Method for forming conjugate of target substance and peptide

By using a linker with multiple puromycin-like substances to form a conjugate with target mRNA, the method addresses the limitations of single-binding nucleic acid translation products, enhancing peptide selection and binding efficiency.

WO2026089003A1PCT designated stage Publication Date: 2026-04-30PEPTIDREAM INC
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/037241
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-25
Filing Date
2025-10-23
Publication Date
2026-04-30

AI Technical Summary

Technical Problem

Existing puromycin-like substance-mediated display methods only allow for a single nucleic acid to be bound to a monovalent translation product, limiting the efficiency and versatility of peptide selection and binding.

Method used

A linker with multiple puromycin-like substances is used to form a conjugate with a target mRNA, allowing multiple translation products to be bound to a single mRNA, which is then synthesized in a cell-free translation system, resulting in a conjugate where multiple peptides are linked to a single nucleic acid.

Benefits of technology

This approach enhances the efficiency of peptide selection and binding by enabling multiple peptides to interact with target substances, increasing the binding ability and versatility of the conjugate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure JPOXMLDOC01-APPB-T000002
    Figure JPOXMLDOC01-APPB-T000002
  • Figure JPOXMLDOC01-APPB-T000003
    Figure JPOXMLDOC01-APPB-T000003
Patent Text Reader

Abstract

The present invention relates to a method for forming a conjugate of a desired target substance and a peptide. A method according to the present invention includes a step for bringing a genetic information material-linker-peptide conjugate into contact with a target substance conjugate containing at least two target substances. The genetic information material-linker-peptide conjugate includes: (a) a linker that includes a bond portion having a structure capable of binding to a desired genetic information material and includes at least two puromycin-like substances, the puromycin-like substances being capable of covalently binding to the C-terminus of a desired peptide; (b) a genetic information material that is bonded to the bond portion of the linker of (a); and (c) a peptide that is bonded to at least two or more puromycin-like substances of the linker of (a) and is encoded by the genetic information material.
Need to check novelty before this filing date? Find Prior Art

Description

A method for forming a conjugate between a target substance and a peptide.

[0001] The present invention relates to a binding portion having a structure capable of binding to a desired genetic information material; a linker comprising at least two (or more) puromycin-like substances; the use of the linker; a genetic information material-linker conjugate comprising the linker; a genetic information material-linker-peptide conjugate comprising the linker, and the like.

[0002] The present invention relates to a method for forming a conjugate of a desired target substance and a peptide, the method comprising the step of contacting the genetic information substance-linker-peptide conjugate with a target substance conjugate containing at least two of the target substance.

[0003] 1. Display Methods: Genotype-phenotype mapping techniques, which originated as tools in evolutionary molecular engineering, are also known as display methods and include phage display, ribosome display, microbead droplet, STABLE (non-covalent DNA display), mRNA display ("In vitro virus", Nemoto N, et al. FEBS Lett. 414, 405-408 (1997) (Non-patent Literature 1), WO98 / 016636 (Patent Literature 1); or "RNA-peptide fusions", Roberts, R.W. & Szostak, J. W., Proc. Natl. Acad. Sci. USA., 94, 12297-12302 (1997) (Non-Patent Literature 2), WO1998 / 31700 (Patent Literature 12)), cDNA display method, photocrosslinked cDNA display method (WO2016 / 159211 (Patent Literature 6)), TRAP (transcription-translation coupled with association of puromycin linker) display method (T. Ishizuka et al., TRAP display: a high-speed selection method for the generation of Known methods include functional polypeptides, Am. Chem. Soc. 2013, 135, 14, 5433-5440 (Non-Patent Literature 3)), and the cDNA TRAP display method (T. Kondo et al., cDNA TRAP display for rapid and stable in intro selection of antibody-like proteins, Chem. Commun., 2021, 572416-572419 (Non-Patent Literature 4)).

[0004] In the display method, when functional peptide or protein molecules are selected from a library, the corresponding genes are linked, making it easy to read their sequences. This is useful when selecting genetic information for polypeptides with specific functions. By combining the display method in a cell-free translation system (in vitro protein synthesis system) with genetic code reprogramming, it becomes possible to synthesize peptides containing non-natural amino acid residues (non-natural peptides).

[0005] 2. Display Method via Puromycin The above display method is a technique that integrates genotype and phenotype by linking mRNA as the genotype with a peptide molecule as the phenotype using a cell-free translation system (in vitro protein synthesis system). A typical method involves linking a synthesized peptide molecule with the mRNA encoding it via puromycin, an analog of the tyrosyl-tRNA 3' terminus. It has also been reported that peptides and mRNA can be similarly linked using substances other than puromycin, such as puromycin derivatives (WO2011 / 049157 (Patent Document 2)).

[0006] In this puromycin-like substance-mediated display method, puromycin is ligated to mRNA via a suitable linker, and when this is introduced into a cell-free translation system to synthesize peptides from the mRNA, the puromycin-like substance ligates to the C-terminus of the elongating peptide chain as a substrate for the peptide transfer reaction in ribosomes, and the resulting peptide molecule ligates to the mRNA via the puromycin-like substance. In this puromycin-like substance-mediated display method, mRNA and the puromycin-like substance are ligated either covalently using RNA ligase or noncovalently through nucleic acid hybridization. These methods, including mRNA display (In vitro virus method), cDNA display method, photocrosslinked cDNA display method (WO2016 / 159211 (Patent Document 6)), and TRAP (transcription-translation coupled with association of puromycin linker) display method, enable the covalent or noncovalent linking of various nucleic acid substances with puromycin-like substances.

[0007] In the above method, the puromycin-like substance acts as a substrate for the peptide transfer reaction in ribosomes. However, regarding the puromycin-like substance-mediated linkage of nucleic acids and their translation products, only those in which one translation product is bound to one nucleic acid are known (for example, WO1998 / 016636 (Patent Document 1), WO2011 / 049157 (Patent Document 2), WO2006 / 041194 (Patent Document 3), JP2011-528912 (Patent Document 4), etc.). In the display method mediated by the puromycin-like substance, only those in which a single nucleic acid is bound to a monovalent translation product (peptide) have been used.

[0008] WO1998 / 016636 WO2011 / 049157 WO2006 / 041194 JP 2011-528912 JP 2008-125396 WO2016 / 159211 WO2012 / 026566 JP 2008-125396 WO2007 / 066627 WO2019 / 077887 WO2023 / 234425 WO1998 / 31700

[0009] N Nemoto,et al.,FEBS Lett.,1997,414,405-408Roberts,R.W,et al.,Proc.Natl.Acad.Sci.USA.,1997,94,12297-12302T.Ishizuka et al.,Am.Chem.Soc.2013,135,14,5433-5440T.Kondo et al.,Chem.Commun.,2021,572416-572419Liu et al.,Proc.Natl.Acad.Sci.USA.2012,109(2),413-418Ko et al.,J.Am.Chem.Soc.2022,144,47,21494-21501I.P.Korndorefer and A.Skerra,Protein Sci.,2002,11,4,883-893K.A.McDonnell et al.,J.Med.Chem.,2010,53,4,1587-1596M.N.Pascha et al.,ACS Chem.Biol.,2022,17,9,2425-2436K.Muguruma et al.,ACS Omega,2019,4,11,14390-14397N.Terasaka et al.,Nat.Chem.Biol.,2014,10,7,555-557H.Murakami et al.,Nat.Methods,2006,3,5,357-359T.Kawakami et al.,Chem.Biol.,2008,15,1,32-42M.Saito et al.,Nat.Commun.,2021,12,1,2654KATO T, et al.Nucleic Acids Res.51,8169-8180,2023Y. Goto et al.,J. Am. Chem. Soc.131,14,5040-5041,2009Zhenling Cui, et al.,Front Bioeng Biotechnol. 8,1031,2020Mizusawa et al.,Bioorg.Med.Chem.,2009,17,6,2381-2387Hayashi et al.,ACS Chem.Biol.,2012、7,3、607-613Hadidi et al., Angew Chem Int Ed Engl.,2023,62,23,e202216784Starck et al.,RNA.,2002,8,7,890-903Bao T Le et al.,Mol Ther Nucleic Acids.,2019,1,14,142-157Irina Anosova et al.,Nucleic Acids Res.,2016.,Feb 18,44,3,1007-1021Michiko Kimoto et al.,Front Mol Biosci, 2022,May 24,9,851646Naho Akiyama et al.,Nat Struct Mol Biol.,2024,Mar,27Valerie de Crecy-Lagard et al.,Trends Microbiol.,2021,Jan,29,1,41-53M.H.Schreier et al.,Journal of Molecular Biology,Vol.116,No.4,727-753H.Trachsel et al.,Journal of Molecular Biology,Vol.116,No.4,755-767P.C.Jelenc et al.,Proceedings of the Natural Academy Science of the United States of America Vol.76,No.7,3174-3178Wen-Rui Hao et al.,Sci Rep.2018 Mar 6;8(1):4256Heather A Huet et al.,MAbs . 2014;6(6):1560-70Thomas Fryer et al.,ACS Cent Sci.2022 Aug 24;8(8):1182-1195Anihoa Moliner-Morro et al.,Biomolecules.2020 Dec 11;10(12):1661Eugene M. Obeng et al.,Nano Today.2022 Oct:46:101580Adam Leach et al.,Sci Rep.2021 May 18;11(1):10475H.Thie et al.,New Biotechnology.2009 Dec 31;26(6):314-21S.M. Cloutier et al.,Mol Immunol. 2000 Dec; 37(17):1067-1077 Karl Gatterdam et al. , Angew Chem Int Ed Engl. 2018 Sep 17;57(38):12395-12399Devein T Wiley et al. , Proc Natl Acad Sci USA. 2013 May 21;110(21):8662-7. Chavee Laomeephor et al. , Int J Pharm. 2024 Jul 20:660:124332. Timothy Q Vu et al. , Biomacromolecules. 2023 Apr 10;24(4):1574-1584. Richard H. Guenther et al. , J Chromatogr. 1988 Jul 1:444:79-87,

[0010] One aspect of the present invention aims to provide a binding portion having a structure capable of binding to a desired genetic information material; a linker comprising at least two (or more) puromycin-like substances; the use of the linker; a genetic information material-linker conjugate comprising the linker; a genetic information material-linker-peptide conjugate comprising the linker, etc.

[0011] One aspect of the present invention aims to provide a method for forming a conjugate of a desired target substance and a peptide, comprising the step of contacting a genetic information substance-linker-peptide conjugate, which includes a binding portion having a structure capable of binding to a desired genetic information substance; and a linker containing at least two or more puromycin-like substances, with a target substance conjugate containing at least two target substances.

[0012] One aspect of the present invention aims to provide a method for forming a conjugate of a desired target substance and a peptide, comprising the step of contacting a genetic information substance-linker-peptide conjugate, which includes a binding portion having a structure capable of binding to a desired genetic information substance; and a linker having at least two binding portions having a structure capable of covalently bonding to the C-terminus of a peptide, with a target substance conjugate containing at least two target substances.

[0013] The inventors of the present invention have discovered, to their surprise, that by translating a target mRNA-linker conjugate—in which a target mRNA is linked to a linker containing a puromycin-like substance bound to each of its multiple branching sites—in a ribosome, a conjugate in which multiple translation products are bound to a single mRNA can be obtained. Furthermore, they have found that such conjugates can be efficiently obtained by repeating this step, leading to the invention. Since the linker of the present invention has multiple puromycin-like substances bound to it, by introducing the mRNA-linker conjugate of the present invention into a cell-free translation system and synthesizing peptides from mRNA, a conjugate of nucleic acid and translation products can be obtained.

[0014] A. The present invention includes, but is not limited to, the following embodiments: [Embodiment 1] A linker comprising a binding portion having a structure capable of binding to a desired genetic information material; and at least two or more puromycin-like substances, wherein the puromycin-like substances are covalently capable of binding to the C-terminus of a desired peptide. [Embodiment 2] The linker according to Embodiment 1, wherein the binding portion having a structure capable of binding to the desired genetic information material comprises a nucleic acid capable of binding to the desired genetic information material. [Embodiment 3] The linker according to Embodiment 1 or 2 for linking the genetic information material and a peptide encoded by the genetic information material. [Embodiment 4] The linker according to any one of Embodiments 1 to 3, wherein the genetic information material is a nucleic acid. [Embodiment 5] The linker according to any one of Embodiments 1 to 3, wherein the puromycin-like substance is puromycin. [Aspect 6] A linker comprising a binding portion having a structure capable of binding to a desired genetic information material; and at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide, the use of the linker for linking the genetic information material to a peptide encoded by the genetic information material. [Aspect 7] (a) A linker according to any one of aspects 1 to 3; and (b) A genetic information material-linker conjugate comprising the genetic information material bound to the binding portion of the linker of (a). [Aspect 8] (a) A linker according to any one of aspects 1 to 3; (b) The genetic information material bound to the binding portion of the linker of (a); and (c) A genetic information material-linker-peptide conjugate comprising the peptide encoded by the genetic information material, bound to at least two or more puromycin-like substances of the linker of (a). [Aspect 9] A method for producing a genetic information material-linker-peptide conjugate, comprising: (1) a step of subjecting the genetic information material-linker conjugate described in Aspect 7 to a cell-free translation system to perform translation of the genetic information material, wherein the puromycin-like substance in the linker binds to the translated peptide, thereby obtaining a genetic information material-linker-peptide conjugate.[Aspect 10] The manufacturing method according to aspect 9, comprising the step of (0) binding a linker according to any one of aspects 1 to 3 with a desired genetic information material to obtain a genetic information material-linker conjugate, before step (1). [Aspect 11] The manufacturing method according to aspect 9 or 10, comprising the step of (2) repeating step (1) two or more times. [Aspect 12] A library comprising at least two genetic information material-linker-peptide conjugates according to aspect 8. [Aspect 13] A screening method for peptides that bind to a desired target substance, comprising the step of contacting a library comprising at least two genetic information material-linker-peptide conjugates according to aspect 8 with the target substance. [Aspect 14] A method for evaluating the binding ability of a peptide to a desired target substance, comprising the step of contacting a genetic information material-linker-peptide conjugate according to aspect 8 with the target substance. [Aspect 15] A method for producing a genetic information material-linker-peptide conjugate, comprising the steps of: (1-i) providing a genetic information material-linker conjugate, in which a linker containing at least one puromycin-like substance is bound to a desired genetic information material, to a cell-free translation system to translate the genetic information material, wherein the puromycin-like substance in the linker binds to the translated peptide, and a genetic information material-linker-peptide conjugate is obtained; and (2-i) repeating the step of (1-i) two or more times. [Aspect 16] A method for producing a genetic information material-linker-peptide conjugate, comprising the steps of: (1-ii) providing a genetic information material-linker conjugate, in which a linker containing at least two puromycin-like substances is bound to a desired genetic information material, to a cell-free translation system to translate the genetic information material, wherein the puromycin-like substance in the linker binds to the translated peptide, and a genetic information material-linker-peptide conjugate is obtained. [Aspect 17] A method for presenting two or more peptides encoded by a desired genetic information material from the genetic information material, wherein each of the peptides is linked to the genetic information material via a functional group that can be covalently bonded to the C-terminus of the peptide.[Aspect 18] The presentation method according to aspect 17, comprising the step of providing the genetic information material-linker conjugate described in aspect 7 to a cell-free translation system and translating the peptide from the genetic information material, wherein the puromycin-like substance and the translated peptide are bound together.

[0015] B. The inventors have further found that by contacting the genetic information material-linker-peptide conjugate with a target substance conjugate containing at least two of the target substances, the translation product can be recognized by multiple target substances. The present invention includes, but is not limited to, the following embodiments. [1] A method for forming a conjugate of a desired target substance and a peptide, comprising the step of contacting a genetic information substance-linker-peptide conjugate with a target substance conjugate comprising at least two of the target substance, wherein the genetic information substance-linker-peptide conjugate comprises: (a) a binding portion having a structure capable of binding to a desired genetic information substance; and a linker comprising at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic information substance bound to the binding portion of the linker in (a); and (c) a peptide encoded by the genetic information substance bound to at least two or more puromycin-like substances of the linker in (a), the genetic information substance-linker-peptide conjugate. [2] The method according to [1], wherein the target substance conjugate comprises at least two of the target substances linked via a target substance linking linker. [3] The method according to [1] or [2], wherein the number of target substances contained in the target substance conjugate is 2 or more and 16 or less. [4] The method according to any one of [1] to [3], wherein the binding portion having a structure capable of binding to the desired genetic information substance in the (a) linker contains a nucleic acid capable of binding to the desired genetic information substance. [5] The method according to any one of [1] to [4], wherein the genetic information substance is a nucleic acid. [6] The method according to any one of [1] to [5], wherein the puromycin-like substance in the (a) linker is puromycin. [7] The method according to any one of [1] to [6], wherein the binding ability between the target substance conjugate and the genetic information substance-linker-peptide conjugate is higher than the binding ability between the desired target substance and the genetic information substance-linker-peptide conjugate.[8] A use for contacting a target substance conjugate comprising at least two desired target substances with a genetic information substance-linker-peptide conjugate to form a conjugate of the target substance and a peptide, wherein the genetic information substance-linker-peptide conjugate comprises: (a) a binding portion having a structure capable of binding to a desired genetic information substance; and a linker comprising at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic information substance bound to the binding portion of the linker in (a); and (c) a peptide encoded by the genetic information substance bound to at least two or more puromycin-like substances of the linker in (a), the use. [9] The use according to [8], wherein the target substance conjugate comprises at least two of the target substances linked via a target substance linking linker.

[10] A screening method for peptides that bind to a desired target substance, comprising the step of contacting a library comprising at least two genetic material-linker-peptide conjugates with a target substance conjugate comprising at least two of the target substance, wherein the genetic material-linker-peptide conjugate comprises: (a) a binding portion having a structure capable of binding to a desired genetic material; and a linker comprising at least two puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic material bound to the binding portion of the linker in (a); and (c) a genetic material-linker-peptide conjugate comprising a peptide encoded by the genetic material, bound to at least two puromycin-like substances of the linker in (a).

[11] The method according to

[10] , wherein the target substance conjugate comprises at least two of the target substances linked via a target substance linking linker.

[12] A method for evaluating the binding ability of a desired target substance to a peptide, comprising the step of contacting a library comprising at least two genetic material-linker-peptide conjugates with a target substance conjugate comprising at least two of the target substance, wherein the genetic material-linker-peptide conjugate is: (a) a binding portion having a structure capable of binding to a desired genetic material; and a linker comprising at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic material bound to the binding portion of the linker in (a); and (c) a genetic material-linker-peptide conjugate comprising a peptide encoded by the genetic material, bound to at least two or more puromycin-like substances on the linker in (a).

[13] The method according to

[12] , wherein the target substance conjugate is a conjugate in which at least two of the target substances are linked via a target substance linking linker.

[14] A method for forming a conjugate of a desired target substance and a peptide, comprising the step of contacting a genetic information substance-linker-peptide conjugate with a target substance conjugate comprising at least two of the target substance, wherein the genetic information substance-linker-peptide conjugate comprises: (a) a linker having a structure capable of binding to a desired genetic information substance; and at least two or more linkers having a structure capable of covalently binding to the C-terminus of a peptide, wherein the length and rigidity of the linker structure connecting the at least two or more linkers having a structure capable of covalently binding to the C-terminus of the peptide can be precisely controlled by chemical synthesis; (b) the genetic information substance bound to the linker of (a); and (c) a peptide encoded by the genetic information substance bound to at least two or more linkers of the linker of (a) having a structure capable of covalently binding to the C-terminus of a peptide, the genetic information substance-linker-peptide conjugate.

[15] The method according to

[14] , comprising the step of subjecting a desired genetic information material-linker-conjugate to a cell-free translation system to translate the genetic information material and obtain a genetic information material-linker-peptide conjugate.

[16] A method for forming a complex of a target substance conjugate containing at least two desired target substances and a genetic information substance-linker-peptide conjugate in which two or more peptides encoded by a desired genetic information substance are linked, comprising: 1) a step of providing a genetic information substance integrally linked to a linker containing at least two or more puromycin-like substances bound to each of a plurality of branched sites to a cell-free translation system and translating the genetic information substance; 2) a step of obtaining a genetic information substance-linker-peptide conjugate by linking the genetic information substance integrally linked to the linker containing at least two or more puromycin-like substances bound to each of the plurality of branched sites, and the peptides encoded by the translated genetic information substance; and 3) a step of contacting the genetic information substance-linker-peptide conjugate with a target substance conjugate containing at least two or more of the target substances.

[17] A method for linking two or more desired target substances having polyhistidine tags, comprising the step of linking each of the two or more target substances via a target substance linking linker having at least two or more substances capable of binding to the polyhistidine tags of the target substances.

[18] The method according to

[17] , wherein the target substance is a protein.

[19] The method according to

[17] , wherein the substance capable of binding to the polyhistidine tag is a metal chelate complex.

[20] A target substance linking linker comprising structural units having at least two or more metal chelate complexes, and including at least two or more of the structural units.

[21] The target substance linking linker according to

[20] , wherein even when two or more of the structural units are included, a polyhistidine tag and one structural unit can each be bound in a one-to-one ratio.

[22] The target substance linking linker according to

[20] , wherein two or more structural units having at least two or more metal chelate complexes are linked via a protein.

[23] A method for linking two or more desired target substances having polyhistidine tags, comprising the step of linking each of the target substances via a target substance linking linker described in

[20] .

[24] A method for forming a conjugate of a desired target substance and a peptide, comprising the step of contacting a genetic information substance-linker-peptide conjugate with a target substance conjugate in which two or more of the target substances are linked via a target substance linking linker described in

[20] .

[25] The method according to

[24] , further comprising the steps of subjecting a desired genetic information substance-linker-conjugate to a cell-free translation system to translate the genetic information substance to obtain a genetic information substance-linker-peptide conjugate, and purifying the genetic information substance-linker-peptide conjugate from the cell-free translation system.

[26] A method for screening peptides that bind to a desired target substance, comprising the steps of: contacting a genetic information material-linker-peptide conjugate with a target substance conjugate in which two or more target substances are linked via a target substance linking linker described in

[20] ; and eluting the complex of the genetic information material-linker-peptide conjugate and the target substance from the complex of the genetic information material-linker-peptide conjugate and the target substance conjugate by adding an additive.

[27] The method according to

[26] , wherein the additive is imidazole.

[28] The method according to

[26] , further comprising the steps of: subjecting a desired genetic information material-linker-conjugate to a cell-free translation system to translate the genetic information material and obtain a genetic information material-linker-peptide conjugate; and purifying the genetic information material-linker-peptide conjugate from the cell-free translation system.

[0016] A. The aforementioned "conjugate in which multiple translation products are bound to a single genetic information material via a puromycin-like substance" can recognize a target substance by the multiple translation products if the translation products have target-binding ability. This makes it possible to confer a stronger binding ability to the target to the translation products. Therefore, by using such a conjugate of the present invention, for example, in cell-free translation systems, display methods (such as display methods via puromycin-like substances) and affinity selection (in vitro selection methods), it becomes possible to recover genetic information material-peptide conjugates that bind to target substances with higher efficiency.

[0017] B. Furthermore, by using a target substance conjugate containing at least two target substances with respect to the "conjugate in which multiple translation products are bound to one genetic information material via a puromycin-like substance," the translation product can be recognized by multiple target substances. By having multiple target substances recognized by multiple translation products having target-binding ability, the binding ability between the translation product and the target substance can be further increased. Therefore, by using such a conjugate of the present invention, for example, in a cell-free translation system display method (such as a display method via a puromycin-like substance) and affinity selection (in vitro selection method), it becomes possible to recover genetic information material-peptide conjugates bound to target substances with higher efficiency.

[0018] Figure 1 shows the structures of linkers 1 to 15 used in the examples. In the structures, "cccgccctcccgccccccgtcc" (SEQ ID NO: 1) and "ctccccgccccccgtcc" (SEQ ID NO: 60) refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. In this DNA, the carbon atom at the 3' position of the ribose at the 3' end is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Figure 1 shows the structures of linkers 1 to 15 used in the examples. In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Figure 1 shows the structures of linkers 1 to 15 used in the example. In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Figure 1 shows the structures of linkers 1 to 15 used in the example.In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Figure 1 shows the structures of linkers 1 to 15 used in the example. In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Figure 1 shows the structures of linkers 1 to 15 used in the example. In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Figure 1 shows the structures of linkers 1 to 15 used in the example.In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Figure 1 shows the structures of linkers 1 to 15 used in the example. In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Figure 1 shows the structures of linkers 1 to 15 used in the example. In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Figure 1 shows the structures of linkers 1 to 15 used in the example.In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, while "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repeats, respectively. Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. In the structure, "cccgccctccccgccccccgtcc" (SEQ ID NO: 1) and "ctccccgccccccgtcc" (SEQ ID NO: 60), c, g, and t refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structure in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Alkynpuromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of each linker 2-15. In the structure, "cccgccctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structure in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Alkynpuromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of each linker 2-15.In the structure, "cccgccctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structure in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Alkynpuromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of each linker 2-15. In the structure, "cccgccctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structure in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Alkynpuromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of each linker 2-15. In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, while "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Alkynpuromycin was used in the synthesis of linkers 4-6, 8, and 11-15.Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. In the structures, "cccgccctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repeats, respectively. Alkynpuromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. In the structure, "cccgccctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structure in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Alkynpuromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of each linker 2-15. In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, while "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by the linkage of these nucleotides. The 3' carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structure in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively.Alkyn puromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of each linker 2-15. In the structures, "cccgcctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgcctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA linked by these nucleotides. The 3' carbon atom of the ribose 3' position at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Alkyn puromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. In the structures, "cccgccctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose 3' position at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repeats, respectively. Alkynpuromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. In the structure, "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgccctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' position of the ribose carbon atom at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond.The structures in quotation marks and the subscript numbers indicate the repeating structure and its number of repetitions, respectively. Alkynpuromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of each linker from 2 to 15. In the structures, "cccgcctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgcctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by linking these nucleotides. The 3' carbon atom of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and its number of repetitions, respectively. Alkyn puromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of each linker 2-15. In the structures, "cccgcctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgcctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA linked by these nucleotides. The 3' carbon atom of the ribose 3' position at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Alkyn puromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of each linker from linker 2 to 15. In the structures, "cccgcctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, while "cccgcctccccgccccccgtcc" and "ctccccgccccccgtcc" refer to DNA formed by the linkage of these nucleotides.The DNA has a 3' carbon atom at the 3' position of the ribose at its 3' end linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structure and the number of repetitions, respectively. Alkyn puromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 2 shows the structures of the precursors used in the synthesis of each linker from 2 to 15. In the structures, "cccgcctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgcctcccgccccccgtcc" and "ctccccgccccccgtcc" refer to the DNA formed by linking these nucleotides. The DNA has a 3' carbon atom at the 3' position of the ribose at its 3' end linked to a PEG or alkyl structure via a phosphodiester bond. The structures in quotation marks and the subscript numbers indicate the repeating structures and their number of repetitions, respectively. Alkyn puromycin was used in the synthesis of linkers 4-6, 8, and 11-15. Figure 3 shows the results of evaluating mRNA-linker conjugate formation by gel electrophoresis and fluorescence imaging. Figure 3a shows the results of an analysis showing that the divalent linker (linker 4) can be ligated to several mRNAs with different total base numbers, in which a portion of the translational region was randomized to one of the deoxynucleotides with adenine, guanine, cytosine, or uracil as a base. Figure 3 shows the results of evaluating mRNA-linker conjugate formation by gel electrophoresis and fluorescence imaging. Figure 3b shows the results of an analysis showing that the divalent linker (linker 4) can be ligated to several mRNAs with different total base numbers, in which a portion of the translational region was randomized to one of the deoxynucleotides with adenine, guanine, cytosine, or uracil as a base. Figure 3 shows the results of evaluating mRNA-linker conjugate formation by gel electrophoresis and fluorescence imaging. Figure 3c shows the results of an analysis that showed linkers can be linked to mRNA in which a portion of the translational region is randomized to one of the deoxynucleotides with adenine, guanine, cytosine, or uracil as bases, regardless of the branched chain structure or the number of puromycins in the linker.Figure 3 shows the results of evaluating mRNA-linker conjugate formation by gel electrophoresis and fluorescence imaging. Figure 3d shows the results of an analysis showing that a divalent linker (linker 8), which has a phosphate group at its 5' end and can form a covalent bond with the 3' end of mRNA via a ligation reaction, can be linked to several mRNAs with different base numbers, in which part of the translational region is randomized to one of the deoxynucleotides with adenine, guanine, cytosine, or uracil as a base. Figure 4 shows the results of an analysis showing that it is possible to create mRNA-linker conjugates with two puromycins at their ends by introducing alkyne puromycin via the CuAAC reaction (AAC: Azide-Alkyne-cycloaddition) to a conjugate formed by linking mRNA with a linker (linker 4 precursor 2) that has azide groups at the ends of two branched chain structures. Figure 5 shows the results of evaluating the peptide binding reaction to mRNA-linker conjugates by gel electrophoresis and fluorescence imaging. Figure 5a shows images obtained when fluorescence originating from Cy5 was detected. Figure 5a shows the results of an analysis showing that multiple peptides can be efficiently presented via puromycin in the linker by performing artificial recycling translation using a divalent linker (linker 3). Figure 5 shows the results of evaluating the peptide binding reaction to the mRNA-linker conjugate by gel electrophoresis and fluorescence imaging. Figure 5b shows images obtained when fluorescence originating from fluorothane was detected. Figure 5b shows the results of an analysis showing that multiple peptides can be efficiently presented via puromycin in the linker by performing artificial recycling translation using a divalent linker (linker 3). Figure 6a shows the results of an analysis by gel electrophoresis and fluorescence imaging showing that multiple peptides can be presented via puromycin in the linker by performing artificial recycling translation using a divalent linker (linker 3). Figure 6b shows that the amount of linker with multiple peptides presented increases when artificial recycling translation is performed. Figure 6c shows the results of an analysis showing that artificial recycling translation increases the amount of peptide presented by the monovalent linker (linker 2).Figure 6d shows the results of an analysis showing that the amount of peptide presented by the monovalent linker (linker 2) increases when artificial recycling translation is performed. Figure 7 shows the results of an analysis using gel electrophoresis and fluorescence imaging showing that reverse transcription is possible even with mRNA hybridized with a divalent linker (linker 3). Figure 8 shows the results of an analysis using gel electrophoresis and fluorescence imaging showing that multiple peptides can be presented even with divalent linkers having different linker lengths. Figure 9a shows the results of an analysis using gel electrophoresis and fluorescence imaging showing that linker 12, which has been modified with biotin at the 5' end and a guanine-based deoxynucleotide immediately before the branching point in the linker, can be specifically cleaved by RNase T1. Figure 9b shows the results of an evaluation of the peptide binding reaction to the mRNA-linker 12 conjugate using gel electrophoresis and fluorescence imaging. This demonstrates that by performing artificial recycling translation using a divalent linker (linker 12), it is possible to efficiently present multiple peptides via puromycin in the linker. Figure 10a shows the results of binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins. It was shown that using a divalent linker (linker 3) improved the recovery rate of DNA originating from binding to the target protein. It was also shown that performing artificial recycling translation improved the recovery rate of DNA originating from binding to the target protein. In the graphs in the figure, the recovery rate (%) is the mean, and the error bars are the standard deviation (n=3). Figure 10b shows the results of binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins. It was shown that using a divalent linker (linker 3-6) can enhance the recovery rate of DNA originating from binding to the target protein, and that the enhancement rate changes depending on the branching chain length. In the graphs in the figure, the recovery rate (%) is the mean, and the error bars are the standard deviation (n=3). Figure 11 shows the results of binding ability evaluation using a Human IgG Fc protein-binding peptide.It was shown that using a divalent linker (linker 3) during artificial recycling translation improved the recovery rate of DNA originating from binding to the target protein. In the graphs in the figures, the recovery rate (%) is the mean value, and the error bars are the standard deviation (n=3). Figure 12 shows the results of the recovery rate evaluation using a hemagglutinin (HA)-binding peptide. It was shown that using a divalent linker (linker 3) improved the recovery rate of DNA originating from binding to the target protein. It was also shown that performing artificial recycling translation improved the recovery rate of DNA originating from binding to the target protein. In the graphs in the figures, the recovery rate (%) is the mean value, and the error bars are the standard deviation (n=3). Figure 13 shows the results of the recovery rate evaluation using a neonatal Fc receptor (FcRn)-binding peptide. It was shown that using divalent linkers (linkers 3-6) can enhance the recovery rate of DNA originating from binding to the target protein, and that this enhancement rate increases as the branching chain length decreases. In the graphs in the figures, the recovery rate (%) represents the mean, and the error bars represent the standard deviation (n=3). Figure 14 shows the results of evaluating the recovery rate for each round in the selection of Fc-binding peptides using a random peptide library. When using a divalent linker (linker 4), it was shown that with each successive selection round, the recovery rate of DNA derived from binding to the target protein was significantly higher than the recovery rate of DNA derived from non-specific binding (obtained in negative selection). Figure 15 shows the results of evaluating the recovery rate using sequences obtained by gene sequence analysis of Fc-binding peptide selection. It was shown that peptide sequences obtained from selection using a divalent linker (linker 4) showed a higher recovery rate of DNA derived from binding to the target protein compared to the recovery rate of DNA derived from non-specific binding. Figure 16 shows the results of evaluating binding ability using Strep-tag II and streptavidin as model peptides and model target proteins.Even when the linker and mRNA are covalently bonded, using a divalent linker (linker 8) improved the recovery rate of DNA originating from binding to the target protein compared to using a monovalent linker (linker 7). In the graphs in the figure, the recovery rate (%) is the mean, and the error bars are the standard deviation (n=3). Figure 17a shows the results of analyzing amino acid acylation at the 3' end of the monovalent linker (linker 9) and the divalent linker (linker 10) by gel electrophoresis and fluorescence imaging. Figure 17b shows the structure of the puromycin-like substance created by amino acid acylation at the 3' end of the linker. Figure 17c shows the structure of the divalent linker created by amino acid acylation at the 3' end of the linker. In the structure, "cccgcctcccgccccccgtcc" represents nucleotides with cytosine, guanine, and thymine as bases, respectively, and "cccgcctcccgccccccgtcc" represents DNA formed by the linkage of these nucleotides. The 3' carbon atom of the ribose at the 3' end of the DNA is linked to the PEG structure via a phosphodiester bond. The structure in quotation marks and the subscript numbers indicate the repeating structure and the number of repeats, respectively. Figure 18 shows the results of binding affinity evaluation using Streptag II and streptavidin as model peptides and model target proteins. Even when an amino acid is covalently bonded to the ribose at the 3' end of the divalent linker (linker 10) via an ester bond, resulting in properties similar to puromycin, using the divalent linker (linker 10) improved the DNA recovery rate derived from binding to the target protein compared to using the monovalent linker (linker 9). In the graph, the recovery rate (%) is the mean, and the error bars represent the standard deviation (n=3). Figure 19 shows the results of binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins. It was shown that using the trivalent linker (linker 11) improved the DNA recovery rate derived from binding to the target protein compared to using the monovalent linker.Furthermore, it was shown that performing artificial recycling translation improved the recovery rate of DNA originating from binding to the target protein in a manner dependent on the number of artificial recycling translations. In the graphs in the figure, the recovery rate (%) is the mean value, and the error bars are the standard deviation (n=3). Figure 20 shows the results of binding affinity evaluation using Strep-tag II and streptavidin as model peptides and model target proteins. It was shown that using a trivalent linker (linker 15) improved the recovery rate of DNA originating from binding to the target protein compared to using a monovalent linker. In the graphs in the figure, the recovery rate (%) is the mean value (n=2). Figure 21a shows the results of binding affinity evaluation using Strep-tag II and streptavidin as model peptides and model target proteins. By using multivalent linkers (linkers 4, 15, 13, and 14), it was possible to increase the DNA recovery rate derived from binding to the target protein compared to using a monovalent linker (linker 1), and it was shown that the rate of increase changed depending on the valency of puromycin in the multivalent linker. In Figure 21a, the increase rate (vertical axis) of the graphs represents the mean value, and the error bars represent the standard deviation (n=3). Figure 21b shows the results of evaluating binding ability using multivalent linkers (linkers 4, 15, 13, and 14) with strep-tag II presented as a model peptide. It was shown that when the target protein, streptavidin, forms a tetramer, the DNA recovery rate derived from binding to the target protein was significantly improved compared to when streptavidin is a monomer. In Figure 21b, the increase rate (vertical axis) of the graphs represents the mean value, and the error bars represent the standard deviation (n=3). Figure 22a shows the results of binding affinity evaluation using Strep-tag II and streptavidin as model peptides and model target proteins. It was shown that using divalent linkers (linkers 4, 5, 6, and 3) increased the DNA recovery rate derived from binding to the target protein compared to using a monovalent linker (linker 1), and that this increase rate varied depending on the branching chain length of the divalent linker. In the graph in Figure 22a, the increase rate (vertical axis) represents the mean, and the error bars represent the standard deviation (n=3).Figure 22b shows the results of evaluating the binding ability of strept-tag II as a model peptide using divalent linkers (linkers 4, 5, 6, and 3). It was shown that when the target protein, streptavidin, forms a tetramer, the recovery rate of DNA originating from binding to the target protein is significantly improved compared to when streptavidin is a monomer. In the graph in Figure 22b, the increase rate (vertical axis) is the mean, and the error bars are the standard deviation (n=3). Figure 23 shows the structures of NTA linkers 1 to 3 used in the example. Figure 24 shows the results of evaluating the recovery rate using neonatal Fc receptor (FcRn) binding peptides. It was shown that when FcRn is polymerized by the streptavidin-Ni-NTA linker 3 complex, which is presented by a trivalent linker (linker 15) and immobilized on magnetic beads, the recovery rate of DNA originating from binding to the target protein is significantly improved. In the graphs in the figures, the recovery rate (%) represents the mean, and the error bars represent the standard deviation (n=3). Figure 25 shows the results of evaluating the recovery rate using neonatal Fc receptor (FcRn) binding peptides. When FcRn was increased by streptavidin-Ni-NTA linker 1-3 complexes immobilized on magnetic beads, similar values ​​were obtained for the recovery rate of DNA derived from binding to the target protein regardless of which NTA linker was used. Figure 26 shows the results of selection of hTRAIL-R2 binding peptides using a random peptide library. In the evaluation of the recovery rate in each round, when selection was performed targeting dimeric target proteins (Fc-tagged proteins) using multivalent linkers (linker 4, linker 15), it was shown that with each subsequent selection round, the recovery rate of DNA derived from binding to the target protein was significantly higher than the recovery rate of DNA derived from non-specific binding (obtained in negative selection). Figure 27 shows the results of the selection of hTRAIL-R2-binding peptides targeting hTRAIL-R2, which is macromatured by the streptavidin-Ni-NTA linker 1 complex immobilized on magnetic beads.In evaluating the recovery rate in each round, it was shown that when using a divalent linker (linker 4), the recovery rate of DNA derived from binding to the target protein was significantly higher with each subsequent selection round compared to the recovery rate of DNA derived from non-specific binding (obtained in negative selection).

[0019] The present invention includes, but is not limited to, the following embodiments. Unless otherwise specified herein, the technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art. The substances, materials and examples disclosed herein are illustrative and not intended to limit them. Where the phrase "in one embodiment" is used herein, it means that the invention is not limited to that embodiment, i.e., it is not limited to that embodiment.

[0020] 1. Linker In one embodiment, the present invention relates to a linker. The linker of the present invention comprises a binding portion having a structure capable of binding to a desired genetic information material; and at least two (or more) puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide. The covalent bond is preferably an amide bond.

[0021] "Genetic information material" is a substance that is translated into peptides (containing information) in ribosomes.

[0022] In one embodiment, the "genetic information material" is a nucleic acid. The nucleic acid as the genetic information material may be of the native or non-native type. Native nucleic acids include naturally occurring modified nucleic acids, while non-native nucleic acids include nucleic acids that have been modified with non-native substances or whose structure has been partially substituted. The types of nucleic acids include RNA, RNA-DNA hybrids, etc. Although not limited to these, RNA can be preferably used as such nucleic acid, and mRNA is more preferable. The base sequence of the genetic information material may be known or unknown. The sequence may be based on a sequence that exists in nature, or it may be an artificially designed sequence. For example, it may have a sequence that has been randomly synthesized by organic synthesis, or it may be a sequence that has been made to encode a protein with an unknown sequence by inserting random mutations using the PCR method.

[0023] As described above, the "genetic information material" codes for a peptide, and the amino acid sequence of this peptide may be known or unknown. Furthermore, there are no particular limitations on the length of this peptide. In one embodiment, the length of the peptide coded by the "genetic information material" may consist of one or more amino acids, preferably two or more, and there are no particular upper limits, but it may be 1000 or less, 500 or less, 100 or less, 50 or less, 30 or less, or 20 or less.

[0024] Therefore, the length of the "genetic information material" may, in one embodiment, be 3 bases or more, preferably 6 bases or more, and there is no particular upper limit, but it may be 3000 bases or less, 1500 bases or less, 300 bases or less, 150 bases or less, 90 bases or less, or 60 bases or less.

[0025] Furthermore, the type of peptide encoded by the "genetic information material" is not particularly limited. The peptide may include molecules to which tRNA can be ligated and which can be condensed by ribosomes. Ribosomes are known to be able to translate various molecules with structures different from common amino acids ("Translation initiation with exotic amino acids using EF-P-responsive artificial initiator tRNA", KATO T, et al. Nucleic Acids Res. 51, 8169-8180, 2023 (Non-Patent Literature 15) and "Translation Initiation with Initiator tRNA Charged with Exotic Peptides", Goto Y, et al. J. Am. Chem. Soc. 131, 14, 5040-5041, 2009 (Non-Patent Literature 16), “Cell-Free Approach for Non-canonical Amino Acids Incorporation Into Polypeptides”, Zhenling Cui, et al. Front Bioeng Biotechnol. 8, 1031, 2020 (Non-Patent Literature 17)). Therefore, even if the structure is different from that of amino acids, it is applicable to the present invention as long as it is translatable by ribosomes. That is, in this specification, the peptide translated by ribosomes is a molecule that can be ligated to tRNA and is translatable by ribosomes.

[0026] The peptide may be a molecule containing a natural amino acid residue, a non-natural amino acid residue, or a structure that can be ligated to tRNA and translated by ribosomes. Here, non-natural amino acids are any compounds to which tRNA can be ligated and which can be condensed by ribosomes. Non-limited examples include β-amino acids, γ-amino acids, L-amino acids, D-amino acids (also called D-type amino acids), N-alkyl amino acids such as N-methyl amino acids and N-ethyl amino acids, peptoids, α-substituted amino acids, α-α-2 substituted amino acids, cyclic α-amino acids, amino acid mutants, amino acid derivatives, and other chemically modified amino acids. The peptide may also contain a hydroxy acid to which RNA can be ligated and which can be condensed by ribosomes. Furthermore, the peptide translated from the "genetic information material" by ribosomes is not limited in shape and may take any shape after translation, such as a single-stranded peptide, a cyclic peptide (including peptides in which part is cyclic), or a shape having a specific secondary structure. In one embodiment, the translated peptide is cyclic.

[0027] In one embodiment, the peptide is a peptide that binds to a target substance. In one embodiment, the peptide is a protein fragment or its full length. In one embodiment, the peptide is an antagonist or agonist of a target substance. In one embodiment, the peptide is an antigen or an antibody against said antigen. Non-limitingly, the peptide may be a peptide being elongated in a ribosome as a substrate for a peptide transfer reaction. In this specification, "peptides encoded by genetic material" includes not only peptides that have been fully translated from genetic material, but also peptides that are being translated and elongated.

[0028] A "structure capable of binding to a desired genetic information substance" refers to a structure that can bind to a desired genetic information substance, either directly or indirectly.

[0029] One embodiment of the "structure capable of indirectly binding to a desired genetic information material" refers to a structure capable of binding to a desired genetic information material via a suitable linker. The suitable linker is a linker capable of connecting the desired genetic information material and the linker of the present invention. The suitable linker also includes a substance capable of directly binding to the desired genetic information material and a substance capable of directly binding to the linker of the present invention. As the substance capable of directly binding to the desired genetic information material, nucleic acids capable of binding to the desired genetic information material can be used.

[0030] Furthermore, one embodiment of a substance that can be indirectly bonded to the linker of the present invention is one of a pair of functional groups that can bond to each other. By selecting a pair of functional groups that can bond to each other, and using one functional group in the appropriate linker and the other functional group in the linker of the present invention, the appropriate linker and the linker of the present invention can be bonded. In this case, the "pair of functional groups that can bond to each other" can be appropriately selected based on the common technical knowledge of those skilled in the art. Non-limiting examples of reactions for bonding using such a pair of functional groups include click chemistry, represented by azide-alkyne pairs, reactions via bioconjugation reactions, and nucleophilic substitution or addition reactions using nucleophilic functional group-electrophilic functional group pairs. Specific examples of these include azide-acyclic strained alkyne pairs, azide-acyclic strained alkyne pairs, thiol-maleimide pairs, and thiol-haloacetyl pairs. Furthermore, the structure of the appropriate linker is not particularly limited as long as it can achieve the above objectives. In view of the above-mentioned objectives, an appropriate structure can be selected based on the common technical knowledge of those skilled in the art.

[0031] As described above, one embodiment of the linker of the present invention, "a binding portion having a structure capable of indirectly binding to a desired genetic information material," is a binding portion having a structure that, when binding to a desired genetic information material via a suitable linker, has a functional group that can bind to "one of a pair of mutually binding functional groups" of the suitable linker.

[0032] Another embodiment of the "binding portion having a structure capable of binding to a desired genetic information substance" is a binding portion containing a nucleic acid capable of binding to the desired genetic information substance. When the "binding portion having a structure capable of binding to a desired genetic information substance" contains a nucleic acid capable of binding to the desired genetic information substance, the linker of the present invention can directly bind the nucleic acid portion in the linker to the desired genetic information substance.

[0033] The nucleic acids of the "nucleic acids that can bind to genetic information material" may be native or non-native, and a mixture of native and non-native nucleic acids may be used. While not limited to these, DNA can be used as such nucleic acids. Furthermore, in this specification, the "non-native nucleic acids" that can constitute the nucleic acids of the "nucleic acids that can bind to genetic information material" also include peptide nucleic acids. Peptide nucleic acids are molecules having a structure similar to DNA or RNA, with a peptide structure in the main chain, and are sometimes referred to as PNA. In peptide nucleic acids, the main chain consists of N-(2-aminoethyl)glycine linked by an amide bond instead of a sugar (deoxyribose or ribose). Purine rings or pyrimidine rings, corresponding to nucleic acid bases, are attached to the main chain via methylene and carbonyl groups. Peptide nucleic acids, insofar as they can bind to the desired genetic information material, can also be components of the linker, similar to native nucleic acids.

[0034] Based on the purpose of the linker, the nucleic acid can be selected to have an appropriate structure that is "capable of binding to a desired genetic information substance" based on common technical knowledge. Preferably, it is a structure that can be covalently or non-covalently bonded. The base sequence of the nucleic acid is not particularly limited. The length of the base sequence of the nucleic acid is also not particularly limited, and is only required to be long enough to bind to the desired genetic information substance, and may be appropriately determined according to the length of the desired genetic information substance. In one embodiment, the length of the base sequence of the nucleic acid is a length that can specifically hybridize with the desired genetic information substance. In one embodiment, the length of the base sequence of the nucleic acid is 2 or more bases, 3 or more bases, 5 or more bases, 10 or more bases, 11 or more bases, 12 or more bases, 13 or more bases, 14 or more bases, 15 or more bases, 16 or more bases, 17 or more bases, 18 or more bases, 19 or more bases, 20 or more bases, or 22 or more bases. From the viewpoint of maintaining the binding between the nucleic acid and the desired genetic information material, if the length of the base sequence of the nucleic acid to be hybridized is 9 bases or less, it is preferable to covalently bond the nucleic acid with the desired genetic information material by a method described later, in addition to hybridization. In one embodiment, the length of the base sequence of the nucleic acid is 200 bases or less, 150 bases or less, 100 bases or less, 80 bases or less, 70 bases or less, 60 bases or less, 55 bases or less, 50 bases or less, 45 bases or less, 40 bases or less, 35 bases or less, 30 bases or less, or 25 bases or less. In one embodiment, the length of the base sequence of the nucleic acid is within any combination of the lengths greater than or equal to the lengths described above and the lengths less than or equal to the lengths described above. All or part of the base sequence of the nucleic acid is capable of binding with the genetic information material.

[0035] The nucleic acid and the genetic information material can be linked by non-covalent and / or covalent bonds. Specific forms of linking the nucleic acid and the genetic information material are not limited to, but preferably involve non-covalent linking using single-stranded DNA capable of specifically hybridizing with a target RNA (preferably target mRNA). Other forms include UV irradiation of single-stranded DNA containing a photocrosslinkable non-natural nucleic acid that has hybridized with the target RNA at a specific site to photocrosslink the target RNA and the single-stranded DNA, and enzymatic covalent linking of the ends of the target RNA and the single-stranded DNA using RNA ligase or DNA ligase.

[0036] In one embodiment, the "nucleic acid capable of binding to genetic material" is a single-stranded DNA capable of specifically hybridizing with a target RNA. Such DNA may include, but is not limited to, non-natural nucleic acids.

[0037] The linker contains at least two or more puromycin-like substances. In this specification, a linker containing two puromycin-like substances may be referred to as a "divalent linker," and a linker containing n puromycin-like substances may be referred to as an "n-valent linker."

[0038] In this specification, "puromycin-like substance" means a substance that has a site that can link to a linker and can covalently bond to the C-terminus of a peptide on a ribosome. Such a substance is not limited to puromycin or its derivatives described later, but may be, for example, a molecule in which puromycin and suppressor tRNA described in Patent Document 1 bind and are recognized as a single unit by the ribosome. In one embodiment, the "puromycin-like substance" is a substance that has the function of reacting with peptidyl tRNA bound to the P-site of a ribosome to form a complex with an elongated peptide, and there are no particular limitations as long as such a substance exists. Here, "peptidyl tRNA" may be peptidyl tRNA produced in the translation process of the peptide encoded by the genetic information material. In one embodiment, the puromycin-like substance can covalently, preferably by amide, bond with such peptidyl tRNA on a ribosome.

[0039] Furthermore, one embodiment of a "puromycin-like substance" is a substance having a structure in which a nucleoside or nucleic acid or a substance having a similar chemical structural framework, or a continuum thereof, is chemically bonded to an amino acid or a substance having a similar chemical structural framework, and has the function of reacting with peptidyl-tRNA bound to the P site of a ribosome to form a complex with an elongated peptide.

[0040] In one embodiment, the puromycin-like substance is puromycin.

[0041] Furthermore, in one embodiment, a puromycin-like substance is a puromycin derivative. A puromycin derivative is not limited to those that have the complete puromycin structure, but also includes those in which part of the puromycin structure is missing or partially substituted with another structure. Non-limited examples of puromycin derivatives include 3'-N-aminoacylpuromycin aminonucleoside (PANS-amino acid) and 3'-N-aminoacyladenosine aminonucleoside (AANS-amino acid), in which the amino group of 3'-aminoadenosine and the carboxyl group of an amino acid are linked by an amide bond formed by dehydration condensation. Examples of PANS-amino acids include PANS-Gly, where the amino acid part is glycine; PANS-Val, where the amino acid part is valine; PANS-Ala, where the amino acid part is alanine; or a mixture of PANS-amino acids in which the amino acid part corresponds to each of the individual amino acids. Furthermore, examples of AANS-amino acids include AANS-Gly, where the amino acid portion is glycine; AANS-Val, where the amino acid portion is valine; AANS-Ala, where the amino acid portion is alanine; or an AANS-amino acid mixture where the amino acid portion corresponds to each amino acid of the total amino acid group. In addition, nucleosides or ester-bonded nucleosides and amino acids can also be used (WO2011 / 049157 (Patent Document 2)). Furthermore, non-limiting examples of puromycin derivatives include alkyne analogs of puromycin ("Imaging protein synthesis in cells and tissues with an alkyne analog of puromycin," Liu et al., Proc. Natl. Acad. Sci. USA. 2012, 109(2), 413-418 (Non-Patent Literature 5)) and Puroswitch, which allows translation to be controlled by light ("Optical Control of Translation with a Puromycin Photoswitch," Ko et al.) One could also cite al., J. Am. Chem. Soc. 2022, 144, 47, 21494-21501 (Non-Patent Literature 6).

[0042] In one embodiment, the puromycin-like substance may also be a substance consisting of puromycin or a derivative thereof and one or two deoxyribonucleotides or ribonucleotides. Non-limiting examples of such substances include ribocytidyl puromycin (rCpPur), deoxydyl puromycin (dCpPur), and deoxyuridyl puromycin (dUpPur).

[0043] Furthermore, in one embodiment, the puromycin-like substance may be one in which the adenine-like structure bound to position 1 of the sugar skeleton in puromycin is replaced with a substance having a different chemical structural skeleton. Non-limiting examples include those in which the adenine-like structure bound to position 1 of the sugar skeleton in puromycin is replaced with adenine, a thieno[3,4-d]pyrimidine skeleton and an azetidine structure, or a thieno[3,4-d]pyrimidine skeleton and a 3,3-difluoroazetidine structure ("Inherently Emissive Puromycin Analogues for Live Cell Labelling," Haddi et al., Angew Chem Int Ed Engl., 2023, 62, 23, e202216784, Non-Patent Literature 20).

[0044] In one embodiment, the puromycin-like substance may have an amino acid-like structure attached to the 3-position of the sugar backbone in puromycin, which is replaced with a natural amino acid residue, a non-natural amino acid residue, or a residue having a hydroxyl group such as a hydroxyl acid or a hydroxyl acid derivative, and which forms an amide bond or ester bond with the C-terminus of a peptide on the ribosome. As a non-limiting example, puromycin may have an amino acid-like structure attached to the 3-position of the sugar backbone substituted with β-alanine or (2r)-3-hydroxy-2-methylpropanoic acid ("Synthesis of puromycin derivatives with backbone-elogenated substances and associated translation inhibition activities," Mizusawa et al., Bioorg. Med. Chem., 2009, 17, 6, 2381-2387, Non-Patent Literature 18).

[0045] Furthermore, in one embodiment, the puromycin-like substance may have various molecules, such as one nucleic acid, multiple nucleic acids, small molecule compounds, or PEG, attached to the 5th position of the sugar skeleton in puromycin. Non-limiting examples include those in which 1 to 30 nucleic acids, biotin, or fluorescein are attached to the 5th position of the sugar skeleton in puromycin ("Puromycin oligonucleotides reveal steric restrictions for ribosome entry and multiple modes of translation inhibition," Starck et al., RNA, 2002, 8, 7, 890-903, Non-Patent Literature 21).

[0046] Furthermore, puromycin is an analogue of the 3' end of tyrosyl-tRNA, and the nucleic acid structure substitutions described below can be applied. It is known that the sugar backbone or phosphate group of RNA or DNA can be replaced by various non-natural sugar backbones or amide bond backbones (Bao T. Le et al., Antisense Oligonucleotides Targeting Angogenic Factors as Potential Cancer Therapeutics, Mol Ther Nucleic Acids, 2019, 1, 14, 142-157, Non-Patent Literature 22, and Irina Anosova et al., The structural diversity of artificial genetic polymers, Nucleic Acids). Res., 2016, Feb 18, 44, 3, 1007-1021, Non-Patent Literature 23). Non-limiting examples of such non-natural skeletons include PNA, LNA, PS, 2'-F, 2'OMe, 2'-O-OMe, PMO, NP, UNA, 4'Thio, FANA, CeNA, HNA, tcDNA, ENA, ANA, hDNA, FRNA, GNA, TNA, XyNA, dXyNA, etc. Substances in which the sugar skeleton or phosphate portion of puromycin or puromycin analog is replaced using a replaceable non-natural sugar skeleton or phosphate skeleton are also a form of puromycin-like substance.

[0047] Furthermore, RNA or DNA molecules with non-natural bases are known to possess the function of hybridizing DNA or RNA (Michiko Kimoto et al., Genetic Code Engineering by Natural and Unnatural Base Pair Systems for the Site-Specific Incorporation of Non-Standard Amino Acids Into Proteins., Front Mol Biosci, 2022, May 24, 9, 851646. Non-Patent Literature 24). Non-specific examples of such unnatural skeletons include isoG, isoC, P, Z, s, y, Ds, Pa, Ds, Px, 5SICS, NaM, TPT3, NaM, CNMO, TAT1, NaM, and 5FM. Substances that utilize unnatural base skeletons to replace the base portion of puromycin or puromycin analogs are also a form of puromycin-like substance.

[0048] Furthermore, it is widely known that naturally occurring modified RNA molecules retain or partially possess the functions of native RNA (Naho Akiyama et al., Structural insights into the decoding capability of isoleucine tRNAs with lysidine and agmatidine., Nat Struct Mol Biol., 2024, Mar, 27 (Non-Patent Literature 25) and Valerie de Crecy-Lagard., Functions of bacterial tRNA modifications: from ubiquity to diversity., Trends). Microbiol., 2021, Jan, 29, 1, 41-53 (Non-Patent Literature 26). Substances in which a naturally occurring modified RNA skeleton is used to replace the sugar skeleton, phosphate skeleton, or base portion of puromycin or a puromycin analog are also one embodiment of a puromycin-like substance.

[0049] The number of puromycin-like substances contained in the linker is at least two, and there is no particular upper limit. The number of puromycin-like substances contained in the linker may be, without limitation, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3. Not necessarily, preferably, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, or 2 to 3. In one embodiment, the number of puromycin-like substances contained in the linker is 2, 3, 4, 5, or 6.

[0050] Nucleic acids capable of binding to the desired genetic material may be located either at the ends or in the middle of the linker. If the linker is interpreted as a copolymer formed by linking two or more monomer compounds, the detailed structure of each monomer constituting the copolymer can be omitted, and the structure of the linker can be simply represented by a line obtained by connecting the linkages of adjacent monomers with lines. In this specification, the ends of the line representing the linker are referred to as the ends of the linker, and the portion of the line with linkages at both ends is referred to as the middle of the linker.

[0051] At least two or more puromycin-like substances may be present at either the ends or the middle of the linker. In one embodiment, the linker is branched (branched linker), and each branch chain may be bound to a puromycin-like substance. In this specification, branching refers to a state in which, when the linker is described as a line, a branched line is obtained. The lengths of each branch chain of a branched linker may be the same or different. In one embodiment, the lengths of each branch chain of a branched linker are the same.

[0052] The structure of the linker is not particularly limited, as long as it is a structure that can be linked to the C-terminus of the peptide being elongated during the translation process. A person skilled in the art can select an appropriate structure based on common technical knowledge, taking into account the purpose of the linker.

[0053] While not limiting, the linker as a whole may be moderately flexible, based on a simple linear structure with few side chains, and may include at least one branching section, at which the branching section branches into at least three linear structures with few side chains (hereinafter, each chain-like structure connected at the branching section is referred to as a "branched chain"). In this specification, branching into three at the branching section means that at the branching section, three chain-like structures are connected at their respective ends. For example, linker 1 described in the example does not have a branching section, while linker 3 has one branching section and three branched chains. Furthermore, the branched chain may include further branching sections.

[0054] In fact, the length, flexibility, and rigidity of the linker structure can be precisely controlled through chemical synthesis. That is, linkers connecting binding sites that have structures capable of binding to at least two peptides can be manufactured through chemical synthesis, with appropriate control of the linker structure depending on the purpose and application.

[0055] Furthermore, although not limited, the linker as a whole may be hydrophilic. Also, although not limited, to constitute the linker, for example, oligonucleotides such as single-stranded or double-stranded DNA or RNA, polyalkylenes such as polyethylene, polyalkylene glycols such as polyethylene glycol (PEG), polystyrene, linear polysaccharides, linear peptides, or combinations thereof may be appropriately selected and used. When using a combination of these linear substances, they may be appropriately linked together with appropriate linking groups (-NH-, -CO-, -O-, -NHCO-, -CONH-, -NHNH-, -O-PO 2 H-O-,-(CH 2 ) n -[n is, for example, 1 to 10, preferably 1 to 3], -S-, -SO-, etc. can be chemically linked.

[0056] In a non-limiting embodiment, the linker includes the following structures (1) to (4).

[0057] (1) A linkage to the genetic information material via a phosphodiester bond, and a linkage to puromycin via a phosphodiester bond; (2) A branching portion to which three branched chains are linked; (3) A linear portion composed of PEG that is linked to the genetic information material, PEG alone, alkylene alone, or a combination of PEG and alkylene; and (4) A linkage portion in the linear portion via a phosphodiester bond and / or amide bond, and / or a linkage portion linked via a CuAAC reaction (AAC: Azide-Alkyne-cycloaddition), or a SPAAC reaction ((strain-promoted Azide-Alkyne-cycloaddition) azide-alkyne cycloaddition reaction).

[0058] Alternatively, in a non-limiting embodiment, the linker includes the following structures (1) to (4).

[0059] (1) A linkage to the genetic information material via a phosphodiester bond, and a linkage to puromycin via a phosphodiester bond; (2) A branching region to which four branched chains are linked; (3) A linear region composed of PEG that is linked to the genetic information material, PEG alone, alkylene alone, or a combination of PEG and alkylene; and (4) A linkage region in the linear region via a phosphodiester bond and / or amide bond, and / or a linkage region linked via a CuAAC reaction (AAC: Azide-Alkyne-cycloaddition) or a SPAAC reaction ((strain-promoted Azide-Alkyne-cycloaddition) azido-alkyne cycloaddition reaction).

[0060] The length of the linker is not particularly limited as long as it has a structure that can be linked to the C-terminus of the peptide being extended during the translation process. It is known that the overall length of the linker does not have a significant effect on the linker presentation efficiency ("cDNA TRAP display for rapid and stable in in vitro selection of antibody-like proteins" T. Kondo et al., Chem. Commun., 2021, 572416-572419 (Non-Patent Literature 4)). Those skilled in the art can appropriately select an appropriate length based on common technical knowledge, taking into account the purpose of the linker of this application.

[0061] The linker can be synthesized using known methods. Non-limitingly, for example, a puromycin-like substance can be introduced into a branched linear substance bound to a nucleic acid using a CuAAC reaction (AAC: Azide-Alkyne-cycloaddition) or a SPAAC reaction ((strain-promoted Azide-Alkyne-cycloaddition) azide-alkyne cycloaddition reaction).

[0062] The statement that the puromycin-like substance is covalently bondable to the C-terminus of a desired peptide means that the puromycin-like substance is present in the linker (at its end or in the middle) in a state that allows it to covalently bond to the C-terminus of the desired peptide. In such a state, the puromycin-like substance is considered to be able to covalently bond to the C-terminus of a peptide being extended as a substrate for a peptide transfer reaction in a ribosome. A preferred embodiment of the covalent bond is an amide bond. Those skilled in the art can appropriately design a linker to achieve such a state based on the prior art. One embodiment is a state in which the nucleoside (including a chemical structural skeleton similar to a nucleoside) of the puromycin-like substance can covalently bond to an amino acid (including a substance having a chemical structural skeleton similar to an amino acid) located at the C-terminus of the desired peptide. In one embodiment, at least one, preferably two or more, and more preferably all, of the puromycin-like substances are bonded to the end of the branched chain constituting the linker that is not bonded to the branch. In one embodiment, the puromycin-like substance is bound to the side chains of the branched chains located in the middle of the linker.

[0063] Therefore, the type and size (length) of peptides to which the puromycin-like substance can bind are not particularly limited. One desired embodiment of the peptide is a linear peptide, preferably a peptide whose C-terminus is linear. The peptide may contain not only natural amino acid residues but also non-natural amino acid residues. Non-limited examples of such peptides include the fluorescent model peptide (amino acid sequence: SEQ ID NO: 19), streptavidin-binding peptide (amino acid sequence: SEQ ID NO: 21), human neonatal Fc receptor (FcRn)-binding peptide (amino acid sequence: SEQ ID NO: 23), hemagglutinin (HA)-binding peptide (amino acid sequence: SEQ ID NO: 25), and human IgG Fc protein (Fc)-binding peptide (amino acid sequence: SEQ ID NO: 27), and the peptide may be at least one selected from these.

[0064] Furthermore, the peptide may also be a peptide being elongated in a ribosome as a substrate for a peptide transfer reaction. In this specification, "peptide" includes not only peptides whose translation from genetic material has been completely completed, but also peptides that are being elongated during translation.

[0065] In one embodiment, the linker is used to link the genetic information material with a peptide encoded by the genetic information material.

[0066] The linker may be modified as appropriate depending on its intended use. While not limited to such modifications, known modification methods can be used. For example, by modifying it with binding substances such as biotin, FLAG tags, HA tags, His tags, fluorescent molecules, fluorescent proteins, chemiluminescent proteins, peroxidases, alkaline phosphatases, or other color-developing proteins, the genetic information material-linker-peptide conjugate described in section 4 below can be suitably used in section 9, "Method for Evaluating Binding Ability." Furthermore, there are no particular limitations on the number of modifying substances for the linker; it may be one or more.

[0067] 2. Use of the linker In one embodiment, the present invention relates to the use of the linker for linking a genetic information material with a peptide encoded by the genetic information material.

[0068] In one embodiment, the present invention relates to a linker comprising a binding portion having a structure capable of binding to a desired genetic information material; and at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide, and the use of the linker for linking the genetic information material to a peptide encoded by the genetic information material.

[0069] The linker and its components are as described in "1. Linker". The "binding portion having a structure capable of binding to a desired genetic information material" in the linker binds to the genetic information material. The puromycin-like substance can covalently bond to the C-terminus of a desired peptide. Therefore, it is possible to link the genetic information material and the peptide encoded by the genetic information material via the linker. Since there are at least two puromycin-like substances in the linker, it is possible to link two or more of the peptides to the genetic information material.

[0070] The present invention relates to a linker used to link a genetic information material with a peptide encoded by the genetic information material.

[0071] The present invention relates to a kit or composition (e.g., an experimental composition) comprising the linker. The kit or composition is used, for example, to link a genetic material with a peptide encoded by the genetic material. Alternatively, the kit or composition is used in the following "8. Screening Method," "9. Method for Evaluating Binding Ability," "11. Method for Presenting Peptides," etc.

[0072] In addition to the linker, the kit of the present invention may also include reagents (e.g., additives), genetic information materials, etc., for use in screening methods, etc.

[0073] 3. Genetic Information Material-Linker Conjugate In one embodiment, the present invention relates to a genetic information material-linker conjugate. The genetic information material-linker conjugate of the present invention comprises (a) the linker; and (b) the genetic information material bonded to the junction of the linker in (a).

[0074] The "linker" and its components, "genetic information material," etc., are as described in "1. Linker" or "2. Use of Linker."

[0075] The linked body is an embodiment in which the genetic information material is linked to a "binding portion having a structure capable of binding to a desired genetic information material" in the linker.

[0076] As described in "1. Linker," one embodiment of the linker is a linker that includes a binding portion having a structure capable of indirectly binding to a desired genetic information material. In this embodiment, the linkage may further include the appropriate linker, and may be a linkage of genetic information material-appropriate linker-linker of the present invention. The appropriate linker is a linker capable of connecting the desired genetic information material and the linker of the present invention. The appropriate linker includes a material capable of directly binding to the desired genetic information material and a material capable of directly binding to the linker of the present invention.

[0077] Furthermore, the linked body only needs to include (a) and (b) as its constituent elements, and it is not necessarily required to use the linker in the manufacturing process of the linked body; a "linker precursor" may be used instead. A "linker precursor" is an intermediate for producing the linker, and an example of this is an intermediate before the puromycin-like substance is bonded to the linker. One embodiment of such a linker precursor has two or more reactive groups for bonding the puromycin-like substance, and each of these groups becomes the linker by bonding the puromycin-like substance. Such a linker precursor is also an embodiment of the present invention.

[0078] For example, as described in Example 3-2, a genetic information material-linker conjugate obtained by binding a desired genetic information material and a linker precursor, followed by binding a puromycin-like substance, also contains (a) and (b) as its constituent elements, and is therefore one embodiment of the "genetic information material-linker conjugate".

[0079] In one embodiment, the present invention includes a conjugate of a desired genetic information material and a puromycin-like substance, wherein the desired genetic information material and at least two puromycin-like substances are linked, and at least two of the puromycin-like substances are covalently bondable to the C-terminus of a desired peptide. The linker comprises at least two puromycin-like substances, and the puromycin-like substances are covalently bondable to the C-terminus of a desired peptide. In this specification, the "conjugate of a genetic information material and a puromycin-like substance" may include the "genetic information material-linker conjugate" unless there is a particular technical disadvantage.

[0080] The genetic information material-linker conjugate can link the genetic information material and the peptide encoded by the genetic information material via the linker constituting the conjugate. In one aspect of the present invention, the use of the conjugate for linking the genetic information material and the peptide encoded by the genetic information material.

[0081] The aforementioned linker can also be suitably used in "6. Library preparation," "8. Screening method," "9. Binding ability evaluation method," "11. Peptide presentation method," etc. In one embodiment, the present invention relates to the use of the linker and the genetic information material linker in library preparation, screening methods, or binding ability evaluation methods.

[0082] The present invention also relates, in one aspect, to a linker-to-genetic material conjugate used for linking the genetic material to a peptide encoded by the genetic material. The present invention also relates, in one aspect, to a linker-to-genetic material conjugate used for library preparation, screening methods, or methods for evaluating binding ability.

[0083] The present invention relates to a kit or composition (e.g., an experimental composition) comprising a linker and a genetic information material. The kit or composition is used, for example, to link a genetic information material with a peptide encoded by the genetic information material. Alternatively, the kit or composition is used in the following "6. Library Preparation," "8. Screening Method," "9. Binding Ability Evaluation Method," "11. Peptide Presentation Method," etc.

[0084] 4. Genetic Information Material-Linker-Peptide Conjugate In one embodiment, the present invention relates to a genetic information material-linker-peptide conjugate. The genetic information material-linker-peptide conjugate comprises (a) the linker; (b) the genetic information material bound to the binding site of the linker in (a); and (c) a peptide encoded by the genetic information material, bound to at least one of the puromycin-like substances of the linker in (a).

[0085] The "linker" and its components, such as "genetic information material" and "peptides," are as described in "1. Linker," "2. Use of Linker," or "3. Genetic Information Material-Linker Linker."

[0086] The peptide (c) is linked to at least one, preferably two or more, puromycin-like substances of the linker. Preferably, the peptide (c) is linked to all or some (two or more) of the puromycin-like substances of the linker. In one embodiment, the peptide (c) is linked to all of the puromycin-like substances of the linker. That is, the upper limit of the number of peptides (c) is the number of puromycin-like substances present in the linker. In one embodiment, the peptide (c) is linked to all of the puromycin-like substances of the linker. Not limited to two or more, preferably two to eight, two to seven, two to six, two to five, two to four, or two to three peptides are linked. In one embodiment, two peptides are linked.

[0087] The aforementioned "genetic information material-linker-peptide conjugate" can be suitably used, for example, in "6. Library preparation," "7. Method for forming a conjugate of a target substance and a peptide (1)," "8. Screening method," "9. Method for evaluating binding ability," and "11. Method for presenting peptides." In one embodiment, the present invention relates to the use of the aforementioned genetic information material-linker-peptide conjugate in library preparation, screening methods, or methods for evaluating binding ability. In one embodiment, the present invention relates to the aforementioned genetic information material-linker-peptide conjugate used in library preparation, screening methods, or methods for evaluating binding ability.

[0088] In one embodiment, the present invention also includes (d) a conjugate of a desired genetic information material and a puromycin-like substance; and (e) a genetic information material-puromycin-like substance-peptide conjugate comprising a peptide encoded by the desired genetic information material, bound to the puromycin-like substance of the conjugate in (d).

[0089] "The conjugate of the desired genetic information material and the puromycin-like substance," "peptides," etc., are 3. Genetic information material-linker conjugates, or as described above.

[0090] The present invention relates to a kit or composition (for example, an experimental composition) comprising the genetic information substance-linker-peptide conjugate. The present invention relates to a kit or composition (for example, an experimental composition) comprising the genetic information substance-puromycin-like substance-peptide conjugate. The kit or composition is used, for example, in the preparation of the library described in "6. Library", "8. Screening method", "9. Binding ability evaluation method", "11. Peptide presentation method", etc.

[0091] 5. Method for producing a genetic information substance-linker-peptide conjugate (1) In one embodiment, the present invention relates to a method for producing a genetic information substance-linker-peptide conjugate. The production method comprises: (1) a step of subjecting the genetic information substance-linker conjugate of the present invention to a cell-free translation system and translating the genetic information substance, wherein the puromycin-like substance in the linker and the translated peptide bind together to obtain a genetic information substance-linker-peptide conjugate.

[0092] More precisely, the process includes, in part, step (0) before step (1), a step of combining the linker with a desired genetic information material to obtain a genetic information material-linker conjugate.

[0093] The "linker" and its components, such as "genetic information material" and "peptides," are as described in "1. Linker," "2. Use of Linker," "3. Genetic Information Material-Linker Concatenation," or "4. Genetic Information Material-Linker-Peptide Concatenation."

[0094] In step (0), the method for binding the linker and the genetic material is not particularly limited and can be carried out by any known method depending on the binding mode. "Hybridization" can be carried out by subjecting the linker and the genetic material to conditions suitable for nucleic acid hybridization (temperature, salt concentration, etc.). Furthermore, methods such as UV irradiation of single-stranded DNA hybridized with target mRNA at a specific site to bind by photocrosslinking, and enzymatic covalent bonding of the ends of target mRNA and single-stranded DNA using RNA ligase or DNA ligase can also be carried out using known materials and known conditions.

[0095] In step (1), the genetic information material is translated in the ribosome based on the genetic information material-linker conjugate obtained in step (0). The puromycin-like substance in the linker binds to the translated peptide, and a genetic information material-linker-peptide conjugate is obtained.

[0096] The method for translating the genetic information material is not particularly limited and can be carried out using known translation methods. The peptide may be a peptide that has completed the translation step of binding to the puromycin-like substance, or a peptide that is being elongated in a ribosome as a substrate for a peptide transfer reaction.

[0097] Non-limitingly, the above manufacturing method (particularly the translation step in (1)) uses a cell-free translation system. Non-limitingly, the cell-free translation system is a combination of ribosomes extracted from cells, protein factors involved in translation, tRNA, amino acids, energy sources such as ATP, and its regeneration system, and is not particularly limited as long as it can translate mRNA into protein. Non-limitingly, the cell-free translation system may include initiation factors, elongation factors, dissociation factors, aminoacyl-tRNA synthetase, etc. These factors can be obtained by purification from extracts of various cells. Examples of cells used for purifying the factors include prokaryotic cells or eukaryotic cells. Examples of prokaryotic cells include Escherichia coli cells, hyperthermophilic bacteria cells, or Bacillus subtilis cells. Examples of eukaryotic cells include yeast cells, wheat germ, rabbit reticulocytes, plant cells, insect cells, or animal cells. In addition to naturally occurring tRNAs and aminoacyl-tRNA synthetases (ARS), artificial tRNAs and artificial aminoacyl-tRNA synthetases that recognize non-natural amino acids can also be used. Furthermore, chemically synthesized tRNAs and tRNAs linked by RNA ligases can also be used.

[0098] Furthermore, non-limitingly, cell-free translation systems are reconstituted cell-free translation systems. Examples of reconstituted cell-free translation systems include systems in which components unrelated to translation are removed by subdividing E. coli extracts and reconstituting each factor. Reconstituted cell-free translation systems require purified ribosomes, translation initiation factors, translation elongation factors, mRNA, aminoacyl-tRNA, and substrates such as ATP and GTP (M.H. Schreier, B. Erni and T. Staehelin (1977) "Initiation of mammalian protein synthesis. I. Purification and characterization of seven initiation factors." Journal of Molecular Biology, Vol. 116, No. 4, 727-753 (Non-patent Literature 27); H. Trachsel, B. Emi, M.H. Schreier and T. Staehelin (1977) "Initiation of mammalian protein synthesis. II. The assembly of the initiative complex with purified initiative factors." Journal of Molecular Biology, Vol. 116, No. 4, 755-767 (Non-patent document 28)). Of these, aminoacyl-tRNA can be substituted by adding tRNA, aminoacyl-tRNA synthetase and its substrate to the same reaction solution.Furthermore, as is done in general cell-free translation systems, it is possible to add proteins, enzymes, and their substrates, such as translation termination factors, ribosome regeneration factors, creatine kinase, myokinase, nucleotide diphosphate kinase, and pyrophosphatase, to improve the efficiency and fidelity of the translation reaction (P.C. Jelenc and C.G. Kurland (1979) “Nucleoside triphos phosphate regeneration declines the frequency of translation errors” Proceedings of the Natural Academy Science of the United States of America). Vol. 76, No. 7, 3174-3178 (Non-Patent Document 29)).

[0099] Reconstituted cell-free translation systems can more easily prevent contamination by inhibitors such as nucleases and proteases than conventional cell-free translation systems that use cell extracts.

[0100] Furthermore, when synthesizing peptides containing special amino acids, the FIT system (WO2012 / 026566 (Patent Document 7)) can be used without limitation.

[0101] As shown in Figure 5(b) of Example 5 and Figures 6(a) and (b) of Example 6, even with only one translation reaction, a genetic information material-linker-peptide conjugate was obtained, although the amount was smaller compared to when artificial recycling translation was performed, in which each puromycin-like substance in the linker was bound to the translated peptide. While not limited to theory, one possible reason is that after the translation reaction, the ribosomes spontaneously dissociate from the peptides, initiating the translation of the second or subsequent peptides, and the synthesized peptides then bind to each puromycin-like substance in the linker. Alternatively, it is conceivable that multiple ribosomes bind to the genetic information material being translated to form a polysome, and the peptides translated by each ribosome then bind to each puromycin-like substance in the linker.

[0102] It is desirable that the aforementioned genetic material-linker-peptide conjugate dissociates from the ribosome after its manufacture, i.e., after the peptide synthesis is completed (including cases where peptide synthesis is still in progress). Dissociation of the conjugate from the ribosome, i.e., dissociation of the peptide from the ribosome, can be carried out by known methods. In order for ribosomes to perform their function, it is necessary to maintain an appropriate three-dimensional structure, which requires Mg ions. Therefore, by adding a substance that can bind to Mg ions, such as EDTA, Mg ions are removed, the ribosome denatures, and its function is lost. Thus, non-limitingly, by denatured ribosomes, for example by adding EDTA, a conjugate in a state of dissociation from the ribosome can be efficiently obtained. Alternatively, a substance that can denature ribosomes may be added instead of EDTA.

[0103] In one embodiment, the manufacturing method includes repeating step (1) two or more times (step (2)). The manufacturing method including repeating step (1) two or more times may be referred to herein as the "artificial recycling translation (method)". The number of times step (1) is repeated is not particularly limited. In one embodiment, it may be repeated two to eight times, two to seven times, two to six times, two to five times, two to four times, or two to three times. In one embodiment, step (1) is repeated twice. Also, in one embodiment, step (1) is repeated three times.

[0104] When using an n-valent linker, artificial recycling translation may occur two or more times, but from the viewpoint of the efficiency of peptide binding to puromycin-like substances, a greater number of repetitions is preferable, and n or more repetitions are even preferable. In order to repeat the translation of the genetic information material two or more times, it is desirable to temporarily dissociate the ribosome from the peptide after translation is complete or in progress. That is, it is desirable to perform the ribosome dissociation step after the translation step of the genetic information material. The method of ribosome dissociation is as described above. Even without artificial ribosome dissociation, ribosomes may spontaneously dissociate from the peptide and begin translation of the second or subsequent peptides.

[0105] When ribosome dissociation is performed by adding a substance capable of binding to Mg ions as described above, it is preferable to add undenatured ribosomes after creating ribosome non-denaturing conditions for the next translation step.

[0106] For example, Mg(OAc) 2 By adding (for example, at a concentration of about 9-20 mM), Mg ions can be added, making ribosomes capable of translation.

[0107] Furthermore, by immobilizing the genetic information material-linker-peptide conjugate onto a solid layer such as magnetic beads, removing the liquid phase portion under ribosome denaturation conditions, and then adding a solution under ribosome non-denaturation conditions, ribosomes can be made into a translatable state.

[0108] In one embodiment, the genetic information material-linker-peptide conjugate may be subjected to a treatment after its manufacture to improve the stability of the mRNA portion of the mRNA-linker-peptide conjugate. As a stabilization treatment, for example, an RNA-DNA hybrid strand may be formed by performing a reverse transcription reaction using the conjugate as a template. Non-limitingly, a reverse transcription reaction is performed by adding a reverse transcription reaction solution to a reaction solution containing the genetic information material-linker-peptide conjugate obtained by the translation reaction.

[0109] Non-limitingly, the genetic information material-linker-peptide conjugate exhibits a higher recovery rate by recovery using a peptide-binding substance than when using a linker containing only one puromycin-like substance. In one embodiment, by using the genetic information material-linker-peptide conjugate, it is possible to obtain peptides (genetic information material-linker-peptide conjugates) with a recovery rate by recovery using a peptide-binding substance that is 1.5 times, 2 times or more, 3 times or more, 5 times or more, 10 times or more, 20 times or more, 100 times or more, or 600 times or more than when using a linker containing only one puromycin-like substance.

[0110] The peptide-binding substance (target substance) is not particularly limited in type, as long as it is a substance that can bind to a peptide. Examples of non-limiting target substances include proteins, nucleic acids, glycans, small molecule compounds, and cells. In one embodiment, the target substance is a protein.

[0111] In one embodiment, the present invention relates to a genetic information material-linker-peptide conjugate produced by a method comprising: (1) a step of binding the linker with a desired genetic information material to obtain a genetic information material-linker conjugate; and (2) a step of subjecting the genetic information material-linker conjugate obtained in step (1) to a cell-free translation system to perform translation of the genetic information material, wherein the puromycin-like substance in the linker binds to the translated peptide, and a genetic information material-linker-peptide conjugate is obtained.

[0112] Such "genetic information material-linker-peptide conjugates" can be suitably used in, for example, "6. Preparation of Libraries," "7. Method for Forming Conjugates of Target Substance and Peptide (1)," "8. Screening Method," "9. Method for Evaluating Binding Ability," and "11. Method for Presenting Peptides."

[0113] 6. Library In one embodiment, the present invention relates to a library comprising at least two genetic information material-linker-peptide conjugates of the present invention.

[0114] The "linker" and its components, such as "genetic information material" and "peptides," are as described in "1. Linker," "2. Use of Linker," "3. Genetic Information Material-Linker Concatenation," or "4. Genetic Information Material-Linker-Peptide Concatenation."

[0115] The library is characterized by comprising at least two of the genetic material-linker-peptide conjugates, and can otherwise be prepared by known methods. For example, as shown in Examples 10, 11, 12, 13, 15-19, the linker showed high recovery rates in all of the different display methods, and can therefore be used with known display methods and libraries using puromycin-like substances.

[0116] Non-limitingly, the library is a library prepared by combining display methods in which the linker is covalently or non-covalently linked to the genetic information material in a cell-free translation system. Non-limitingly, the library is a library prepared using the mRNA display method, the TRAP display method, or the RAPID display method.

[0117] Furthermore, the library is not limited to a random peptide library. For example, by using randomized nucleic acids as the genetic material, a library of genetic material-linker-peptide conjugates containing a variety of peptides encoded by them can be obtained.

[0118] The genetic material-linker-peptide conjugate contains at least two desired peptides, each peptide bound to a puromycin-like substance in the linker, and two or more peptides may be present at close range where they can interact with each other (depending on the length of the linker, etc.). Therefore, it becomes possible to screen for peptides (genetic material-linker-peptide conjugates) that have a weaker binding ability to the target substance. Furthermore, by using the library of the present invention, it becomes possible to recover genetic material-peptide conjugates that bind to the target substance with higher efficiency.

[0119] 7. Method for forming a conjugate of a target substance and a peptide (1) In one embodiment, the present invention relates to a method for forming a conjugate of a desired target substance and a peptide. The method comprises the step of contacting a genetic information substance-linker-peptide conjugate with a target substance conjugate comprising at least two of the target substance, wherein the genetic information substance-linker-peptide conjugate comprises: (a) a binding portion having a structure capable of binding to a desired genetic information substance; and a linker comprising at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic information substance bound to the binding portion of the linker in (a); and (c) a peptide encoded by the genetic information substance bound to at least two or more puromycin-like substances of the linker in (a).

[0120] In this embodiment, the target substance conjugate comprises at least two target substances. At least two of the target substances are presented in a state that allows them to contact the genetic information substance-linker-peptide conjugate.

[0121] The "linker" and its components, "genetic information material," "peptide," "library," "target substance," etc., are as described in "1. Linker," "2. Use of Linker," "3. Genetic Information Material-Linker Conjugate," "4. Genetic Information Material-Linker-Peptide Conjugate," "5. Method for Producing Genetic Information Material-Linker-Peptide Conjugate (1)," or "6. Library."

[0122] The target substance is not particularly limited in type, as long as it is a substance that can bind to peptides. Examples of non-limiting target substances include proteins, nucleic acids, glycans, small molecule compounds, cells, etc. In one embodiment, the target substance is a protein.

[0123] The number of target substances contained in the target substance conjugate is at least two, and there is no particular upper limit, but it may be any of 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3. Non-limitingly, it is preferable that the number of target substances contained in the target substance conjugate is the same as or greater than the number of puromycin-like substances contained in the linker. In one embodiment, the number of target substances contained in the target substance conjugate is two or more and 16 or less.

[0124] There are no particular limitations on the bonding mode of the target substance conjugate; each target substance may be linked to the others covalently or noncovalently. Furthermore, each target substance may be linked via a linker, or it may be linked directly without a linker. Alternatively, directly linked target substances may be further linked to other target substances via linkers. In this specification, a linker that links target substances in a target substance conjugate may be referred to as a "target substance linking linker." The "target substance linking linker" is not directly related to, and is not limited to, the description in "1. Linker." In relation to the target substance conjugate, "linker" means "target substance linking linker."

[0125] Based on the common technical knowledge of those skilled in the art, an appropriate structure can be selected for the target substance conjugate so that it can come into contact with the genetic information substance-linker-peptide conjugate.

[0126] In a target substance conjugate, it is preferable that each target substance is in close proximity. Here, "close proximity" means that the target substances are linked at a distance that gives a high local concentration around the linking site. Those skilled in the art can appropriately link the target substances so that they are in close proximity, based on common technical knowledge. By having each target substance in close proximity, a further improvement in the binding ability to the genetic information substance-linker-peptide conjugate can be expected. Therefore, in the present invention, if the recovery rate of the genetic information substance-linker-peptide conjugate bound to the target substance is improved, and / or if the binding ability between the target substance conjugate and the genetic information substance-linker-peptide conjugate is higher than that between a single target substance and the genetic information substance-linker-peptide conjugate, then it can be determined that each target substance is in close proximity. It should be noted, however limited, that the improvement in binding ability is thought to be due to the avidity effect that occurs between multiple target substances and multiple peptides.

[0127] The target substance conjugate may be a naturally occurring polymer of the target substance, or it may be an artificially formed polymer of a target substance that does not naturally exist as a polymer, provided that at least two of the target substances are presented in a state that allows them to contact the genetic information substance-linker-peptide conjugate. Non-limiting examples of the former include polymers of streptavidin, polymers of Fc protein, and polymers of hemagglutinin.

[0128] In one embodiment, the target substance linkage is a linkage in which at least two of the target substances are linked via a linker (a linker for linking target substances).

[0129] Non-limitingly, a target substance linkage may be a structure in which two or more target substances are covalently linked via a linker (a linker for linking target substances).

[0130] One non-limiting embodiment of such a target substance conjugate may be a protein engineering construct in which two or more target proteins are repeatedly linked together in tandem via a peptide linker (Wen-Rui Hao et al., Sci Rep. 2018 Mar 6;8(1):4256 (Non-Patent Literature 30), and Heather A Huet et al., MAbs. 2014;6(6):1560-70 (Non-Patent Literature 31)). In this case, the peptide linker is a linker for linking the target substance (a linker for linking target substances), and can be appropriately selected based on the common technical knowledge of those skilled in the art.

[0131] Furthermore, non-limitingly, it is also possible to use a target substance conjugate that is covalently linked to the target substance, which is the target protein, using a tag. For example, one of the combinations of SpyTag (tag) and SpyCatcher protein is introduced into the target protein, and this is reacted with a linker (target substance conjugate linker) consisting of 1 to 6 SpyCatcher proteins linked in tandem, resulting in a conjugate that is 2 to 6-merized (Thomas Fryer et al., ACS Cent Sci. 2022 Aug 24;8(8):1182-1195 (Non-Patent Literature 32)).

[0132] Furthermore, one non-limiting embodiment of a target substance conjugate, in which target substances are covalently linked, may involve introducing one of a pair of bioorthogonal functional groups to a target protein and polymerizing it by reaction with a linker (target substance linking linker) having the corresponding other functional group. Those skilled in the art can appropriately select a combination of bioorthogonal functional groups based on common technical knowledge. A non-limiting example of such a construct is one in which an azide group is introduced site-specifically to a target protein and reacted with a linker (target substance linking linker) having strained alkynes at the ends of a 2 or 4-branched polyethylene glycol structure to polymerize it into a dimer or tetramer (Anihoa Moliner-Morro et al., Biomolecules. 2020 Dec 11;10(12):1661 (Non-Patent Literature 33)).

[0133] Non-limitingly, a linker for target substance linking that utilizes a combination of functional groups capable of the above-described bioorthogonal reactions may be hydrophilic as a whole. Furthermore, although not limiting, to constitute the linker for target substance linking, linear substances such as single-stranded or double-stranded DNA or RNA oligonucleotides, polyethylene or other polyalkylenes, polyethylene glycol (PEG) or other polyalkylene glycols, polystyrene, linear polysaccharides, linear peptides, or combinations thereof may be appropriately selected and used. When using a combination of these linear substances, they may be appropriately linked together with suitable linking groups (-NH-, -CO-, -O-, -NHCO-, -CONH-, -NHNH-, -O-PO) 2 H-O-,-(CH 2 ) n -[n is, for example, 1 to 10, preferably 1 to 3], -S-, -SO-, etc. can be chemically linked.

[0134] Furthermore, in a preferred embodiment of the present invention, the target substance conjugate is a form in which two or more target substances are linked non-covalently via a linker (target substance linking linker). The target substance conjugate may, without limitation, be a fusion protein obtained by fusing a target protein with all or part of the monomers of a substance that naturally possesses the property of multimerization or a substance that has been artificially given the property of multimerization, as a linker (target substance linking linker), and then expressing, purifying, and multiplying it. Examples of such fusion proteins include those formed by dimerization of target proteins with Fc proteins (2, 4, or 10-merization), those formed by trimerization of target proteins with the trimerization domain of bacteriophage T4 fibrin (foldon), those formed by tetramerization of target proteins with the tetramerization domain of p53 protein, and those formed by dimerization of target proteins with leucine zipper motifs (Eugene M. Obeng et al., Nano Today. 2022 Oct:46:101580 (Non-Patent Literature 34), Adam Leach et al., Sci Rep. 2021 May 18;11(1):10475 (Non-Patent Literature 35), and H. Thie et al., New Biotechnology. 2009). Dec 31;26(6):314-21 (Non-Patent Document 36)).

[0135] In the case of a target substance linkage polymerized by the aforementioned fusion protein, all or part of the substance that naturally possesses the property of polymerization or the substance that has been artificially given the property of polymerization can be considered a linker for linking the target substances (a linker for linking target substances).

[0136] Furthermore, the target substance conjugate may be a multimerized product obtained by introducing an affinity tag to a target protein and reversibly linking the target protein to a linker containing a binding substance for the affinity tag (a linker for target substance linking). An example of this is a product obtained by introducing a site-specific biotin tag to a target protein and multimerizing it via streptavidin (tetramer) (S.M. Cloutier et al., Mol Immunol. 2000 Dec;37(17):1067-1077 (Non-Patent Literature 37)). In this case, streptavidin (tetramer) functions as a linker that links the target substance (a linker for target substance linking).

[0137] Furthermore, as an example of this, as shown in Examples 19 and 21, a polyhistidine tag is introduced to the target protein, and it is then polymerized via a nickel-coordinated nitrilotriacetate structure conjugate (SA-Ni-NTA) introduced to streptavidin via (tetramer) biotin (Karl Gatterdam et al., Angew Chem Int Ed Engl. 2018 Sep 17; 57(38): 12395-12399 (Non-Patent Literature 38)).

[0138] In one embodiment, the "target substance linkage" is a linkage in which at least two target substances having polyhistidine tags are linked via a target substance linking linker having at least two substances capable of binding to polyhistidine tags. The "substances capable of binding to polyhistidine tags" may be metal chelate complexes and are not particularly limited as long as they have a structure capable of chelating to metal ions. Non-limiting examples include nitrilotriacetic acid (NTA) structures, which may be NTA structures linked in a continuous sequence, as in Examples 19, 21, and unreferenced document 38. Furthermore, the structure linking at least two polyhistidine tag-binding substances in the "target substance linking linker having at least two substances capable of binding to polyhistidine tags" is not particularly limited as long as it is linkable, and may be covalent or non-covalent. Non-limiting examples include those mediated by proteins (utilizing the binding of biotin and streptavidin) and those mediated by chemical bonds (peptide linkers, PEG linkers, nucleic acid linkers).

[0139] In one embodiment, the target substance conjugate is a conjugate in which at least two of the target substances are linked together by being immobilized covalently or noncovalently on a solid phase surface or a membrane lipid.

[0140] Such target substance conjugates are not limited to those in which two or more target proteins are covalently immobilized on gold nanoparticles (Devein T Wiley et al., Proc Natl Acad Sci U S A. 2013 May 21;110(21):8662-7. (Non-patent Literature 39)), or those in which they are non-covalently immobilized on virus-like particles or liposomes (Chavee Laomeephol et al., Int J Pharma. 2024 Jul 20:660:124332. (Non-patent Literature 40), Timothy Q Vu et al., Biomacromolecules. 2023 Apr). Examples include 10;24(4):1574-1584 (Non-Patent Literature 41). The solid-phase surface or membrane lipid material used for immobilizing the target material can be appropriately selected based on the common technical knowledge of those skilled in the art. When at least two target materials are linked together via the solid-phase surface or membrane lipid material to form a target material conjugate, the solid-phase surface or membrane lipid material can be considered a linker for linking the target materials (target material linking linker). As described above, many methods are known that can be used to link target materials, and those skilled in the art can select an appropriate target material linker based on the common technical knowledge to obtain a target material conjugate.

[0141] In one embodiment, the present invention is a complex of a target substance conjugate comprising at least two desired target substances and a genetic information substance-linker-peptide conjugate. Such a complex may be obtained by a method for forming a conjugate of the desired target substances and the peptide.

[0142] Furthermore, in one embodiment, the present invention relates to a use for contacting a target substance conjugate comprising at least two desired target substances with a genetic information substance-linker-peptide conjugate to form a conjugate of the target substance and a peptide, wherein the genetic information substance-linker-peptide conjugate comprises: (a) a binding portion having a structure capable of binding to a desired genetic information substance; and a linker comprising at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic information substance bound to the binding portion of the linker in (a); and (c) a peptide encoded by the genetic information substance bound to at least two or more puromycin-like substances of the linker in (a), wherein the genetic information substance-linker-peptide conjugate comprises the genetic information substance-linker-peptide conjugate.

[0143] In one embodiment, the present invention relates to a target substance conjugate comprising at least two desired target substances, used in a method for forming a conjugate of a desired target substance and a peptide. The method comprises contacting a genetic material-linker-peptide conjugate with the target substance conjugate comprising at least two target substances, wherein the genetic material-linker-peptide conjugate comprises: (a) a binding portion having a structure capable of binding to a desired genetic material; and a linker comprising at least two puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic material bound to the binding portion of the linker in (a); and (c) a peptide encoded by the genetic material, bound to at least two puromycin-like substances of the linker in (a).

[0144] The information described in sections 1. Linker through 6. Library also applies to this section, unless there is a technical inconsistency.

[0145] In one embodiment, the binding portion in the linker (a) having a structure capable of binding to the desired genetic material comprises a nucleic acid capable of binding to the desired genetic material.

[0146] In one embodiment, the genetic information material is a nucleic acid.

[0147] In one embodiment, the puromycin-like substance in the linker (a) is puromycin.

[0148] In one embodiment, the binding ability between the target substance conjugate and the genetic information substance-linker-peptide conjugate is higher than the binding ability between the desired (one) target substance and the genetic information substance-linker-peptide conjugate.

[0149] Furthermore, the aforementioned target material conjugate is as described above in this section.

[0150] 8. Screening Method (1) In one embodiment, the present invention relates to a screening method (1) for peptides that bind to a desired target substance. The method comprises the step of contacting a library containing at least two genetic material-linker-peptide conjugates with the target substance conjugates.

[0151] In one embodiment, a method (1) for screening peptides that bind to a desired target substance comprises the step of contacting a library comprising at least two genetic material-linker-peptide conjugates with a target substance conjugate comprising at least two of the target substance, wherein the genetic material-linker-peptide conjugate comprises: (a) a binding portion having a structure capable of binding to a desired genetic material; and a linker comprising at least two puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic material bound to the binding portion of the linker in (a); and (c) a genetic material-linker-peptide conjugate comprising a peptide encoded by the genetic material, bound to at least two puromycin-like substances of the linker in (a).

[0152] In one embodiment, the target substance assembly is an assembly in which at least two of the target substances are linked via a linker (a linker for linking target substances).

[0153] The "linker" and its components, "genetic information material," "peptide," "library," "target substance," and "target substance conjugate," etc., are as described in "1. Linker," "2. Use of Linker," "3. Genetic Information Material-Linker Conjugate," "4. Genetic Information Material-Linker-Peptide Conjugate," "5. Method for Producing Genetic Information Material-Linker-Peptide Conjugate," "6. Library," or "7. Method for Forming a Conjugate of Target Substance and Peptide (1)."

[0154] Examples of the target substance, though not limited to specific examples, include proteins, nucleic acids, glycans, small molecule compounds, and cells. In one embodiment, the target substance is a protein.

[0155] The matters described in sections "1. Linker" through "7. Method for forming a conjugate between a target substance and a peptide (1)" also apply to this section, unless there is a technical inconsistency.

[0156] The screening method (1) is characterized by using the library, which includes at least two of the genetic information material-linker-peptide conjugates, in other words, the known screening method can be used in other respects. The screening method (1) makes it possible to screen for peptides (genetic information material-linker-peptide conjugates) that have a weaker binding ability to the target substance. Furthermore, the screening method (1) makes it possible to recover genetic information material-peptide conjugates that bind to the target substance with higher efficiency.

[0157] Furthermore, by using a target substance conjugate containing at least two target substances with respect to the aforementioned "conjugate in which multiple translation products are bound to one genetic information material via a puromycin-like substance," the translation product can be recognized by multiple target substances. By having multiple target substances recognized by multiple translation products having target-binding ability, a stronger binding ability can be obtained than when using only one target substance. This improvement in binding ability is thought to be due to the avidity effect, although it is not limited to this. Therefore, the screening method (1) using a target substance conjugate containing at least two target substances makes it possible to recover peptide-genetic information material conjugates that bind to target substances with even greater efficiency.

[0158] 9. Method for Evaluating Binding Ability In one embodiment, the present invention relates to a method for evaluating the binding ability between a desired target substance and a peptide. The method includes the step of contacting the genetic information material-linker-peptide conjugate of the invention with the target substance.

[0159] In one embodiment, the present invention relates to a method for evaluating the binding ability of a desired target substance to a peptide. The method comprises the step of contacting a library comprising at least two genetic material-linker-peptide conjugates with a target substance conjugate comprising at least two of the target substance, wherein the genetic material-linker-peptide conjugate comprises: (a) a binding portion having a structure capable of binding to a desired genetic material; and a linker comprising at least two puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic material bound to the binding portion of the linker in (a); and (c) a genetic material-linker-peptide conjugate comprising a peptide encoded by the genetic material, bound to at least two puromycin-like substances of the linker in (a).

[0160] In one embodiment, the target substance assembly is an assembly in which at least two of the target substances are linked via a linker (a linker for linking target substances).

[0161] The "linker" and its components, "genetic information material," "peptide," "target substance," "target substance conjugate," etc., are as described in "1. Linker," "2. Use of Linker," "3. Genetic Information Material-Linker Conjugate," "4. Genetic Information Material-Linker-Peptide Conjugate," "5. Method for Producing Genetic Information Material-Linker-Peptide Conjugate (1)," "6. Library," or "7. Method for Forming a Conjugate of Target Substance and Peptide (1)."

[0162] The matters described in sections "1. Linker" through "8. Screening Method (1)" also apply to this section, unless there is a technical inconsistency.

[0163] In one embodiment, the evaluation method is characterized by contacting the genetic information material-linker-peptide conjugate of the present invention with the target substance, and is not particularly limited in other respects. In one embodiment, the evaluation method includes the steps of contacting the genetic information material-linker-peptide conjugate with the target substance, and measuring the binding ability of the peptide in the genetic information material-linker-peptide conjugate to the target substance.

[0164] In one embodiment, the evaluation method is characterized by contacting the genetic information material-linker-peptide conjugate of the present invention with the target substance conjugate, and is not particularly limited in other respects. In one embodiment, the evaluation method includes the steps of contacting the genetic information material-linker-peptide conjugate with the target substance conjugate, and measuring the binding ability between the peptide in the genetic information material-linker-peptide conjugate and the target substance conjugate.

[0165] The method for evaluating the binding ability described above is not particularly limited, and known methods for evaluating binding ability can be used. The target substance and the target substance conjugate may exist in a solution, be immobilized on a carrier such as beads, chips, or plates, or be expressed in cells, viruses, etc. Furthermore, it is possible to immobilize the genetic information substance-linker-peptide conjugate of the present invention onto beads or sensor chips, etc., and evaluate its interaction with the target substance and the target substance conjugate. The binding ability to the target substance and the target substance conjugate can be evaluated by known methods. Non-limiting examples of such methods for evaluating binding ability include detection methods based on mass difference, such as surface plasmon resonance and biolayer interferometry, ELISA, qPCR quantification, flow cytometry, dye staining, chemichromic detection, chemiluminescence detection, and fluorescence detection.

[0166] The genetic information material-linker-peptide conjugate of the present invention can be modified with known affinity tags and modifying substances, such as binding substances represented by FLAG tags, HA tags, His tags, etc., fluorescent molecules, fluorescent proteins, chemiluminescent proteins, and chromogenic proteins such as peroxidase and alkaline phosphatase. Furthermore, as described in the examples, it is also possible to label with biotin. The genetic information material-linker-peptide conjugate thus modified can be used as appropriate for immobilization, purification, evaluation of binding ability, and other purposes.

[0167] Furthermore, the modified genetic material-linker-peptide conjugate can be reacted with a target substance or target substance conjugate immobilized on beads, chips, or plates, or with a target substance or target substance conjugate expressed in cells, viruses, etc., and its binding affinity can be identified using known labeling and detection methods.

[0168] The binding ability to the modified genetic material-linker-peptide conjugate can be evaluated by known methods. Not limited to these methods, the binding ability can be evaluated by detection techniques such as mass difference-based detection methods including surface plasmon resonance and biolayer interferometry, ELISA, qPCR quantification, flow cytometry, dye staining, chemichromic detection, chemiluminescence detection, and fluorescence detection.

[0169] As shown in the examples, the evaluation method uses the genetic information material-linker-peptide conjugate of the present invention, which improves the binding ability to the target substance. This makes it possible to more accurately evaluate the binding ability of peptides (genetic information material-linker-peptide conjugates) that have a weaker binding ability to peptides.

[0170] 10. Method for Producing Genetic Information Material-Linker-Peptide Conjugates (2) In one embodiment, the present invention relates to a method for producing a genetic information material-linker-peptide conjugate, comprising the steps of: (1-i) subjecting a genetic information material-linker conjugate, in which a linker containing at least one puromycin-like substance is bound to a desired genetic information material, to a cell-free translation system to translate the genetic information material, wherein the puromycin-like substance in the linker binds to the translated peptide, thereby obtaining a genetic information material-linker-peptide conjugate; and (2-i) repeating the step of (1-i) two or more times.

[0171] In one embodiment, the present invention includes, prior to step (1-i), a step of binding the linker to the desired genetic information material, wherein the linker comprises (0-i) a binding portion having a structure capable of binding to a desired genetic information material, and at least one puromycin-like substance, the puromycin-like substance being covalently capable of binding to the C-terminus of a desired peptide, to obtain a genetic information material-linker conjugate.

[0172] In one embodiment, the present invention relates to a method for producing a genetic information material-linker-peptide conjugate, comprising the steps of (1-ii) subjecting a genetic information material-linker conjugate, in which a linker containing at least two or more puromycin-like substances is bound to a desired genetic information material, to a cell-free translation system and translating the genetic information material, wherein the puromycin-like substances in the linker bind to the translated peptide, thereby obtaining a genetic information material-linker-peptide conjugate.

[0173] In one embodiment, the present invention includes, prior to step (1-ii), a step of binding the linker, which comprises (0-ii) a binding portion having a structure capable of binding to a desired genetic information material and at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide, to a desired genetic information material-linker conjugate. Here, the components of the linker, "genetic information material," "peptide," etc., are as described in "1. Linker," "2. Use of Linker," "3. Genetic Information Material-Linker Conjugate," or "4. Genetic Information Material-Linker-Peptide Conjugate." Steps (1) and (2) are as described above.

[0174] The manufacturing method described in "5. Method for producing a genetic information material-linker-peptide conjugate (1)" includes an artificial recycling translation step. The inventors have found that the method including the artificial recycling translation step is effective not only when using a linker containing "two or more puromycin-like substances" but also when using a linker containing "one puromycin-like substance" (also referred to as a "monovalent linker" in this specification). This is shown, for example, in Figure 10 of Example 10, Figure 11 of Example 11, and Figure 12 of Example 12. In all of these examples, when using a monovalent linker, the recovery rate was significantly improved when comparing a method with one translation step to a method with two translation steps. Although not bound by theory, this is thought to be because, when a linker containing one puromycin-like substance is used in the translation step, a large amount of linker without a peptide bound remains in the reaction solution after one translation step, while the amount of linker with a peptide bound in the reaction solution increases when the translation step is repeated two or more times consecutively. Therefore, even when using a monovalent linker, it is thought that increasing the number of linkers bound to the peptide through artificial recycling translation can increase the amount of the conjugate formed by the binding of the genetic information material-linker-peptide conjugate to the target substance.

[0175] The genetic information material-linker-peptide conjugate obtained by the above manufacturing method can be suitably used in a screening method for peptides that bind to a desired target substance, and in a method for evaluating the binding ability between a desired target substance and a peptide. The screening method (1) and the method for evaluating the binding ability are not particularly limited, and known methods can be used for each.

[0176] The matters described in "5. Method for producing genetic information material-linker-peptide conjugates (1)" also apply to "10. Method for producing genetic information material-linker-peptide conjugates (2)" unless there is a technical contradiction.

[0177] 11. Method for Presenting Peptides In one embodiment, the present invention relates to a method for presenting two or more peptides encoded by a desired genetic information material from the genetic information material, wherein each peptide is linked to the genetic information material via a functional group that can be covalently bonded to the C-terminus of the peptide.

[0178] "Genetic information material," "peptides," etc., are as described in "1. Linker," "2. Use of Linker," "3. Genetic Information Material-Linker Conjugate," or "4. Genetic Information Material-Linker-Peptide Conjugate."

[0179] In one embodiment, the presentation method includes the step of providing the genetic information material-linker conjugate to a cell-free translation system and translating the peptide from the genetic information material, wherein the puromycin-like substance and the translated peptide are bound together.

[0180] The steps for "binding the linker to the genetic information material," "cell-free translation system," and "translation of peptides" are as described in "5. Method for producing genetic information material-linker-peptide conjugates (1)," unless there is a technical inconsistency.

[0181] The presenting method of the present invention allows for the presentation of multiple peptides encoding a desired genetic material, thereby improving avidity and enabling more efficient recovery of genetic material-peptide conjugates that bind to the target substance.

[0182] 12. Method for forming a conjugate of a target substance and a peptide (2) In one embodiment, the present invention relates to a method for forming a conjugate of a desired target substance and a peptide.

[0183] The method described above includes the step of bringing a genetic information material-linker-peptide conjugate into contact with a target material conjugate containing at least two of the target material.

[0184] The genetic information material-linker-peptide conjugate is a linker comprising: (a) a binding site having a structure capable of binding to a desired genetic information material; and at least two binding sites having a structure capable of covalently binding to the C-terminus of a peptide; wherein the length and rigidity of the linker structure connecting the at least two binding sites having a structure capable of covalently binding to the C-terminus of the peptide can be precisely controlled by chemical synthesis; (b) the genetic information material bound to the binding sites of the linker in (a); and (c) a peptide encoded by the genetic information material, bound to at least two binding sites of the linker in (a) having a structure capable of covalently binding to the C-terminus of a peptide.

[0185] The linker in this method comprises (a) a binding site having a structure capable of binding to a desired genetic material; and at least two binding sites having a structure capable of covalently binding to the C-terminus of a peptide, wherein the structure connecting the at least two binding sites having a structure capable of covalently binding to the C-terminus of a peptide can be precisely controlled chemically in terms of its length and rigidity.

[0186] The "binding site having a structure capable of binding to the desired genetic information material," etc., are as described in "1. Linker" to "11. Method of Peptide Presentation," unless there is a technical inconsistency.

[0187] The "at least two binding sites having a structure capable of covalently bonding to the C-terminus of the peptide" are not particularly limited. Even if it is not a puromycin-like substance as described in "1. Linker" to "11. Method of Peptide Presentation," as long as it has a structure capable of covalently bonding to the C-terminus of the peptide, it can achieve the objective of linking the genetic information material and the peptide.

[0188] The "linker structure connecting at least two or more binding sites having a structure that can covalently bond to the C-terminus of a peptide" is not particularly limited, as long as its length and rigidity can be precisely controlled through chemical synthesis. Non-limiting examples of the "linker structure connecting at least two or more binding sites having a structure that can covalently bond to the C-terminus of a peptide" include those mediated by chemical bonds (branched peptide linkers, PEG linkers, and nucleic acid linkers).

[0189] In one embodiment, a method for forming a conjugate of a desired target substance and a peptide may include the steps of subjecting a desired genetic information substance-linker-conjugate to a cell-free translation system, translating the genetic information substance, and obtaining a genetic information substance-linker-peptide conjugate.

[0190] The steps of "contacting a genetic information material-linker-peptide conjugate with a target material conjugate containing at least two of the target material," "(b) the genetic information material bound to a binding site of the linker in (a) having a structure capable of binding to the genetic information material," "(c) a peptide encoded by the genetic information material bound to at least two binding sites of the linker in (a) having a structure capable of covalently binding to the C-terminus of a peptide," "cell-free translation system," and "translation" are as described in "1. Linker" to "11. Method of Presenting Peptides," unless there is a technical inconsistency.

[0191] 13. Method for forming a complex of a genetic information substance-linker-peptide conjugate In one embodiment, the present invention relates to a method for forming a complex of a target substance conjugate containing at least two desired target substances and a genetic information substance-linker-peptide conjugate in which two or more peptides encoded by a desired genetic information substance are linked.

[0192] The method includes: 1) a step of providing a genetic information material, which is integrally linked to a linker containing at least two or more puromycin-like substances bound to each of the branched locations, to a cell-free translation system to translate the genetic information material; 2) a step of obtaining a genetic information material-linker-peptide conjugate by linking the linker containing at least two or more puromycin-like substances bound to each of the branched locations, the integrally linked genetic information material, and the peptide encoded by the translated genetic information material; and 3) a step of contacting the genetic information material-linker-peptide conjugate with a target substance conjugate containing at least two or more of the target substance.

[0193] A linker containing at least two or more puromycin-like substances bound to each of the multiple branched locations is a branched form of the linker described in "1. Linker".

[0194] At least two or more puromycin-like substances may be present at either the ends or the middle of the linker. The linker is branched (branched linker), and each branch chain may have a puromycin-like substance bound to it. The lengths of each branch chain of the branched linker may be the same or different. In one embodiment, the lengths of each branch chain of the branched linker are the same.

[0195] "Genetic information material," "cell-free translation system," "translation," and "contacting a genetic information material-linker-peptide conjugate with a target substance conjugate containing at least two of the target substance" are as described in "1. Linker" to "12. Method for forming a conjugate of target substance and peptide (2)," unless there is a technical inconsistency.

[0196] 14. Method for linking two or more desired target substances having polyhistidine tags (1) In one embodiment, the present invention relates to a method for linking two or more desired target substances having polyhistidine tags. The method includes the step of linking the two or more target substances via a target substance linking linker having at least two or more substances capable of binding to the polyhistidine tags of the target substances.

[0197] The "target substance," etc., are as described in "1. Linker" to "13. Method for forming a conjugate of genetic information material - linker - peptide conjugate," unless there is a technical inconsistency. In one embodiment, the target substance is a protein.

[0198] In one embodiment, the substance capable of binding to the polyhistidine tag is a metal chelate complex. The "substance capable of binding to the polyhistidine tag" and the "metal chelate complex" are as described in "7. Method for forming a conjugate of a target substance and a peptide (1)".

[0199] 15. Linker for linking target substances In one embodiment, the present invention relates to a linker for linking target substances.

[0200] The linker for linking the target substance consists of structural units having at least two or more metal chelate complexes, and includes at least two or more of the aforementioned structural units.

[0201] A "metal chelate complex" is as described in "7. Method for forming a conjugate between a target substance and a peptide (1)". A "structural unit having at least two metal chelate complexes" is a structure in which a structure containing at least two metal chelate complexes constitutes one unit.

[0202] In no particular way, the number of metal chelate complexes constituting the structural unit having at least two or more metal chelate complexes is at least two, and there is no upper limit. In no particular way, the number of metal chelate complexes included in the structural unit is 20 or less, 15 or less, 10 or less, 6 or less, or 3 or less.

[0203] The linker for linking the target substance comprises at least two of the structural units. Not limited to, the linker for linking the target substance comprises two, three, four, five, six, seven, eight, nine, or ten of the structural units.

[0204] Non-limitingly, even when the linker for linking target substances contains two or more of the structural units, the polyhistidine tag and one structural unit can each be bound in a one-to-one ratio. The phrase "even when the linker contains two or more of the structural units, the polyhistidine tag and one structural unit can each be bound in a one-to-one ratio" means "a state in which the polyhistidine tag and one structural unit having at least two or more metal chelate complexes can each be bound in equal proportions."

[0205] In one embodiment, the linker for linking target substances has two or more structural units, each having at least two metal chelate complexes, linked together via a protein.

[0206] Non-limitingly, the structural units having at least two metal chelate complexes have a strong affinity for 6xHis tag with KD values ​​of 1000 pM (1 nM) or less, 500 pM or less, 300 pM or less, 200 pM or less, 100 pM or less, and 90 pM or less.

[0207] In one embodiment, the target substance that can bind to the polyhistidine tag is a protein. The target substance linker can be used to screen for binding targets of the target substance, which is a protein, from a library.

[0208] In one embodiment, the present invention includes use for screening a library for the binding target of the target substance linker, which is a protein.

[0209] In one embodiment, the present invention includes a target substance linker for use in screening a library for binding targets of a target substance protein.

[0210] In one embodiment, the present invention relates to a kit for screening a library of binding targets for a target substance protein, which includes the target substance linker. In addition to the target substance linker, the kit of the present invention may also include reagents (e.g., additives), genetic information materials, etc., for use in a method of screening a library of binding targets for a target substance protein.

[0211] In one embodiment, the present invention relates to a composition for use in screening a library for the binding target of a protein, which is a target substance linker, including the linker for linking the target substance.

[0212] 16. Method for linking two or more desired target substances having polyhistidine tags (2) In one embodiment, the present invention relates to a method for linking two or more desired target substances having polyhistidine tags. The method includes the step of linking each of the target substances via a linker for linking target substances as described in "15. Linker for linking target substances".

[0213] The "linker for linking target substances" used in the method of the present invention is the linker described in "15. Linker for linking target substances".

[0214] The "target substance," etc., are as described in "1. Linker" to "15. Linker for linking target substance," etc., unless there is a technical inconsistency. In one embodiment, the target substance is a protein.

[0215] 17. Method for forming a conjugate of a target substance and a peptide (3) In one embodiment, the present invention relates to a method (3) for forming a conjugate of a desired target substance and a peptide. The method includes the step of bringing a genetic information material-linker-peptide conjugate into contact with a target substance conjugate in which two or more of the target substances are linked via a target substance linker described in "15. Target substance linking linker".

[0216] "Genetic information material," "linker," "peptide conjugate," "target material," "target material conjugate," etc., are as described in "1. Linker" to "16. Method for linking two or more desired target materials having polyhistidine tags (2)," unless there is a technical inconsistency.

[0217] The "linker for linking target substances" used in the method of the present invention is the linker described in "15. Linker for linking target substances".

[0218] The "target material," etc., are as described in "1. Linker" to "16. Method for linking two or more desired target materials having polyhistidine tags (2)," unless there is a technical inconsistency.

[0219] In one embodiment, the method may further include the steps of: subjecting a desired genetic information material-linker-conjugate to a cell-free translation system to translate the genetic information material and obtain a genetic information material-linker-peptide conjugate; and purifying the genetic information material-linker-peptide conjugate from the cell-free translation system.

[0220] The "cell-free translation system," "translation," etc., are as described in "1. Linker" to "16. Method for linking two or more desired target substances having polyhistidine tags (2)," unless there is a technical inconsistency.

[0221] 18. Screening Method (2) In one embodiment, the present invention relates to a screening method (2) for peptides that bind to a desired target substance.

[0222] The method includes the steps of bringing a genetic information material-linker-peptide conjugate into contact with a target substance conjugate in which two or more target substances are linked via a target substance linker described in "15. Linker for linking target substances", and adding an additive to elute the complex of the genetic information material-linker-peptide conjugate and the target substance from the complex of the genetic information material-linker-peptide conjugate and the target substance conjugate.

[0223] The step of "bringing a genetic information material-linker-peptide conjugate to a target substance conjugate in which two or more target substances are linked via a target substance linker described in '15. Linker for linking target substances'" can be carried out, for example, by the step described in "17. Method for forming a conjugate of a target substance and a peptide (3)".

[0224] The additive used to "elute the complex of the genetic information material-linker-peptide conjugate and the target substance" is not particularly limited, as long as it is a reagent that can elute the complex of the genetic information material-linker-peptide conjugate and the target substance from the complex of the genetic information material-linker-peptide conjugate and the target substance conjugate.

[0225] In one embodiment, the additive is imidazole.

[0226] In one embodiment, the method may further include the steps of: subjecting a desired genetic information material-linker-conjugate to a cell-free translation system to translate the genetic information material and obtain a genetic information material-linker-peptide conjugate; and purifying the genetic information material-linker-peptide conjugate from the cell-free translation system.

[0227] The "cell-free translation system," "translation," etc., are as described in "1. Linker" to "17. Method for forming a conjugate between the target substance and the peptide (3)," unless there is a technical inconsistency.

[0228] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples. Those skilled in the art can easily modify and change the present invention based on the description herein, and such modifications fall within the technical scope of the present invention.

[0229] [Example 1: Synthesis of various linkers] The linkers were designed to include either "cccgcctccccgccccccgtcc" (SEQ ID NO: 1) or "ctccccgccccccgtcc" (SEQ ID NO: 60) as the mRNA hybridization region. Linkers 1, 2, 7, and 9 were designed to contain one puromycin capable of amide bonding to the C-terminus of the desired peptide, linkers 3-6, 8, 10, and 12 contained two, linkers 11 and 15 contained three, linker 13 contained four, and linker 14 contained six (Figures 1-1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, and 1-10). The synthesis method for the linkers was designed as follows.

[0230] Linkers 1, 7, 9, 10: Refer to the corresponding non-patent documents below: Linker 1 (Non-patent document 3), Linker 7 ("In Vitro Selection of Anti-Akt2 Thioether-Macrocyclic Peptides Leading to Isoform-Selective Inhibitors", Hayashi et al., ACS Chem. Biol., 2012, 7, 3, 607-613, Non-patent document 19), Linkers 9, 10 (Patent document 2), Synthesis by general phosphoramidite method and purification by high-performance liquid chromatography (HPLC).

[0231] Linker 2: A linker 2 precursor (Figure 2-1) with a thiol at the 3' end was synthesized by a general phosphoramidite method, followed by Cy5 modification via Michael addition of the thiol to maleimide, and then purification by HPLC.

[0232] Linker 3: Linker 3 precursor 1 (Figure 2-1), having two primary amines at the 5' end, is synthesized by a general phosphoramidite method. This precursor is then reacted with 4-azido-butane-1-euic acid NHS ester, which has an amine-reactive N-hydroxysuccinimide (NHS) ester at one end, to synthesize linker 3 precursor 2 (Figure 2-2), followed by HPLC purification. Subsequently, linker 3 precursor 3 (Figure 2-2) is synthesized by a general phosphoramidite method. This precursor is then combined with linker 3 precursor 2 via a SPAAC reaction to synthesize linker 3, followed by HPLC purification.

[0233] Linkers 4-6, 8, 11-15: Linker 4-6, 8, 11-15 precursor 1 (Figures 2-3, 2-4, 2-5, 2-7, 2-8, 2-10, 2-11, 2-13, 2-15), which have multiple primary amines at the 5' end, are synthesized by a general phosphoramidite method. These precursors are then reacted with 4-azidobutane-1-euic acid NHS ester, which has an amine-reactive NHS ester at one end, to synthesize linker 4-6, 8, 11-15 precursor 2 (Figures 2-3, 2-4, 2-5, 2-7, 2-9, 2-10, 2-12, 2-14, 2-15), followed by HPLC purification. Next, alkynpuromycin (Figure 2-6) was synthesized by a general phosphoramidite method, and linkers 4-6, 8, and 11-15 were synthesized by linking them with linker precursor 2 via a CuAAC reaction, followed by purification by HPLC.

[0234] Based on the synthesis method designed above, linkers 1 and 3 were synthesized by BEX Corporation (Japan), and linkers 2, 4-15 were synthesized by Gene Design Corporation (Japan). Linker 12 was synthesized using linker 12 precursor 2, which was also synthesized by Gene Design Corporation (Japan), and an alkyne puromachine. Linkers 4-12, 15, and linker 12 precursor 2 were analyzed by Gene Design Inc. using HPLC (BioAccord® SYSTEM, Waters Inc.) (column used: XBridge C18 Column 130Å 2.5μm 4.6mm x 75mm, column temperature: 60℃, solvent A: 100mM hexafluoroisopropanol (HFIP) 8mM triethylamine, solvent B: methanol, solvent B gradient: 5-40% (5-30% for linkers 4, 9, 10, and linker 12 precursor 2, 5-50% for linker 8, and 5-60% for linkers 11, 13-15), 20 minutes, flow rate: 1 mL / min). The purity of each linker obtained from the above analysis was as follows.

[0235] Linker 4: 96.3% Linker 5: 95.6% Linker 6: 91.6% Linker 7: 97.6% Linker 8: 95.54% Linker 9: 98.75% Linker 10: 98.18% Linker 11: 90.3% Linker 12 Precursor 2: 97.68% Linker 13: 92.65% Linker 14: 89.38% Linker 15: 96.17%

[0236] Also, the results of mass spectrometry by the electrospray ionization time-of-flight mass spectrometer (ESI-TOF-MS, BioAccord TM SYSTEM, Waters) implemented by GeneDesign were as follows.

[0237] Linker 4: ESI-TOF-MS, [M − H] - Calculated value 10808.12; Measured value 10807.00 (after deconvolution). Linker 5: ESI-TOF-MS, [M − H] - Calculated value 11496.72; Measured value 11496.00 (after deconvolution). Linker 6: ESI-TOF-MS, [M − H] - Calculated value 12185.32; Measured value 12184.00 (after deconvolution). Linker 7: ESI-TOF-MS, [M − H] - Calculated value 7587.33; Measured value 7588.0 (after deconvolution). Linker 8: ESI-TOF-MS, [M − H] - Calculated value 9398.84; Measured value 9400.30 (after deconvolution). Linker 9: ESI-TOF-MS, [M − H] - Calculated value 9150.22; Measured value 9150.90 (after deconvolution). Linker 10: ESI-TOF-MS, [M − H] - Calculated value 1115.62; Measured value 11115.00 (after deconvolution). Linker 11: ESI-TOF-MS, [M − H] -Calculated value 13659.18; Measured value 13662.00 (after deconvolution). Linker 12 precursor: ESI-TOF-MS, [M-H] - Calculated value 9303.66; Measured value 9302.00 (after deconvolution). Linker 13: ESI-TOF-MS, [M-H] - Calculated value 16493.59; Measured value 16493.00 (after deconvolution). Linker 14: ESI-TOF-MS, [M-H] - Calculated value 22880.98; Measured value 22880.60 (after deconvolution). Linker 15: ESI-TOF-MS, [M-H] - Calculated value: 12281.98; Measured value: 12284.80 (after deconvolution).

[0238] Linkers 1-12 (final concentration: 20 μM), synthesized by contract, were each treated with 3-hydroxypicolinic acid (final concentration: 50% (v / v), saturated solution, 50% acetonitrile, 0.1% trifluoroacetic acid, 10 mg / mL diammonium hydrogen citrate) and crystallized on an MTP 384 TARGET PLATE POLISHED STEEL BC (Bruker) (RT). The crystallized samples were analyzed by mass spectrometry (linear mode, positive ion mode) using a matrix-assisted laser desorption / ionization time-of-flight mass spectrometer (MALDI-TOF-MS, autoflex® maX, Bruker), and the results were as follows.

[0239] Linker 1: MALDI-TOF-MS(m / z), [M+H] + Calculated value 8995.34; Measured value 8994.27. Linker 2: MALDI-TOF-MS (m / z), [M+H] + Calculated value 9956.42; Measured value 9956.17. Linker 3: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 13782.77; Measured value: 13782.73. Linker 4: MALDI-TOF-MS (m / z), [M+H] +Calculated value 10810.13; Measured value 10808.55. Linker 5: MALDI-TOF-MS (m / z), [M+H] + Calculated value 11498.73; Measured value 11496.18. Linker 6: MALDI-TOF-MS (m / z), [M+H] + Calculated value 12187.33; Measured value 12185.45. Linker 7: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 7589.35; Measured value: 7589.90. Linker 8: MALDI-TOF-MS (m / z), [M+H] + Calculated value 9400.86; Measured value 9400.68. Linker 9: MALDI-TOF-MS (m / z), [M+H] + Calculated value 9152.24; Measured value 9152.58. Linker 10: MALDI-TOF-MS (m / z), [M+H] + Calculated value 11117.64; Measured value 11117.02. Linker 11: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 13661.20; Measured value: 13661.66. Linker 12: MALDI-TOF-MS (m / z), [M+H] + Calculated value: 11725.66; Measured value: 11724.23.

[0240] These results confirmed that the substance obtained above is the target linker.

[0241] [Example 2: Synthesis of DNA used in the example] Template DNA was synthesized to produce mRNA to be bound to the linker.

[0242] Template DNA was prepared by ligating synthetic single-stranded DNA and primers using polymerase chain reaction (PCR). Tables 1-1 and 1-2 show the nucleotide sequences of the synthetic single-stranded DNA used in the PCR for preparing the template DNA. Table 1-3 shows the sequences of the primers used in the examples described herein. Table 2 shows the combinations of synthetic single-stranded DNA and primers used in the synthesis of each template DNA in these examples.

[0243]

[0244]

[0245]

[0246]

[0247] Table 3 shows the template DNA obtained by the above PCR, and the amino acid sequences of the peptides encoded by the translation region of the template DNA in the translation reaction in each of the following examples. The template DNA consists of a T7 promoter sequence, a ribosome binding sequence, a start codon, a peptide sequence, a spacer peptide sequence, an amber codon, and a linker hybridization sequence.

[0248]

[0249]

[0250] In Tables 3-1 and 3-2, lowercase letters represent DNA, uppercase letters represent commonly used amino acid abbreviations, Fph represents N-(3',6'-dihydroxy-3-oxo-3-H-spiro[isobenzenefuran-1,9'-xanthene]-5-carboxyl)-L-phenylalanine, MeA represents N-methyl-L-alanine, and ClAcY represents N-2-chloroacetyl-L-tyrosine. Underlined text indicates the translation region in the template DNA.

[0251] Furthermore, the template DNA (SEQ ID NO: 18) prepared using the "Synthetic single-stranded DNA for model sequences" in the table encodes an oligonucleotide encoding a fluorescent model peptide (SEQ ID NO: 19) containing a fluorothane structure, while the template DNA (SEQ ID NO: 20) prepared using the "Synthetic single-stranded DNA for Strep-tag II" encodes a streptavidin-binding peptide (SEQ ID NO: 21, "Improved affinity of engineered streptavidin for the Strep-tag II peptide is due to a fixed open conformation of the lid-like loop at the binding site" I.P. Korndorfer and A. Skerra, Protein The oligonucleotide encoding the FcRn binder was prepared using a template DNA (SEQ ID NO: 22) created by "Synthetic Single-Stranded DNA for FcRn Binder". The template DNA was SEQ ID NO: 23, “Synthesis and Structure-Activity Relationships of Dimeric Peptide Antagonists of the Human Immunoglobulin G-Human Neonatal Fc Receptor (IgG-FcRn) Interaction” by K.A. McDonnell et al. Oligonucleotides encoding hemagglutinin (HA) binding peptides (SEQ ID NO: 24, “Inhibition of H1 and H5 Influenza A Virus Entry by Diverse Macrocyclic Peptides Targeting the Hemagglutinin Stem Region” M.N.Pascha et al., ACS Chem. Biol., 2022, 17, 9The oligonucleotide encoding 2425-2436 (Non-Patent Literature 9) and the template DNA (SEQ ID NO: 26) prepared by "Synthetic Single-Stranded DNA for Fc Binder" each contain oligonucleotides encoding human IgG Fc protein (Fc) binding peptides (SEQ ID NO: 27, "Kinetic-Based Structural Requirements of Human Immunoglobulin G Binding Peptides," K. Muguruma et al., ACS Omega, 2019, 4, 11, 14390-14397 (Non-Patent Literature 10)).

[0252] According to Table 2, 100 μL of PCR reaction mixture (final concentration: 1 × Phusion HF buffer, 200 μM dNTPs, 3% dimethyl sulfoxide (DMSO), 2 units Phusion DNA polymerase) was prepared containing synthetic single-stranded DNA (final concentration: 2 nM) other than the synthetic single-stranded DNA for mRNA A-L containing random regions, and the corresponding primer (final concentration: 500 nM). The reaction was carried out using a thermal cycler (T100 thermal cycler, BioRad) with 25 cycles of 98°C for 60 seconds (98°C for 10 seconds, 61°C for 30 seconds, 72°C for 30 seconds). The reaction product was purified using AMPure XP (Beckman Coulter).

[0253] Furthermore, according to Table 2, the following are used: Extension PCR reaction mixture (final concentration: 1 μM) containing synthetic single-stranded DNA for mRNA A-L including random regions (final concentration: 1 μM, each sequence number 32-43), corresponding reverse primers, 1× buffer for KOD-Plus- ver. 2 (Toyobo Co.), 200 μM dNTPs, 1.5 mM MgSO4. 4A solution of 0.02 U / μL KOD plus (Toyobo Co., Ltd.) was prepared and reacted using a thermal cycler (T100 thermal cycler, BioRad) at 94°C for 2 minutes, (60°C for 40 seconds, 68°C for 60 seconds) for 5 cycles, and 68°C for 60 seconds. Subsequently, the post-reaction solution prepared above was converted into a PCR reaction solution (final concentration: 10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% (v / v) Triton X-100, 2 mM MgCl). 2 The mixture was diluted 40-fold with 250 μM dNTPs, 250 nM corresponding forward primer, 250 nM corresponding reverse primer, and Taq DNA Polymerase (NEB) (0.02 U / μL). The reaction was carried out using a thermal cycler (T100 thermal cycler, BioRad) at 95°C for 40 seconds, followed by four cycles of {95°C for 40 seconds, 50°C for 40 seconds, 72°C for 60 seconds}, and then at 72°C for 60 seconds. After the reaction, the mixture was purified by phenol-chloroform extraction and ethanol precipitation, and the resulting pellet was redissolved in ultrapure water.

[0254] [Example 3: Preparation of mRNA-linker conjugates] Example 3-1 Preparation of mRNA and preparation of mRNA-linker conjugates mRNA was synthesized by transcription reaction using T7 RNA polymerase based on the template DNA prepared in Example 2 (excluding the template DNA of mRNA A to L which contains random regions). The resulting reaction product was purified using RNAClean XP (Beckman Coulter). After purification, the mRNA concentration was determined from the UV absorption at 260 nm and diluted to 20 μM.

[0255] Furthermore, template DNA of mRNA A-L containing random regions was transcribed into a transcription mix (final concentration: 40 mM Tris-HCl (pH 8.0), 1 mM Spermidine, 0.01% (v / v) Triton X-100, 10 mM DTT, 20 mM MgCl). 2The solution was diluted five-fold with 25 mM KOH, 3.75 mM NTPs, and 0.24 μM T7 RNA polymerase, and the reaction was carried out at 37°C for 6 hours. After the reaction, the DNase reaction solution (final concentration: 40 mM Tris-HCl (pH 8.0), 10 mM MgSO4) was added. 4 , 1 mM CaCl 2 0.025 U / μL of RQ1 RNase-Free DNase (Promega) was added, and the reaction was carried out at 37°C for 1 hour. Finally, the post-reaction solution was purified by phenol-chloroform extraction, and the mRNA concentration was determined from the UV absorption at 260 nm, and the solution was diluted to 20 μM.

[0256] Each mRNA prepared in this manner (excluding mRNA produced from template DNA of mRNA I-L containing random regions) (final concentration: 5 μM) and each linker prepared in Example 1 (final concentration: 5.5 μM) were heated (95°C, 3 minutes) in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-KOH (final concentration: 62.5 mM, pH 7.6) and KOAc (final concentration: 375 mM, pH 7.6), and then allowed to stand at room temperature to hybridize, thereby producing 5 μM mRNA-linker conjugates. Of the mRNA-linker conjugates prepared in this manner, those using mRNA A to H containing random regions were dissolved in five times the volume of loading buffer (final concentration: 7M urea, 10mM EDTA, 1mM Tris-HCl (pH 7.6)) and heated at 95°C for 1 minute. After 8% denatured urea polyacrylamide electrophoresis and SYBR Green II staining, fluorescence imaging was performed using PhalosFX (Biorad).

[0257] For mRNAs prepared from template DNA containing random regions (mRNA I-L), each mRNA (final concentration: 1 μM) was mixed with linker 8 (final concentration: 1.5 μM), 1x Ligation Buffer (Takara), and DMSO (final concentration: 10% (v / v), T4 RNA ligase (Takara, final concentration: 5 U / μL)), and a ligation reaction was carried out at 37°C for 1 hour. A portion of the prepared mRNA-linker conjugates were dissolved in five times the volume of loading buffer (final concentration: 7 M urea, 10 mM EDTA, 1 mM Tris-HCl (pH 7.6)), heated at 95°C for 1 minute, and then subjected to 8% denatured urea polyacrylamide electrophoresis and SYBR Green II staining, followed by fluorescence imaging using PharosFX (Biorad).

[0258] Figure 3 shows the analysis results of mRNA-linker conjugates. In all mRNA-linker conjugates, a fluorescent band originating from the mRNA-linker conjugate was observed at the higher molecular weight side relative to the mRNA. This indicates that various linkers can be applied to a wide range of genetic materials.

[0259] Example 3-2 Binding of a puromycin-like substance to an mRNA-linker 4 precursor 2 conjugate The mRNA (final concentration: 5 μM) prepared from the template DNA of the model sequence in Example 3-1 and linker 4 precursor 2 (final concentration: 10 μM) were heated (95°C, 3 minutes) in HEPES-KOH (final concentration: 62.5 mM, pH 7.6) and KOAc (final concentration: 375 mM, pH 7.6), and then allowed to stand at room temperature to allow hybridization to be performed, thereby producing a 5 μM mRNA-linker 4 precursor 2 conjugate. Next, alkynpuromycin (final concentration: 53.4 μM), DMSO (final concentration: 10% (v / v)), tris(3-hydroxypropyltriazolylmethyl)amine (THPTA) / copper(II) sulfate solution (final concentration: THPTA = 10 mM, copper(II) sulfate = 5 mM), and sodium ascorbate (final concentration: 10 mM) were added to the above conjugate (final concentration: 3.3 μM), and the CuAAC (AAC: Azide-Alkyne-cycloaddition) reaction was carried out at room temperature for 2 hours. After the CuAAC reaction, the solution was purified by ethanol precipitation, then dissolved in five times the volume of loading buffer (final concentration: 7M urea, 10 mM EDTA, 1 mM Tris-HCl (pH 7.6)) and heated at 95°C for 1 minute. Following 8% denatured urea polyacrylamide electrophoresis and SYBR Green I staining, fluorescence imaging was performed using PhalosFX (Biorad).

[0260] Figure 4 shows the fluorescence imaging results. The fluorescence band derived from the mRNA-linker 4 precursor 2-linker conjugate shifted completely to the high molecular weight side after the CuAAC reaction, which is thought to be due to the reaction of alkyne puromycin to each of the two azide groups contained in the linker. This indicates that it is possible to indirectly create an mRNA-linker conjugate containing two puromycin groups by introducing one of a pair of mutually binding functional groups, such as an azide-alkyne, to mRNA and reacting it with puromycin containing the other functional group of the pair.

[0261] [Example 4: Preparation of aminoacyl-tRNA] The aminoacyl-tRNA to be used in the translation reaction in the cell-free translation system was prepared as follows.

[0262] For aminoacylation of tRNA by acylation catalytic RNA (ARS ribozyme), the following amino acid activated esters are used: (3',6'-dihydroxy-3-oxo-3-H-spiro[isobenzenefuran-1,9'-xanthene]-5-carboxyl)-L-phenylalanine cyanomethyl ester (Fph-CME, "An orthogonal ribosome-tRNA pair via engineering of the peptidyl transfer center" N. Terasaka et al., Nat. Chem. Biol., 2014, 10, 7, 555-557), and L-tryptophan cyanomethyl ester (W-CME, "A highly flexible tRNA") "Acylation method for non-natural polypeptide synthesis" H. Murakami et al., Nat. Methods, 2006, 3, 5, 357-359 (Non-patent Literature 12)), N-methyl-L-alanine dinitrobenzyl ester (MeA-DBE, "Messenger RNA-programmed incorporation of multiple N-methyl-amino acids into linear and cyclic peptides" T. Kawakami et al.) al., Chem. Biol., 2008, 15, 1, 32-42 (Non-Patent Literature 13)), N-2-chloroacetyl-L-tyrosine cyanomethyl ester (ClAcY-CME, "Macrocyclic peptides exhibit antiviral effects against influenza virus HA and prevent pneumonia in animal models" M. Saito et al., Nat. Commun., 2021, 12, 1, 2654 (Non-Patent Literature 14)) was prepared (prepared by the method disclosed in Japanese Patent Application Publication No. 2008-125396 (Patent Literature 8)).

[0263] Enhanced flexizyme (Table 4, eFx, WO2007 / 066627 (Patent Document 9)) was used as the ARS ribozyme to link Fph-CME, W-CME, or ClAcY-CME with tRNA. For MeA-DBE, dinitrobenzyl flexizyme (Table 4, dFx, WO2007 / 066627 (Patent Document 9)) was used.

[0264] In this process, Fph, W, and ClAcY are assigned to the AUG codon, and MeA to the UGC codon, and Ini-tRNA having CAU in the anticodon portion (Table 4, WO2012 / 026566 (Patent Document 7)), and tRNA having GCA. GCA (Table 4, WO2019 / 077887 (Patent Document 10)) were used respectively.

[0265] For Fph-CME, W-CME, and ClAcY-CME (final concentration: 5 mM), eFx (final concentration: 25 μM), Ini-tRNA (final concentration: 25 μM), HEPES-KOH (final concentration: 100 mM, pH 7.5), and MgCl 2 (Final concentration: 50 mM), DMSO (Final concentration: 20%) was added, and the aminoacylation reaction was carried out at 0°C overnight. For MeA-DBE (Final concentration: 5 mM), dFx (Final concentration: 25 μM), tRNA GCA (Final concentration: 25μM), HEPES-KOH (Final concentration: 100mM, pH 7.5), MgCl 2 (Final concentration: 50 mM) and DMSO (Final concentration: 20%) were added, and the aminoacylation reaction was carried out at 0°C overnight. After aminoacylation, an equal volume of 3 M NaOAc (pH 5.2) was added to the sample, and then ethanol precipitation was performed.

[0266] Next, the pellet was redissolved with 0.3 M NaOAc (pH 5.2) and then precipitated again with ethanol. Finally, the pellet was washed once each with 70% ethanol containing 0.1 M NaOAc (pH 5.2) and 70% ethanol. The resulting aminoacyl-tRNA pellet was dissolved in 0.2% acetic acid.

[0267]

[0268] Table 4 shows a list of sequences of the ARS ribozymes and tRNAs used in the examples (SEQ ID NOs: 28-31). Capital letters indicate commonly used abbreviations for each RNA.

[0269] [Example 5: Translation reaction using mRNA-linker conjugate (1)] A translation reaction was carried out using the mRNA-linker conjugate prepared in Example 3.

[0270] The cell-free translation system used for translation was configured as follows.

[0271] 50 mM HEPES-KOH [pH 7.6], 100 mM KOAc, 20 mM creatine phosphate, 12.5 mM Mg(OAc) 2 2 mM guanosine triphosphate (GTP), 2 mM adenosine triphosphate (ATP), 1 mM cytidine triphosphate (CTP), 1 mM uridine triphosphate (UTP), 2 mM spermidine, 1 mM dithiothreitol (DTT), 1.5 mg / mL E. E. coli total tRNA (manufactured by Roche or in-house (final concentration: 1.0 mg / mL), Richard H. Guenther et al., J Chromatogr. 1988 Jul 1:444:79-87 (Non-Patent Document 42), 1.2 μM ribosome, 2.7 μM Initiation factor 1 (IF1), 0.4 μM Initiation factor 2 (IF2), 1.5 μM Initiation factor 3 (IF3), 0.25 μM Termination factor 2 (RF2), 0.17 μM Termination factor 3 (RF3), 0.5 μM Ribosome termination factor (RRF), 10 μM Elongation factor thermal instability (EF-Tu), 10 μM Elongation factor thermostability (EF-Ts), 0.26 μM Elongation factor G (EF-G), 5 μM Elongation factor P (EF-P), 0.6 μM; Methionine transformylase, 4 μg / mL; Creatine kinase (Roche), 3 μg / mL; Myokinase (Sigma), 0.1 μM; Pyrophosphatase, 0.1 μM; Nucleotide-diphosphatase kinase.

[0272] These include a conjugate of a model sequence mRNA encoding a fluorescent model peptide containing the fluorothane structure prepared in Example 3 and linker 2 or 3 (final concentration: 1 μM), and two types of aminoacyl-tRNA (final concentration: 10 μM Fph-Ini tRNA, 10 μM MeA-tRNA). GCA ), 15 types of amino acids (final concentration: 0.2 mM Ala, Arg, Asn, Gly, His, Ile, Leu, Phe, Pro, Ser, Thr, Trp, Val, Asp, Tyr) and 15 types of aminoacyl-tRNA synthetases (final concentration: 0.73 μM AlaRS, 0.03 μM ArgRS, 0.38 μM AsnRS, 0.09 μM GlyRS, 0.02 μM HisRS, 0.4 μM IleRS, 0.04 μM LeuRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.09 μM ThrRS, 0.03 μM TrpRS, 0.02 μM ValRS (0.13 μM), AspRS (0.02 μM), and TyrRS were added, and the translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, ethylenediaminetetraacetic acid (EDTA, final concentration: 12.5 mM) was added, and the mixture was left to stand on an ice bath for 10 minutes to denature the ribosomes.

[0273] Next, a second translation reaction was performed to conduct artificial recycling translation. Mg(OAc) 2 (Final concentration: 12.5 mM), Translation-related solution (Final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM Creatine phosphate, 47.0 mM Potassium acetate, 0.94 mM Spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, Aminoacyl-tRNA (Final concentration: 10 μM Fph-Ini tRNA, 10 μM MeA-tRNA) GCA ) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0274] Equal volumes of Novex® Tricin SDS Sample Buffer (2x, Thermo) were added to the post-translational reaction mixture, and the samples were separated by 16% tricine-modified polyacrylamide electrophoresis (1x Novex® Tricin SDS Running Buffer). The resulting gels were then fluorescence-imaged using PharosFX (Biorad) (excitation: fluoroceine or Cy5 mode, filter: fluoroceine or Cy5).

[0275] The results obtained are shown in Figure 5. Figure 5a shows the image obtained when fluorescence from Cy5 was detected, and Figure 5b shows the image obtained when fluorescence from fluorothane was detected. Linker 2 is a linker with its 5' end labeled with Cy5, and when it binds to a fluorescent model peptide containing a fluorothane structure, the fluorescence bands from Cy5 and fluorothane overlap. When the conjugate of mRNA and linker 2 was translated under conditions containing the amino acids necessary for translation, a fluorescence band overlapping between Cy5 and fluorothane was obtained at the higher molecular weight side of the conjugate. From the above results, it was shown that by using a fluorothane-labeled peptide, the binding of the peptide to the linker can be confirmed by molecular weight shift.

[0276] When the mRNA-linker 3 conjugate was translated, a fluorescent band was obtained only under conditions containing the amino acids necessary for translation. Furthermore, the obtained fluorothane-derived fluorescent band was located on the higher molecular weight side relative to linker 2, suggesting that this fluorescent band originates from the mRNA-linker 3-peptide conjugate. Additionally, when translation was performed using the mRNA-linker 3 conjugate, two peptide-derived fluorescent bands were obtained, which is thought to be due to molecular weight differences resulting from the difference in the number of peptides bound to the end of linker 3.

[0277] Furthermore, by using a divalent linker (linker 3), two fluorescence bands are obtained even without artificial recycling translation. However, when artificial recycling translation is performed, the fluorescence intensity of the higher molecular weight band is enhanced. This is thought to be because, in addition to the linker to which one peptide was bound during the first translation, another peptide is added, causing an increase in the fluorescence intensity of that band.

[0278] These results demonstrate that by translating mRNA-linker conjugates in a cell-free translation system, mRNA-linker-peptide conjugates with multiple peptides attached can be obtained, and that by performing artificial recycling translation, mRNA-linker-peptide conjugates can be efficiently presented.

[0279] [Example 6: Translation reaction using mRNA-linker conjugates (2)] As mRNA-linker conjugates, linkers 2 and 3 were hybridized to model sequence mRNA encoding a fluorescent model peptide containing a fluorothane structure. Artificial recycling translation was performed under the same conditions as in Example 5, and finally, EDTA (final concentration: 5 mM) was added to stop the translation reaction.

[0280] In this example, in order to improve the resolution in electrophoresis, nuclease treatment was performed in addition to the procedure in Example 5. Specifically, RNase H (NEB, 2.5 units) and RNase T1 (Thermo, 200 units) were added to the translation solution, and nuclease treatment was performed at 37°C for 2 hours. After nuclease treatment, tricine-modified polyacrylamide electrophoresis and fluorescence imaging were performed under the same conditions as in Example 5.

[0281] The results obtained are shown in Figure 6. Figures 6a and 6c are images obtained when fluorescence derived from fluorothane was detected. In mRNA-linker conjugates that underwent artificial recycling translation using a bivalent linker (linker 3), nuclease treatment resulted in two distinct fluorescent bands compared to before treatment (Figure 6a). On the other hand, in mRNA-linker conjugates that underwent artificial recycling translation using a monovalent linker (linker 2), even when fractionation ability was improved by nuclease treatment, there was only one fluorescent band derived from the peptide (Figure 6c). This indicates that multiple peptides are linked in mRNA-linker conjugates that underwent artificial recycling translation using a bivalent linker (linker 3).

[0282] Furthermore, artificial recycling translation enhanced the fluorescence band intensity derived from the peptide (Figure 6b, d), demonstrating that repeating the translation reaction can increase the proportion of mRNA-linker conjugates that form covalent bonds with the peptide.

[0283] [Example 7: Translation reaction using mRNA-linker conjugates (3)] As mRNA-linker conjugates, mRNA-linker conjugates were obtained by hybridizing linkers 2 and 3, respectively, to a model sequence mRNA encoding a fluorescent model peptide containing a fluorothane structure, and artificial recycling translation was performed under the same conditions as in Example 5. In this example, in addition to the procedure in Example 5, a reverse transcription treatment was performed in the reaction solution containing the translation product.

[0284] Specifically, the reaction solution containing the translation product obtained above is mixed with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 2 1 mM DTT, 0.3 mM deoxynucleotide triphosphosphate (dNTPs), 5 units / μL MLV reverse transcriptase, and 3 μM TGG-ssG4S2.R23RT (SEQ ID NO: 9) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes. After reverse transcription, tricine-modified polyacrylamide electrophoresis and fluorescence imaging were performed under the same conditions as in Example 5.

[0285] The results obtained are shown in Figure 7. Figure 7 is an image obtained when fluorescence derived from fluorothane was detected. When TGG-ssG4S2.R23RT hybridized with the mRNA-linker 2-peptide conjugate, the fluorescence band derived from the conjugate shifted to the higher molecular weight side. Furthermore, the mRNA-linker-peptide conjugate hybridized with TGG-ssG4S2.R23RT shifted even further to the higher molecular weight side after the reverse transcription reaction.

[0286] Unlike linker 2, multiple fluorescent bands were observed in the mRNA-linker 3-peptide conjugate. This indicates that multiple peptides can be linked in the bivalent linker, enabling reverse transcription.

[0287] [Example 8: Translation reaction using mRNA-linker conjugates (4)] As mRNA-linker conjugates, mRNA-linker conjugates were used, in which linkers 2, 3, 4, 5, and 6 were hybridized to model sequence mRNA encoding a fluorescent model peptide containing a fluorothane structure, respectively. Artificial recycling translation was performed under the same conditions as in Example 6.

[0288] The results obtained are shown in Figure 8. Figure 8 is a merged image obtained when fluorescence derived from Cy5 and fluorothane was detected, respectively. In mRNA-linker conjugates using a monovalent linker (linker 2), there was only one fluorescence band derived from the peptide. In contrast, mRNA-linker conjugates using linkers 3, 4, 5, and 6, which each contain two puromycin molecules, all yielded two fluorescence bands derived from the peptide. From the above, it was shown that even if the linker lengths between the puromycin molecules differ in various ways, a bivalent linker can produce mRNA-linker-peptide conjugates with multiple peptides linked together.

[0289] [Example 9: Translation reaction using mRNA-linker conjugate (5)] Example 9-1 Specific cleavage of linker 12 by RNaseT1 Linker 4 and linker 12 were treated with enzymes in RNaseT1 solution (200 U RNaseT1 (Thermo), 50 mM Tris-HCl (pH 7.5), 2 mM EDTA) at 37°C overnight. After enzyme treatment, the samples were subjected to denatured urea polyacrylamide electrophoresis and SYBR Green II staining, followed by fluorescence imaging using PhalosFX (Biorad).

[0290] The results obtained are shown in Figure 9a. Linker 4, which does not have a guanine-based deoxynucleotide, showed no change in the position of the fluorescent band even after enzymatic treatment. On the other hand, linker 12, which was modified with a guanine-based deoxynucleotide immediately before the branching point, showed a shift in the fluorescent band to the low molecular weight side after enzymatic treatment. This indicates that specific cleavage is possible by performing such modification.

[0291] Example 9-2 Analysis of display peptides using Tricin PAGE As the mRNA-linker conjugate, linker 12 was hybridized to a model sequence mRNA encoding a fluorescent model peptide containing a fluorescein structure. Artificial recycling translation was performed under the same conditions as in Example 5, and finally, EDTA (final concentration: 5 mM) was added to stop the translation reaction.

[0292] In this example, in order to improve the resolution in electrophoresis, nuclease treatment was performed in addition to the procedure in Example 5. Specifically, RNase T1 (Thermo, 200 units) was added to the translation solution, and nuclease treatment was performed at 37°C for 2 hours. After nuclease treatment, tricine-modified polyacrylamide electrophoresis and fluorescence imaging were performed under the same conditions as in Example 5.

[0293] The results obtained are shown in Figure 9b. Figure 9b is an image obtained by detecting and superimposing fluorescence derived from Cy5 and fluorothane. In mRNA-linker conjugates that underwent artificial recycling translation using a bivalent linker (linker 12), nuclease treatment resulted in two distinctly separated fluorescence bands compared to before treatment (Figure 9b). On the other hand, in mRNA-linker conjugates that underwent artificial recycling translation using a monovalent linker (linker 2), even when fractionation ability was improved by nuclease treatment, there was only one fluorescence band derived from the peptide (Figure 9b). This indicates that multiple peptides are linked in mRNA-linker conjugates that underwent artificial recycling translation using a bivalent linker (linker 12).

[0294] [Example 10: Display assay using mRNA-linker-peptide conjugate with Strep-tagII as a model peptide] A display assay was performed to evaluate the recovery rate associated with binding to streptavidin using an mRNA-linker-peptide conjugate with Strep-tagII as a model peptide.

[0295] The following experiments were performed using mRNA-linker conjugates obtained by hybridizing the mRNA encoding Strep-tagII, prepared in Example 3, with linker 1 or linkers 3-6.

[0296] Compared to the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentrations: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM) were added. TrpRS was added, and the translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to samples that were not subjected to artificial recycling translation to a final concentration of 16.7 mM, and to samples that were subjected to artificial recycling translation to a final concentration of 12.5 mM. The samples were then left to stand on an ice bath for 10 minutes to denature the ribosomes.

[0297] Furthermore, a second translation reaction was performed on the samples used for artificial recycling translation.

[0298] To the reaction solution after the first translation reaction described above, Mg(OAc) 2 (Final concentration: 12.5 mM), translation-related solution (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0299] Next, the reaction solution containing the translation product obtained in the above reaction is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 21 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM RT_Strep-tag II (SEQ ID NO: 14) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0300] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and HEPES (final concentration: 53.4 mM) were added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0301] After desalting, magnetic beads immobilized with streptavidin as the target protein (final concentration: 1 mg / mL, Dynabeads® M-280 streptavidin, Thermo) were added, and the binding reaction was carried out at 4°C for 1 hour. At the same time, as a negative control, the desalted sample was added to magnetic beads immobilized with Protein G (final concentration: 1 mg / mL, Dynabeads® Protein G for Immunoprecipitation, Thermo), and the binding reaction was carried out by mixing at 4°C for 1 hour. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. Furthermore, the aforementioned magnetic separation, supernatant removal, resuspension with HBS-T, and mixing at 4°C for 5 minutes were performed a total of two times. Finally, after magnetic separation and supernatant removal, the mixture was resuspended using PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (2 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.

[0302] The amount of DNA in the solution before adding the target protein after desalting, and the amount of DNA recovered from the magnetic beads, were quantified using real-time PCR. Real-time PCR was performed using LightCycle 96 (Roche Applied Science), with Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTPs (final concentration: 0.25 mM), and MgCl added to the aforementioned PCR solution. 2 The reaction solution, to which (final concentration: 2 mM), T7g 10M, F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO: 10) (0.25 μM), and the sample solution was added was subjected to measurement.

[0303] Figure 10 shows the results of three trials of the display assay. Here, the recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins, respectively, using a bivalent linker (linker 3) significantly enhanced the DNA recovery rate derived from binding to the target protein compared to a monovalent linker (linker 1). Furthermore, the enhancement of the recovery rate was also confirmed in artificial recycling translation (Figure 10a). In addition, when comparing bivalent linkers with different branching chain lengths (linkers 3-6), the recovery rate showed different enhancement rates depending on the type of linker branching chain length (Figure 10b). From these results, it was considered that the binding ability to the target protein was improved by the avidity effect derived from multiple peptides linked to the linker.

[0304] [Example 11: Display assay using mRNA-linker-peptide conjugate with Fc binder as a model peptide] Example 11-1 Biotinylated recombinant human IgG1 Fc protein (final concentration: 29 μM, 110-HG, R&D Systems) and EZ-Link NHS-PEG4-Biotin (final concentration: 290 μM, Thermo) were reacted in 1x phosphorate buffer saline (PBS) at 4°C overnight. After the reaction, the mixture was purified using Bio-Gel P30 Gel (Biorad) substituted with 1x PBS.

[0305] Example 11-2 Immobilization of biotinylated Fc onto magnetic beads The biotinylated Fc (2.8 μM) prepared as described above and magnetic beads (final concentration: 31 mg / mL, Dynabeads® M-280 streptavidin, Thermo) were mixed at 4°C for 20 minutes. After mixing, the magnetic beads were magnetically separated and the supernatant was removed, followed by resuspension with HBS-T. Furthermore, the above magnetic separation, supernatant removal, and resuspension with HBS-T were repeated a total of two times. Finally, after magnetic separation and supernatant removal, the mixture was resuspended using HBS-T (final concentration: 10 mg / mL).

[0306] Example 11-3 Display assay using mRNA-linker-peptide conjugates with Fc binder as a model peptide The following experiment was performed using mRNA-linker conjugates prepared in Example 3, in which linker 1 or linker 3 was hybridized to mRNA encoding Fc binder.

[0307] Compared to the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), 15 amino acids (0.2 mM Leu, Met, Val, Ser, Pro, Thr, Ala, Tyr, His, Lys, Asp, Glu, Cys, Trp, Gly), and 15 aminoacyl-tRNA synthetases (0.04 μM LeuRS, 0.03 μM MetRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.09 μM ThrRS, 0.73 μM AlaRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.11 μM LysRS, 0.13 μM) were added. AspRS (0.23 μM), GluRS (0.02 μM), CysRS (0.03 μM), TrpRS (0.09 μM), GlyRS (0.09 μM) were added to adjust to the final concentration as indicated, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to the samples that were not subjected to artificial recycling translation to a final concentration of 16.7 mM, and to the samples that were subjected to artificial recycling translation to a final concentration of 12.5 mM. The samples were then left to stand on an ice bath for 10 minutes to denature the ribosomes.

[0308] Furthermore, a second translation reaction was performed on the samples used for artificial recycling translation.

[0309] To the reaction solution after the first translation reaction described above, Mg(OAc) 2 (Final concentration: 12.5 mM), translation-related solution (Final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT), and ribosomes (Final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (Final concentration: 16.7 mM) was added to stop the translation reaction.

[0310] Next, the reaction solution containing the translation product obtained as described above is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl).2 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM RT_Fc binder (SEQ ID NO: 17) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0311] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and oxidized glutathione (final concentration: 1 mM, Nacalai Co.) were added, and the reaction was carried out at 37°C for 1 hour.

[0312] For the above samples, HEPES (final concentration: 53.4 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column that had been replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0313] The desalted sample was mixed with either Fc-immobilized magnetic beads (final concentration: 6.2 mg / mL) or non-immobilized Fc magnetic beads (final concentration: 6.2 mg / mL, Dynabeads® M-280 streptavidin, Thermo), and the mixture was stirred at 4°C for 1 hour to allow the binding reaction to occur. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (1.5 mg / mL), transferred to a new sample tube, and stirred at 4°C for 5 minutes. Furthermore, the above process of magnetic separation, supernatant removal, resuspending with HBS-T, and stirring at 4°C for 5 minutes was repeated a total of two times. Finally, after magnetic separation and removal of the supernatant, the solution was resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (12.4 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.

[0314] The amount of DNA in the solution before adding the target protein after desalting, and the amount of DNA recovered from the magnetic beads, were quantified using real-time PCR. Real-time PCR was performed using LightCycle 96 (Roche Applied Science), with Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTPs (final concentration: 0.25 mM), and MgCl added to the aforementioned PCR solution. 2 The reaction solution, to which T7g 10M, F52 (0.25 μM), RV_Fc binder (SEQ ID NO: 13) (0.25 μM), and the sample solution was added was subjected to measurement.

[0315] Figure 11 shows the results of three trials of the display assay. Here, the recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the recovery rate evaluation using Fc binder and Fc as model peptides and model target proteins, DNA was recovered in high yield only when a bivalent linker (linker 3) was used, indicating that a high recovery rate could be obtained by using the target bivalent linker. Furthermore, when artificial recycling translation was performed, a higher recovery rate was obtained compared to when it was not performed, suggesting that artificial recycling translation is effective in recovering conjugates bound to the target in high yield. From these results, it was considered that the binding ability to the target protein was improved by the avidity effect derived from the multiple peptides linked to the linker.

[0316] [Example 12: Display assay using mRNA-linker-peptide conjugate with HA binder as a model peptide] Example 12-1 Immobilization of HA onto magnetic beads Influenza A H5N1 (A / Indonesia / 5 / 2005) hemagglutinin / HA protein-HIS-tag (final concentration: 4.5 μM, 11060-V08B, Shino Biological) and magnetic beads (final concentration: 4 mg / mL, Dynabeads® His-tag Isolation and Pulldown, Thermo) were mixed at 4°C for 20 minutes. After mixing, the magnetic beads were magnetically separated and the supernatant was removed, followed by resuspension with HBS-T. Furthermore, the above magnetic separation, supernatant removal, and resuspension with HBS-T were repeated a total of two times. Finally, after magnetic separation and removal of the supernatant, the suspension was resuspended using HBS-T (final concentration: 10 mg / mL).

[0317] Example 12-2 Display assay using mRNA-linker-peptide conjugates with HA binder as a model peptide The following experiment was performed using mRNA-linker conjugates prepared in Example 3, in which linker 1 or linker 3 was separately hybridized to mRNA encoding HA binder.

[0318] Compared to the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), one aminoacyl-tRNA (10 μM ClAcY Ini-tRNA), 13 amino acids (final concentrations: 0.2 mM Phe, Leu, Val, Ser, Thr, Ala, Tyr, His, Asn, Lys, Cys, Trp, Gly), and 12 aminoacyl-tRNA synthetases (0.68 μM PheRS, 0.04 μM LeuRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.09 μM ThrRS, 0.73 μM AlaRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM) were added. AsnRS (0.11 μM), LysRS (0.02 μM), CysRS (0.03 μM), TrpRS (0.09 μM), GlyRS (0.09 μM) were added to adjust the final concentration to the stated value, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to samples that were not subjected to artificial recycling translation to a final concentration of 16.7 mM, and to samples that were subjected to artificial recycling translation to a final concentration of 12.5 mM. The samples were then left to stand on an ice bath for 10 minutes to denature the ribosomes.

[0319] Furthermore, to the reaction solution after the first translation reaction described above, Mg(OAc) 2 (Final concentration: 12.5 mM), translation-related solution (Final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT), aminoacyl-tRNA (Final concentration: 10 μM ClAcY Ini-tRNA) and ribosomes (Final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (Final concentration: 16.7 mM) was added to stop the translation reaction.

[0320] Next, the reaction solution containing the obtained translation product is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 21 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM RT_HA binder (SEQ ID NO: 16) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0321] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and HEPES (final concentration: 53.4 mM) were added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0322] The desalted sample was mixed with HA-immobilized magnetic beads (final concentration: 4 mg / mL) or HA-unimmobilized magnetic beads (final concentration: 4 mg / mL, Dynabeads® His-tag Isolation and Pulldown, Thermo), and the mixture was stirred at 4°C for 1 hour to allow the binding reaction to occur. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (2 mg / mL), transferred to a new sample tube, and stirred at 4°C for 5 minutes. Furthermore, the above magnetic separation, supernatant removal, resuspending with HBS-T, and stirring at 4°C for 5 minutes was repeated a total of two times. Finally, after magnetic separation and removal of the supernatant, the mixture was resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (8 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.

[0323] The amount of DNA in the solution before adding the target protein after desalting, and the amount of DNA recovered from the magnetic beads, were quantified using real-time PCR. Real-time PCR was performed using LightCycle 96 (Roche Applied Science), with Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTPs (final concentration: 0.25 mM), and MgCl added to the aforementioned PCR solution. 2The reaction solution, to which T7g 10M, F52 (0.25 μM), RV_HA binder (SEQ ID NO: 12) (0.25 μM), and the sample solution was added was subjected to measurement.

[0324] Figure 12 shows the results of three trials of the display assay. Here, recovery (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the binding ability evaluation using HA binder and HA as model peptides and model target proteins, using a bivalent linker (linker 3) resulted in an enhanced recovery rate of DNA derived from binding to the target protein compared to a monovalent linker (linker 1). Using the target linker resulted in high-yield recovery of mRNA-linker-peptide conjugates bound to the target protein. Furthermore, the recovery rate was enhanced by performing artificial recycling translation, demonstrating that artificial recycling translation enables highly efficient recovery of mRNA-linker-peptide conjugates bound to the target. From these results, it was considered that the binding ability to the target protein was improved by the avidity effect derived from the multiple peptides linked to the linker.

[0325] [Example 13: Display assay using mRNA-linker-peptide conjugate with FcRn binder as a model peptide] Example 13-1 Preparation of FcRn-immobilized beads Magnetic beads (final concentration: 9.3 mg / mL, Dynabeads® M-280 streptavidin, Thermo) and biotinylated FcRn (0.7 μM, FCM-H82W7, ACRObiosissystems) were mixed at 4°C for 20 minutes. The magnetic beads after mixing were magnetically separated, the supernatant was removed, and the mixture was resuspended with HBS-T. Furthermore, the above magnetic separation, supernatant removal, and resuspending with HBS-T were repeated a total of two times. Finally, after magnetic separation and supernatant removal, the mixture was resuspended using HBS-T (final concentration: 10 mg / mL).

[0326] Example 13-2 Display assay using mRNA-linker-peptide conjugates with FcRn binder as a model peptide The following experiment was performed using mRNA-linker conjugates prepared in Example 3, in which linker 1 or linkers 3-6 were separately hybridized to mRNA encoding FcRn binder.

[0327] Compared to the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), 12 amino acids (0.2 mM Phe, Leu, Met, Ser, Pro, Thr, Tyr, His, Asn, Cys, Arg, Gly), and 12 aminoacyl-tRNA synthetases (0.68 μM PheRS, 0.04 μM LeuRS, 0.03 μM MetRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.09 μM ThrRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.02 μM CysRS, 0.03 μM ArgRS, 0.09 μM) were added. GlyRS was added and adjusted to the final concentration as indicated, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to a final concentration of 12.5 mM, and the mixture was left to stand on an ice bath for 10 minutes to denature the ribosomes. Furthermore, Mg(OAc) was added to the reaction solution from the first translation reaction described above. 2 (Final concentration: 12.5 mM), translation-related solution (Final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT), and ribosomes (Final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (Final concentration: 16.7 mM) was added to stop the translation reaction.

[0328] Next, the reaction solution containing the obtained translation product is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 21 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM RT_FcRn binder (SEQ ID NO: 15) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0329] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and oxidized glutathione (final concentration: 1 mM, Nacalai Co.) were added, and the reaction was carried out at 37°C for 1 hour.

[0330] For the above samples, HEPES (final concentration: 53.4 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0331] The desalted sample was mixed with FcRn-immobilized magnetic beads (final concentration: 3.2 mg / mL) and mixed at 4°C for 1 hour to allow the binding reaction to occur. After the binding reaction, the magnetic beads were magnetically separated and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (1.6 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. Furthermore, the above magnetic separation, supernatant removal, resuspension with HBS-T, and mixing at 4°C for 5 minutes were repeated a total of two times. Finally, after magnetic separation and supernatant removal, the sample was resuspended using PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (3.2 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.

[0332] The amount of DNA in the solution before adding the target protein after desalting, and the amount of DNA recovered from the magnetic beads, were quantified using real-time PCR. Real-time PCR was performed using LightCycle 96 (Roche Applied Science), with Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTPs (final concentration: 0.25 mM), and MgCl added to the aforementioned PCR solution. 2The reaction solution, to which (final concentration: 2 mM), T7g 10M, F52 (0.25 μM), RV_FcRn binder (SEQ ID NO: 11) (0.25 μM), and the sample solution to be measured was added, was subjected to measurement.

[0333] Figure 13 shows the results of three trials of the display assay. Here, recovery (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the evaluation of binding ability using FcRn binder and FcRn as model peptides and model target proteins, the recovery rate of DNA derived from binding to the target protein was enhanced for all bivalent linkers (linkers 3-6) compared to the monovalent linker (linker 1), indicating that using the target linker improved the recovery rate of mRNA-linker-peptide conjugates bound to the target protein. Furthermore, the recovery rate was higher as the branching chain length of the linker shortened, demonstrating that selecting an appropriate linker branching chain length improves the recovery rate of mRNA-linker-peptide conjugates bound to the target protein. This was thought to be due to the improved binding ability to the target protein caused by the avidity effect derived from the multiple peptides linked to the linker.

[0334] [Example 14: Screening of target-binding peptides using a randomized peptide library] Example 14-1 Preparation of aminoacyl-tRNA The aminoacyl-tRNA to be used in the translation reaction in a cell-free translation system was prepared as follows.

[0335] For aminoacylation of tRNA by acylation catalyst RNA (ARS ribozyme), the following amino acid activated esters are used: (2,6-dichloropyridine-4-yl)methylmethyl-L-alaninate hydrochloride (MeA-DCPE), (2,6-dichloropyridine-4-yl)methyl-L-cysteinate hydrochloride (Cys-DCPE), 2,2,2-trifluoroethylmethyl-L-phenylalaninate hydrochloride (MeF-TEE), (2,6-dichloropyridine-4-yl)methyl N-methylglycinate hydrochloride (MeG-DCPE), 2,2,2-trifluoroethyl(2-chloroacetyl)-L-phenylalaninate (ClAc-F-TEE), (2,6-dichloropyridine-4-yl)methyl(S)-2-(methylamino)hexanoate hydrochloride (MeNle-DCPE), and 2,2,2-trifluoroethyl L-tryptophanate hydrochloride (Trp-TEE) was prepared (by the method disclosed in WO2023 / 234425 (Patent Document 11)).

[0336] Enhanced flexizyme (Table 4, eFx, WO2007 / 066627 (Patent Document 9)) was used as the ARS ribozyme to link MeF-TEE, ClAc-F-TEE, and Trp-TEE with tRNA. For MeA-DCPE, Cys-DCPE, MeG-DCPE, and MeNle-DCPE, dinitrobenzyl flexizyme (Table 4, dFx, WO2007 / 066627 (Patent Document 9)) was used.

[0337] In this process, ClAc-F is assigned to the AUG codon, MeA to the GCC codon, Cys to the TGG codon, MeF to the UUC codon, MeG to the AUC codon, MeNle to the ACC codon, and Trp to the TGC codon. Therefore, Ini-tRNAs having CAU in the anticodon portion (Table 4, WO2012 / 026566 (Patent Document 7)) and tRNAs having GGC are used. GGC tRNA having CCA CCA tRNA having GAA GAA tRNA having GAU GAU tRNA containing GGU GGU tRNA having GCA GCA(Table 4, WO2019 / 077887 (Patent Document 10)) were used respectively.

[0338] For ClAc-F-TEE (final concentration: 5 mM), the corresponding ARS ribozyme (final concentration: 25 μM), Ini-tRNA (final concentration: 25 μM), bicinene (final concentration: 50 mM, pH 9.0), and MgCl 2 (Final concentration: 50 mM), DMSO (Final concentration: 20%) was added, and the aminoacylation reaction was carried out at 0°C overnight. For Cys-DCPE (Final concentration: 5 mM), the corresponding ARS ribozyme (Final concentration: 25 μM), the corresponding tRNA (Final concentration: 25 μM), HEPES-KOH (Final concentration: 50 mM, pH 7.5), and MgCl were added. 2 (Final concentration: 20 mM), DMSO (Final concentration: 20%), and DTT (Final concentration: 5 mM) were added, and the aminoacylation reaction was carried out at 0°C overnight. For other amino acid activated esters (Final concentration: 5 mM), the corresponding ARS ribozyme (Final concentration: 25 μM), the corresponding tRNA (Final concentration: 25 μM), HEPES-KOH (Final concentration: 50 mM, pH 7.5), and MgCl were added. 2 (Final concentration: 50 mM) and DMSO (Final concentration: 20%) were added, and the aminoacylation reaction was carried out at 0°C overnight. After aminoacylation, an equal volume of 3 M NaOAc (pH 5.2) was added to the sample, and then ethanol precipitation was performed.

[0339] Next, the pellet was redissolved with 0.3 M NaOAc (pH 5.2) and then precipitated again with ethanol. Finally, the pellet was washed once each with 70% ethanol containing 0.1 M NaOAc (pH 5.2) and 70% ethanol. The resulting aminoacyl-tRNA pellet was dissolved in 0.2% acetic acid.

[0340] Table 4 shows a list of sequences of the ARS ribozymes and tRNAs used in the examples (SEQ ID NOs: 28-31, 53-59, 64). Capital letters indicate commonly used abbreviations for each RNA.

[0341] Example 14-2 Construction of mRNA-linker-peptide conjugate library Using mRNA-linker conjugates prepared in Example 3, in which linker 1 or linker 4 was separately hybridized to mRNA G containing a random region, the following experiments were performed.

[0342] To the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), seven aminoacyl-tRNAs (final concentration: 10 μM), ClAc-F Ini-tRNA, MeF tRNA, etc. were added. GAA MeG tRNA GAU , MeNle tRNA GGU MeA tRNA GGC , W tRNA GCA , C tRNA CCA ), 10 types of amino acids (final concentration 0.2 mM Leu, Val, Ser, Pro, Tyr, His, Asn, Asp, Arg, Gly) and 10 types of aminoacyl-tRNA synthetases (final concentration 0.04 μM LeuRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.13 μM AspRS, 0.03 μM ArgRS, 0.09 μM GlyRS), Mg (OAc) 2 (Final concentration: 1 mM) was added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to a final concentration of 12.5 mM, and the mixture was left to stand on an ice bath for 10 minutes to denature the ribosomes.

[0343] Furthermore, to the reaction solution after the first translation reaction described above, Mg(OAc) 2 (Final concentration: 13.5 mM), Translation-related solution (Final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT), Aminoacyl-tRNA (Final concentration 10 μM ClAc-F Ini-tRNA, MeF tRNA) GAAMeG tRNA GAU , MeNle tRNA GGU MeA tRNA GGC , W tRNA GCA , C tRNA CCA ) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0344] Next, the reaction solution containing the translation product obtained above is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 2 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM TGG-ssG4S2.R23RT (SEQ ID NO: 9) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0345] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0346] Example 14-3 Selection of target-binding peptides using an mRNA-linker-peptide conjugate library The desalted sample obtained in step 2 above was mixed with recombinant human IgG1 Fc protein (final concentration: 250 nM, 110-HG, R&D Systems) and magnetic beads (final concentration: 3 mg / mL, Dynabeads® Protein G, Thermo), and the mixture was stirred at 4°C for 60 minutes to allow the binding reaction to occur. After the binding reaction, magnetic separation was performed and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (1.5 mg / mL), transferred to a new sample tube, and stirred at 4°C for 1 minute. Furthermore, the above magnetic separation, supernatant removal, resuspending with HBS-T, and stirring at 4°C for 1 minute was repeated a total of two times. Finally, after magnetic separation and supernatant removal, PCR mix solution (10mM Tris-HCl (pH 8.5), 50mM KCl, 0.1% Triton X-100, dNTP (final concentration: 0.25mM), MgCl2 The solution was resuspended using (final concentration: 2 mM), T7g 10M, F52 (0.25 μM), TGG-ssG4S2, and R44 (SEQ ID NO: 8) (0.25 μM) (3.0 mg / mL), and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was collected. From this point onward, the above process is referred to as positive selection.

[0347] The amount of DNA in the solution before the addition of the target protein after desalting, and the amount of DNA after recovery from magnetic beads (positive selection), were quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used as the real-time PCR analyzer. The reaction solution prepared by adding Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), and the sample solution to the aforementioned PCR mix solution was used for measurement. Furthermore, DNA recovered from the magnetic beads was amplified by PCR (T100 thermal cycler, BioRad, 94°C 60 seconds, {94°C 40 seconds, 61°C 40 seconds, 72°C 40 seconds}) based on the Threhold Cycle (Cq value) obtained from the real-time PCR method. The reaction product was purified using AMPre XP (Beckman Coulter). From the purified DNA, mRNA was synthesized by a transcription reaction using T7 RNA polymerase, and the resulting reaction product was purified using RNAClean XP (Beckman Coulter). After purification, the mRNA concentration was determined from the UV absorption at 260 nm and diluted to 20 μM.

[0348] Using the mRNA obtained above, a peptide library was constructed using the same method as in Example 13-2. The desalted sample was mixed with magnetic beads (final concentration: 3 mg / mL, Dynabeads® Protein G, Thermo), and the mixture was heated at 4°C for 10 minutes to allow the binding reaction to occur. After the binding reaction, the magnetic beads were removed by magnetic separation. The above mixing with magnetic beads and removal of magnetic beads by magnetic separation was performed a total of two times. The process from the construction of the peptide library using mRNA to the removal of magnetic beads was defined as negative selection. The magnetic beads after magnetic separation were resuspended using HBS-T (3.0 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, the supernatant was collected, and this was used as the negative selection sample in real-time PCR.

[0349] The supernatant after magnetic separation was further subjected to the positive selection described above. Specifically, the amount of DNA in the obtained samples was quantified using the real-time PCR method described above. Based on the Threhold Cycle (Cq value) obtained from the real-time PCR method, DNA amplification and mRNA synthesis were performed by PCR only on the samples after positive selection, in the same manner as described above.

[0350] Furthermore, the negative selection, positive selection, real-time PCR, and PCR-based DNA amplification and mRNA synthesis were performed a total of three times.

[0351] The results of the selection process described above are shown in Figure 14. Here, recovery (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the selection of target-binding peptides using Fc as a model target protein, when selection was performed using a monovalent linker (linker 1), no significant difference was obtained between the recovery rate of DNA derived from binding to the target protein (obtained in positive selection) and the recovery rate of DNA derived from nonspecific binding (obtained in negative selection). On the other hand, when selection was performed using a divalent linker (linker 4), the recovery rate of DNA derived from binding to the target protein was significantly higher than the recovery rate of DNA derived from nonspecific binding. This suggests that, in the case of a monovalent linker (linker 1), the binding between the target-binding peptide and the Fc protein was not maintained during the washing operation in the selection process due to its weak binding ability. However, in the case of a divalent linker (linker 4), the avidity effect derived from multiple peptides linked to the linker improved the binding ability to the target protein, and thus the binding between the target-binding peptide and the Fc protein was maintained during the washing operation.

[0352] Example 14-4 Gene sequence analysis by next-generation sequencing (NGS) For each round of DNA, the desired sequence was added by PCR, and then NGS analysis was performed. The specific test method is shown below.

[0353] For the samples after the final round of PCR, in order to add the hybridize and index regions of the forward and reverse primers that initiate sequencing in NGS analysis, 50 μL of the PCR-posted sample (final concentration: 2% (v / v)) and 1st PCR reaction mixture (final concentration: 1× Phusion HF buffer, 200 μM dNTPs, 250 nM forward primer (F70-ID12-07-4 (SEQ ID NO: 46) for selection samples using a monovalent linker, F70-ID12-07-5 (SEQ ID NO: 47) for selection samples using a bivalent linker), 250 nM R38-3UTR-SBS-R (SEQ ID NO: 48), 20 U / mL Phusion DNA polymerase) were prepared and heated using a thermal cycler (T100 thermal cycler, BioRad) at 95°C for 120 seconds, then at 95°C for 20 seconds. The reaction was carried out using a thermal cycler (T100 thermal cycler, BioRad) for 6 cycles of {95°C for 30 seconds, 72°C for 30 seconds}. Next, in order to add hybridization regions to the nucleic acid sequences immobilized on the flow cell for NGS analysis to the PCR-treated sample, 50 μL of the PCR-treated sample (final concentration: 2% (v / v)) and a 2nd PCR reaction solution (final concentration: 1 × Phusion HF buffer, 200 μM dNTPs, 250 nM F63-P5-SBS-F (SEQ ID NO: 49), 250 nM R58-SBSR-P7 (SEQ ID NO: 50), 20 U / mL Phusion DNA polymerase) were prepared, and the reaction was carried out using a thermal cycler (T100 thermal cycler, BioRad) for 95°C for 120 seconds, then 6 cycles of {95°C for 20 seconds, 61°C for 30 seconds, 72°C for 30 seconds}. The reaction product was purified using AMPre XP (Beckman Coulter). Gene sequencing analysis was performed on the purified sample using Miseq® System and Miseq Regent Micro Kit v2.

[0354] Example 14-5: Evaluation of Binding Ability by Display Assay In each NGS analysis of the selection using the monovalent linker and the bivalent linker, the peptide sequences translated from the read gene information were analyzed, and only the sequences in which the fixed sequences of the peptides designed via the gene information and the number of randomized peptides were maintained were extracted. Furthermore, from the extracted peptide sequences, the top 15 sequences in terms of appearance frequency were selected, and mRNA was prepared according to Example 2. After the preparation, for the mRNAs of the top 15 sequences in terms of appearance frequency selected from the selections using the monovalent linker and the bivalent linker, Linker 1 or Linker 4 was hybridized separately, respectively, to prepare mRNA-linker conjugates.

[0355] With respect to the cell-free translation system constructed in Example 5, the above mRNA-linker conjugate (final concentration: 1 μM), seven aminoacyl-tRNAs (final concentration 10 μM ClAc-F Ini-tRNA, MeF tRNA GAA , MeG tRNA GAU , MeNle tRNA GGU , MeA tRNA GGC , W tRNA GCA , C tRNA CCA ), ten types of amino acids (final concentration 0.2 mM Leu, Val, Ser, Pro, Tyr, His, Asn, Asp, Arg, Gly) and ten types of aminoacyl-tRNA synthetases (final concentration 0.04 μM LeuRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.13 μM AspRS, 0.03 μM ArgRS, 0.09 μM GlyRS), Mg(OAc) 2 (final concentration: 1 mM) were added, and a translation reaction was performed at 37 °C for 30 minutes. After the reaction, EDTA was added to a final concentration of 12.5 mM, and the mixture was allowed to stand on an ice bath for 10 minutes to denature the ribosomes.

[0356] Furthermore, with respect to the reaction solution in which the above first translation reaction was performed, Mg(OAc) 2(Final concentration: 13.5 mM), translation-related solution (Final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT), aminoacyl tRNA (Final concentration 10 μM ClAc-F Ini-tRNA, MeF tRNA GAA , MeG tRNA GAU , MeNle tRNA GGU , MeA tRNA GGC , W tRNA GCA , C tRNA CCA ) and ribosome (Final concentration: 1.2 μM) were added, and a translation reaction was carried out at 37 °C for 30 minutes. After the reaction, EDTA (Final concentration: 16.7 mM) was added to stop the translation reaction.

[0357] Next, to the reaction solution containing the translation product obtained above, a reverse transcription reaction solution (Final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl 2 , 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM TGG-ssG4S2.R23RT (SEQ ID NO: 9)) was added, and a reverse transcription reaction was carried out at 42 °C for 30 minutes.

[0358] After the reverse transcription reaction, EDTA (Final concentration: 16.7 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Bio-Rad) desalting column replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0359] The desalted sample was mixed with recombinant human IgG1 Fc protein (final concentration: 250 nM, 110-HG, R&D Systems) and magnetic beads (final concentration: 3 mg / mL, Dynabeads® Protein G, Thermo) or magnetic beads (final concentration: 3 mg / mL, Dynabeads® Protein G, Thermo) alone, and the mixture was stirred at 4°C for 30 minutes to allow the binding reaction to occur. After the binding reaction, magnetic separation was performed and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (1.5 mg / mL) and transferred to a new sample tube. Furthermore, the above magnetic separation, supernatant removal, and resuspension with HBS-T were repeated a total of three times. Finally, after magnetic separation and supernatant removal, the mixture was resuspended using HBS-T (3.0 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.

[0360] The amount of DNA in the solution before the addition of the target protein after desalting, and the amount of DNA after recovery from the magnetic beads, were quantified by real-time PCR. For the real-time PCR measurement procedure, a LightCycler 96 (Roche Applied Science) was used, and the reaction solution prepared by adding Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), and the sample solution to the aforementioned PCR mix solution was subjected to measurement.

[0361] The results of the above display assay are shown in Figure 15. Here, recovery (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the selection of target-binding peptides using Fc as a model target protein, for the top 15 sequences selected using a monovalent linker (linker 1), no significant difference was found between the recovery rate of DNA derived from binding to the target protein and the recovery rate of DNA derived from nonspecific binding, regardless of whether a monovalent or divalent linker was used in the display assay. On the other hand, for the top 15 sequences selected using a divalent linker (linker 4), many sequences showed a significantly higher recovery rate of DNA derived from binding to the target protein compared to the recovery rate of DNA derived from nonspecific binding in the display assay using the divalent linker. This suggests that, in a selection using a randomized peptide library, when a bivalent linker (linker 4) is used, the avidity effect derived from multiple peptides linked to the linker maintains binding to Fc, and sequences with target-binding ability are selected as the most frequently occurring sequences.

[0362] [Example 15: Display assay using mRNA-linker conjugates (covalent)] Example 15-1 Preparation of mRNA-linker conjugates (covalent) by ligation Each mRNA (final concentration: 1.0 μM) prepared from the template DNA of mRNA display format Strip-tag II in Example 2 and linker 7 or linker 8 (final concentration: 1.5 μM) prepared in Example 1 were reacted in a ligation solution (10% DMSO (v / v), 1x ligation buffer (TAKARA), 5 U / μL T4 RNA ligase) at 37°C for 1 hour. After the reaction, NaCl (final concentration: 0.3 M) and EDTA (5 mM) were added to stop the reaction. Then, phenol / chloroform extraction was performed, followed by ethanol precipitation. After drying, the mixture was dissolved in ultrapure water to produce a 5 μM mRNA-linker conjugate (covalent).

[0363] Example 15-2 Display assay using mRNA-linker-peptide conjugate with Strep-tagII as a model peptide Using the mRNA-linker-peptide conjugate (covalent) obtained by the ligation reaction in Example 1 above, the recovery rate associated with binding to streptavidin was evaluated in the display assay described below.

[0364] For the cell-free translation system configured in Example 5, the following were added: mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentration: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM). TrpRS was added, and the translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to the samples to be subjected to artificial recycling translation to a final concentration of 12.5 mM, and the samples were left to stand on an ice bath for 10 minutes to denature the ribosomes.

[0365] To the reaction solution after the first translation reaction described above, Mg(OAc) 2 (Final concentration: 12.5 mM), translation-related solution (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0366] Next, the reaction solution containing the translation product obtained above is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 2 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM RT_Strep-tag II (SEQ ID NO: 14) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0367] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0368] After desalting, magnetic beads immobilized with streptavidin as the target protein (final concentration: 1 mg / mL, Dynabeads® M-280 streptavidin, Thermo) were added, and the binding reaction was carried out at 4°C for 1 hour. At the same time, as a negative control, the desalted sample was added to magnetic beads immobilized with Protein G (final concentration: 1 mg / mL, Dynabeads® Protein G for Immunoprecipitation, Thermo), and the binding reaction was carried out by mixing at 4°C for 1 hour. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. Furthermore, the aforementioned magnetic separation, supernatant removal, resuspension with HBS-T, and mixing at 4°C for 5 minutes were performed a total of two times. Finally, after magnetic separation and supernatant removal, the mixture was resuspended using PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (2 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.

[0369] The amount of DNA in the solution before adding the target protein after desalting, and the amount of DNA recovered from the magnetic beads, were quantified using real-time PCR. Real-time PCR was performed using LightCycle 96 (Roche Applied Science), with Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTPs (final concentration: 0.25 mM), and MgCl added to the aforementioned PCR solution. 2 The reaction solution, to which (final concentration: 2 mM), T7g 10M, F52 (0.25 μM), RV_mRNA display_Strep-tag II (SEQ ID NO: 45) (0.25 μM), and the sample solution to be measured was added, was subjected to measurement.

[0370] Figure 16 shows the results of three trials of the display assay. Here, the recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins, respectively, the use of a bivalent linker (linker 8) significantly enhanced the DNA recovery rate derived from binding to the target protein compared to a monovalent linker (linker 7). Furthermore, the enhancement of the recovery rate was also confirmed in artificial recycling translation. From these results, it was considered that, similar to Example 10, the binding ability to the target protein was improved by the avidity effect derived from the multiple peptides linked to the linker.

[0371] The results from Examples 10 and 15-2 above demonstrate that, regardless of the method of linking mRNA and the linker, the use of a bivalent linker enables the presentation of multiple peptides, and that the avidity effect improves the ability to bind to target proteins.

[0372] [Example 16: Construction of a linker (RAPID linker) in which an amino acid is covalently bonded to the 3'-terminus ribose via an ester bond, and a display assay using the same] Example 16-1 Acylation of the 3' terminus of linkers 9 and 10 by ARS ribozyme 2,2,2-trifluoroethylmethyl-L-phenylalaninate hydrochloride (NMe-Phe-TEE) was prepared as the amino acid activated ester used for aminoacylation of the 3' terminus of linkers 9 and 10 by ARS ribozyme (prepared by the method disclosed in WO2023 / 234425 (Patent Document 11)). eFx was used as the ARS ribozyme to separately link the 3' terminus of linkers 9 and 10 to each amino acid activated ester. For NMe-Phe-TEE (final concentration: 5 mM), eFx (final concentration: 25 μM), linker 9 or linker 10 (final concentration: 25 μM), HEPES-KOH (final concentration: 50 mM, pH 7.5), MgCl 2 (Final concentration: 50 mM), DMSO (Final concentration: 20%) was added, and the aminoacylation reaction was carried out at 0°C overnight. After adding an equal volume of 3 M NaOAc (pH 5.2) to the aminoacylated sample, ethanol precipitation was performed.

[0373] Next, the pellets were redissolved using 0.3 M NaOAc (pH 5.2), and then ethanol precipitation was performed again. Finally, the pellets were washed once each with 70% ethanol containing 0.1 M NaOAc (pH 5.2) and 70% ethanol. The resulting aminoacylated sample pellets were dissolved in 0.2% acetic acid. The aminoacylated sample was dissolved in 2.64 times the volume of loading buffer (final concentration: 41 mM sodium acetate, 23% formamide, 2.7 mM EDTA), and then separated by electrophoresis of a 20% modified polyacrylamide gel (50 mM sodium acetate (pH 5.2), 6 M urea) under acidic conditions (electrophoresis solution: 50 mM sodium acetate (pH 5.2)). The gel after electrophoresis was analyzed by fluorescence staining using SYBR Green II (Invitrogen, SYBRhaMolecular Probes Inc.).

[0374] The results obtained are shown in Figure 17a. Figure 17a is an image obtained when fluorescence originating from SYBR Green I (Invitrogen, SYBRhaMolecular Probes Inc.) was detected. When acylation was performed using a monovalent linker (linker 9), one band appeared that was shifted to the higher molecular weight side compared to the band position before acylation. It is thought that this band shift is obtained because the molecular weight increases when one amino acid is acylated to the linker. When a divalent linker (linker 10) was used, two bands appeared that were shifted to the higher molecular weight side compared to the band position before acylation. It is thought that this is obtained because the molecular weight increases when one or two amino acids are acylated to the divalent linker (linker 10), which has two CCAs at its terminus, which are nucleic acid recognition sites of ARS ribozyme, and these band shifts are obtained in each case.

[0375] Example 16-2 Display assay using mRNA-linker-peptide conjugate with Strep-tagII as a model peptide A display assay was performed to evaluate the recovery rate associated with binding to streptavidin using an mRNA-linker-peptide conjugate with Strep-tagII as a model peptide.

[0376] The mRNA encoding Strep-tagII, prepared in Example 3, was hybridized with linker 9 or linker 10, to which MePhe was acylated in Example 16-1, in a 1 mM sodium acetate solution, and the following experiments were performed.

[0377] For the cell-free translation system constructed in Example 5, the above mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentration: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp) and nine types of aminoacyl-tRNA synthetases (final concentration: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37 °C for 30 minutes (the first translation reaction). After the reaction, for the samples for which artificial recycling translation was to be performed, EDTA was added to a final concentration of 12.5 mM, and the mixture was allowed to stand on an ice bath for 10 minutes to denature the ribosomes.

[0378] For the reaction solution obtained from the above first translation reaction, Mg(OAc) 2 (final concentration: 12.5 mM), a translation-related solution (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA) and ribosomes (final concentration: 1.2 μM) were added, and a translation reaction was carried out at 37 °C for 30 minutes (the second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0379] Next, to the reaction solution containing the translation product obtained above, a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl 2 , 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM RT_Strep-tag II (SEQ ID NO: 14)) was added, and a reverse transcription reaction was carried out at 42 °C for 15 minutes.

[0380] After the reverse transcription reaction, after adding EDTA (final concentration: 16.7 mM), desalting was performed using a Bio-Gel P30 Gel (Bio-Rad) desalting column replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0381] After desalting, magnetic beads immobilized with streptavidin as the target protein (final concentration: 1 mg / mL, Dynabeads™ M-280 Streptavidin, Thermo) were added, and a binding reaction was carried out at 4 °C for 1 hour. At this time, as a negative control, magnetic beads immobilized with Protein G (final concentration: 1 mg / mL, Dynabeads™ Protein G for Immunoprecipitation, Thermo) were added with the desalted sample, and mixed at 4 °C for 1 hour to carry out the binding reaction. After the binding reaction, the magnetic beads were magnetically separated and the supernatant was removed. Next, the magnetic beads were resuspended with HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4 °C for 5 minutes. Furthermore, the above magnetic separation, supernatant removal, resuspension with HBS-T, and mixing at 4 °C for 5 minutes were carried out a total of 2 times. Finally, after magnetic separation and supernatant removal, it was resuspended with a PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (2 mg / mL) and heated at 95 °C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.

[0382] The amount of DNA in the solution before adding the target protein after the above desalting and the amount of DNA recovered from the magnetic beads were quantified by real-time PCR. The real-time PCR measurement procedure used a LightCycler 96 (Roche Applied Science), and Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTP (final concentration: 0.25 mM), MgCl 2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Streptag II (SEQ ID NO: 10) (0.25 μM) and the reaction solution added with the measurement sample solution were used for measurement.

[0383] Figure 18 shows the results of three trials of the above display assay. Here, the recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins, respectively, the use of a bivalent linker (linker 10) significantly enhanced the DNA recovery rate derived from binding to the target protein compared to a monovalent linker (linker 9). Furthermore, the enhancement of the recovery rate was also confirmed in artificial recycling translation. From these results, it was considered that, similar to Example 10, the binding ability to the target protein was improved by the avidity effect derived from the multiple peptides linked to the linker.

[0384] The results from Examples 10, 16-1, and 16-2 confirmed that target substances can be presented even with substances other than puromycin. This suggests that even with substances other than puromycin, if they can covalently bind to the elongating peptidyl, multiple peptides can be presented by using a divalent linker, and the ability to bind to the target protein is improved by the avidity effect.

[0385] [Example 17: Display Assay Using a Trivalent Linker] Example 17-1 Display Assay 1 Using an mRNA-linker-peptide conjugate with Strep-tagII as a Model Peptide A display assay was performed to evaluate the recovery rate associated with binding to streptavidin using an mRNA-linker-peptide conjugate with Strep-tagII as a model peptide.

[0386] The following experiments were performed using mRNA-linker conjugates obtained by hybridizing linker 1 and linker 11 to the mRNA encoding Strep-tagII prepared in Example 3.

[0387] Compared to the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentrations: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM) were added. TrpRS was added, and the translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to samples that did not undergo artificial recycling translation to a final concentration of 16.7 mM, and EDTA was added to samples that underwent a second translation by artificial recycling translation to a final concentration of 12.5 mM. The samples were then left to stand on an ice bath for 10 minutes to denature the ribosomes.

[0388] Furthermore, a second translation reaction was performed on the samples used for artificial recycling translation.

[0389] To the reaction solution after the first translation reaction described above, Mg(OAc) 2(Final concentration: 12.5 mM), Translation-related solution (Final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM Creatine phosphate, 47.0 mM Potassium acetate, 0.94 mM Spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, Aminoacyl-tRNA (Final concentration: 10 μM W) Ini-tRNA and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the reaction, EDTA was added to samples that did not undergo a third translation by artificial recycling translation to a final concentration of 16.7 mM, and to samples that underwent a third translation by artificial recycling translation to a final concentration of 12.5 mM. The samples were then left to stand on an ice bath for 10 minutes to denature the ribosomes. Furthermore, a third translation reaction was performed on the samples undergoing artificial recycling translation.

[0390] To the reaction solution after the second translation reaction described above, Mg(OAc) 2 (Final concentration: 12.5 mM), translation-related solution (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (third translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0391] Next, the reaction solution containing the translation product obtained above is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 21 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM RT_Strep-tag II (SEQ ID NO: 14) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0392] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0393] After desalting, magnetic beads immobilized with streptavidin as the target protein (final concentration: 1 mg / mL, Dynabeads® M-280 streptavidin, Thermo) were added, and the binding reaction was carried out at 4°C for 1 hour. At the same time, as a negative control, the desalted sample was added to magnetic beads immobilized with Protein G (final concentration: 1 mg / mL, Dynabeads® Protein G for Immunoprecipitation, Thermo), and the mixture was mixed at 4°C for 1 hour to carry out the binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 30 minutes. Furthermore, the aforementioned magnetic separation, supernatant removal, resuspension with HBS-T, and mixing at 4°C for 30 minutes were performed a total of two times. Finally, after magnetic separation and supernatant removal, the mixture was resuspended using PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (2 mg / mL), and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was collected.

[0394] The amount of DNA in the solution before adding the target protein after desalting, and the amount of DNA recovered from the magnetic beads, were quantified using real-time PCR. Real-time PCR was performed using LightCycle 96 (Roche Applied Science), with Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTPs (final concentration: 0.25 mM), and MgCl added to the aforementioned PCR solution. 2 The reaction solution, to which (final concentration: 2 mM), T7g 10M, F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO: 10) (0.25 μM), and the sample solution to be measured was added, was subjected to measurement.

[0395] Figure 19 shows the results of three trials of the display assay. Here, the recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the evaluation of binding ability using Strep-tag II and streptavidin as model peptides and model target proteins, respectively, the use of a trivalent linker (linker 11) significantly enhanced the DNA recovery rate derived from binding to the target protein, in a manner dependent on the number of artificial recycling translations, compared to a monovalent linker (linker 1). This is thought to be due to the improved binding ability to the target protein caused by the avidity effect derived from the multiple peptides linked to the linker.

[0396] Example 17-2 Display assay 2 using mRNA-linker-peptide conjugate with Strep-tagII as a model peptide A display assay was performed to evaluate the recovery rate associated with binding to streptavidin using an mRNA-linker-peptide conjugate with Strep-tagII as a model peptide.

[0397] The following experiments were performed using mRNA-linker conjugates obtained by hybridizing linker 1 and linker 15 to the mRNA encoding Strep-tagII prepared in Example 3.

[0398] Compared to the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentrations: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM) were added. TrpRS was added, and the translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to the samples to be subjected to artificial recycling translation to a final concentration of 12.5 mM, and the samples were left to stand on an ice bath for 10 minutes to denature the ribosomes.

[0399] To the reaction solution after the first translation reaction described above, Mg(OAc) 2 (Final concentration: 12.5 mM), translation-related solution (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0400] Next, the reaction solution containing the obtained translation product is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 2 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM RT_Strep-tag II (SEQ ID NO: 14) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0401] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0402] After desalting, magnetic beads immobilized with streptavidin as the target protein (final concentration: 1 mg / mL, Dynabeads® M-280 streptavidin, Thermo) were added, and the binding reaction was carried out at 4°C for 1 hour. At the same time, as a negative control, the desalted sample was added to magnetic beads immobilized with Protein G (final concentration: 1 mg / mL, Dynabeads® Protein G for Immunoprecipitation, Thermo), and the mixture was mixed at 4°C for 1 hour to carry out the binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 30 minutes. Furthermore, the aforementioned magnetic separation, supernatant removal, resuspension with HBS-T, and mixing at 4°C for 30 minutes were performed a total of two times. Finally, after magnetic separation and supernatant removal, the mixture was resuspended using PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (2 mg / mL), and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was collected.

[0403] The amount of DNA in the solution before adding the target protein after desalting, and the amount of DNA recovered from the magnetic beads, were quantified using real-time PCR. Real-time PCR was performed using LightCycle 96 (Roche Applied Science), with Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTPs (final concentration: 0.25 mM), and MgCl added to the aforementioned PCR solution. 2 The reaction solution, to which (final concentration: 2 mM), T7g 10M, F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO: 10) (0.25 μM), and the sample solution to be measured was added, was subjected to measurement.

[0404] Figure 20 shows the results of two trials of the display assay. Here, the recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins, respectively, the recovery rate of DNA derived from binding to the target protein was significantly enhanced by using a trivalent linker (linker 15) compared to a monovalent linker (linker 1). This is thought to be due to the improved binding ability to the target protein caused by the avidity effect derived from the multiple peptides linked to the linker.

[0405] [Example 18: Display assay using mRNA-linker-peptide conjugates with monomeric or tetrameric streptavidin as a model target protein and strep-tag II as a model peptide] Example 18-1 Immobilization of monomeric or tetrameric streptavidin onto magnetic beads Dynabeads™ M-270 Carboxylic acid (final concentration: 3 mg / mL) was reacted with 50 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.1 M 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.0) and 50 mM N-hydroxysuccinimide (0.1 M MES, pH 5.0) at room temperature for 10 minutes. After the reaction, the magnetic beads were magnetically separated, the supernatant was removed, and the mixture was resuspended in 0.1 M MES (pH 5.0). Furthermore, the magnetic separation, supernatant removal, and resuspension with MES (pH 5.0) were repeated a total of two times. Next, the magnetic beads (final concentration: 10 mg / mL) were reacted overnight in 0.1 M MES (pH 5.0) on an ice bath with monomeric streptavidin (final concentration: 12.9 μM, SAE0094, Sigma) or tetrameric streptavidin (final concentration: 3.3 μM, Fujifilm Wako Pure Chemical Industries). After the reaction, the magnetic beads were magnetically separated, the supernatant was removed, and the mixture was resuspended in HBS-T (pH 7.4), followed by bead washing in the same manner. Furthermore, the magnetic separation, supernatant removal, resuspension with HBS-T (pH 7.4), and washing were repeated a total of two times.

[0406] Example 18-2 Display assay using mRNA-linker-peptide conjugates with monomeric or tetrameric streptavidin as a model target protein and strep-tag II as a model peptide A display assay was performed to evaluate the recovery rate associated with binding to monomeric or tetrameric streptavidin using mRNA-linker-peptide conjugates with strep-tag II as a model peptide.

[0407] The following experiments were performed using mRNA-linker conjugates obtained by hybridizing the strep-tagII encoding mRNA prepared in Example 3 with linker 1, linker 4, linker 15, linker 13, or linker 14.

[0408] Compared to the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentrations: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM) were added. TrpRS was added, and the translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to a final concentration of 12.5 mM, and the mixture was left to stand on an ice bath for 10 minutes to denature the ribosomes.

[0409] To the reaction solution after the first translation reaction described above, Mg(OAc) 2(Final concentration: 12.5 mM), translation-related solution (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.5 mg / mL E. coli total tRNA (in-house manufactured), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0410] Next, the reaction solution containing the obtained translation product is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 2 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM RT_Strep-tag II (SEQ ID NO: 14) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0411] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and HEPES (final concentration: 53.4 mM) were added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0412] After desalting, magnetic beads immobilized with the monomeric streptavidin prepared as described above as the target protein (final concentration of magnetic beads: 0.19 mg / mL, final concentration of monomeric streptavidin immobilized on the magnetic beads: 250 nM (in terms of monomeric streptavidin)) or magnetic beads immobilized with tetrameric streptavidin (final concentration of magnetic beads: 0.26 mg / mL, final concentration of tetrameric streptavidin immobilized on the magnetic beads: 250 nM (in terms of monomeric streptavidin)) were added, and a binding reaction was carried out at 4°C for 1 hour. After the binding reaction, the magnetic beads were magnetically separated and the supernatant was removed. Next, the magnetic beads were resuspended with HBS-T (final concentration: 0.048 mg / mL for monomeric streptavidin-immobilized beads, 0.065 mg / mL for tetrameric streptavidin-immobilized beads), transferred to a new sample tube, and then mixed at 4°C for 15 seconds. Furthermore, the above series of washing operations (magnetic separation, supernatant removal, resuspension with HBS-T, mixing at 4°C for 15 seconds) were performed a total of 3 times. Finally, after magnetic separation and supernatant removal, it was resuspended with a PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (final concentration: 0.19 mg / mL for monomeric streptavidin-immobilized beads, 0.26 mg / mL for tetrameric streptavidin-immobilized beads) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was recovered.

[0413] The amount of DNA in the solution before adding the target protein after the above desalting and the amount of DNA recovered from the magnetic beads were quantified by the real-time PCR method. The real-time PCR measurement device used was LightCycler 96 (Roche Applied Science), and Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTP (final concentration: 0.25 mM), MgCl 2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Streptag II (SEQ ID NO: 10) (0.25 μM) and the reaction solution added with the measurement sample solution were used for measurement.

[0414] Figure 21 shows the results of three trials of the display assay described above. Here, the recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. The “relative increase in recovery rate (times) compared to when using a monovalent linker (linker 1)” is the relative value between the recovery rate obtained when using a multivalent linker and the recovery rate obtained when using a monovalent linker (linker 1). The “relative increase in recovery rate (times) compared to when targeting monomeric streptavidin” represents the relative increase in the recovery rate obtained when targeting tetrameric streptavidin with each multivalent linker compared to the recovery rate obtained when targeting monomeric streptavidin with each linker.

[0415] In the binding affinity evaluation using Strep-tag II and tetrameric streptavidin as model peptides and model target proteins, the use of multivalent linkers (linkers 4, 15, 13, and 14) significantly enhanced the DNA recovery rate derived from binding to the target protein compared to the use of monovalent linkers. Furthermore, although the rate of increase varied depending on the valency of puromycin, a greater amplification was observed with multivalent linkers compared to monovalent linkers, even with different puromycin valencies (Figure 21a). In addition, in the binding affinity evaluation using multivalent linkers with different valencies (linkers 4, 15, 14, and 13) with strep-tag II presented as a model peptide, the DNA recovery rate derived from binding to the target protein was significantly enhanced when the target protein, streptavidin, was in the tetrameric form compared to when streptavidin was in the monomer form (Figure 21b). These results demonstrate that using a polyvalent linker allows for more efficient recovery of the genetic material-linker-peptide conjugate compared to a monovalent linker, and that the rate of increase is more favorably enhanced when the target protein is in high quantification. These phenomena are thought to be due to improved binding affinity between the linker-peptide conjugate and the target protein.

[0416] Example 18-3 Display assay 2 using mRNA-linker-peptide conjugates with monomeric or tetrameric streptavidin as a model target protein and strep-tag II as a model peptide A display assay was performed to evaluate the recovery rate associated with binding to monomeric or tetrameric streptavidin using mRNA-linker-peptide conjugates with strep-tag II as a model peptide.

[0417] The following experiments were performed using mRNA-linker conjugates obtained by hybridizing the strep-tagII encoding mRNA prepared in Example 3 with linker 1, linker 3, linker 4, linker 5, or linker 6.

[0418] Compared to the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentrations: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM) were added. TrpRS was added, and the translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to a final concentration of 12.5 mM, and the mixture was left to stand on an ice bath for 10 minutes to denature the ribosomes.

[0419] To the reaction solution after the first translation reaction described above, Mg(OAc) 2(Final concentration: 12.5 mM), translation-related solution (final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.5 mg / mL E. coli total tRNA (in-house manufactured), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.

[0420] Next, the reaction solution containing the obtained translation product is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 2 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM RT_Strep-tag II (SEQ ID NO: 14) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0421] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and HEPES (final concentration: 53.4 mM) were added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0422] After desalting, magnetic beads immobilized with monomeric streptavidin prepared as described above (final concentration of magnetic beads: 0.19 mg / mL, final concentration of monomeric streptavidin immobilized on magnetic beads: 250 nM (equivalent to monomeric streptavidin)) or magnetic beads immobilized with tetrameric streptavidin (final concentration of magnetic beads: 0.26 mg / mL, final concentration of tetrameric streptavidin immobilized on magnetic beads: 250 nM (equivalent to monomeric streptavidin)) were added as the target protein, and the binding reaction was carried out at 4°C for 1 hour. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (final concentrations: monomeric streptavidin immobilized beads 0.048 mg / mL, tetrameric streptavidin immobilized beads 0.065 mg / mL), transferred to a new sample tube, and mixed at 4°C for 15 seconds. Furthermore, the aforementioned magnetic separation, supernatant removal, resuspension with HBS-T, and mixing at 4°C for 15 seconds were performed a total of three times. Finally, after magnetic separation and supernatant removal, the mixture was resuspended using PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (final concentration: monomeric streptavidin-immobilized beads 0.19 mg / mL, tetrameric streptavidin-immobilized beads 0.26 mg / mL), and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was collected.

[0423] The amount of DNA in the solution before adding the target protein after desalting, and the amount of DNA recovered from the magnetic beads, were quantified using real-time PCR. Real-time PCR was performed using LightCycle 96 (Roche Applied Science), with Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTPs (final concentration: 0.25 mM), and MgCl added to the aforementioned PCR solution. 2 The reaction solution, to which (final concentration: 2 mM), T7g 10M, F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO: 10) (0.25 μM), and the sample solution to be measured was added, was subjected to measurement.

[0424] Figure 22 shows the results of three trials of the display assay described above. Here, the recovery rate (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. The “relative increase in recovery rate (times) compared to when using a monovalent linker (linker 1)” is the relative value between the recovery rate obtained when using a divalent linker and the recovery rate obtained when using a monovalent linker (linker 1). The “relative increase in recovery rate compared to when targeting monomeric streptavidin” represents the relative increase in the recovery rate obtained when targeting tetrameric streptavidin with each divalent linker compared to the recovery rate obtained when targeting monomeric streptavidin with each linker. In the binding affinity evaluation using Strep-tag II and tetrameric streptavidin as model peptides and model target proteins, the use of divalent linkers with different linker lengths (linkers 3, 4, 5, and 6) significantly enhanced the DNA recovery rate derived from binding to the target protein compared to the use of monovalent linkers. Furthermore, although the rate of increase varied depending on the branching chain length, a greater amplification was observed with divalent linkers compared to monovalent linkers, even with different branching lengths (Figure 22a). In addition, in the binding affinity evaluation using divalent linkers with different linker lengths (linkers 3, 4, 5, and 6) with Strep-tag II presented as a model peptide, the DNA recovery rate derived from binding to the target protein was significantly enhanced when the target protein, streptavidin, formed a tetramer compared to when streptavidin was a monomer (Figure 22b). These results demonstrate that using a divalent linker allows for more efficient recovery of the genetic material-linker-peptide conjugate compared to a monovalent linker, and that the rate of increase is more favorably enhanced when the target protein is in high-quantity form. These phenomena are thought to be due to improved binding affinity between the linker-peptide conjugate and the target protein.

[0425] [Example 19: Display assay using mRNA-linker-peptide conjugates with monomeric FcRn or polymerized FcRn as a model target protein and FcRn binder as a model peptide] Example 19-1-1 Overview of NTA linker synthesis NTA linkers 1 to 3 (Figure 23) were synthesized under the following conditions. All raw materials, building blocks, reagents, acids, bases, solid resins, and solvents used in the chemical synthesis in the following examples were either commercially available or could be synthesized organically based on the common sense of those skilled in the art.

[0426] In these examples, peptide chain elongation was carried out using the resins described in each example as starting materials, under commonly used peptide coupling reaction conditions and Fmoc removal reaction conditions. The reaction was performed using a CEM Liberty Blue automated peptide synthesizer, following the manufacturer's manual. The common amino acids used are listed below, with side chain protecting groups indicated in parentheses. The structural names of the above amino acids after peptide chain elongation are also shown below (Table 5).

[0427]

[0428] Example 19-1-2 Synthesis of Each NTA Linker Precursor In this example, each NTA linker precursor having the sequences (SEQ ID NOs. 61-63) shown in Table 6 below was synthesized.

[0429]

[0430] The abbreviations in Table 6 are as follows: MeG: 2-(methylamino)acetic acid (CAS 107-97-1); KCOPipzaa: (2S)-2-amino-6-{[4-(carboxymethyl)piperazine-1-carbonyl]aminohexanoic acid; Kbio: NH at the end of the side chain of the C-terminal lysine. 2 The carboxyl group of biotin is bonded to it.

[0431] Furthermore, the N-terminal cysteine ​​in sequence numbers 61-63 is acetylated, with the 1-position being N-acetyl-L-cysteine.

[0432] The lysine main chain carboxylic acid of the C-terminal Kbio in sequence numbers 61-63 is NH 2 Replace with (CONH 2 It is amidated, and the 25th position is 2-amino-6-((1-hydroxy-5-(2-hydroxy-3a,4,6,6a-tetrahydro-1H-thieno[3,4-d]imidazol-6-yl)pentylidene)amino)hexaimide acid.

[0433] Peptide synthesis was performed by elongation from Fmoc-Lys(Biot)-OH using a general solid-phase synthesis method, employing Sieber Amide resin (product of Watanabe Chemical Industry Co., Ltd.): 9-fluorenylmethoxycarbonyl group (Fmoc) as a protecting group for the α-amino group; 10% piperidine in N,N-dimethylformamide (DMF) for Fmoc deprotection; 4.2 equivalents of Fmoc-amino acid, 4 equivalents of Oxyma Pure, and 8 equivalents of N,N'-diisopropylcarbodiimide (DIC) as coupling reagents for peptide elongation; and an automated Liberty Blue (CEM Inc.).

[0434] Next, the N-terminal Fmoc group was deprotected with 10% pyrrolidine in DMF, and the resin was then washed sequentially with DMF and dichloromethane (DCM). Subsequently, 5% acetic anhydride in DCM was added to the resin, and the mixture was stirred. The resin was then washed sequentially with DMF and DCM, and subsequently dried.

[0435] A mixture of trifluoroacetic acid (TFA)-water-triisopropylsilane (TIS)-3,6-Dioxa-1,8-octaneditiol (DODT) (92.5:2.5:2.5 v / v / v / v / ) was added, and the resulting mixture was stirred at room temperature for 90 minutes. The crude peptides (each NTA linker precursor) were collected from the resin by cleavage and ether precipitation, washed three times with diethyl ether, and then dried.

[0436] Table 7 shows the measurement conditions for liquid chromatography-mass analysis (LC-MS) to confirm the acquisition of the NTA linker precursor and NTA linker, and Table 8 shows the results of the liquid chromatography-mass analysis.

[0437]

[0438]

[0439] Specifically, first, the synthesis of the NTA linker precursor was confirmed by LC-MS analysis under analytical condition 1 in Table 7 (Table 8). Furthermore, the NTA linker precursor was purified under analytical condition 2 in Table 7.

[0440] Example 19-1-3 Synthesis of Each NTA Linker To each NTA linker precursor synthesized and purified in Example 19-1-2, 6.2 equivalents of Maleimido-C3-NTA (20% DMSO, 0.1 M phosphate buffer (pH 7.8), 3 mM TCEP) were added and stirred for 15 hours. Next, the synthesis of each NTA linker was confirmed by LC-MS analysis under analytical condition 1 in Table 7 (Table 8). Furthermore, the NTA linkers were purified under analytical condition 3 in Table 7.

[0441] Example 19-2 Preparation of monomeric or tetrameric streptavidin-Ni-NTA linker complexes on magnetic beads Magnetic beads (final concentration: 1 mg / mL) immobilized with monomeric or tetrameric streptavidin prepared in Example 18-1 and the NTA linkers 1-3 (final concentration: 6.25 μM) were mixed in HBS (25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl) at room temperature for 30 minutes. After mixing, magnetic separation and supernatant removal were performed, and the mixture was resuspended in HBS. Further magnetic separation, supernatant removal, and resuspending in HBS were repeated twice. Next, each washed magnetic bead (final concentration: 1 mg / mL) was mixed with nickel(II) chloride hexahydrate (final concentration: 10 mM) in HBS at room temperature for 30 minutes. After mixing, magnetic separation and supernatant removal were performed, followed by resuspension with HBS. Furthermore, magnetic separation, supernatant removal, and resuspension with HBS were repeated twice to prepare magnetic beads immobilized with monomeric or tetrameric streptavidin-Ni-NTA linker (NTA linker 1, 2, or 3) complexes.

[0442] Example 19-3 Immobilization of FcRN onto monomeric or tetrameric streptavidin-Ni-NTA linker complexes immobilized on magnetic beads Each magnetic bead (final concentration: 1 mg / mL) immobilized with monomeric or tetrameric streptavidin-Ni-NTA linker complexes 1-3, prepared in Example 19-2, was mixed with histag human FcRn protein (final concentration: 1.4 μM, ACRO Biosystems, FCN-H52W7) in HBS-T at 4°C for 30 minutes. After mixing, magnetic separation and supernatant removal were performed, and the mixture was resuspended in HBS (final concentration: 1 mg / mL). Furthermore, magnetic separation, supernatant removal, and resuspending in HBS were repeated twice.

[0443] Example 19-4 Display assay using mRNA-linker-peptide conjugates with FcRn binder as a model peptide The following experiment was performed using mRNA-linker conjugates prepared in Example 3, in which linker 1 or linker 15 was separately hybridized to mRNA encoding FcRn binder.

[0444] Compared to the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), 12 types of amino acids (final concentration: 0.2 mM Phe, Leu, Met, Ser, Pro, Thr, Tyr, His, Asn, Cys, Arg, Gly), and 12 types of aminoacyl-tRNA synthetases (0.68 μM PheRS, 0.04 μM LeuRS, 0.03 μM MetRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.09 μM ThrRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.02 μM CysRS, 0.03 μM ArgRS, 0.09 μM) were added. GlyRS was added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to a final concentration of 12.5 mM, and the mixture was left to stand on an ice bath for 10 minutes to denature the ribosomes. Furthermore, Mg(OAc) was added to the reaction solution from the first translation reaction described above. 2(Final concentration: 12.5 mM), translation-related solution (Final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.5 mg / mL E. coli total tRNA (in-house manufactured product), 0.47 mM DTT), and ribosomes (Final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (Final concentration: 16.7 mM) was added to stop the translation reaction.

[0445] Next, the reaction solution containing the translation product obtained above is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl). 2 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, and 3 μM RT_FcRn binder (SEQ ID NO: 15) were added, and the reverse transcription reaction was carried out at 42°C for 30 minutes.

[0446] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and oxidized glutathione (final concentration: 1 mM, Nacalai Co.) were added, and the reaction was carried out at 37°C for 1 hour.

[0447] For the above samples, HEPES (final concentration: 53.4 mM) was added, and then desalting was performed using a Bio-Gel P30 Gel (Biorad) desalting column replaced with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).

[0448] The desalted sample was mixed with magnetic beads (final concentration: 8 mg / mL, Dynabeads® His-tag Isolation and Pulldown, Thermo) at 4°C for 10 minutes. After mixing, the magnetic beads were removed by magnetic separation, and then new magnetic beads (final concentration: 8 mg / mL, Dynabeads® His-tag Isolation and Pulldown, Thermo) were added and mixed at 4°C for 10 minutes. After repeating the above process, the magnetic beads were removed by magnetic separation and the process proceeded to the next step.

[0449] The aforementioned samples were separately mixed with each magnetic bead immobilized with a monomer or tetramer streptavidin-Ni-NTA linker 3 complex containing or not containing FcRn, prepared in Examples 19-2 and 19-3 (final concentration of magnetic beads: 1.6 mg / mL, final concentration of FcRn immobilized on magnetic beads: 250 nM). The mixtures were then mixed at 4°C for 1 hour to allow the binding reaction to occur. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended using HBS-T (final concentration: 0.4 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. Furthermore, the above magnetic separation, supernatant removal, resuspending with HBS-T, and mixing at 4°C for 5 minutes was repeated a total of two times. Finally, after magnetic separation and removal of the supernatant, the mixture was resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100, 1 M imidazole) (final concentration: 1.6 mg / mL) and allowed to stand for 10 minutes. After standing, magnetic separation was performed and the supernatant was collected.

[0450] The amount of DNA in the solution before adding the target protein after desalting, and the amount of DNA recovered from the magnetic beads, were quantified using real-time PCR. Real-time PCR was performed using LightCycle 96 (Roche Applied Science), with Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), dNTPs (final concentration: 0.25 mM), and MgCl added to the aforementioned PCR solution. 2 The reaction solution, to which (final concentration: 2 mM), T7g 10M, F52 (0.25 μM), RV_FcRn binder (SEQ ID NO: 11) (0.25 μM), and the sample solution to be measured was added, was subjected to measurement.

[0451] Figure 24 shows the results of three trials of the display assay. Here, recovery (%) represents the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the evaluation of binding ability using the FcRn binder and FcRn as model peptides and model target proteins, an increase in the recovery rate of DNA derived from binding to the target protein was observed with the use of the trivalent linker in both cases where FcRn was immobilized using monomeric or tetrameric streptavidin-Ni-NTA linker 3. Furthermore, this increase was more pronounced when FcRn was increased using tetrameric streptavidin-Ni-NTA linker 3, indicating that it is more favorably improved when the target protein is increased. These phenomena are thought to be due to an improvement in the binding ability of the multiple peptides linked to the linker (linker 15) to the target protein.

[0452] Example 19-5 Comparison between NTA linkers The following experiment was performed using mRNA-linker conjugates prepared in Example 3, which were obtained by hybridizing linker 15 with mRNA encoding the FcRn binder.

[0453] Compared to the cell-free translation system configured in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), 12 types of amino acids (final concentration: 0.2 mM Phe, Leu, Met, Ser, Pro, Thr, Tyr, His, Asn, Cys, Arg, Gly), and 12 types of aminoacyl-tRNA synthetases (0.68 μM PheRS, 0.04 μM LeuRS, 0.03 μM MetRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.09 μM ThrRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.02 μM CysRS, 0.03 μM ArgRS, 0.09 μM) were added. GlyRS was added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to a final concentration of 12.5 mM, and the mixture was left to stand on an ice bath for 10 minutes to denature the ribosomes. Furthermore, Mg(OAc) was added to the reaction solution from the first translation reaction described above. 2(Final concentration: 12.5 mM), translation-related solution (Final concentration: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.5 mg / mL E. coli total tRNA (in-house manufactured product), 0.47 mM DTT), and ribosomes (Final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (Final concentration: 16.7 mM) was added to stop the translation reaction.

[0454] Next, the reaction solution containing the translation product obtained above is combined with a reverse transcription reaction solution (final concentration: 50 mM Tris-HCl, ...

Claims

1. A method for forming a conjugate of a desired target substance and a peptide, comprising the step of contacting a genetic information substance-linker-peptide conjugate with a target substance conjugate containing at least two of the target substance, wherein the genetic information substance-linker-peptide conjugate is: (a) a binding portion having a structure capable of binding to a desired genetic information substance; and a linker comprising at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic information substance bound to the binding portion of the linker in (a); and (c) a peptide encoded by the genetic information substance bound to at least two or more puromycin-like substances of the linker in (a), the genetic information substance-linker-peptide conjugate.

2. The method according to claim 1, wherein the target substance linkage comprises at least two of the target substances linked together via a target substance linking linker.

3. The method according to claim 1 or 2, wherein the number of target substances contained in the target substance conjugate is 2 or more and 16 or less.

4. The method according to any one of claims 1 to 3, wherein the binding portion in the linker (a) having a structure capable of binding to the desired genetic information material comprises a nucleic acid capable of binding to the desired genetic information material.

5. The method according to any one of claims 1 to 4, wherein the genetic information material is nucleic acid.

6. The method according to any one of claims 1 to 5, wherein the puromycin-like substance in the linker (a) is puromycin.

7. The method according to any one of claims 1 to 6, wherein the binding ability between the target substance conjugate and the genetic information substance-linker-peptide conjugate is higher than the binding ability between the desired target substance and the genetic information substance-linker-peptide conjugate.

8. Use for contacting a target substance conjugate comprising at least two desired target substances with a genetic information substance-linker-peptide conjugate to form a conjugate of the target substance and a peptide, wherein the genetic information substance-linker-peptide conjugate is: (a) a binding portion having a structure capable of binding to the desired genetic information substance; and a linker comprising at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of the desired peptide; (b) the genetic information substance bound to the binding portion of the linker in (a); and (c) a genetic information substance-linker-peptide conjugate comprising a peptide encoded by the genetic information substance, bound to at least two or more puromycin-like substances of the linker in (a).

9. The use according to claim 8, wherein the target material conjugate comprises at least two of the target materials connected via a target material linking linker.

10. A screening method for peptides that bind to a desired target substance, comprising the step of contacting a library comprising at least two genetic material-linker-peptide conjugates with a target substance conjugate comprising at least two of the target substance, wherein the genetic material-linker-peptide conjugate is: (a) a binding portion having a structure capable of binding to a desired genetic material; and a linker comprising at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic material bound to the binding portion of the linker in (a); and (c) a genetic material-linker-peptide conjugate comprising a peptide encoded by the genetic material, bound to at least two or more puromycin-like substances of the linker in (a).

11. The method according to claim 10, wherein the target material conjugate comprises at least two of the target materials linked together via a target material linking linker.

12. A method for evaluating the binding ability of a desired target substance to a peptide, comprising the step of contacting a library comprising at least two genetic information substance-linker-peptide conjugates with a target substance conjugate comprising at least two of the target substance, wherein the genetic information substance-linker-peptide conjugate is: (a) a binding portion having a structure capable of binding to a desired genetic information substance; and a linker comprising at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide; (b) the genetic information substance bound to the binding portion of the linker in (a); and (c) a genetic information substance-linker-peptide conjugate comprising a peptide encoded by the genetic information substance, bound to at least two or more puromycin-like substances of the linker in (a).

13. The method according to claim 12, wherein the target material conjugate comprises at least two of the target materials linked together via a target material linking linker.

14. A method for forming a conjugate of a desired target substance and a peptide, comprising the step of contacting a genetic information substance-linker-peptide conjugate with a target substance conjugate containing at least two of the target substance, wherein the genetic information substance-linker-peptide conjugate is a linker comprising: (a) a binding portion having a structure capable of binding to a desired genetic information substance; and at least two binding portions having a structure capable of covalently bonding to the C-terminus of a peptide; wherein the length and rigidity of the linker structure connecting the at least two binding portions having a structure capable of covalently bonding to the C-terminus of a peptide can be precisely controlled by chemical synthesis; (b) the genetic information substance bound to the binding portion of the linker in (a); and (c) a peptide encoded by the genetic information substance bound to at least two binding portions of the linker in (a) having a structure capable of covalently bonding to the C-terminus of a peptide, the method comprising the genetic information substance-linker-peptide conjugate.

15. The method according to claim 14, comprising the step of subjecting a desired genetic information material-linker-conjugate to a cell-free translation system to translate the genetic information material and obtain a genetic information material-linker-peptide conjugate.

16. A method for forming a complex of a target substance conjugate containing at least two desired target substances and a genetic information substance-linker-peptide conjugate in which two or more peptides encoded by a desired genetic information substance are linked, comprising: 1) a step of providing a genetic information substance integrally linked to a linker containing at least two or more puromycin-like substances bound to each of a plurality of branched sites to a cell-free translation system and translating the genetic information substance; 2) a step of obtaining a genetic information substance-linker-peptide conjugate by linking the genetic information substance integrally linked to the linker containing at least two or more puromycin-like substances bound to each of the plurality of branched sites, and the peptides encoded by the translated genetic information substance; and 3) a step of contacting the genetic information substance-linker-peptide conjugate with a target substance conjugate containing at least two or more of the target substances.

Citation Information

Patent Citations

  • Molecule that homologizes genotype and phenotype and utilization thereof

    WO1998016636A1

  • LINKER FOR CONSTRUCTING mRNA-PUROMYCIN-PROTEIN CONJUGATE

    WO2006041194A1

  • Method for screening of protein using immobilized puromycin linker

    WO2007046520A1

  • Peptide library production method, peptide library, and screening method

    WO2012074130A1

  • Linker

    WO2024225483A1