0.08; 21.8-fold increase relative normal tissue), IFI27 (9.63 ± 0.12; 66.3-fold increase), and HLA-DRA (9.3 ± 0.1; 31- fold increase) for potential use as biomarkers for PDAC prognosis, whereby low levels of expression of these TAM markers would increase the susceptibility of PDAC patients for anti-TGFB2 mRNA directed therapies.
[0441] Example 15: In this example, macrophage-associated mRNA expression was studied to relate mRNA expression levels to overall survival outcomes. The prognostic impact of TGFB2 mRNA expression levels was determined by comparing patients expressing high versus low levels of TGFB2 (50th percentile cut-off) in low macrophage tumor microenvironment (TME).
[0442] Macrophage-associated mRNA expression was obtained in part from a UCSC Xena database to compare normal pancreatic tissue and PDAC tumor samples. mRNADocket No. 018988-021W01 expression levels related to overall survival outcomes and the prognostic impact of TGFB2 mRNA expression levels was further determined by comparing patients expressing high versus low levels of TGFB2 (50th percentile cut-off) in low macrophage tumor microenvironment. Additional data was obtained in TCGA- cBioportal (cbioportal.org / study / summary?id=paad_tcga_pan_can_atlas) and KMplotter (kmplot.com / analysis / index.php?p=service&cancer=pancancer_rnaseq).
[0443] The TGFB2 gene exhibited low mRNA expression levels in normal tissue, with less than one TPM, while, in tumor tissue, TGFB2 expression levels exhibited a 7.9-fold increase in mRNA expression relative to normal tissue (P < 0.0001).
[0444] Interferon Alpha Inducible Protein 27 (IFI27), the downstream product of Interferon regulatory factor 9 (IRF9) and Signal transducer and activator of transcription 1 (STAT1) transcriptional activation by Interferon alpha / beta receptor 1 (IFNAR1) exhibited a significant 66.3-fold increase in expression in tumor tissue compared to normal tissue (P < 0.0001).
[0445] The statistical contrast between the expression of IRF9 mRNA also displayed a significant (P<0.0001) 4.2-fold increase in mRNA expression levels.
[0446] These increased levels of mRNA expression were found to be prognostically significant, whereby patients with high expression levels of either TGFB2, IRF9, or IFI27 showed median OS times ranging from 16 to 20 months (P<0.01 compared to 72 months for patients with low levels of expression for both TGFB2 and either IRF9 or IFI27).
[0447] In TME with low macrophage levels, patients with high levels of TGFB2 mRNA exhibited significantly shorter OS outcomes than patients with low TGFB2 mRNA levels (Median OS of 72.2 versus 15.3 months, P<0.0001).
[0448] Furthermore, expression of TGFB2 mRNA and 81 TAM markers exhibited TGFB2 prognostic impact independent of 54 TAM markers showed by multivariate Cox regression models.
[0449] Nine genes exhibited significant increases in HR for TGFB2 expression, marker gene expression, and a significant interaction term between TGFB2 and marker gene expression (C1QA, CD74, HLA-DQB1, HLA-DRB1, HLA-F, IFI27, IRF9, LGALS9, MARCO), showing that the impact on OS for TGFB2high group of PDAC patients is modified by a subpopulation of TAM expressing these marker genes,Docket No. 018988-021W01 whereby the negative prognostic impact of TGFB2 mRNA levels is observed at low macrophage marker levels.
[0450] Of these genes, the highest levels of expression in tumor tissue were observed for CD74 (Mean ± SEM = 10.94 ± 0.08; 21.8-fold increase relative normal tissue), IFI27 (9.63 ± 0.12; 66.3-fold increase), and HLA-DRA (9.3 ± 0.1; 31-fold increase) for potential use as biomarkers for PDAC prognosis.
[0451] The study of this example showed that a combination of pharmacological tools can be used in treating PDAC patients, targeting both TGFB2, the components of the type-I interferon signaling pathway, and TAM markers to improve OS outcomes. TGFB2 expression impacts OS independent of TAM markers, but the multivariate models observed a statistical interaction that showed TGFB2 was a negative prognostic indicator at low levels of the IFN-I activated genes and TAM marker expression, including the immune checkpoint LGALS9 (upregulated 16.5-fold in tumor tissue; PO.OOOl).
[0452] An integrated database for PDAC was used for Kaplan-Meier analysis to determine the prognostic impact of TGFB ligand (TGFB1, TGFB2, TGFB3 median expression cut-off values for high versus low patient sub-groupings) on OS for all PDAC patients (N=177), PDAC patients with low macrophage populations (N=68), and PDAC patients with low macrophage and low neoantigen levels (N=47). See, e.g. Gyorffy B. Integrated analysis of public datasets for the discovery and validation of survival-associated genes in solid tumors. Innovation (Cambridge 5(3): 100625, 2024).
[0453] In this study, patient-level clinical metadata and RNA sequencing-based batch normalized mRNA expression data was analyzed for 177 patients diagnosed with PDAC (cBioportal). TPM expression values were correlated to OS outcomes by compiling patient-level data. To calculate the percentiles of gene expression from 177 PDAC patients, log2 transformed TPM values were stratified according to medians of ranked values. Four patient groups were then formed based on their expression levels of TGFB2 and Gene2 (Genes expressed in the tumor microenvironment that included TGFB1, TGFB2, TGFB3, TGFBR1, TGFBR2, TGFBR3, IFNAR1, STAT1, IRF9, andIFI27): high expression of both (TGFB2high / Gene2high; higher than or equal to the 50th percentile of both TGFB2 and Gene2);Docket No. 018988-021W01 low expression of both (TGFB21ow / Gene21ow; lower than the 50th percentile of both TGFB2 and Gene2); and combinations of high and low expression levels for both genes under investigation (TGFB2high / Gene21ow, and TGFB21ow / Gene2high).
[0454] OS curves censored at 120 months were then compared between these groups to assess the survival impact of the combinations of TGFB2 and Gene2 levels. The impact was evaluated of either TGFB2high / Gene2high versus the remaining patients on OS to test the effect of the subset of patients with high mRNA gene expression levels. The patient subsets' OS outcomes were analyzed using the Kaplan-Meier (KM) method tested for statistical significance using the log-rank chi-square test, implemented utilizing R-based software packages including survival_3.2-13, survminer_0.4.9, and survMisc_0.5.5. To present the treatment outcomes in a graphical format, plotted as graphs using dplyr_1.0.7, ggplot2_3.3.5, and ggthemes_4.2.4 implemented in R. P- values were considered, less than 0.05 being significant after adjusting for multiple comparisons across four groups (6 comparisons) using the Benjamini and Hochberg method.
[0455] Example 16: Hazard ratio comparisons for PDAC patients were used to determine the independent effect of low TGFB2 mRNA levels and target gene control on target gene expression levels, age, and interaction between TGFB2 and the target gene.
[0456] Univariate Cox proportional hazards models were used to assess the prognostic impact of TGFB ligands (TGFB1 / 2 / 3; N=177), receptors (TGFBR1 / 2; N=177), and Age (N=178) on the overall survival (OS) of PDAC patients. Variables that indicated significant effects on OS outcomes were further investigated in a multivariate model that included age as a confounding variable.
[0457] Prognostic impacts on TGFB2 mRNA expression levels of markers were investigated for macrophages by performing Multivariate analyses utilizing the Cox proportional hazards model to assess the individual effects of TGFB2 and Gene2 mRNA levels on OS. This analysis controlled for age at diagnosis and the interaction between TGFB2 and Gene2. Briefly, the model included (i) The mRNA expression level for TGFB2 as a categorical variable comparing high versus low TGFB2 mRNA expression levels at 50% cut-off for expression values, (ii) The mRNA expression level for Gene2Docket No. 018988-021W01 as a categorical variable comparing high versus low Gene2 mRNA expression levels (50% cut-off), and (iii) age at diagnosis, and (iv) interaction term implemented in R (survival_3.2-13 ran in R version 4.1.2. Forest Plots were utilized to visualize the Hazard ratios for Cox proportional hazards models for OS outcomes (survminer_0.4.9 ran in R version 4.1.2. The life table hazard ratios (HRs) were estimated using the exponentiated regression coefficient for Cox proportional hazards analyses implemented in R (survival_3.2-13 ran in R version 4.1.2).
[0458] The effect of adding an interaction term (TGFB2 x Gene2) as the fourth parameter in the Cox proportional hazards model was analyzed. This enabled the determination of the independent impact of TGFB2 and Gene2 in models with the interaction term. To understand how different combinations of TGFB2 high and low mRNA expression groups in the context of Gene2 high and low mRNA expression groups affect predicted survival proportion at any given time, the shift in the baseline OS curve for 177 PDAC patients were plotted and calculated using parameters from the interaction model. The median OS times for patients with high and low TGFB2 expression levels who expressed high or low levels of Gene2 were compared. A significant interaction effect from the interaction model would indicate differences in OS times for patients with high versus low TGFB2 expression levels depending on their Gene2 levels. Interaction parameters with HR less than 1 showed that the negative prognostic impact of high TGFB2 mRNA levels is enhanced at low levels of Gene2 expression.
[0459] Example 17: TGFB2 mRNA expression correlation with the mRNA levels of macrophage prognostic markers in the tumor microenvironment.
[0460] A curated list of 81 macrophage markers, identified in classically-activated Ml (CAM) or alternatively-activated M2 (AAM) subtypes was obtained (see, e.g. Atanasov et al., 2018; Wu et al., 2020; Berglund et al., 2021; Poh and Ernst, 2021). Additionally, markers were obtained from single-cell RNA sequencing experiments that utilized pancreatic ductal adenocarcinoma tumor tissues (see, e.g. Chen et al., 2021; Pratt et al., 2021; Chijimatsu et al., 2022; Yang et al., 2023; Zhang et al., 2023) for investigations in this study.
[0461] Multivariate analyses using the Cox proportional hazards model examined the independent impact of TGFB2 and macrophage markers on overall survival. To controlDocket No. 018988-021W01 for age at diagnosis and interaction effect, 81 models were screened (TGFB2 interaction with TAM markers, TGFB genes, Interferon receptors / STATl / IRF9 / IFI27) using multivariate Cox models. Of these, 54 exhibited significant increases in HR for TGFB2 independently of TAM markers. To identify prognostically relevant markers, TGFB2- Gene pairs were further examined that exhibited either significant increases in both TGFB2 and TAM marker OS hazard ratios or an increase in TGFB2 hazard ratio and a significant (P<0.05) interaction effect revealing 21 gene markers that impact OS in combination with TGFB2 levels (ADM, AP0C1, C1QA, CCL18, CCL5, CD40, CD74, EGLN3, HHLA2, HLA-DQB1, HLA-DRA, HLA-DRB 1, HLA-F, IFI27, IFNAR1, IRF9, LGALS9, MARCO, SPI1, TGFB 1, TLR8). 17 exhibited significant increases in HR for TGFB2 expression and the interaction term with the paired gene (AP0C1, C1QA, CCL18, CCL5, CD40, CD74, HLA-DQB1, HLA-DRA, HLA-DRB1, HLA-F, IFI27, IRF9, LGALS9, MARCO, SPI1, TGFB 1, TLR8), and 13 showed significant increases in HR for TGFB2 and the paired genes (ADM, C1QA, CD74, EGLN3, HHLA2, HLA- DQB1, HLA-DRB1, HLA-F, IFI27, IFNAR1, IRF9, LGALS9, MARCO). Nine genes exhibited significant increases in HR for TGFB2 expression, TAM marker expression, and a significant interaction term (C1QA, CD74, HLA-DQB1, HLA-DRB 1, HLA-F, IFI27, IRF9, LGALS9, MARCO).
[0462] Example 18: Differential expression of mRNA comparing PDAC tumors versus normal pancreatic tissue samples.
[0463] log2 transformed transcripts per million (TPM) summarized RNAseq data files were utilized (see, e.g. toil-xena-hub.s3.us-east- Lamazonaws.com / download / TcgaTargetGtex_rsem_gene_tpm.gz; Full metadata) (UCSC Xena) (https: / / xenabrowser.net / datapages / ) to compare gene expression levels for 178 tumor tissue samples (search term: "TCGA Pancreatic Adenocarcinoma") versus 167 pancreatic tissue samples (search term: "GTEX Pancreas"). This resource reports results from the UCSC Toil RNAseq recompute compendium, which is a standardized realigned and recalculated gene and transcript expression data set for all TCGA, and GTEx that enables users to contrast gene and transcript expression between TCGA "tumor" samples and corresponding GTEx "normal" samples (Goldman et al., 2020).
[0464] A two-way ANOVA model was applied to identify differentially expressed genes to compare normal versus tumor tissue samples. The log2 transformed TPMDocket No. 018988-021W01 values for Gene and Tissue were included as fixed factors, along with one interaction term to investigate gene-level effects for normal and tumor tissues (Gene x Tissue). For each gene, a comparison was done between normal and tumor samples blocked by the Gene factor and then determined significance by adjusting the P-value using the false discovery rate algorithm provided for in the R-package (FDR corrected for all pairs) calculations performed in R using multcomp l .4-17 and emmeans l .7.0 packages ran in R version 4.1.2 (2021-11-01) with RStudio front end (RStudio 2021.09.0+351 "Ghost Orchid" Release)). Bar chart graphics were constructed using the ggplot2_3.3.5 R package.
[0465] A two-way hierarchical clustering technique was used to organize expression patterns such that sample and probesets displaying similar expression profiles were grouped together using the average distance metric (default Euclidean distance implemented using the heatmap.2 function in the R package gplots_3. 1.1). The cluster figure displayed the mean expression levels in tumor tissue centered to the normal pancreas expression levels representing log2-transformed fold-change values. The associated dendrograms organized and depicted expression levels of co-regulated genes for both (rows) and pancreatic cancer patients (columns).
[0466] Example 19: Results for TGFB2 mRNA expression and Age are significant negative prognostic indicators in PDAC patients.
[0467] Univariate Cox proportional hazards models were used to assess the prognostic impact of TGFB ligands (TGFB1 / 2 / 3; N=177), receptors (TGFBR1 / 2; N=177), and Age (N=178) on the OS of PDAC patients (FIG. 8). There were significant increases in HR for the TGFB2high group of patients (HR (95% CI range) = 1.58 (1.03- 2.43); P = 0.035) and age at diagnosis as a linear co-variate (HR (95% CI range) = 1.0279 (1.007-1.0492); P = 0.009) (FIG. 8). Examination of age at diagnosis as a linear covariate with TGFB2high group of patients using the Multivariate Cox proportional hazards model showed the HR (95% CI) for TGFB2high group of patients was 1.68 (1.10 - 2.58; P = 0.017). The effect of TGFB2 mRNA was independent of the confounding effect of age at diagnosis for this cohort of PDAC patients (HR (95% CI) was 1.029 (1.009 - 1.05; P = 0.0051). The Cox proportional hazards model that investigated the interaction of age and TGFB2 mRNA expression was ill-conditionedDocket No. 018988-021W01 and over-fitted with high error bars and low power to detect whether there was a dependency of TGFB2 mRNA levels and age at diagnosis.
[0468] High levels of TGFB2 expression in PDAC patients exhibited significant increases in HR independent of age, TGFB ligands (FIG. 9), and TGFB receptors (FIG. 10).
[0469] TGFB2, but not TGFB 1 and TGFB3 mRNA levels, have a significant negative prognostic impact at low macrophage levels in PDAC tumors.
[0470] OS survival data correlated with mRNA expression for PDAC patients were depicted as Kaplan-Meier curves to determine the prognostic impact of TGFB ligand (TGFB2 median expression cut-off values for high versus low mRNA expression patient sub-groupings) for all PDAC patients, PDAC patients with low macrophage populations, and PDAC patients with low macrophage and low neoantigen levels (Figure 1) The median OS time for 88 patients from the TGFB21ow group (20.5 (95% CI: 17.2 - NA, Events = 43) months)) was not significantly different from the TGFB2high group (N=89, Median OS = 19.9 (95% CI: 16 - 24.4, Events = 49) months; P = 0.167) of PDAC patients (Figure 1A). PDAC patients with low macrophage burden exhibited a significantly improved OS outcome in the TGFB21ow group of patients (N=34; Median = 72.7 (95% CI: 17.7 - NA, Events = 13) months) compared with the TGFB2high group (N=34; Median = 15.3 (95% CI: 9.3 - NA, Events = 21) months; P = 0.00252) (Figure IB). In PDAC patients with decreased macrophage and neoantigen levels, the TGFB21ow PDAC group (N=24, Median = 72.7 (95% CI: 72.7 - NA, Events = 5) months) experienced significantly longer OS times than the TGFB2high group of patients (Median = 23, Median = 15.3 (95% CI: 9.2 - NA, Events = 15) months; Logrank Chi-Square = 15.66, P < 0.001) (Figure 1C). The negative prognostic impact of TGFB2 mRNA levels observed in this cohort of PDAC patients was not observed for TGFB1 (Figure S4) and TGFB3 (Figure S5). These results showed that TGFB2 is a specific negative prognostic marker independent of macrophage levels in the TME.
[0471] Example 20: PDAC tumors exhibit augmented mRNA expression levels for TGFB ligands, interferon alpha receptors, and downstream transcriptional activators to normal pancreatic tissue samples.
[0472] Since TGFB ligands and receptors and interferon-alpha pathways can both activate macrophages in the TME, RNA sequencing was utilized (RNAseq) data filesDocket No. 018988-021W01 that summarize log2 transformed transcripts per million values (TPM) to perform a comparative analysis of gene expression levels in 178 PDAC patients and normal pancreatic tissue samples. TGFB2 exhibited very low expression levels in normal tissue (<0 log2 TPM equivalent to TPM value of 1) but experienced a significant increase in expression levels in tumor tissue: mean ± SEM log2 transformed TPM values for TGFB2 mRNA expression was found to be significantly higher in PDAC patients (2.76 ± 0.11) compared to normal tissue (-0.22 ± 0.12). The median and range of TGFB2 mRNA expression was -0.09 (-9.97 - 3.21) for normal tissue and 2.82 (-3.05 - 6.54) for PDAC patients, representing a 7.9-fold increase in mRNA expression relative to normal tissue (P < 0.0001). Through gene expression level analysis, it was discovered that IFI27, the downstream product of IRF9 / STAT1 transcriptional activation by IFNAR1, exhibited a significant increase in expression in tumor tissue compared to normal tissue, with a 66.3-fold increase in mRNA expression relative to normal tissue (P < 0.0001). IFI27 displayed the highest fold change of all the genes examined relative to normal tissue and one of the most abundant genes in tumor tissue. In normal tissue, the average expression level of IFI27 was 3.58 ± 0.13, while in patients with PDAC, it was 9.63 ± 0.12. The median expression level and range were 3.66 (-9.97 - 8.36) for normal tissue and 9.78 (4.53 - 12.46) for PDAC patients (FIG. 13).
[0473] Example 21: Patients with low levels of TGFB2 and the transcription factor, Interferon Regulatory Factor 9 (IRF9), or the transcriptional product, Interferon Alpha Inducible Protein 27 (IFI27) mRNA expression had improved OS times compared to those with high levels of either TGFB2, IRF9, or IFI27.
[0474] TGFB21ow / IRF91ow group of patients exhibited significantly longer survival times (Median = 72 months) compared to all combinations of TGFB2 and IRF9 expression levels (Median = 16, 19, 20 months, corresponding to P-values of 0.0003, 0.0004, and 0.0005 for TGFB21ow / IRF9high, TGFB2high / IRF91ow and TGFB2high / IRF9high respectively) (Figure 2). Similar results were obtained examining TGFB2 and the IRF9 transcriptionally activated product, IFI27, in PDAC patients (Figure 3). The patients with low levels of both genes had significantly longer survival times compared to all combinations of TGFB2 and IFI27 expression levels (P-value = 0.004 for all comparisons) (Figure 3).Docket No. 018988-021W01
[0475] Example 22: TGFB2 and IFN-I activated pathway gene expression exhibited independent increases in hazard ratios using multivariate Cox proportional hazards models.
[0476] Next, was tested whether the impact of TGFB2 mRNA expression was independent of the interferon-alpha pathway. Multivariate analyses of the potential prognostic impact of IFNAR1 / STAT1 / IRF9 / IFI27 mRNA expression levels on OS were determined using the multivariate Cox proportional hazards model adjusted for age and TGFB2 interaction with IFNAR1 / STAT1 / IRF9 / IFI27 (Figure 4). The Cox multivariate proportional hazards model examining the effects of TGFB2 and IFNAR1 mRNA expression levels showed that there was a significant increase in HR for the TGFB2high group of patients (HR (95% CI range) = 2.27 (1.18-4.36); P = 0.014). In addition, there was a significant increase in HR for IFNARlhigh group of PDAC patients (HR (95% CI range) = 2.22 (1.17-4.22); P = 0.015) accounting for the significant effect of age at diagnosis in this model (HR (95% CI range) = 1.03 (1.01-1.05); P = 0.004). There was no significance of the interaction term in the model (HR (95% CI range) = 0.51 (0.22- 1.2); P = 0.122) (Figure 4A). Examination of the model investigating the interaction between STAT1 and TGFB2 showed that there was a borderline significant increase in HR for TGFB2high group of patients (HR (95% CI range) = 1.84 (0.97-3.46); P = 0.06 ) There was a significant increase in HR for the STATlhigh group of patients (HR (95% CI range) = 2 (1.08-3.71); P = 0.029) accounting for significant impact of age at diagnosis (HR (95% CI range) = 1.03 (1.01-1.05); P = 0.005). The interaction term in the model was not found to be significant (HR (95% CI range) = 0.7 (0.3-1.63); P = 0.413) (Figure 4B). This model was also used to examine the interaction between IRF9 and TGFB2 and showed a significant increase in the hazard ratio for patients in the TGFB2high group of patients. The group of patients with high TGFB2 expression showed a significant increase in HR (HR (95% CI range) = 3.32 (1.71-6.47); P < 0.001). Similar results were found for the IRF9high group of patients (HR (95% CI range) = 3.5 (1.82-6.72); P < 0.001) controlling for the significant effect of age (P = 0.014), and the interaction term (P = 0.002) (Figure 4C). The results showed that patients in the TGFB2high group had a significant increase in HR (with HR (95% CI range) = 2.74 (1.42-5.28) and P = 0.003) when analyzed paired with IFI27 mRNA expression.Similarly, patients in the IFI27high group also had a significant increase in HR (withDocket No. 018988-021W01HR (95% CI range) = 2.56 (1.34-4.87) and P = 0.004) controlling for significant effects of age and the interaction term (P = 0.019 and P = 0.032 respectively) (Figure 4D, Table 6).
[0477] Example 23: TGFB2 and macrophage marker gene expression exhibited independent increases in hazard ratios using multivariate Cox proportional hazards models.
[0478] TGFB2-macrophage marker pairs were examined that exhibited either significant increases in both TGFB2 and macrophage marker OS HRs or an increase in TGFB2 hazard ratio and a significant (P<0.05) interaction effect, revealing 21 gene markers that impact OS in combination with TGFB2 levels (17 markers from single-cell RNA seq experiments, TGFB 1, IFI27, IFNAR1, and IRF9) (Figure 5). The Ml marker, CD68, only exhibited a significant independent effect of TGFB2 (HR (95% CI) = 2.42 (1.31-4.48), P = 0.005), and no effect of CD68 (HR (95% CI) = 1.41 (0.76-2.62), P = 0.277). The M2 marker, MRC1 / CD206, showed a highly significant impact of TGFB2 in this multivariate context (HR (95% CI) = 2.53 (1.35-4.73), P = 0.004) and a borderline significant impact for MRC1 / CD206 (HR (95% CI) = 1.87 (1-3.51), P = 0.051). TGFB2 exhibited hazard ratios of greater than three analyzed in the multivariate model with the following genes: CD74 (HR (95%CI) = 3.98 (2.12-7.44)); HLA-F (HR (95%CI) = 4.65 (2.21-9.78)); IRF9 (HR (95%CI) = 3.32 (1.71-6.47));LGALS9 (HR (95%CI) = 3.55 (1.79-7.06)); and, MARCO (HR (95%CI) = 3.13 (1.64- 5.97)). One of the macrophage markers also showed HR greater than 3 : HLA-F (HR (95%CI) = 3.41 (1.64-7.07)). IRF9 exhibited an independent increase in HR (HR (95%CI) = 3.5 (1.82-6.72)).
[0479] Nine genes exhibited significant OS HR impacts with significant effects of TGFB2, Gene 2 with significant interaction effects showing co-dependency of Gene 2 on TGFB2 levels (C1QA, CD74, HLA-DQB 1, HLA-DRB 1, HLA-F, IFI27, IRF9, LGALS9, MARCO) (Figure 5A).
[0480] Gene expression levels were depicted for 178 PDAC patients versus 167 pancreatic tissue samples using a cluster figure of the mRNA expression levels for Macrophage markers, TGFB1 / 2, interferon-alpha receptor 1 (IFNAR1) activated receptors, and the corresponding downstream signaling molecules (IRF9) and the transcriptional product, Interferon Alpha Inducible Protein 27 (IFI27) mean centered toDocket No. 018988-021W01 the corresponding mRNA expression levels in normal tissue. All 24 genes exhibited fold changes greater than 2 (P<0.0001 for all comparisons). Examination of the dendrogram showed that the expression of CCL8 was distinct from the other genes, IFNAR1 was co-regulated with ADM, CD40, and IRF9. IFI27 was coregulated with MARCO, CD68, and APOCI . TGFB2 was co-regulated with TGFB1, MRC1 / CD206, TLR8, SPI1, C1QA, HLA-F and LGALS9 (Figure 5B). Sixteen of the macrophage markers were upregulated greater than 10-fold in the tumor compared to normal tissues: CCL18, MARCO, APOCI, CD68, HLA-DRA, HLA-DQB1, CD74, CCL5, HLA-DRB1, EGLN3, C1QA, LGALS9, HHLA2, HLA-F, TLR8, SPI1. Of these 16 genes, TLR8 was expressed at very low levels in tumor tissue (< 1 TPM). TGFB2, MRC1, MARCO, CCL8, CCL5, and EGLN3 were expressed at very low levels in normal tissues. The highest levels of expression in tumor tissue were observed for CD74 (Mean ± SEM = 10.94 ± 0.08), IFI27 (Mean ± SEM = 9.63 ± 0.12), and HLA-DRA (9.3 ± 0.1) (FIG. 13).
[0481] Calculation of predicted survival curves using the Cox proportional hazards regression model parameters that included the interaction term for combinations of TGFB2high versus TGFB21ow groups of PDAC patients in the context of the macrophage marker groups' high and low mRNA expression (Figure 6). The four most significantly impacted increases in HR for the effect of high levels of TGFB2 mRNA included HLA-F, CD74, LGALS9, and IRF9. The significant interaction term in the models shows improvements in overall survival (OS) at low levels of TGFB2 mRNA when paired with low levels of marker genes (Figures 6A, C, E, G; predicted median OS times ranged from 49.4 to 72.7 months for TGFB21ow / Markergenelow group of PDAC patients compared to median OS times ranging from 15.1 to 17.5 months for the TGFB2high / Markergenelow group of patients). Conversely, at high levels of marker genes mRNA levels, all combinations of TGFB2 and marker gene subgroups exhibited short OS times whereby the TGFB21ow group of PDAC patients did not exhibit improvements in median OS compared to the TGFB2high group of patients (Figures 6B, D, F, H; predicted OS times ranged from 17 to 22.5 months).
[0482] Example 24: High level of TGFB2, not TGFB 1 or TGFB3 mRNA levels, can be a negative prognostic marker for OS in PDAC patients.
[0483] Without wishing to be bound by theory, while cancer progresses, TGFB pathways facilitate epithelial-to-mesenchymal transition (EMT), activating cancer cellsDocket No. 018988-021W01 to acquire mesenchymal and stem cell properties. This allows them to dissociate from the primary tumor mass, invade surrounding tissue, and intravasate into blood vessels. In mouse genetic models, the expression of oncogenic KRAS in pancreatic or acinar cellsmay be closely associated with the development of acinar-to-ductal metaplasia (ADM) and low-grade pancreatic intraepithelial neoplasia due to interactions with various macrophage populations and TGFB ligands. Ml -like macrophages contribute to ADM by secreting cytokines / chemokines such as TNF, CCL5, IL-6, and IL-la, or through MMPs, followed by the release of IL-13 by DCLK1 + cells and duct-like cells that lead to the polarization of Ml -like to M2-like macrophages. Additionally, macrophage release of TGFB ligands induces fibrosis by activating pancreatic stellate cells.
[0484] In further theory, cross-talk of TGFB pathway and EMT-associated pathways related to stem cell properties have been characterized by utilizing single-cell RNA-seq data showing upregulation of mRNAs encoding factors involved in BMP signalling, PI3K-AKT signalling, RAS signalling, KIT signalling, ERKs signalling, YAP / TAZ, HIPPO, NOTCH, and Wnt pathways showing a widespread impact of TGFB pathways in the TME.
[0485] Studies herein examined mRNA levels in PDAC tumors, indicated that the Transforming Growth Factor Beta 2 (TGFB2) gene exhibited low expression levels in normal tissue, with less than 0 log2 TPM (equivalent to a TPM value of 1). In contrast, in tumor tissue, TGFB2 expression levels are significantly higher, representing a 7.9- fold increase in mRNA expression relative to normal tissue (P < 0.0001) (FIG. 13). An increase in expression was also observed for TGFB1 (8.3-fold increase; P<0.0001) and TGFB3 (2-fold increase; P<0.0001) mRNA expression levels (FIG. 13). Examination of the impact of TGFB 1 / 2 / 3 mRNA levels on OS using univariate Cox proportional hazards models showed that only TGFB2 exhibited a significant increase in HR (FIG. 8), showing that specifically targeting TGFB2 for therapeutic purposes. Age at diagnosis was a potentially confounding factor in the TGFB2 impact on OS, as the univariate Cox proportional hazards model showed a significant increase in HR (P = 0.009). A multivariate model that controlled for age at diagnosis maintained a significant effect on HR for high levels of TGFB2 in PDAC patients (HR = 1.68 (1.10 - 2.58; P = 0.017)). The impact of TGFB2 was also independent of TGFB 1 or TGFB3Docket No. 018988-021W01 levels in the multivariate models that controlled for age (FIG. 9). These results showed that the specific targeting of TGFB2 mRNA, not TGFB1 or TGFB3, will derive the most therapeutic benefit in PDAC patients. The prognostic impact of TGFB2 mRNA levels on OS was enhanced in patients with low macrophage abundance (Figure 1), showing a significant clinical outcome interaction between TGFB pathways and TAMs in the TME. The OS outcomes for PDAC patients appear to have both TGFB2-macrophage- dependent and independent mechanisms in the TME.
[0486] Example 25: IFN-I response can be a negative prognostic indicator in PDAC patients and impacts the effect of TGFB2 mRNA levels on OS outcome.
[0487] Without wishing to be bound by theory, since IFN-I pathways also activate macrophages, this observation was extended to examine the mRNA expression of interferon-alpha receptor 1 (IFNAR1), as well as their corresponding downstream signaling molecules, such as STAT1, IRF9, and Interferon Alpha Inducible Protein 27 (IFI27) on OS outcomes (FIG. 13). Gene expression level analysis indicates that Interferon Alpha Inducible Protein 27 (IFI27), the downstream product of Interferon regulatory factor 9 (IRF9) and Signal transducer and activator of transcription 1 (STAT1) transcriptional activation by Interferon alpha / beta receptor 1 (IFNAR1), exhibited a significant increase in expression in tumor tissue compared to normal tissue. IFI27 and STAT1 mRNA expression levels were found to be 66.3 and 7.1 times higher in tumor tissue than in normal tissue (P < 0.0001 for both comparisons), respectively (FIG. 13). This observation supported the notion that interferon-alpha receptor activation and increased mRNA levels of ligands and receptors of the TGFB pathway play an essential role in the PDAC tumor microenvironment. Studies in other cancers have shown that the use of IFN-a, a ligand that activates IFNAR1, can promote stemlike properties in oral squamous cell carcinoma (OSCC) cells, whereby tumor xenografts treated with IFN-a, increased the expression of sternness markers and tumor growth. In vitro tests conducted on OSCC cells treated with IFN-a have shown increased self-renewal capacity and sternness markers. A strong correlation may exist between the death receptor CD95 / Fas, IFN-I-dependent activation of STAT1, and sternness in various cancer types. CD95 may be an apoptosis-inducing death receptor but can also participate in various tumor-promoting activities. Chronic stimulation of CD95 in tumor cells may increase the number of cancer stem cells in breast cancer.Docket No. 018988-021W01
[0488] Without wishing to be bound by theory, when IFN-a binds to IFNAR1 and 2, it activates JAK1 and TYK2. These enzymes then phosphorylate STAT1 and STAT2, which combine with IRF9 to form the ISGF3 transcriptional complex (Figure 7). The ISGF3 complex moves to the nucleus where it binds to the IRSE elements and triggers the transcription of a group of genes known as IFN-stimulated genes (ISGs). The levels of interferon regulatory factors (IRFs) 2, 6, 7, 8, and 9 in PDAC tumor and normal tissues may be significantly higher in tumors compared to normal tissues. In pancreatic cancer patients, the expression of IRF7 was significantly associated with the pathology stage. At the same time, high levels of IRF2, low levels of IRF3, and high levels of IRF6 were indicators of poorer overall survival. Furthermore, increased mRNA expression, amplification, and deep deletion were the most common types of genetic alterations of IRFs in PDAC. In addition, IRFs were positively correlated with the abundance of tumor-infiltrating immune cells, including B cells, CD8+ T cells, CD4+ T cells, macrophages, neutrophils, and dendritic cells in PC. The functional analysis indicated the involvement of IRFs in the T cell receptor signaling pathway, immune response, and Toll-like receptor signaling pathway. In conclusion, this study provides evidence supporting the involvement of IRFs in the progression of PDAC. The findings showed that the expression of IRFs can serve as a potential biomarker for the diagnosis and prognosis of PDAC.
[0489] Without wishing to be bound by theory, IFN-a can be a component of the initial response to invading infectious agents in a healthy immune system. It triggers the expression of numerous Interferon-stimulated genes (ISGs) via the association of STAT1 / STAT2 / IRF9, including Interferon alpha-inducible protein 27 (IFI27), also known as ISG12a. IFI27 belongs to the IFI6 / IFI27 family, which consists of a conserved 80 amino acid motif known as the ISG12 motif. It may be significantly stimulated by hepatitis B virus (HBV) infections (Ullah et al., 2021). IFI27 may be highly expressed in several cancers such as ovarian cancer, hepatocellular carcinoma, and breast cancer. Overexpression of IFI27 may increase the proliferation, migration, and invasion of Cholangiocarcinoma cells. Clinically, higher expression of IFI27 may be associated with worse overall survival in patients with Cholangiocarcinoma. mRNA expression of IFI27 in PDAC may show that the gene encoding Interferon Alpha-Inducible IFI27 was significantly upregulated in pancreatic cancer tissues compared to normal tissues.Docket No. 018988-021W01Additionally, higher expression of IFI27 was found to be negatively correlated with the overall survival rate of pancreatic cancer patients. The functional annotation of IFI27 demonstrated its relationships to cellular immunity and metabolism, particularly glycolysis. Analysis of infiltrating immune cells showed that increased expression of IFI27 correlated with decreased CD8+ T cells and increased M2 macrophages.
[0490] Example 26. High levels of TGFB2 and high levels of IRF9 (Figure 2) or IFI27 (Figure 3) impacted OS. Patients were stratified into four groupings based on their expression levels of TGFB2 and IRF9 or IFI27 using the 50th percentile cut-offs for the range of mRNA expression levels of these genes: high expression of both (TGFB2high / IRF9 high or IFI27high; higher than or equal to the 50th percentile of both TGFB2 and IRF9 or IFI27); low expression of both (TGFB21ow / IRF9 low or IFI271ow; lower than the 50th percentile of both TGFB2 and IRF9 or IFI27); and combinations of high and low expression levels for both genes under investigation (TGFB2high / IRF9 low or IFI271ow, and TGFB21ow / IRF9 high or IFI27high).
[0491] Patients with low levels of TGFB2 and IRF9 or IFI27 expression exhibited median OS times of 72 months. Patients with either high expression levels of TGFB2, IRF9 or IFI27 showed median OS times ranging from 16 to 20 months (P<0.01 for all comparisons with the TGFB21ow / IRF9 low or IFI271ow). This showed that knocking down TGFB2 and IRF9 or IFI27 expression results in a pronounced improvement in PDAC OS outcomes.
[0492] The effects of TGFB2, IRF9, or IFI27 were determined independent, multivariate analyses were performed of the hazard ratios of TGFB2 and IRF9 or IFI27 levels on OS were determined using the multivariate Cox proportional hazards model to adjust for age and TGFB2 interaction with either IRF9 or IFI27 (Figure 4C and D).
[0493] In this scenario, the beneficial effects of reduced TGFB2 levels were only observed in the context of low expression levels of IRF9 or IFI27, as demonstrated by the significant interaction term in the multivariate Cox proportional hazards models (Figure 4C and D). This showed that TGFB2 and IRF9 or IFI27 were overall independent prognostic markers for PDAC survival, but the impact of TGFB2 mRNA IRF9 or IFI27 can be reduced at high IRF9 / IFI27 mRNA levels. IFI27 was one of the most significantly upregulated genes in the PDAC TME (66.3-fold increase) with highDocket No. 018988-021W01 levels of expression in tumor tissue (Mean ± SEM = 9.63 ± 0.12 log2 TPM), showing its potential to serve as a prognostic biomarker in these patients.
[0494] Example 27. Targeting TGFB2 and IFN-I response gene expression in PDAC patients.
[0495] Without wishing to be bound by theory, to exploit targeting TGFB pathways in PDAC patients, TGF-P signaling inhibitors have been extensively researched in preclinical settings and have entered clinical development under five categories. The first category pertains to ligand inhibition, involving the delivery of antisense oligonucleotides (ASOs) either intravenously or through immune cell engineering to prevent TGF-P synthesis AP12009, API 104 / AP15012, Lucanix™, and ISTH0036). The second category involves ligand traps and neutralizing antibodies that prevent TGF-P ligands from binding to receptors, including GC1008, 2G7, 1D11, LY2382770, and CAT-192. The third category pertains to a vaccine-based strategy. The fourth category involves small molecule inhibitors, which inhibit receptor kinase activity and prevent signal transduction including SB431542, Ki 26894, SD208, LY2109761, IN-1130, LY2157299, TEW-7197, and PF-03446962. The fifth category employs intracellular peptide aptamers (and antagonists) (extensively reviewed in (C.-Y. Huang et al., 2021)).
[0496] The anticancer compound OT-101 (Trabedersen) is a targeted antisense molecule that selectively binds to the human TGF-P2 mRNA (TGFB2). In a Phase I / II clinical trial, patients with PDAC treated with OT-101 and subsequent chemotherapy displayed significantly improved overall survival (OS) rates (D'Cruz et al., 2018). The mechanism of action of OT-101 involves the suppression of TGF-P signaling, which leads to the upregulation of cytokines, namely, IL-8, IL-15, IP-10, and HGF. A mixed analysis of the covariance model with OS as the covariate at each time point showed that anti-tumor cytokines, IL-8, and IL-15 were significantly associated with OS during Cycle 1 of therapy. These findings showed that OT-101 can improve the clinical outcomes of patients with PDAC and may serve as a valuable therapeutic agent in managing this disease. This led to the design of a clinical study to compare the efficacy and safety of OT-101 in combination with FOLFIRINOX (folinic acid, 5-FU, irinotecan, oxaliplatin) to FOLFIRINOX alone in patients with advanced and unresectable or metastatic pancreatic cancer (NCT06079346 submitted on 2023-09-29).Docket No. 018988-021W01
[0497] This present study showed that abrogating TGFB2 mRNA levels and components of the IFN-a response (IFNAR1, STAT1,IRF9, and IFI27) can significantly improve OS outcomes in PDAC patients (Figure 4) to propose the use of inhibitors of IFNAR1 activation in conjunction with OT-101 would significantly improve OS outcomes in PDAC patients. To identify inhibitors of the type-I interferon signaling pathway, a high-throughput screening study was conducted using the secreted embryonic alkaline phosphatase reporter gene assay against a library of 32,000 compounds that yielded 25 compounds of potential small molecule inhibitors. Subsequent characterization of these compounds was conducted to assess their cytotoxicity, effects on STAT phosphorylation, and activities in IFN regulatory factor (IRF) transcription (Yuliantie et al., 2018). Interestingly, a more recent study examining the role of Enhancer of zeste homolog 2 (EZH2), an enzyme that adds methyl groups to the histone protein H3 at the lysine 27 position, leading to gene repression, showed that EZH2 expression increased in the peripheral blood mononuclear cells and renal tissues of patients with systemic lupus erythematosus (SLE). This upregulation positively correlates with the overexpression of interferon-stimulated genes (ISGs). In- vitro inhibition of EZH2 using either siRNAs or chemical inhibitors reduced the phosphorylation of STAT1 and the induction of ISGs stimulated by IFN-a (Wu et al., 2021). Our study's findings provide for using an expanded set of pharmacological tools in combination therapies for PDAC patients, exploiting the knockdown of TGFB2 and components of the type-I interferon signaling pathway.
[0498] Example 28. High TGFB2 mRNA expression levels exhibit increases in HR independent of 9 prognostic macrophage markers (C1QA, CD74, HLA-DQB1, HLA- DRB 1, HLA-F, IFI27, IRF9, LGALS9, MARCO) in the TME but the impact of high TGFB2 mRNA levels reduced at high levels of macrophage markers.
[0499] Highlighted herein was the complex role of TGFB2 mRNA levels and markers for macrophages in the PDAC TME, such that TGFB2 mRNA impacts OS in PDAC patients independent of macrophages in the TME as high TGFB2 levels showed shorter median OS times in patients with low macrophage abundance (Figure IB).
[0500] Also investigated was the molecular gene expression of TAM populations that impact OS independently of TGFB2 mRNA levels in the TME in PDAC patients by compiling a list of potential macrophage markers from published single-cell RNA-seqDocket No. 018988-021W01 experiments and testing their impact and TGFB2 correlations to OS using a multivariate Cox proportional hazards model controlling for age and statistical interaction between TGFB2 and macrophage markers.
[0501] 81 macrophage markers were used, and 54 exhibited significant increases in HR for TGFB2 independently of the macrophage markers, thereby identifying potential markers for TAM populations contributing to the low abundance macrophage environment that exhibits the macrophage-independent impact of TGFB2 mRNA in PDAC patients (Figure 1). Of these, nine genes exhibited significant increases in HR for TGFB2 expression, macrophage marker expression, and a significant interaction term (C1QA, CD74, HLA-DQB1, HLA-DRB 1, HLA-F, IFI27, IRF9, LGALS9, MARCO).
[0502] Gene expression profiles that compared upregulation of TGFB2 mRNA in tumor tissue revealed that TGFB2 was co-regulated with three (C1QA, HLA-F, and LGALS9) of these nine genes that also included mRNA expression levels of TGFB 1, MRC1 / CD206, TLR8, SPI1, C1QA, HLA-F, and LGALS9 in the cluster of genes (Figure 5B). The significant effect of the interaction term from the multivariate model showed that macrophages expressing high levels of these nine genes significantly reduce the negative prognostic impact of high TGFB2 mRNA. This effect was demonstrated by the four most significantly impacted increases in HR for the effect of high levels of TGFB2 mRNA presented in models for HLA-F, CD74, LGALS9, and IRF9, showing predicted OS profiles comparing high versus low expression of these four marker genes (see Figure 6).
[0503] IFI27 a highly expressed prognostic marker that was coregulated with MARCO, CD68, and APOCI macrophage markers, and IFNAR1 was co-regulated with ADM, CD40, and IRF9 showing that IFN-I activation may operate via multiple subpopulations of TAMs in the PDAC TME. In normal tissues MARCO was expressed at very low levels (< 1 TPM) and significantly upregulated in tumor tissue (47-fold increase, P<0.0001), MARCO was found to be co-regulated with IFI27 expression (Figure 5B) and exhibited a similar parameter profile for the multivariate Cox proportional hazards model (Figure 5 A), showing that the detection of MARCO in tumor tissue would limit the impact of TGFB2 knockdown for OS improvements in PDAC patients. A study that examined the single-cell RNA-seq method to characterizeDocket No. 018988-021W01 dynamic changes in TME of PDAC patients charted the emergence of four subsets of macrophages during malignancy in which MARCO was co-expressed with SPP1 marker gene (Chen et al., 2021) pro-angiogenic TAMs in the development of PDAC (Ma et al., 2022) playing a role in epithelial-mesenchymal transition (EMT) and aiding in tumor invasion (Wang et al., 2023). MARCO and CD163 expression in PDAC tissues was a negative prognostic marker for pancreatic cancer after surgery (Shi et al., 2021), and the application of anti-bodies against MARCO may be a therapeutic approach to remodel the TME towards susceptibility to immunotherapies (Dong et al., 2023).
[0504] Single-cell transcriptomic profiles obtained from resected PDAC primary tumors and matched liver metastases identified a subset of TAMs expressing HLA- DRA, CD74, C1QA (Zhang et al., 2023) that also exhibited independent prognostic effects with significant interaction terms with TGFB2 mRNA expression in the multivariate models reported in our study (Figure 5A) thereby showing cooperation of TGFB2 and this subtype of TAMs in metastasis of pancreatic cancer cells.
[0505] Examining the upregulation of gene expression in tumors relative to normal tissue (Figure 5A) it was found that LGALS9 was co-regulated with TGFB2 mRNA levels. The multivariate Cox proportional hazards model that included statistical interaction of TGFB2 and LGALS9 showed that TGFB2 exhibited one of the four most impactful increases in HR. However, the effect was abolished at high levels of LGALS9 (Figure 6F). This prediction model showed that either LGALS6 can be used as a biomarker to identify patients that would not respond to TGFB2 mRNA blockade or inhibition of LGALS6 in combination with TGFB2 abrogation to achieve survival benefit for PDAC patients. A study that applied a computational approach to characterize ligand-receptor interactions between macrophages and tumor ductal cells using the CellphoneDB algorithm to interrogate single-cell transcriptomics data showed significant LGALS9-CD44 and LGALS9-MET interactions were correlated with worse overall survival in PDAC TME and LGALS9 was over-expressed in the macrophage subset (Yang et al., 2023). LGALS9, upregulated 16.5 fold in tumor tissue, produces Galectin-9 protein that interacts with tumors independently to influence tumor progression, functioning as an immune checkpoint and merging as a target for immunotherapy (Zhang et al., 2024).Docket No. 018988-021W01
[0506] Example 29. TGFB2 was found herein to be a negative prognostic indicator in low macrophage and low neoantigen TME PDAC tumors (Figure 1C), which was also reflected in the multivariate analysis of OS outcomes identifying TGFB2 with shorter OS times at low levels of Major Histocompatibility Complex, Class I, F, HLA-F (Figure 6).
[0507] Similar model parameter profiles were observed for Major Histocompatibility Complex, Class II, DQ Beta 1 (HLA-DQB1) and Major Histocompatibility Complex, Class II, DR Beta 1 (HLA-DRB 1) mRNA gene expression profiles showing that under conditions of low neoantigens or low expression of MHC class I or II mRNA that codes for cell surface receptors presenting antigens to T-cells, TGFB2 mRNA expression results in worse OS outcomes (Figure 5). Examining mRNA expression levels in tumor versus normal comparisons (Figure 5B) showed that CD74, a type-II transmembrane glycoprotein, has been shown to function as a chaperone in transporting MHC II molecules involved in antigen presentation (Long et al., 1983), was coregulated with HLA-DQB 1, HLA-DRB1, and HLA-DRA, and serve as a marker for Ml -like macrophage infiltration in 32 cancers including PDAC from the TCGA dataset (Li et al., 2024).
[0508] HLA-DRA (9.3 ± 0.1; 31-fold increase) and CD74 (Mean ± SEM = 10.94 ± 0.08; 21.8-fold) exhibited the most significant increase in expression levels in tumor tissue relative to normal tissue, showing its potential use as a biomarker for PDAC prognosis, whereby PDAC patients with low levels of CD74 or HLA-DRA would benefit from TGFB2 mRNA knockdown.
[0509] This example shows it has become evident that targeting the tumor microenvironment requires a careful analysis of multiple dependencies among interacting biochemical components in TAMs present in the TME. This example shows that inhibiting TGFB2 mRNA levels to improve overall survival (OS) may be effective only when the mRNA expression levels of the IFNAR1 / STAT1 / IRF9 / IFI27 axis are low. This improvement in OS was observed for TGFB2 independent of TGFB1 and TGFB3 ligands.
[0510] Without wishing to be bound by theory, improving treatment outcomes may be challenging, considering recent disappointing reports from clinical trials targeting the TGFB pathway that did not specifically block the mRNA production of TGFB2.Docket No. 018988-021W01
[0511] Without wishing to be bound by theory, trials employing bintrafusp alfa, a first-in-class bifunctional fusion protein designed to block TGF-P and PD-L1, were evaluated in two randomized phase II studies in lung cancer and one in biliary tract cancer. However, in these studies (NCT04727541, NCT04066491), bintrafusp alfa did not demonstrate superiority over standard-of-care therapies (Gameiro et al., 2022; Yoo et al., 2023), and very modest improvements in metastatic nasopharyngeal carcinoma (Chiang et al., 2023). Very recently, Novartis discontinued the development of the pan- anti-TGFB monoclonal antibody NIS793 for the treatment of patients with pancreatic cancer and other malignancies (NCT04390763, NCT04935359, NCT05417386).
[0512] Herein it was shown that TGFB2 mRNA needs to be specifically targeted for treatment. Targeting TGFB2 was necessary, and because the activation of IFN-I and subpopulations of TAMs also contribute to clinical outcomes independent of TGFB2 mRNA levels, combination therapy can be used.
[0513] Furthermore, the multivariate Cox proportional hazards models showed that the impact of TGFB2 mRNA may be reduced at high levels of IRF9 / IFI27 or markers for TAM subpopulations.
[0514] Example 30. Knocking down TGFB2 and IRF9 or IFI27 mRNA expression resulted in a surprising improvement in OS outcomes.
[0515] The negative prognostic impact of TGFB2 mRNA levels was observed at low not high TAM marker mRNA levels.
[0516] Pancreatic adenocarcinoma tumors exhibited increased levels of mRNA expression for components of the Transforming growth factor-P pathway (TGFB 1 / 2 / 3, TGFBR1 / 2 / 3) and Interferon Type I pathways (IFNAR1, STAT1, IRF9 and IFI27). These increased levels of mRNA expression were found to be prognostically and therapeutically significant, whereby patients with either high expression levels of TGFB2, IRF9, or IFI27 showed median OS times ranging from 16 to 20 months (P<0.01 compared to 72 months for patients with low levels of expression for both TGFB2 and either IRF9 or IFI27). This showed that knocking down TGFB2 and IRF9 or IFI27 mRNA expression results in a pronounced improvement in OS outcomes.
[0517] Furthermore, increases in hazard ratios were independent for high levels of TGFB2 and IRF9 or IFI27, controlling for age and interaction effects using a multivariate Cox proportional hazards model.Docket No. 018988-021W01
[0518] Examination of TAM markers applying multivariate Cox proportional hazards models revealed nine genes exhibiting significant increases in HR for TGFB2 expression, TAM marker gene expression, and a significant interaction term between TGFB2 and marker gene expression (C1QA, CD74, HLA-DQB 1, HLA-DRB1, HLA-F, IFI27, IRF9, LGALS9, MARCO), showing that the impact on OS for TGFB2high group of PDAC patients was modified by a subpopulation of TAM expressing these marker genes, whereby the negative prognostic impact of TGFB2 mRNA levels was observed at low not high TAM marker mRNA levels. Of these genes, the highest levels of expression in tumor tissue were observed for CD74 (Mean ± SEM = 10.94 ± 0.08; 21.8- fold increase relative normal tissue), IFI27 (9.63 ± 0.12; 66.3-fold increase), and HLA- DRA (9.3 ± 0.1; 31 -fold increase) and therefore can potentially be used as biomarkers for PDAC prognosis.
[0519] Highly significant impacts of PDAC OS were observed with respect to prognostic impacts of TGFB2, LGALS9 mRNA, and the interaction term for the Cox multivariate regression models, showing that Gal-9 immune checkpoint protein could be targeted for therapy in combination with TGFB2 blockade with molecules such as OT- 101. Results herein showed that a wider range of drugs will be required to be used in combination treatments for patients with pancreatic adenocarcinoma. Targeting both TGFB2, macrophage polarization in the TME, and elements of the type-I interferon signaling pathway could greatly enhance survival rates for these patients.
[0520] Example 31. Multivariate Cox proportional hazards models impacting OS in PDAC patients. Hazard ratios were calculated for macrophage markers, TGFB ligands and receptors, interferon alpha receptors, and interferon alpha response genes (STAT1, IRF9, and IFI27). Results for hazard ratios are shown in Table 6.Table 6: Multivariate Cox proportional hazards models impacting OS in PDACDocket No. 018988-021W01Docket No. 018988-021W01Docket No. 018988-021W01
[0521] Example 32. Comparing the mRNA expression levels in normal pancreatic tissue and tumor samples obtained from patients diagnosed with PDAC.Docket No. 018988-021W01Table 7: Comparing the mRNA expression levels in normal pancreatic tissue and tumor samples obtained from patients diagnosed with PDAC
[0522] Example 33. Comparing mRNA expression levels for macrophage markers in normal brain tissue and tumor samples obtained from patients diagnosed with PDAC.
[0523] Genes identified in the Multivariate Cox proportional hazards model that showed prognostically relevant markers from examining TGFB2-Gene pairs that exhibited either significant increases in both TGFB2 and gene marker OS HR, or an increase in TGFB2 HR and a significant (P<0.05) interaction with the gene marker effect revealing 21 gene markers that impact OS in combination with TGFB2 levels.We also included known markers for classically characterized Ml (CD68) and M2 (MRC1 / CD206) macrophages and TGFB2 for comparison.Table 8: Comparing mRNA expression levels for macrophage markers in normal brain tissue and tumor samples obtained from patients diagnosed with PDACDocket No. 018988-021W01
Claims
Docket No. 018988-021W01WHAT IS CLAIMED IS:
1. A composition comprising an agent for suppressing expression of TGF-P2 for treating or ameliorating the symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 elevated and (b) one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
2. A composition comprising an agent for suppressing expression of TGF-P2 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 elevated and (b) one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
3. A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of TGFB2; and administering a therapeutically sufficient amount of the composition to the subject, wherein the subject is selected who has (a) TGF-P2 elevated and (b) one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
4. The composition or method of any of claims 1-3, wherein the cancer is pancreatic cancer.
5. The composition or method of any of claims 1-3, wherein the cancer is characterized by non-immunogenic tumors.
6. The composition or method of any of claims 1-3, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
7. The composition or method of any of claims 1-3, wherein the agent for suppressing expression of TGF-P2 is (OT-101) C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO: 67 or CGGCATGTCTATTTTGTA SEQ ID NO: 75.
8. The composition or method of any of claims 1-3, wherein the composition comprises a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.Docket No. 018988-021W019. The composition or method of any of claims 1-3, wherein the composition is substantially free of excipients.
10. The composition or method of any of claims 1-3, wherein the composition is stable for at least 14 days in carrier at 37°C.
11. The composition or method of any of claims 1-3, wherein the subject after the administration has reduced TGF-P2 mRNA expression.
12. The composition or method of any of claims 1-3, wherein the administration increases survival rate at month 6, 12, 18, 24, 30, or 36.
13. The composition or method of any of claims 1-3, wherein the administration of the composition is combined with a standard of care treatment for cancer, wherein the standard of care treatment comprises chemotherapy or radiation therapy.
14. An agent for suppressing expression of IRF9 for treating or ameliorating the symptoms of cancer in a subject.
15. A composition comprising an agent for suppressing expression of IRF9 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.
16. A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of IRF9; and administering a therapeutically sufficient amount of the composition to the subject.
17. The agent, composition or method of any of claims 14-16, wherein the cancer is pancreatic cancer.
18. The agent, composition or method of any of claims 14-16, wherein the cancer is characterized by non-immunogenic tumors.
19. The agent, composition or method of any of claims 14-16, wherein the subject is selected who has (a) IRF9 elevated and (b) one or more of TGF-P2, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.Docket No. 018988-021W0120. The agent, composition or method of any of claims 14-16, wherein the agent, medicament or administration comprises one or more IRF9-specific antisense oligonucleotides complementary to a IRF9 transcript and 15-30 nucleotides in length.
21. The agent, composition or method of any of claims 14-16, wherein the agent, medicament or administration comprises one or more IRF9-specific antisense oligonucleotides complementary to a IRF9 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.
22. The agent, composition or method of any of claims 14-16, wherein the agent, medicament or administration comprises one or more IRF9-specific antisense oligonucleotides complementary to a IRF9 transcript as in Table 1.
23. The agent, composition or method of any of claims 14-16, wherein the agent, medicament or administration comprises IRF9-specific antisense oligonucleotides CAATGTCTGAATGGACTGCT SEQ ID NO:8 or C*A*A*T*G*T*C*T*G*A*A*T*G*G*A*C*T*G*C*T SEQ ID NO: 1.
24. The agent, composition or method of any of claims 14-16, comprising an IRF9-specific antisense oligonucleotide as in Table 1 having one or more nucleotides chemically modified as a phosphorothioate internucleoside linkage, a methoxypropylphosphonate intemucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-0Me ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’ -4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5- methylcytodine base.
25. The agent, composition or method of any of claims 14-16, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.
26. The agent, composition or method of any of claims 14-16, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.
27. The agent, composition or method of any of claims 14-16, wherein the agent, medicament or administration is substantially free of excipients.
28. The agent, composition or method of any of claims 14-16, wherein the agent, medicament or administration is stable for at least 14 days in carrier at 37°C.
29. The agent, composition or method of any of claims 14-16, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.Docket No. 018988-021W0130. The agent, composition or method of any of claims 14-16, wherein the agent or medicament is administered by infusion or injection.
31. The agent, composition or method of any of claims 14-16, wherein the agent, medicament or administration increases survival rate of subjects at month 6, 12, 18, 24, 30, or 36.
32. An agent for suppressing expression of LGALS9 for treating or ameliorating the symptoms of cancer in a subject.
33. A composition comprising an agent for suppressing expression of LGALS9 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.
34. A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of LGALS9; and administering a therapeutically sufficient amount of the composition to the subject.
35. The composition or method of any of claims 32-34, wherein the cancer is pancreatic cancer.
36. The agent, composition or method of any of claims 32-34, wherein the cancer is characterized by non-immunogenic tumors.
37. The agent, composition or method of any of claims 32-34, wherein the subject is selected who has (a) LGALS9 elevated and (b) one or more of TGF-P2, IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
38. The agent, composition or method of any of claims 32-34, wherein the agent, medicament or administration comprises one or more LGALS9-specific antisense oligonucleotides complementary to a LGALS9 transcript and 15-30 nucleotides in length.
39. The agent, composition or method of any of claims 32-34, wherein the agent, medicament or administration comprises one or more LGALS9-specific antisense oligonucleotides complementary to a LGALS9 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.
40. The agent, composition or method of any of claims 32-34, wherein the agent, medicament or administration comprises one or more LGALS9-specific antisense oligonucleotides complementary to a LGALS9 transcript as in Table 2.Docket No. 018988-021W0141. The agent, composition or method of any of claims 32-34, wherein the agent, medicament or administration comprises LGALS9-specific antisense oligonucleotides CTTGAATAGTCCCAGAAAAG SEQ ID NO: 28 or C*T*T*G*A*A*T*A*G*T*C*C*C*A*G*A*A*A*A*G SEQ ID NO:24.
42. The agent, composition or method of any of claims 32-34, comprising a LGALS9- specific antisense oligonucleotide as in Table 2 having one or more nucleotides chemically modified as a phosphorothioate internucleoside linkage, a methoxypropylphosphonate intemucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-0Me ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’-4’ constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5-methylcytodine base.
43. The agent, composition or method of any of claims 32-34, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.
44. The agent, composition or method of any of claims 32-34, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.
45. The agent, composition or method of any of claims 32-34, wherein the agent, medicament or administration is substantially free of excipients.
46. The agent, composition or method of any of claims 32-34, wherein the agent, medicament or administration is stable for at least 14 days in carrier at 37°C.
47. The agent, composition or method of any of claims 32-34, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.
48. The agent, composition or method of any of claims 32-34, wherein the agent is administered by infusion or injection.
49. The agent, composition or method of any of claims 32-34, wherein the agent, medicament or administration increases survival rate of subjects at month 6, 12, 18, 24, 30, or 36.
50. An agent for suppressing expression of IFI27 for treating or ameliorating the symptoms of cancer in a subject.
51. A composition comprising an agent for suppressing expression of IFI27 in the preparation of a medicament for treating or ameliorating the symptoms of cancer in a subject.Docket No. 018988-021W0152. A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for suppressing expression of IFI27; and administering a therapeutically sufficient amount of the composition to the subject.
53. The agent, composition or method of any of claims 50-52, wherein the cancer is pancreatic cancer.
54. The agent, composition or method of any of claims 50-52, wherein the cancer is characterized by non-immunogenic tumors.
55. The agent, composition or method of any of claims 50-52, wherein the subject is selected who has (a) IFI27 elevated and (b) one or more of TGF-P2, IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
56. The agent, composition or method of any of claims 50-52, wherein the agent, medicament or administration comprises one or more IFI27-specific antisense oligonucleotides complementary to a IFI27 transcript and 15-30 nucleotides in length.
57. The agent, composition or method of any of claims 50-52, wherein the agent, medicament or administration comprises one or more IFI27-specific antisense oligonucleotides complementary to a IFI27 pre-RNA, pre-mRNA or mRNA and 18-21 nucleotides in length.
58. The agent, composition or method of any of claims 50-52, wherein the agent, medicament or administration comprises one or more IFI27-specific antisense oligonucleotides complementary to a IFI27 transcript as in Table 3.
59. The agent, composition or method of any of claims 50-52, wherein the agent, medicament or administration comprises IFI27-specific antisense oligonucleotides GTATATTTGGGATAGTTGGC SEQ ID NO:61 or G*T*A*T*A*T*T*T*G*G*G*A*T*A*G*T*T*G*G*C SEQ ID NO:47.
60. The agent, composition or method of any of claims 50-52, comprising a IFI27-specific antisense oligonucleotide as in Table 3 having one or more nucleotides chemically modified as a phosphorothioate internucleoside linkage, a methoxypropylphosphonate intemucleoside linkage, an aminophosphoro linkage to a morpholino group, a 2’-OMe ribose group, a 2’ -MOE methoxy ethyl ribose group, a 2’ -4’ constrained methoxy ethyl bicyclic ribose group, a 2’ -4’Docket No. 018988-021W01 constrained ethyl bicyclic ribose group, an LNA ribose group, a 2’-F ribose group, or a 5- methylcytodine base.
61. The agent, composition or method of any of claims 50-52, wherein the agent is conjugated to a polyethylene glycol, a lipid, or a triantenarry N-acteyl-galactosamine.
62. The agent, composition or method of any of claims 50-52, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline, or a combination thereof.
63. The agent, composition or method of any of claims 50-52, wherein the agent, medicament or administration is substantially free of excipients.
64. The agent, composition or method of any of claims 50-52, wherein the agent, medicament or administration is stable for at least 14 days in carrier at 37°C.
65. The agent, composition or method of any of claims 50-52, wherein the agent, medicament or administration is combined with a standard of care treatment for the cancer.
66. The agent, composition or method of any of claims 50-52, wherein the agent or medicament is administered by infusion or injection.
67. The agent, composition or method of any of claims 50-52, wherein the agent, medicament or administration increases survival rate of subjects at month 6, 12, 18, 24, 30, or 36.
68. A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IRF9 for use in treating or ameliorating symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 and IRF9 elevated and (b) one or more of LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
69. A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IRF9 for use in the preparation of a medicament for treating or ameliorating symptoms of a cancer in a subject, wherein the subject is selected who has (a) TGF- P2 and IRF9 elevated and (b) one or more of, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
70. A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: selecting the subject who has (a) TGF-P2 and IRF9 elevated and (b) one or more ofDocket No. 018988-021W01LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced; administering an agent for suppressing expression of TGF-P2; and administering an agent for suppressing expression of IRF9; wherein the agent for suppressing expression of TGF-P2 and the agent for suppressing expression of IRF9 are administered concurrently, simultaneously, sequentially, or separately in time.
71. The composition or method of any of claims 68-70, wherein the cancer is pancreatic cancer.
72. The composition or method of any of claims 68-70, wherein the cancer is characterized by non-immunogenic tumors.
73. The composition or method of any of claims 68-70, wherein the composition or medicament is administered by infusion or injection.
74. The composition or method of any of claims 68-70, wherein the TGF-P2 and the one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F have an mRNA level elevated above a median of a control group of subjects having the same cancer.
75. The composition or method of any of claims 68-70, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
76. The composition or method of any of claims 68-70, wherein the agent for suppressing expression of TGF-P2 is (OT-101) C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO: 67 or CGGCATGTCTATTTTGTA SEQ ID NO: 75.
77. The composition or method of any of claims 68-70, wherein the agent for suppressing expression of IRF9 is selected from Table 1, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
78. The composition or method of any of claims 68-70, wherein the agent for suppressing expression of IRF9 is C*A*A*T*G*T*C*T*G*A*A*T*G*G*A*C*T*G*C*T SEQ ID NO: 1 or CAATGTCTGAATGGACTGCT SEQ ID NO: 8.
79. The composition or method of any of claims 68-70, wherein the compositions comprise a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.Docket No. 018988-021W0180. The composition or method of any of claims 68-70, wherein the composition is substantially free of excipients.
81. The composition or method of any of claims 68-70, wherein the composition is stable for at least 14 days in carrier at 37°C.
82. The composition or method of any of claims 68-70, wherein the subject after the administration or use has a reduced TGF-P2 expression.
83. The composition or method of any of claims 68-70, wherein the administration or use increases survival rate at month 6, 12, 18, 24, 30, or 36.
84. A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of LGALS9 for use in treating or ameliorating symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 and LGALS9 elevated and (b) one or more of IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
85. A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of LGALS9 for use in the preparation of a medicament for treating or ameliorating symptoms of a cancer in a subject, wherein the subject is selected who has (a) TGF- P2 and LGALS9 elevated and (b) one or more of IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
86. A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: selecting the subject who has (a) TGF-P2 and LGALS9 elevated and (b) one or more of IRF9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced; administering an agent for suppressing expression of TGF-P2; and administering an agent for suppressing expression of LGALS9; wherein the agent for suppressing expression of TGF-P2 and the agent for suppressing expression of LGALS9 are administered concurrently, simultaneously, sequentially, or separately in time.
87. The composition or method of any of claims 84-86, wherein the cancer is pancreatic cancer.Docket No. 018988-021W0188. The composition or method of any of claims 84-86, wherein the cancer is characterized by non-immunogenic tumors.
89. The composition or method of any of claims 84-86, wherein the composition or medicament is administered by infusion or injection.
90. The composition or method of any of claims 84-86, wherein the TGF-P2 and the one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F have an mRNA level elevated above a median of a control group of subjects having the same cancer.
91. The composition or method of any of claims 84-86, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
92. The composition or method of any of claims 84-86, wherein the agent for suppressing expression of TGF-P2 is (OT-101) C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO: 67 or CGGCATGTCTATTTTGTA SEQ ID NO: 75.
93. The composition or method of any of claims 84-86, wherein the agent for suppressing expression of LGALS9 is selected from Table 2, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
94. The composition or method of any of claims 84-86, wherein the agent for suppressing expression of LGALS9 is CTTGAATAGTCCCAGAAAAG SEQ ID NO:28 or C*T*T*G*A*A*T*A*G*T*C*C*C*A*G*A*A*A*A*G SEQ ID NO:24.
95. The composition or method of any of claims 84-86, wherein the agents or compositions comprise a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.
96. The composition or method of any of claims 84-86, wherein the composition is substantially free of excipients.
97. The composition or method of any of claims 84-86, wherein the composition is stable for at least 14 days in carrier at 37°C.
98. The composition or method of any of claims 84-86, wherein the subject upon the administration or use has a reduced TGF-P2 expression.Docket No. 018988-021W0199. The composition or method of any of claims 84-86, wherein the administration or use increases survival rate at month 6, 12, 18, 24, 30, or 36.
100. A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IFI27 for use in treating or ameliorating symptoms of cancer in a subject in need, wherein the subject is selected who has (a) TGF-P2 and IFI27 elevated and (b) one or more of IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
101. A composition comprising an agent for suppressing expression of TGF-P2 and an agent for suppressing expression of IFI27 for use in the preparation of a medicament for treating or ameliorating symptoms of a cancer in a subject, wherein the subject is selected who has (a) TGF- P2 and IFI27 elevated and (b) one or more of IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced.
102. A method for treating or ameliorating the symptoms of cancer in a subject in need, the method comprising: selecting the subject who has (a) TGF-P2 and IFI27 elevated and (b) one or more of IRF9, LGALS9, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F reduced; and administering an agent for suppressing expression of TGF-P2; and administering an agent for suppressing expression of IFI27; wherein the agent for suppressing expression of TGF-P2 and the agent for suppressing expression of IFI27 are administered concurrently, simultaneously, sequentially, or separately in time.
103. The composition or method of any of claims 100-102, wherein the cancer is pancreatic cancer.
104. The composition or method of any of claims 100-102, wherein the cancer is characterized by non-immunogenic tumors.
105. The composition or method of any of claims 100-102, wherein the composition or medicament is administered by infusion or injection.
106. The composition or method of any of claims 100-102, wherein the TGF-P2 and the one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1,Docket No. 018988-021W01 and HLA-F have an mRNA level elevated above a median of a control group of subjects having the same cancer.
107. The composition or method of any of claims 100-102, wherein the agent for suppressing expression of TGF-P2 is selected from Table 4, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
108. The composition or method of any of claims 100-102, wherein the agent for suppressing expression of TGF-P2 is (OT-101) C*G*G*C*A*T*G*T*C*T*A*T*T*T*T*G*T*A SEQ ID NO: 67 or CGGCATGTCTATTTTGTA SEQ ID NO: 75.
109. The composition or method of any of claims 100-102, wherein the agent for suppressing expression of IFI27 is selected from Table 3, and chemically-modified variants thereof, LNA variants thereof, gapmer variants thereof, and any combination or pooling thereof.
110. The composition or method of any of claims 100-102, wherein the agent for suppressing expression of IFI27 is GTATATTTGGGATAGTTGGC SEQ ID NO:61 or G*T*A*T*A*T*T*T*G*G*G*A*T*A*G*T*T*G*G*C SEQ ID NO:47.
111. The composition or method of any of claims 100-102, wherein the composition comprises a carrier of sterile water for injection, saline, isotonic saline, or a combination thereof.
112. The composition or method of any of claims 100-102, wherein the composition is substantially free of excipients.
113. The composition or method of any of claims 100-102, wherein the composition is stable for at least 14 days in carrier at 37°C.
114. The composition or method of any of claims 100-102, wherein the subject after the administration or use has a reduced TGF-P2 expression.
115. The composition or method of any of claims 100-102, wherein the administration or use increases survival rate at month 6, 12, 18, 24, 30, or 36.
116. A method for collecting data, the method comprising: obtaining data relating to a group of subjects to generate a dataset comprising mRNA or protein levels for at least two biomarkers comprising TGF-P2 and one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F.Docket No. 018988-021W01117. The method of claim 116, comprising obtaining one or more clinical parameters from the subjects selected from age, sex, race / ethnicity, medical history, alcohol, and smoking.
118. A method for diagnosing or prognosing pancreatic cancer in an individual subject, the method comprising: obtaining data relating to a control group of subjects to generate a dataset comprising mRNA or protein levels for at least two biomarkers comprising TGF-P2 and one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F; obtaining data relating to an individual subject to generate a dataset comprising mRNA or protein levels for at least two biomarkers comprising TGF-P2 and one or more of IRF9, LGALS9, IFI27, MARCO, CD74, HLA-DRA, C1QA, HLA-DQB1, HLA-DRB1, and HLA-F; comparing the dataset obtained from the individual subject to the dataset of the control group; and determining differences between the individual subject and the control group exceeding a threshold for indicating pancreatic cancer in the individual subject.
119. The method of claim 118, comprising obtaining one or more clinical parameters from the subjects selected from age, sex, race / ethnicity, medical history, alcohol, and smoking.
120. The method of claim 118, comprising diagnosing or prognosing pancreatic cancer in the subject.
121. The method of claim 118, comprising treating the subject for pancreatic cancer by administering an anti-cancer drug.