Site-directed editing of APOB RNA
Site-directed editing of ApoB mRNA using chemically modified ASOs addresses the limitations of current therapies by safely and precisely lowering ApoB levels, thereby reducing cardiovascular disease risk and liver toxicity.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- AIRNA CORPORATION
- Filing Date
- 2025-11-14
- Publication Date
- 2026-05-21
AI Technical Summary
Current therapies for lowering Apolipoprotein B (ApoB) levels, which are associated with cardiovascular diseases, face challenges such as liver toxicity and inefficacy, necessitating the development of novel approaches to modify ApoB expression safely and precisely.
Site-directed editing of ApoB mRNA using chemically modified antisense oligonucleotides (ASOs) to introduce specific amino acid changes through A-to-I editing, targeting specific sites within the ApoB transcript to reduce ApoB protein levels.
The approach effectively lowers ApoB levels, reducing the risk of cardiovascular diseases while minimizing liver toxicity and improving therapeutic efficacy.
Smart Images

Figure US2025055452_21052026_PF_FP_ABST
Abstract
Description
SITE-DIRECTED EDITING OF RNARELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C. §119(e) to U.S. Provisional Application No. 63 / 720,941 , filed November 15, 2024, entitled “SITE-DIRECTED EDITING OF RNA,” U.S. Provisional Application No. 63 / 744,495, filed January 13, 2025, entitled “SITE-DIRECTED EDITING OF RNA,” and U.S. Provisional Application No. 63 / 886,592, filed September 23, 2025, entitled “SITE-DIRECTED EDITING OF RNA,” the contents of each of which are incorporated herein by reference in their entirety.REFERENCE TO ELECTRONIC SEQUENCE LISTING
[0002] The contents of the electronic sequence listing (A146270001 WO00-SEQ-ZJG. xml; Size 221 ,304 bytes; and Date of Creation: November 12, 2025) are herein incorporated by reference in their entirety.FIELD OF THE INVENTION
[0003] The present invention relates to the field of medicine, in particular to the field of site-directed RNA or DNA editing. The invention relates to antisense oligonucleotides (ASOs) for use in the prevention or treatment of a cardiovascular diseases associated with Apolipoprotein (ApoB).BACKGROUND OF THE INVENTION
[0004] The global burden of dyslipidaemias, particularly elevated plasma LDL-cholesterol (LDL-C) levels, has increased over the recent years. Dyslipidaemia can present in various forms, including primary (genetic), secondary (acquired), mixed or combined dyslipidaemia, and dyslipoproteinemia (lipoprotein disorders). Managing each type requires a tailored approach, typically involving lifestyle modifications, medications, and addressing any underlying conditions.
[0005] Dyslipidaemia is a condition characterized by abnormal levels of lipids (fats) in the blood, which can increase the risk of cardiovascular disease. Types of dyslipidaemia are typically categorized based on the type of lipid abnormality (high, low, or abnormal forms of cholesterol or triglycerides) or by the underlying genetic or secondary causes. Dyslipidaemia presents a major risk factor for coronary atherosclerosis and cardiovascular diseases (CVD). Elevated plasma LDL-C levels are a major causal factor for ischaemic heart disease andischaemic stroke in both the developed and the developing world. Both primary (genetic) and secondary (lifestyle) causes contribute to dyslipidaemias in varying degrees. Dyslipidaemia is generally associated with the accumulation of LDL-cholesterol (LDL-C) in the blood, whereby LDL-C specifically refers to the amount of cholesterol estimated to be contained within LDL particles. Among the different forms of dyslipidaemia, hypercholesterolaemia is the most prevalent form (Nabel, 2003).
[0006] It is well-known that high serum cholesterol strongly correlates with the incidence of atherosclerosis and coronary heart disease. Atherosclerosis is a progressive disease characterized by the build-up of fibrous plaques and subsequent disturbance of blood flow. Atherosclerosis is the major cause of CVD. A hallmark of atherosclerosis is the retention of cholesterol-rich low-density lipoprotein (LDL) and other ApoB-containing lipoproteins within the arterial wall. Pharmacotherapy based on cholesterol management and lipid profile is the cornerstone of treatment and prevention. However, measurement of total cholesterol alone may not be adequate to identify subjects at risk for coronary heart disease.
[0007] Apolipoprotein B (ApoB) is a key structural protein encoded by the apoB gene found in atherogenic lipoproteins where it serves as a frame and is crucial in the maintenance of the structural stability of the lipoprotein (Olofsson et al., 2005). It also plays a crucial role in transporting cholesterol through the body and clearing it from the vascular wall. ApoB exists in two main isoforms: apoB48 and apoB100. Each molecule of very low-density lipoprotein (VLDL), intermediate density lipoprotein (IDL), low density lipoprotein (LDL), and lipoprotein(a) contains a single apoB100 molecule, making ApoB an essential component of VLDLs, IDLs and LDLs. This one-to-one ratio allows the plasma concentration of ApoB to serve as a direct measure of the number of circulating atherogenic lipoproteins (Behbodikhah, 2021) and serves as a biomarker to assess the risk of atherosclerotic cardiovascular disease. That is, the LDL-C / ApoB ratio is used as a proxy of LDL size and risk of developing cardiovascular events.
[0008] In action, the ApoB protein attaches to cellular receptors, which allows LDL to enter the cell. Once inside, ApoB is broken down, releasing the fat and cholesterol into the blood. LDL can subsequently cause plaque buildup in the blood vessels. Hence, ApoB has been considered as a potential target for decreasing risk associated with CVD. However, only a handful of treatments have been designed to impact the level of apoB expression. Lipid-lowering therapies that reduce apoB include, for example, statins, niacin, monoclonal antibodies evolocumab, evinacumab and alirocumab, and fibrates (Behbodikhah, 2021). Inclisiran is an siRNA molecule that has been approved for targeting mRNA specifically encoding PCSK9 (Kosmas et al., 2018). On the other hand, mipomersen is a synthetic phosphorothioate antisense oligonucleotide that targets ApoB expression by binding to ApoB-100 mRNA transcripts, inducing RNase H-mediated cleavage of the targeted transcripts. This processeffectively inhibits protein translation, resulting in reductions in LDL-C and other lipoprotein levels. Mipomersen was approved by the FDA in the United States in 2013 as an adjunct to lipid-lowering therapy for treating homozygous familial hypercholesterolemia (FH) (Chambergo-Michilot et al., 2022). However, this approval came with a warning about potential risks of hepatotoxicity and liver steatosis due to ApoB knockdown. In contrast, the European Medicines Agency (EMA) rejected mipomersen over concerns about liver toxicity and cardiovascular adverse effects (Chambergo-Michilot etal., 2022). Likewise, anacetrapib, which was developed to reduce apoB-containing lipoprotein particles, was discontinued because of its association with excess lipid accumulation in adipose tissue.
[0009] Accordingly, new therapies that lower ApoB are needed. While there are ways to lower LDL-C, there remains a high unmet need for novel and improved LDL lowering approaches.SUMMARY OF THE INVENTION
[0010] The present invention is based on the realisation that specific modifications to the native ApoB gene / transcript can be made to reduce the level of circulating or secreted ApoB, thereby leading to therapeutic effects. In particular, making modifications at positions Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A of the ApoB protein results in beneficial and therapeutic effects. The present invention also generally relates to oligonucleotides (or antisense oligonucleotides, ASO) for A-to-l editing with desirable properties for in vitro and in vivo use associated with the prevention or treatment of a disease or a condition associated with ApoB and / or LDL-C in a subject. The present invention also provides methods for effecting site-directed editing of a target RNA or DNA sequence derived from or coding for an endogenous ApoB and treating or preventing diseases or disorders associated with ApoB and / or LDL-C. The problem solved by the invention lies in the provision of a new therapy for treating dyslipidaemia and approaches for targeting ApoB. The inventors have taken a targeted approach to design specific oligonucleotides that target ApoB transcripts for A-to-l editing. The problem solved by the instant invention lies in the provision of chemically modified ASOs capable of mediating a functional change in endogenous ApoB transcripts. Specifically, the invention relates to chemically modified oligonucleotides that target ApoB mRNA transcripts at specific sites to mediate A-to-l editing. This A-to-l editing result in amino acid changes during translation where inosine (I) is read as guanosine (G), leading to a mutation at the protein level. To date, this approach has not been utilised in the prior art.
[0011] The solution to the technical problem is achieved by the embodiments described herein and defined by the appended claims.
[0012] In a first aspect, the invention provides an antisense oligonucleotide (ASO) for use in the prevention or treatment of a disease, or a condition associated with Apolipoprotein B (ApoB) in a subject, wherein the ASO effects site-directed adenosine-to-inosine (A-to-l) editing of a target adenosine in a target RNA sequence derived from a sequence of an endogenous ApoB gene.
[0013] In a second aspect provided herein is an ASO that comprises or consists of one of the sequences selected from: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81 , SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89. SEQ ID NO: 90.
[0001] In a third aspect provided herein is a composition comprising an ASO of the invention, an expression construct of the invention, or a modified protein of the invention.
[0015] In a fourth aspect provided herein is an ASO of the invention or a composition of the invention for therapeutic use
[0016] In a fifth aspect provided herein is an expression construct comprising a nucleotide sequence encoding human ApoB, wherein the nucleotide sequence is at least 60%, at least 70%, at least 80%, at least 90, at least 95% or is 100% identical to SEQ ID NO: 13 and / or SEQ ID NO: 14.
[0017] In a sixth aspect provided herein is a cell comprising an oligonucleotide of the invention or an expression construct of the invention.
[0018] In a seventh aspect provided herein is a modified ApoB protein comprising one or more amino acid substitutions selected from the group consisting of Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A.
[0019] In an eighth aspect provided herein is a method for mutating an endogenous ApoB allele in a cell, wherein the method comprises delivering to the cell a non-naturally occurring composition that can modify the ApoB allele at one or more of the positions corresponding to 3169 (Y1014C in protein), 4159 (K1344R in protein), 4549 (K1474R in protein), 4696 (N1523S in protein), 5514 (T1796A in protein), 5775 (T1883A in protein), 8967 (S2947G in protein), 10522 (N3465S in protein), and 12405 (T4093A in protein) of SEQ ID NO: 13.
[0020] In a ninth aspect provided herein is a method of treating or preventing a disease or condition associated with ApoB in a subject, comprising administering to said subject an oligonucleotide of the invention to modify the ApoB transcript at one or more of positions such that the resulting modified ApoB protein comprises one or more of the following substitutions selected from Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A.BRIEF DESCRIPTION OF DRAWINGS
[0021] The figures shown in the following are merely illustrative and shall describe the present invention in a further way. The figures shall not be construed to limit the present invention thereto.
[0022] FIGs. 1A-1B represent graphs showing (FIG. 1A) multiple A-to-G sites with low LDL-C and liver steatosis risk, (FIG. 1B) editing efficacy (%) of sites 1-10.
[0023] FIGs. 2A-2F represent bar graphs showing (FIG. 2A) the editing efficacy (in %) of chemically modified oligonucleotide AI-3075, (FIG.2B) editing efficacy (in %) of oligonucleotides AI-2780, AI-3437, AI-2776, AI-3811 , AI-3810 and AI-3075, (FIG. 2C) ApoB secretion (in ng / ml) following treatment with AI-3075, (FIG. 2D) change in ApoB secretion (in %) following treatment with AI-3075 or AI-3811 , (FIG. 2E) relative ApoB mRNA levels following treatment with AI-3075, and (FIG. 2F) editing efficiency (in %) of AI-3075 compared to AI-3084.
[0024] FIGs.3A-3D represent bar graphs showing (FIG.3A) editing efficacy (%) at site K1474R and site T4093Aat d3, (FIG. 3B) level of LDL associated with target editing at site K1474R and site T4093A, (FIG. 3C) editing efficacy (%) at sites K1474R (AI-3428, AI-3075, AI-3423), N1523S (AI-3523, AI-3524, AI-3525) and N3465S (AI-3500, AI-3560) at d5, and (FIG. 3D) editing efficacy (%) at sites K1474R (AI-3555, AI-3556, AI-3437) and N3465S (AI-3809, AI-3810) at d7.
[0025] FIGs. 4A-4B represent graphs showing blood biochemistry data from UK BioBank (UKBB) participants for (FIG. 4A) LDL (in mg / dl) and (FIG. 4B) liver enzyme activity (in U / L).DETAILED DESCRIPTION
[0026] Over the years, oligonucleotide therapeutics for RNA targeting have been developed to specifically silence, restore, or modify RNA derived from disease-associated genes and include therapeutics such as, for example, antisense oligonucleotides (ASOs), small interfering RNA (siRNA) and microRNA that interfere with coding and noncoding RNA. The relative ease and accuracy with which ASO sequences can be customized allows virtually any mutated gene to be targeted. As a result, ASOs are the most clinically developed, with several drugs already approved by the U.S. Food and Drug Administration (FDA) and in clinical trials (Cideciyan etal., 2019; Gagliardi andAshizawa, 2021).
[0027] In general, RNA editing is a natural process through which some cells can make discrete changes to specific nucleotide sequences within an RNA molecule in a site-specific way. Unlike DNA editing, the advantage of site-directed RNA editing is that it allows modification of the genetic information that leads to a modified protein in a more precise,efficient, and safe manner. Contrary to DNA, RNA is generally quickly degraded and any errors introduced by off-target modifications to other RNAs will be washed out rather than permanently introduced into the modified DNA of a subject. RNA editing may also be less likely to cause an immune reaction since it is an editing mechanism naturally found in humans. Moreover, RNA editing might provide a more natural response than introducing an external, engineered gene.
[0028] Site-Directed RNA Editing (SDRE) refers to the modification of an RNA sequence by adding or removing nucleotides or altering the character of a nucleobase through deamination. Various RNA editing enzymes are well-known in the field. The first RNA editing process discovered in mammals involved the deamination of cytidine (C) to uridine (II) by APOBEC proteins (Zinshteyn and Nishikura, 2009). Currently, the two most useful and most studied types of RNA editing are cytidine (C) to uridine (U) (“C-to-LF) and adenosine (A) to inosine (I) (“A-to-F) conversions. Among these, the “A-to-F conversion, catalysed by the adenosine deaminases acting on RNA (ADAR) family, is the most prevalent form of RNA editing used for therapeutic purposes in higher eukaryotes.
[0029] “A-to-F editing was initially identified in Xenopus eggs (Bass and Weintraub, 1987; Rebagliati and Melton, 1987). Human cDNA encoding “double stranded RNA adenosine deaminase” was first cloned by Kim et al. (1994) and “A-to-F conversion activity of the protein confirmed by recombinant expression in insect cells. Specifically, “A-to-F editing changes the informational content of the RNA molecule, as inosine preferentially basepairs with cytidine and is therefore interpreted as guanosine (G) by the translational and splicing machinery. Therefore, ADARs have the effect of introducing a functional adenosine to guanosine mutation on the RNA level. Potentially, this approach may be used to repair genetic defects and alter genetic information at the RNA level.
[0030] Over the years, three vertebrate ADAR genes have been identified, producing multiple ADAR proteins through the use of alternative promoters or splicing (Wulff and Nishikura, 2010). These ADAR proteins are expressed in various human tissues and can influence a range of cellular processes, including splicing and translation machinery, the structure of double-stranded RNA (dsRNA), and the binding affinity between RNA and RNA-binding proteins (Tomaselli et al., 2014; Zinshteyn and Nishikura, 2009). Of the three known ADAR genes, hADARI and hADAR2 are expressed in most tissues and encode active deaminases. In contrast, hADAR3 is primarily expressed in the central nervous system and is reported to lack deaminase activity in vitro. All ADARs are multidomain proteins, featuring a targeting or double-stranded RNA-binding domain (dsRBD) and a catalytic domain. Additionally, ADAR1 proteins contain one or more Z-binding domains, while the splice variant ADAR2R and ADAR3 include an R domain (Zinshteyn and Nishikura, 2009; Wulff and Nishikura, 2010). Therefore,ADARs may be hADARI, hADAR2, hADAR3, or any variant thereof. The ability of ADARs to modify RNA sequences has been harnessed for targeted RNA editing in vitro in cells.
[0031] Antisense oligonucleotides (ASOs) are typically short, single-stranded synthetic RNA or DNA molecules, about 18 to 25 nucleobases in length, that bind specifically to target RNA through Watson-Crick base pairing. ASOs are broadly classified into first (Gen 1 ), second (Gen 2), and third (Gen 3) generations. The sequence and design of an ASO are key factors that determine its pharmacological and toxicological properties.
[0032] Gen 1 ASOs were first used to inhibit the translation of Rous sarcoma virus ribosomal RNA (Stephenson and Zamecnik, 1978). These ASOs are characterized by a modified backbone, where the nucleotide linkages are altered by substituting sulphur, methyl, or amine groups to create phosphorothioates (PS), methylphosphonates (MP), and phosphoramidates, respectively. Chemical modifications of ASOs can enhance their properties, such as increasing nuclease resistance and improving efficacy. PS modifications, in particular, have been shown to positively impact ASO stability and pharmacokinetics. However, the chirality of PS linkages can significantly influence the overall properties of the ASO (Iwamoto et al., 2017; Crooke et al., 2020).
[0033] Gen 2 ASOs exhibit enhanced nuclease stability and greater affinity for their RNA targets, leading to improved potency and a better therapeutic index in clinical settings. These ASOs typically feature a phosphorothioate (PS) backbone modification and include alkyl modifications at the 2’ position of the ribose. Such 2’-sugar modifications may include 2’-O-methyl (2’-OMe), 2’-fluoro (2’-F), 2’-O-methoxyethyl (2’-MOE) modifications. As a result, these Gen 2 ASOs tend to be less toxic than solely PS-modified ASOs and exhibit a slightly higher affinity for their target.
[0034] In comparison, Gen 3 ASOs are even more heterogeneous, incorporating a wide range of chemical modifications designed to further enhance binding affinity, stability, and pharmacokinetics (Quemener etal., 2019). This diversity of chemical modifications, along with the ASO sequence, provides significant flexibility in therapeutic applications. Depending on their mechanism of action, ASOs can be used to degrade target mRNA, reduce protein levels, modify or correct splicing events, modulate RNA translation, or target pathological coding and non-coding RNAs (Quemener et al., 2019).
[0035] To ensure the specificity of ASOs, their sequences are typically complementary, or at least partially complementary, to the target RNA. However, in the context of site-directed mutagenesis, such as “A-to-l" RNA editing, the ASO targeting domain deliberately includes a mismatch opposite the targeted adenosine. It is important to note that several endogenous ADAR substrates naturally contain mismatches and / or bulges (Thomas and Beal, 2017) andmimicking these features in the ASO or resulting double-stranded RNA (dsRNA) could potentially enhance substrate recognition or improve the efficiency of editing.
[0036] Further, ASOs can be chemically modified to improve their properties, such as improving resistance to nucleases and increasing their overall effectiveness. While phosphorothioate (PS) modifications seem to have a positive effect on ASOs stability and pharmacokinetics, the difference in chirality of PS linkages may have a substantial influence on the ASO’s overall property (Iwamoto et al., 2017; Crooke et al., 2020). These oligonucleotides tend to be rich in 2’-F-modifications within the 5’ half, which are generally present as blocks of 2’-F-modifications and uniform block of 2’-O-Methyl-modifications within the 3’ terminus on either side of the central base triplet (CBT) (Monian et al., 2022). Further, some of these oligonucleotides contain almost complete stereopure PS-modified backbones and additional charge-neutral PN linkages (also stereopure), the latter of which is not yet applied in the clinics.
[0037] Research in the field of ASO optimisation for “A-to-l” editing has led not only to the identification of the CBT but also to a more thorough investigation of the region immediate 5’ and 3’ to the CBT. In addition to specifically looking at CBT modifications (e.g., 2’-F and 2’-FANA), WO 2021 / 243023 also mentions guide or targeting domain modifications 3’ to the nucleobase just outside the CBT (at position +2 of an oligonucleotide comprising the structure [Am]-X1-X2-X3-X4-[Bn], wherein X4corresponds to the +2 position). It was found that editing the +2 position can affect the editing rate of the target. Improved editing was observed with a 2’-F modification at the +2 position.Terminology
[0038] In order that the present invention may be more readily understood, certain terms are first defined.
[0039] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., a plurality of elements.
[0040] The terms “about” and “approximately” may be understood to permit standard variation as would be understood by those of ordinary skill in the art.
[0041] The term “including” is used herein to mean, and is used interchangeably with, the phrase “including, but not limited to”. Likewise, the term “comprising” is used herein to mean, and is used interchangeably with, the phrase “comprising, but not limited to".
[0042] As used herein, the term "nucleic acid" is intended to include any DNA molecules (e.g., cDNA or genomic DNA) and any RNA molecules (e.g., mRNA) and analogues of the DNA orRNA generated using nucleotide analogues. Oligonucleotides can be single-stranded (ss) or double-stranded (ds). A single-stranded oligonucleotide can have double-stranded regions (formed by portions of the single-stranded oligonucleotide). A double-stranded oligonucleotide can have single-stranded regions, for example, at regions where the two oligonucleotide chains are not complementary to each other. Each component of the DNA or RNA can be modified and categorized by modification of (1) the internucleoside linkage, (2) the deoxyribose / ribose, and / or (3) the nucleobase.
[0043] The term “nucleobase” or “base” refers to biological building blocks that can form nucleosides, which, in turn, may be components of nucleotides. Naturally occurring bases are generally guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U), which are derivatives of purine or pyrimidine. Cytosine, thymine, and uracil are pyrimidine bases that are generally linked to the backbone through their 1 -nitrogen. Adenine and guanine are purine bases and generally linked to the backbone through their 9-nitrogen. It should be understood that naturally and non-naturally occurring base analogues are also included and that the term “nucleobase” also includes “modified nucleobases”.
[0044] Within the context of this invention, the term "modified nucleobase" and "modified base" may be used interchangeably with the term “nucleobase”. A nucleobase may be a nucleobase, which comprises a modification. In some embodiments, a modified nucleobase is capable of at least one function of a nucleobase, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases. In one embodiment, the modified nucleobase is capable of increasing hydrogen bonding, base pair stacking interactions and / or stabilizing a nucleic acid complex. The modified nucleobase (e.g., Benner’s base) may be capable of mimicking the N3 protonated cytosine base. In some embodiments, a modified nucleobase is substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or II. In some embodiments, a modified nucleobase in the context of oligonucleotides refer to a nucleobase that is not A, T, C, G or U. Modifications include but are not limited to nonstandard nucleobases 5-methyl-2’-deoxycytidine (m5C), pseudouridine (pll), dihydrouridine, inosine (I), and 7-methylguanosine. In some embodiments, the modification is iso-uridine (Sbll). Other modifications may include nucleobase replacement by (N) heterocycles (e.g., nebularine) or aromatic rings that stack well in the RNA duplex, such as, e.g., a Benner’s base Z (and / or analogues) or 8-oxo-adenosine (8-oxo-A). As used herein, the term “Benner’s base Z” refers to the pyrimidine analogue 6-amino-5-nitro-3-(1'-p-D-2'-deoxyribofuranosyl)-2(1 H)-pyridone (dZ). In one embodiment, a modification includes the introduction of nucleobase analogues or simple heterocycles that boost editing. As used herein, and as commonly understood by the skilled person in the art, the expression “derivative thereof” refers to a derivative of a (modified) nucleobase, nucleoside or nucleotide. For example, a derivative may be a correspondingnucleobase, nucleoside or nucleotide that has been chemically derived from said nucleobase, nucleoside or nucleotide. For instance, a derivative of deoxycytidine may include fluoro-modified deoxycytidine, 5-methyl-2’-deoxycytidine (m5C), or ribocytidine.
[0045] The term "nucleoside(s)" refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar. In some embodiments, a “nucleoside” refers to a nucleoside unit in an oligonucleotide or a nucleic acid. The term "nucleoside(s)" encompasses all modified versions and derivatives “modified nucleobases”.
[0046] The term "nucleotide(s)" as used herein refers to a monomeric unit of a polynucleotide that consists of a nucleobase, a sugar, and one or more linkages (e.g., phosphate linkages in natural DNA and RNA). In some cases, the linkage may be a non-naturally occurring and / or modified linkage. In some embodiments, the linkage may be an internucleoside linkage as described herein. In one specific embodiment, the modified linkage is a PS linkage. In some embodiments, a “nucleotide” refers to a nucleotide unit in an oligonucleotide or a nucleic acid. The term "nucleotide(s)" encompasses all modified versions and derivatives of “nucleosides” and “modified nucleobases”.
[0047] The term “oligonucleotide(s)“ as used herein is defined as is generally understood by the skilled person as a molecule including two or more covalently linked nucleosides. They can comprise DNA and / or RNA. The oligonucleotides may have a backbone comprising deoxyribonucleotides and / or ribonucleotides.
[0048] As used herein, the term “internucleoside linkage” refers to a linkage between adjacent nucleosides. “Internucleoside linkage” and “linkage” may be used interchangeably. Linkages may be continuous or consecutive. Linkages may be discontinuous or interrupted. As used herein, the term “discontinuous” or “interrupted” means that there are not more than, e.g., 4, 5, 6, 7 or more consecutive internucleoside linkage modifications of the same modification. In some embodiments, the naturally occurring PO linkages are replaced by modified internucleoside linkages. Hence, in some embodiments, the linkage is a non-natural internucleoside linkage. In some embodiments, internucleoside linkage(s) include, but are not limited to phosphorothioate (PS), methanesulfonyl (mesyl) linkage, 3'-methylenephosphonate, 5'-methylenephosphonate, 3'-phosphoroamidate, 2'-5'-phosphodiester, and phosphoryl guanidine (PN) linkages. In one embodiment, the modified linkage is a PS linkage or a methanesulfonyl (mesyl) linkage. In one embodiment, the modified linkage is a PS linkage. In one embodiment, the modified linkage is a methanesulfonyl (mesyl) linkage. In another embodiment, the internucleoside linkage modification is a 3’-3’ or 5’-5’ phosphate ester bonds (3-P-3' and 5-P-5'). The internucleoside linkage may be stereopure or stereorandom. Thus, within a particular oligonucleotide, internucleoside linkages may comprise stereopure and stereorandom linkages. In one embodiment, the natural 3’-5’ phosphodiester linkage isreplaced by modified internucleoside linkages. In some embodiments, the naturally occurring one or more PO linkages are replaced by modified internucleoside linkages in order to introduce one or more PS linkages or non-phosphorus derived internucleoside linkages.
[0049] As used herein the term “antisense oligonucleotide” or “ASO” refers to a short strand of nucleotide analogue that generally hybridizes with the complementary RNA in a sequencespecific manner via Watson-Crick base pairing. The ASO does not have to be perfectly complementary to its target sequence. The ASO can comprise DNA and RNA and may be chemically modified. As used herein the terms “antisense oligonucleotide” (ASO) and “oligonucleotide” may be used interchangeably.
[0050] As used herein, the term “complementary” or “partially complementary” or “substantially complementary” refer to nucleic acid sequences, which due to their complementary nucleotides are capable of specific intermolecular base-pairing. For example, the oligonucleotide may comprise a nucleic acid sequence complementary to a target sequence, e.g., ApoB coding DNA or RNA, or any other target sequence. The ASO may be self-complementary. The ASO may be complementary to a coding or non-coding sequence. As those skilled in the art appreciate, in many instances, perfect (e.g., 100%) complementary or pairing is not required and one or more wobbles (wobble base pairing), bulges, mismatches, etc. may be well tolerated. The one or more wobbles, bulges, mismatches, etc. may be within or outside the CBT. . Hence, in one embodiment, the ASOs comprise a wobble base outside the CBT. In one embodiment, the ASO comprises a mismatch outside the CBT. For example, the ASOs may include a mismatch opposite the target nucleoside to be edited, e.g., opposite the target adenosine to be edited. Hence, the complementarity of the ASOs of the invention may be 100%, except at the nucleoside opposite to a target nucleoside to be edited. In some embodiments, the complementarity of the ASOs of the invention may be 100%, except at the nucleoside opposite to a target nucleoside to be edited and at the -2 (N.2) position. In one embodiment, the complementarity is at least 80%, 85%, 90%, 95%. In one embodiment, the complementarity is 85%-99%. In another embodiment, the ASO comprises 1 , 2, 3, 4 or 5 mismatches when aligned with the target nucleic acid. In one embodiment, the ASOs comprise a wobble base outside the CBT. In one embodiment, one or more mismatches are independently a wobble base paring. In one embodiment, the ASOs comprise up to 4 mismatches or wobble bases outside the CBT. In one embodiment, the ASOs comprise up to 3 mismatches or wobble bases outside the CBT..
[0051] As used herein, the term “target RNA” typically refers to an RNA, which is subject to the editing reaction, and is “targeted” by the respective ASO. The “target sequence” is a sequence fragment to which the antisense oligonucleotide is homologous or complementary.
[0052] As used herein, the term “off-target” or “off-targeting” refers to non-specific and / or unintended genetic modification(s) of the target. Off-target editing may include unintended pointmutations, deletions, insertions, inversions, and translocations. For instance, off-target editing may arise from the promiscuous reactivity of the deaminase enzymes.
[0053] The term "modified sugar" refers to a moiety that can replace a naturally occurring sugar. A modified sugar may mimic the spatial arrangement, electronic properties, or some other physicochemical property of a sugar. The naturally occurring sugar is generally the pentose deoxyribose or ribose, though it should be understood that naturally and non-naturally occurring sugar analogues are also included. For example, sugars may comprise C4 sugars, C5 sugars and / or C6 sugars. In some embodiments, a modified sugar is substituted. In some embodiments, a modified sugar is a sugar that is not ribose or deoxyribose as typically found in natural RNA or DNA (e.g., arabinose). In some embodiments, a modified sugar comprises a 2'-modification. Examples of useful 2’-sugar modifications include, e.g., 2’-ribose (RNA), 2’-deoxyribose (DNA), 2’-arabinose etc.. Those skilled in the art, will appreciate that various types of 2’-sugar modifications are known that can be used in accordance with the present disclosure. In one embodiment, the 2’-sugar modification is 2’-ribose. In one embodiment, the 2’-sugar modification is 2’-deoxyribose. The term “locked nucleic acid” (LNA) or “locked nucleic acids” (LNAs) are also known as bridged nucleic acid (BNA) and refers to modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon. In some embodiments, a modified sugar is a bicyclic sugar, e.g., a sugar used in locked nucleic acid (LNA), BNA, etc.. In some embodiments, a modified sugar is an LNA sugar. In some embodiments, a modified sugar is an BNA sugar. In some embodiments, a sugar modification is 2’-OMe, 2'-O-methoxyethyl (2’-MOE), 2’-F, 5’-vinyl, or S-constrained ethyl (S-cEt). In one embodiment, a 2’-modification is a C2-stereoisomer of 2’-F-ribose. In one embodiment, a 2'-modification is 2’-F. In one embodiment, a 2'-modification is 2'-FANA. In one embodiment, a modified sugar is a sugar of morpholino. In one embodiment, the oligonucleotide comprises, e.g., an UNA (unlocked nucleic acid), a PMO (phosphorodiamidate linked morpholino) or a PNA (peptide nucleic acid). In one embodiment, the nucleic acid analogue is a PNA (peptide nucleic acid). In one embodiment, the nucleic acid analogue is PMO (phosphorodiamidate linked morpholino).
[0054] The term “FANA” or “FANA-modified” refers to 2'-fluoroarabinoside modified nucleobases and / or oligonucleotides comprising such nucleobases. For example, the expression “FANA-cytidine” refers to a cytidine that comprises a 2'-fluoro-beta-D-arabinonucleic acid sugar modification. Within the context of this invention, the expression “a derivative thereof” refers to a corresponding nucleotide(s) or oligonucleotide(s) that has been chemically derived from said nucleotide or oligonucleotide(s).
[0055] The term "mutation" as used herein, refers to a substitution of a residue with another residue within a sequence, e.g., a nucleic acid sequence or amino acid sequence, or to adeletion or insertion of one or more residues within a sequence, e.g., point mutation. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Notably, the invention is not limited to correcting mutations, as it may instead be useful to change a wildtype sequence into a mutated sequence using the ASOs of the invention. Various methods for making amino acid substitutions are well known in the art, and are provided by, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)).
[0056] As used herein, the term “beneficial editing” refers to the editing of a target sequence (or base) derived from a wildtype allele (not a mutated allele) in order to, e.g., modulate the function of a wildtype protein in a useful way to prevent or treat a disease. For example, beneficial editing may include sites, such as ApoB that are not causes for genetic diseases but rather represent wild-type protein sites. These sites are mutated (no underlying G-to-A mutation) to alter the function of the wild-type protein. This beneficial change may be an A-to-l change in the target RNA. Notably, beneficial editing can be of an RNAthat is endogenous or exogenous to the subject. In the present invention, there is one or more edited mutations in the ApoB protein at sites Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A. The edited mutation alters the function of the wildtype protein.
[0057] The expression “functionally preserved” in the context of amino acid substitution refers to amino acid replacement in a protein that changes a given amino acid to a different amino acid with similar biochemical properties so as to have a similar or have a better effect on protein function.
[0058] The term “loss-of-function (LOF) mutation” refers to the situation in which a gene product is prevented from being expressed or produced at the normal level such that there is a decrease in the production or activity of the encoded protein. The protein may be partially or wholly inactivated or may be terminated during translation. A complete LOF mutation is also called a null or amorphic mutation.
[0059] The term “compensatory editing” refers to the modification of RNA nucleotides to change and correct one or more detrimental or unfavourable changes in the RNA sequence when compared to wildtype, e.g., a compensatory A-to-l change could help to functionally compensate for an otherwise non-editable mutation to ameliorate a disease phenotype.
[0060] The term "adenosine deaminase(s)" or “adenosine deaminase(s) acting on RNA” [ADAR(s)], as used herein, refers to any (poly)peptide, protein or protein domain or fragment thereof capable of catalysing the hydrolytic deamination of adenosine to inosine. The term thus not only refers to full-length and wild type ADARs but also to a functional fragment or a functional variant of an ADAR. In some embodiments, the ADAR is an (endogenous) adenosinedeaminase catalysing the deamination of adenosine to inosine or deoxy-adenosine to deoxyinosine. In some embodiments, the ADAR catalyses the deamination of adenine or adenosine in deoxyribonucleic acid (DNA) or in ribonucleic acid (RNA). The ADAR may be a human ADAR. The ADAR may be an endogenous ADAR. Accordingly, in some embodiments, the ADAR is an endogenous human ADAR1, ADAR2 or ADAR3 (hADARI , hADAR2 or hADAR3), or any fragment or isoform(s) thereof (e.g., hADARI p110 and p150).
[0061] The term “guide RNA” (gRNA) or “guide oligonucleotide” refers to a piece of RNA or oligonucleotide (comprising RNA and / or DNA) that functions as a guide for enzymes, with which it forms complexes. The guide RNA or guide oligonucleotide may comprise endogenous and / or exogenous sequences. Guide RNAs bind to their target in a sequence-specific manner. Guides can be used in vitro and in vivo. For example, the guide RNA or guide oligonucleotide directs the base-modifying activity / editing function (e.g., ADAR) to the target to be edited in trans.
[0062] The term “canonical transcript” as used herein is a term used in gene analysis and refers to the Ensembl Canonical transcript. Generally, it is a single transcript chosen for a gene which is the most conserved, most highly expressed and has the longest coding sequence and is represented in other key resources such as Ensemble, NCBI and UniProt (mart.ensembl.org / info / genome / genebuild / canonical.html).
[0063] As used herein, the terms “disease” or “disorder” are used interchangeably to refer to a condition in a subject. In certain embodiments, the condition is a disease in a subject, the severity of which is decreased by inducing an immune response in the subject through the administration of a pharmaceutical composition.
[0064] As used herein, the term “effective amount” in the context of administering a therapy to a subject refers to the amount of a therapy which has a prophylactic and / or therapeutic effect(s).
[0065] As used herein, the term “in combination” in the context of the administration of two or more therapies to a subject, refers to the use of more than one therapy (e.g., more than one prophylactic agent and / or therapeutic agent). The use of the term "in combination" does not restrict the order in which therapies are administered to a subject. For instance, one or more ASOs may be used in combination.
[0066] As used herein, the terms “prevent”, “preventing” and “prevention” refer to the inhibition of the development or onset of a disease or symptoms thereof. In one embodiment, it relates to the administration of the compound to a patient who is known to have an increased risk of developing a certain condition, disorder, or disease.
[0067] As used herein, the terms “treat”, “treatment”, and “treating” refer to the halting, ceasing the progression of, or (partially) reversing particular symptoms of a disease or disorder. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease stabilized (i.e., not worsening)state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.
[0068] The terms “subject” or “patient” are used interchangeable and relate to an animal (e.g., mammals) that may need administration of the compound of the invention in the field of human or veterinary medicine. In specific embodiments, the subject is a human. The subject may be administered the oligonucleotide of the invention for beneficial editing. The subject may be administered the oligonucleotide of the invention for compensatory editing.
[0069] As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatine, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The formulation should suit the mode of administration.
[0070] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present disclosure; other, suitable methods and materials known in the art can also be used.Oligonucleotides
[0071] Described herein are, inter alia, chemically modified antisense oligonucleotides (ASOs). While not intending to be bound by any particular theory of operation, it is believed that nucleobase and backbone linkage modifications are useful in stabilising ASOs, improving their editing efficacy, reducing their off-target editing, and / or hydrophobicity. Since the one or more modifications can be synthetically transferred to various oligonucleotide sequences, such modifications have the potential to improve the editing efficacy of oligonucleotides with different target specificities. The ASOs of the invention are useful in changing a wildtype ApoB sequence into a mutated sequence in order to modulate protein expression and / or function (“beneficialediting”). Thus, the oligonucleotides may be used as active agents to treat genetic disorders or diseases associated with ApoB.
[0072] The inventors have realised that in the context of providing oligonucleotides for use in the prevention or treatment of a disease or a condition associated with low-density lipoprotein (LDL) in a subject, wherein the ASO effects site-directed adenosine-to-inosine (A-to-l) editing of a target adenosine, and to achieve a beneficial editing, it is necessary to target a sequence derived from a sequence of an endogenous apoB gene such that the ApoB protein has reduced secretion or protein synthesis. Treatment by means disclosed herein results in reduced ApoB (e.g., reduced Apo B secretion) and reduced levels of LDL-C. The treatment also avoids liver steatosis and / or hepatotoxicity due to ApoB breakdown.
[0073] The inventors have also realised that to provide shorter oligonucleotides for RNA editing and to achieve a beneficial balance of high editing efficacy and low hydrophobicity, it is desirable to incorporate certain backbone linkage and nucleobase modifications and / or mixtures thereof into the oligonucleotides. In particular, depending on the length of the ASO, it is desirable that the ASOs have a mixture of different modifications at the 2’-position of the sugar residue. Specifically, the inventors found that depending on the length and symmetry of the ASO, there are preferred combinations of 2’-sugar and internucleoside linkage modifications that improve target editing. In particular, the inventors have found that combining 2’-F and / or 2’OMe modifications, as well as PO, PS and mesyl linkage modifications improves overall editing when compared to control and ASOs of the prior art. Accordingly, in one embodiment, the oligonucleotide comprises a mixture of 2’-F, 2’OMe modifications, and PO, PS and mesyl linkages.
[0074] The oligonucleotides of the invention are specific to ApoB encoding RNA. Hence, provided herein are oligonucleotides that target the nucleotide sequence for ApoB coding mRNA, wherein the oligonucleotide is selected from the group consisting of various oligonucleotide sequences targeting the nucleotide sequences for ApoB that are disclosed herein.
[0075] Hence, provided herein are antisense oligonucleotides (ASO) for use in the prevention or treatment of a disease or a condition associated with ApoB in a subject, wherein the ASO effects site-directed adenosine-to-inosine (A-to-l) editing of a target adenosine in a target RNA sequence derived from a sequence of an endogenous ApoB gene. Also provided herein are chemically modified oligonucleotides and compositions comprising the same.
[0076] The oligonucleotides provided herein are for use in A-to-l editing of ApoB coding transcripts. Generally, a single adenosine (A) is targeted for editing. However, in some instances more than one adenosines in the target RNA may be edited. Hence, in one embodiment, at least one target adenosine in the target RNA sequence is to be edited. In oneembodiment, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 adenosine(s) is / are to be edited in the target RNA. In one embodiment, 2 adenosines in the target RNA sequence are to be edited. In one embodiment, 3 adenosines in the target RNA sequence are to be edited. In one embodiment, 4 adenosines in the target RNA sequence are to be edited. In one embodiment, 5 adenosines in the target RNA sequence are to be edited. In one embodiment, 6 adenosines in the target RNA sequence are to be edited. In one embodiment, 7 adenosines in the target RNA sequence are to be edited. In one embodiment, 8 adenosines in the target RNA sequence are to be edited. In one embodiment, 9 adenosines in the target RNA sequence are to be edited. In one embodiment, 10 adenosines in the target RNA sequence are to be edited.
[0077] In some embodiments, to achieve a beneficial balance of high editing efficacy and lysosomal stability, it is advantageous to incorporate certain features into the oligonucleotides. It was found that, in some embodiments, introducing a non-canonical nucleobase or nucleoside analogue, in particular inosine, at the -2 position (N.2) with a G:C-rich region enhances target editing. In some embodiments, the oligonucleotides of the invention are modified and designed accordingly.
[0078] In some embodiments, the ASOs of the present invention incorporate a non-canonical nucleobase at the N.2position which replaces a guanosine nucleobase (G) which would normally hybridise with its complementary cytosine (C) on the intended target RNA sequence. The intention therefore is that the non-canonical nucleobase forms a hybrid with C on the target RNA when brought into contact with the target RNA sequence. This forms a less stable bond compared to the G:C bond that would have otherwise been formed. This surprisingly benefits theA-to-l editing process.
[0079] In some embodiments, the invention aims to provide oligonucleotides designed to target RNAs for A-to-l editing carrying a cytosine (C) at the position opposite to the N.2position of the oligonucleotide when the oligonucleotide is aligned with the target RNA, thereby enabling the formation of a non-canonical base:C bond (e.g., I:C bond) and facilitating A-to-l RNA editing. This approach enables the targeting of any RNA for A-to-l editing that contains a cytosine (C) directly 5’ to the CBT in the target RNA, i.e., opposite to the -2 position in the oligonucleotide.
[0080] In some embodiments, a chemically modified oligonucleotide provided herein is capable of binding to a target sequence in a target RNA, wherein the oligonucleotide comprises a central base triplet (CBT) of 3 nucleotides (5’- N+ieNofN-i - 3’) with the central nucleotide (No) directly opposite to the target adenosine in the target RNA, wherein the core oligonucleotide comprises the following sequence: 5’- N+saN+4bN+3cN+2dN+ieNofN-igN.2hN.3 ' N.4 ' N.5k- 3’; and wherein at position -2 (N.2) there is a non-canonical nucleobase or nucleoside analogue, which would otherwise form a G:C bond when hybridised to its target RNA sequence. The term “which would otherwise form a G:C bond when hybridised to its target RNA sequence” is intended todefine the non-canonical base with reference to the target sequence, as the non-canonical base is a substitute for what conventionally would be a guanosine (G) opposite the target cytosine (C). The design therefore takes into account the sequence of the target RNA. The non-canonical base is therefore present at the N.2position when intended to hybridise to a cytosine on the target RNA.
[0081] Inosine is a purine nucleoside formed by hypoxanthine linked to the sugar residue. In one embodiment, the nucleobase is hypoxanthine. In one embodiment, the sugar is ribose. In one embodiment, the sugar is deoxyribose.
[0082] In one embodiment, the nucleoside analogue at position -2 (N.2) is selected from the group consisting of 2'-deoxyinosine (dl), 2'-OH-inosine (rl), 2'-fluoro-inosine (2'-F-l), 2'-ara-fluoro-inosine (2’-FANA-l), 2'-O-methyl (2'-OMe) inosine, 8-aza-inosine, and 2’,2’-di-fluoro-inosine. In one embodiment, the nucleoside analogue is 2’-O-methyl-inosine. In one embodiment, the nucleoside analogue is 1 -methylinosine. In one embodiment, the nucleoside analogue is 2'-O-methylinosine. In one embodiment, the nucleoside analogue is 1 ,2'-0-dimethylinosine. In some embodiments, the wobble base pairing between oligonucleotides of the invention and the respective target RNA at position N.2is an inosine-cytosine (l-C) pairing. In some embodiments, the inosine is chemically modified.
[0083] In some embodiments, introducing 2’-O-methyl-inosine into the oligonucleotide may lead to structural changes within the oligonucleotide and / or when bound to the target RNA. In one embodiment, there is destabilisation of double strand formation between the oligonucleotide and the target RNA.
[0084] It was further shown herein that, in some embodiments, constructs having a 2’-OMe at N.2and a 2’-F at N.3 show high-level RNA editing yields. Hence, in one embodiment, the N.2nucleotide carries a 2’-O-alkyl-modification. In one embodiment, the N.3nucleotide carries a 2’-F-modification. In one embodiment, the N.2nucleotide carries a 2’-O-alkyl-modification, and the N-3 nucleotide carries a 2’-F-modification.
[0085] The oligonucleotides of the invention benefit from having a base level of internucleoside linkage modifications, e.g., at least one linkage that is a phosphorothioate (PS), methanesulfonyl (mesyl) or other linkage. This will have a positive effect on, inter alia, the pharmacokinetics as well as stability, protein binding, intracellular localization, hydrophobicity and cytotoxicity of ASOs.
[0086] In one embodiment of the invention, the chemically modified oligonucleotides of the invention comprise at least one linkage that is a methanesulfonyl (mesyl) linkage. In one embodiment, the mesyl linkage content is at least 10% or 15%, that is at least 10% or 15% of the internucleoside linkages are methanesulfonyl (mesyl) linkages. In one embodiment, the mesyl linkage content is at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,80%, or 90%. In some embodiments, at least 10% of linkages are mesyl modified internucleoside linkages, optionally at least 20%, 30%, 40% or 50%. In one embodiment, no more than 95%, 90%, 85%, 80%, 70%, 60%, 50%, 40%, or 30% of the linkages are mesyl linkages. In one embodiment, at least 5% of the internucleoside linkages are methanesulfonyl (mesyl) linkages. In one embodiment, at least 8% of the internucleoside linkages are methanesulfonyl (mesyl) linkages.
[0087] The specificity sequence of the ASOs of the invention may be described as a 5’ to 3’ (antisense) oligonucleotide or polynucleotide sequence. The specificity sequence and target region will be described with reference to the target “A” (adenosine to be edited). The target A is located at the “zero position” within the target sequence. The specificity sequence site within the ASO that is directly opposite the target “A” to be edited is referred to as the zero position (No). The downstream positions (i.e., 3’ to the No position) are marked -1, -2, -3, etc. (N-i, N.2, N-3, etc.), while the upstream (i.e., 5’ to the No position) positions are numbered +1 , +2, +3 (N+i, N+2, N+3, etc.). Accordingly, an oligonucleotide of the invention may have a general sequence of 5’- > N+5aN+4bN+3cN+2dN+ieNofN-i a N-2hN.31N.4' N.5. -3’.
[0088] Mesyl linkages may be located at any nucleotide position within the oligonucleotides of the invention. For instance, one or more mesyl linkage modifications may be located at internal positions anywhere along the entire length of the oligonucleotide or (only) at the 5’ and / or 3’ terminal ends of the oligonucleotide. Alternatively, in one embodiment, the mesyl linkage is located within a 5’ and / or a 3’ terminus flanking region(s) outside of the CBT (5’ - N+iNoN-i -3’), i.e., upstream of N+iand / or downstream of N-i. In one embodiment, the mesyl linkage is located within the CBT, i.e., between position +1 and 0 and / or between positions 0 and -1. In one embodiment, the mesyl linkage is directly (i.e., adjacent to) upstream of N+i(at position +2). In one embodiment, the mesyl linkage is directly downstream (i.e., adjacent to) of N.i (at position -2). In one embodiment, the oligonucleotide comprises a mesyl linkage within the flanking region 3’ to No. In one embodiment, the oligonucleotide comprises a mesyl linkage within the flanking region 5’ to No. In one embodiment, the oligonucleotide comprises a mesyl linkage within each of the 5’ and 3’ flanking regions. In one embodiment, the oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, or 8 mesyl linkages within the flanking regions 3’ and / or 5’ to No. In one embodiment, the oligonucleotide comprises between 1-20 mesyl linkages 5’ to No. In one embodiment, the oligonucleotide comprises between 1-10 mesyl linkages 3’ to No.
[0089] In one embodiment, the oligonucleotide comprises 2, 3, 4, 5, 6 or 7 mesyl modifications within a 3’ and / or 5’ flanking region(s) outside of the CBT. In one embodiment, the oligonucleotide comprises at least 2, 3, 4, 5, 6, or 7 mesyl modifications within a 3’ and / or 5’ flanking region(s) outside of the CBT. In one embodiment, the 5' terminus flanking region comprises the terminal 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide (s) of the oligonucleotide,preferably wherein the 5' terminus flanking region comprises the outermost 6, 5, 4, 3, 2, or 1 nucleotide(s). In one embodiment, the 3' terminus flanking region comprises the terminal 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) of the oligonucleotide, preferably wherein the 3' terminus flanking region comprises the outermost 4, 3, 2, or 1 nucleotide(s).
[0090] In one embodiment, the oligonucleotide comprises 1, 2, or 3 mesyl linkages within the 3’ and / or 5’ terminus flanking region(s). In one embodiment, the 1 , 2, or 3 mesyl linkages within the 3’ and / or 5’ terminus flanking region(s) are between the terminal 1, 2, 3 and 4 nucleotides of the 5’ and / or 3’ terminus. That is, in one embodiment, the 1 , 2, or 3 mesyl linkages are located between the outermost 5 nucleotides of the 5’ and / or outermost 4 nucleotides of the 3’ terminus of the oligonucleotide. In one embodiment, the 1 or 2 mesyl linkages are located between the outermost 2 or 3 nucleotides of the 5’ and / or outermost 2 or 3 nucleotides of the 3’ terminus of the oligonucleotide.
[0091] In other embodiments, the oligonucleotide comprises a mesyl linkage between the terminal and penultimate nucleotide of the 5’ terminus and a mesyl linkage between the terminal and penultimate nucleotide of the 3’ terminus. In other embodiments, the oligonucleotide comprises 2 mesyl linkages at the 5’ terminus, which are placed between the terminal 3 nucleotides of the 5’ terminus. In other embodiments, the oligonucleotide comprises 2 mesyl linkages at the 3’ terminus, which are placed between the terminal 3 nucleotides of the 3’ terminus. In one embodiment, the oligonucleotide comprises 2 mesyl linkages at the 5’ terminus, which are placed between the terminal 3 nucleotides of the 5’ terminus and 2 mesyl linkages at the 3’ terminus, which are placed between the terminal 3 nucleotides of the 3’ terminus.
[0092] . The oligonucleotides of the invention may contain internal mesyl linkages or mesyl linkages at the 5’ and / or 3’ terminal ends. As used herein, “internal mesyl linkages” are those linkages that are not located between the terminal two nucleotides of the 5’ or 3’ terminus. In one embodiment, the mesyl linkage is located at position -6. In one embodiment, the mesyl linkage is located at position -5. In one embodiment, the mesyl linkage is located at position +18. In one embodiment, the mesyl linkage is located at position +19. In one preferred embodiment, the mesyl linkage is located at position -2. In one preferred embodiment, the mesyl linkage is located at position -7. In one preferred embodiment, the mesyl linkage is located at position +4. In one preferred embodiment, the mesyl linkage is located at position +13. In one preferred embodiment, the mesyl linkage is located at position +21. In one preferred embodiment, the mesyl linkage is located at position +23.
[0093] Accordingly, in one embodiment, the oligonucleotide comprises mesyl linkages at positions +24, +23, +13, -2, -7 and -8. In one embodiment, the oligonucleotide comprises mesyl linkages at positions +24, +21, +13, +4, -7 and -8. In one embodiment, the oligonucleotide comprises mesyl linkages at positions +24, +23, +21 , +13, +4, -2, -7 and -8. In one embodiment,the oligonucleotide comprises mesyl linkages at positions +24, +23, -2, -7 and -8. in one embodiment, the oligonucleotide comprises mesyl linkages at positions +24, +23, -7 and -8. In one embodiment, the oligonucleotide comprises mesyl linkages at positions +24, -2, and -8. In one embodiment, the oligonucleotide comprises mesyl linkages at positions +24 and -8.
[0094] Alternatively, or additionally mesyl linkages may be located at the terminal nucleotides of the ASO of the invention, i.e., between the terminal and penultimate nucleotide of the 5’ and / or 3’ end of the ASO. In one embodiment, a mesyl linkage is located in the 5’ and / or 3’ flanking regions of the ASO. In one embodiment, a mesyl linkage is located at position +24 and / or at position -8.
[0095] The chemically modified oligonucleotides of the invention may be symmetrical, which means that the two nucleotide sequences adjacent to the CBT have the same length, or not symmetrical (asymmetrical or asymmetric design), which means that the two sequences flanking the CBT, i.e., the regions 5’ and 3’ to the CBT and / or position No, have different lengths. The asymmetric design enables a more flexible use of the sequence space around the target. Hence, in one embodiment, the the oligonucleotide comprises an asymmetric design. In one embodiment, the oligonucleotide has: (i) a length of 25 to 30nt located 5’ to No, and (ii) a length of 5 to 20nt located 3’ to No.
[0096] In some embodiments, oligonucleotides of different lengths may require a different mixture of particular 2’-modifications and internucleoside linkage modifications in order to provide optimal RNA editing. In some embodiments, the shorter the oligonucleotide, the better might be the endosomal escape. In some embodiments, toxicity of the particular oligonucleotide may also depend on its length. In some embodiments, shorter oligonucleotides may experience higher specificity. In some embodiments, longer oligonucleotides may bind stronger or faster to their respective RNA target,. In some embodiments, editing-boosting bulges, mismatches and wobbles may also work better in long oligonucleotides. As a result, there is a benefit and / or trade-off for both long and short oligonucleotides of the invention.
[0097] The oligonucleotides may be of varying lengths. For instance, in some embodiments, the oligonucleotide has a length of between 20 and 200 nucleotides. In some embodiments, oligonucleotides range from about 23-80 nucleotides in length, e.g., about 23-50 nucleotides (nt) in length or about 40-80 nucleotides in length. In certain embodiments, the oligonucleotide has a length of 23-80 nucleotides. In one embodiment, the oligonucleotide is 30-50 nt long. In some embodiments, the oligonucleotide has a length of 23-80, 23-70, 23-60, 23-50, 25-45, or 30-45, nucleotides. In some embodiments, the oligonucleotide has a length of 25-80, 25-70, 25-60, or 25-50nucleotides. In some embodiments, the oligonucleotide has a length of 30-80, 30-70, 30-60, 30-50, 30-40 nucleotides. In some embodiments, the oligonucleotide has a lengthof 40-80 or 45-50 nucleotides. In one embodiment, the oligonucleotide has a length of no more than 45 nucleotides. In one embodiment, the oligonucleotide has a length of 45nt.
[0098] In some embodiments, the oligonucleotide has a length of at least 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides. In one embodiment, the oligonucleotide has a length of 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides. In one embodiment, the oligonucleotide has a length of 25 nucleotides. In one embodiment, the oligonucleotide has a length of 30 nucleotides. In one embodiment, the oligonucleotide has a length of 32 nucleotides. In one embodiment, the oligonucleotide has a length of 33 nucleotides. In one embodiment, the oligonucleotide has a length of 34 nucleotides. In one embodiment, the oligonucleotide has a length of 35 nucleotides. In one embodiment, the oligonucleotide has a length of 36 nucleotides. In one embodiment, the oligonucleotide has a length of 40 nucleotides. In one embodiment, the oligonucleotide has a length of 45 nucleotides. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.
[0099] Without being bound by any theory, inventors submit that the ideal asymmetry for each target might depend on the length and the specific underlying sequence of the particular oligonucleotide. The inventors previously showed that for asymmetric ASOs, a shorter overall oligonucleotide is sufficient for high editing efficacy compared to the symmetric design (WO 2022 / 253810). It is known that ADAR works as an asymmetric dimer with a footprint of up to 50 bp. While some substrates are more efficiently edited by the deaminase domain alone rather than by the full-length protein, the opposite holds true for other substrates. This suggests that depending on the size of the target / drug RNA helix, ADAR might bind in different ways. This leads to a situation, wherein, depending on the length of the ASO, specific (a)symmetries on the target adenosine and specific modifications patterns (e.g., sugar and internucleoside linkage modifications) are preferred. For an optimal binding of the deaminase, a short 3’ terminus seems to be sufficient (at least 5 nt beside the CBT). On the other hand, the 5’ terminus may provide binding space for the dsRBDs and thus typically requires more nucleotides (at least 19 nt beside the CBT). As previously described, the oligonucleotides of the invention have the following structural scheme: (length of 5’ terminus) - (1) - (length of 3’ terminus), wherein 1 corresponds to the central nucleotide of the CBT opposite of the target A. For example, an ASO of the invention with a length of 45 and an asymmetry of “29-1-15”, has a 5’ terminus that is29nt long and a 3’ terminus that is 15nt long. In one embodiment, the oligonucleotide is asymmetric.
[0100] According to the invention, the ASO may be asymmetric. Hence, in one embodiment, the chemically modified oligonucleotide of the invention comprises an asymmetric design, wherein there is a different number of nucleotides 5’ and 3’ of No. For instance, there may be 20-30nt at the 5’ terminus (5’ to No) and 5-20nt at the 3’ terminus (3’ to No). In one embodiment, there are 24-29nt 5’ to No, and 8-15nt 3’ to No. In some embodiments, there are 24nt 5’ of the CBT. In some embodiments, there are 25nt 5’ of the CBT. In some embodiments, there are 29nt 5’ of the CBT. In one embodiment, there are no more than 29nt 5’ of the CBT. In one embodiment, the 5’ terminus is shortened to a length of 24nt or 25nt 5’ of the CBT. In some embodiments, there are up to 15nt 3’ of the CBT. In some embodiments, there are no more than 15nt 3’ of the CBT. In some embodiments, the 3’ terminus is shortened to a length of 15nt 3’ of the CBT. In some embodiments, the 3’ terminus is shortened to a length of 8nt 3’ of the CBT. In one embodiment, the region 3’ to the CBT contains 8nt or 15nt.
[0101] In one preferred embodiment, the oligonucleotide has an asymmetry of 25-1-8 in a 5' to 3' direction. In one preferred embodiment, the oligonucleotide has an asymmetry of 25-1-8 in a 5' to 3' direction, and wherein the mesyl linkage is located at positions +24, -2, and -8. In one preferred embodiment, a further mesyl linkage is located at position +4 and / or position +13. In one preferred embodiment, a further mesyl linkage is located at position +21 , and optionally at position -7 and -23.
[0102] In one preferred embodiment, the oligonucleotide has an asymmetry of 29-1-8 in a 5' to 3' direction. In one embodiment, the oligonucleotide contains mesyl, PS and / or PO linkages. In one preferred embodiment, the oligonucleotide has an asymmetry of 29-1-15 in a 5' to 3' direction. In one embodiment, the oligonucleotide contains mesyl, PS and / or PO linkages. In one preferred embodiment, the oligonucleotide has an asymmetry of 24-1-8 in a 5' to 3' direction. In one embodiment, the oligonucleotide contains mesyl, PS and / or PO linkages.
[0103] In one embodiment, the oligonucleotide is AI-2771 . In some embodiments, the oligonucleotide comprises SEQ ID NO: 1. In one embodiment, the oligonucleotide is AI-2772. In some embodiments, the oligonucleotide comprises SEQ ID NO: 2. In one embodiment, the oligonucleotide is AI-2780. In some embodiments, the oligonucleotide comprises SEQ ID NO: 3. In one embodiment, the oligonucleotide is AI-2781. In some embodiments, the oligonucleotide comprises SEQ ID NO: 4. In one embodiment, the oligonucleotide is AI-2773. In some embodiments, the oligonucleotide comprises SEQ ID NO: 5. In one embodiment, the oligonucleotide is AI-2774. In some embodiments, the oligonucleotide comprises SEQ ID NO: 6. In one embodiment, the oligonucleotide is AI-2775. In some embodiments, the oligonucleotide comprises SEQ ID NO: 7. In one embodiment, the oligonucleotide is AI-2776.In some embodiments, the oligonucleotide comprises SEQ ID NO: 8. In one embodiment, the oligonucleotide is AI-2779. In some embodiments, the oligonucleotide comprises SEQ ID NO: 9.
[0104] In one embodiment, the oligonucleotide is AI-3075. In some embodiments, the oligonucleotide comprises SEQ ID NO: 11. In one embodiment, the oligonucleotide is AI-2763. In some embodiments, the oligonucleotide comprises SEQ ID NO: 12.
[0105] In one embodiment, the oligonucleotide is AI-3437. In some embodiments, the oligonucleotide comprises SEQ ID NO: 77. In one embodiment, the oligonucleotide is AI-3811. In some embodiments, the oligonucleotide comprises SEQ ID NO: 78. In one embodiment, the oligonucleotide is AI-3810. In some embodiments, the oligonucleotide comprises SEQ ID NO: 79. In one embodiment, the oligonucleotide is AI-4140. In some embodiments, the oligonucleotide comprises SEQ ID NO: 80. In one embodiment, the oligonucleotide is AI-3428. In some embodiments, the oligonucleotide comprises SEQ ID NO: 81. In one embodiment, the oligonucleotide is AI-3432. In some embodiments, the oligonucleotide comprises SEQ ID NO: 82. In one embodiment, the oligonucleotide is AI-3555. In some embodiments, the oligonucleotide comprises SEQ ID NO: 83. In one embodiment, the oligonucleotide is AI-3556. In some embodiments, the oligonucleotide comprises SEQ ID NO: 84. In one embodiment, the oligonucleotide is AI-3523. In some embodiments, the oligonucleotide comprises SEQ ID NO: 85. In one embodiment, the oligonucleotide is AI-3524. In some embodiments, the oligonucleotide comprises SEQ ID NO: 86. In one embodiment, the oligonucleotide is AI-3525. In some embodiments, the oligonucleotide comprises SEQ ID NO: 87. In one embodiment, the oligonucleotide is AI-3500. In some embodiments, the oligonucleotide comprises SEQ ID NO: 88. In one embodiment, the oligonucleotide is AI-3560. In some embodiments, the oligonucleotide comprises SEQ ID NO: 89. In one embodiment, the oligonucleotide is AI-3809. In some embodiments, the oligonucleotide comprises SEQ ID NO: 90.
[0106] Furthermore, the ASO of the invention may comprise 2’-fluoro (2’-F) and / or 2’0me modifications. In one embodiment, at least 20%, 30%, 40%, 50% or 60% nucleotides are fluoro (F)-modified at the 2’ position of the sugar residue. In one embodiment, the oligonucleotide comprises 5 to 202’-F modifications. In one embodiment, the oligonucleotide comprises 122’-F modifications. In one embodiment, a 2’-F modification is located at one or more of the following positions selected from the group consisting of: +22, +21 , +19, +17, +16, +15, +14, +13, +11, +9, +8 +7, +6, +5, +3, +2, +1, and -3. In one embodiment, the 2’-F modification is located at position +22, +21 , +19, +16, +15, +13, +11, +9, +7, +5, +2, and -3.
[0107] In one embodiment, at least 20%, preferably 30-70%, more preferably 40-60% of the chemical modifications outside the CBT are 2'-O-methyl (2’-OMe) substituents.
[0108] In one embodiment, each RNA nucleoside is replaced by either a 2’-modified RNA or DNA. In addition to the at least one linkage that is a methanesulfonyl (mesyl) linkage the oligonucleotide may comprise a phosphodiester (PO) linkage and / or internucleoside linkage modifications such as phosphorothioate (PS) or phosphoryl guanidine (PN) linkages. In one embodiment, the oligonucleotide comprises one or more internucleoside linkages selected from the group consisting of PN, PO and PS. In one embodiment, a further internucleoside linkage is a PS linkage. In one embodiment, at least 40% of linkages are PS linkages. In one embodiment, between 40% and 65% of linkages are PS linkages. In one embodiment, the internucleoside linkage modification is a 3’-3’ or 5’-5’ phosphate ester bonds (3-P-3' and 5-P-5'). In one embodiment, the natural 3’-5’ phosphodiester linkage is replaced by modified internucleoside linkages. In some embodiments, the naturally occurring one or more PO linkages are replaced by modified internucleoside linkages to introduce one or more PS linkages or non-phosphorus derived internucleoside linkages. In one embodiment, an internucleoside linkage is a PS linkage. In one embodiment, an internucleoside linkage is a stereorandom PS linkage. In one embodiment, an internucleoside linkage is a chirally controlled PS linkage. In one embodiment, an internucleoside linkage is not a chirally controlled PS linkage.
[0109] In addition to the design features mentioned before, the chemically modified oligonucleotides may comprise at least one nucleotide of the CBT modified at the 2’-position of the sugar base or being deoxyribonucleosides, which permits added stabilization against nuclease digestion. Hence, in certain embodiments, the CBT is chemically modified. The CBT (5’...- N+I-NQ-N-I -...3’) may carry different modifications and permutations of the various modifications. That is, positions N+i, No and / or N-i may carry modifications at the 2’ position. In one embodiment, only one position within the CBT is chemically modified. In one embodiment, two positions within the CBT are chemically modified. In one embodiment, all positions within the CBT are chemically modified.
[0110] In one embodiment, at least one of the three oligonucleotides of the CBT is a deoxyribonucleotide. In one embodiment, at least one of the three nucleotides of the CBT is chemically modified at the 2’ position of the sugar residue. In one embodiment, at least one of the three oligonucleotides is 2’-FANA-modified. In one embodiment, at least one of the three oligonucleotides is -O-methyl-modified. In one embodiment, at least one of the three oligonucleotides is 2’-F-modified. In some embodiments, at least one of the three nucleotides of the CBT is chemically modified at the 2’-position of the sugar residue, a deoxyribonucleoside, or a combination thereof. In one embodiment, the chemical modification at the 2’ position is one or more of the following: (i) N+iis 2’-fluoro (2’-F), 2’-fluoroarabinoside (2’-FANA),deoxyribonucleic acid (DNA), 2‘-O-Methoxyethyl (2’-MOE) or 2'-O-Methyl (2’-0Me); and / or (ii) No is 2'-FANA or DNA; and / or (iii) N-i is 2'-FANA, DNA or 2’-0Me. In one embodiment, N-i is 2’-0Me. In one embodiment, (i) N+iis 2‘-O-Methoxyethyl (2’-MOE); (ii) No is DNA; and (iii) N-i is DNA.
[0111] In one embodiment, at least two of the three nucleotides of the CBT are chemically modified at the 2'-position of the sugar residue, a deoxyribonucleoside, or a combination thereof. In some embodiments, N+iis 2'-F, 2’-FANA, DNA, or 2’-OMe; and / or No is 2'-FANA or DNA; and / or N-i is 2'-FANA, DNA, or 2’-O-methyl. In one embodiment, N+iis DNA. In one embodiment, N+iis 2’-F. In one embodiment, N+iis 2’-FANA. In one embodiment, No is 2'-FANA. In one embodiment, No is DNA. In one embodiment, N-i is 2'-FANA. In one embodiment, N.1 is DNA.
[0112] According to one embodiment, each of the three nucleosides of the CBT is either singularly or a combination of: (a) a deoxyribonucleotide; and / or (b) 2’-fluoroarabinoside (2’-FANA) modification; and / or (c) 2’-O-methyl (2’-OMe) modification; and / or (d) 2’-fluoro (2’-F) modification.
[0113] In one embodiment, the middle or centre nucleotide (No) of the CBT does not comprise a 2’-sugar modification, although it may be a deoxyribonucleotide. In one embodiment, No does not comprise a 2’-alkyl modification. In one embodiment, No does not comprise a 2’-OMe modification.
[0114] In some embodiments, the CBT comprises no cytosine analogues. In one embodiment, the CBT does not comprise pseudoisocytidine (PiC) or 6-amino-5-nitro-2(1 H)-pyridone. In one embodiment, the CBT does not comprise a Benner’s base Z (dZ). In other embodiments, the CBT does not comprise a cytidine analogue such as, for example, 5- hydroxyC-H+, 5-aminoC-H+ and 8-oxoA (syn). Hence, in one embodiment, (i) No comprises no 2’-sugar modification, preferably wherein No comprises no 2’-alkyl modification (e.g., no 2’OMe modification), and / or (ii) the CBT comprises no cytosine analogues.
[0115] The oligonucleotides of the invention may also comprise modifications to the nucleotides positioned outside of the CBT. For example, the sugar or base of the one or more nucleotides may be modified. This is typically to provide greater resistance to nuclease attack in vivo. In one embodiment, the oligonucleotide incorporates modifications at one or more of the 2’-position of the nucleotides and these modifications are composed of different groups. In one embodiment, the oligonucleotide comprises a mixture of 2’-O-alkyl, 2’-F, 2’-MOE, 2'-FANA and / or LNA modifications. The oligonucleotides may comprise any permutation of these 2’-sugar modifications.
[0116] In one embodiment, at least 50%, more preferably at least 80% of the nucleotides outside the CBT are modified independently from another at the 2’ position of thesugar residue. In one embodiment, the 2’-sugar modification is selected from 2’-F, 2’-FANA, 2’-O-alkyl, 2’-O-methoxyethyl (2’-MOE), and / or locked nucleic acid (LNA). In one embodiment, the 2’-O-alkyl modification is a 2’-OMe modification. However, the oligonucleotides of the invention preferably do not contain blocks of more than 6 continuous nucleotides modified in the same way. In one embodiment, the oligonucleotides preferably do not contain blocks of more than 6 continuous 2’-0Me- or 2’-F-modified nucleotides. In one embodiment, the oligonucleotides preferably do not contain blocks of more than 5, 4, or 3 continuous 2’-0Me- or 2’-F-modified nucleotides. In one embodiment, the oligonucleotides preferably do not contain blocks of more than 4 continuous 2’-0Me- or 2’-F-modified nucleotides.
[0117] In one embodiment, a 2’-sugar modification is a 2’-O-alkyl modification. In one embodiment, a 2’-O-alkyl modification is a 2’-OMe, 2’-0-ethyl, or 2’-O-propyl modification. In some embodiment, a 2’-sugar modification is a 2'-MOE modification. In one embodiment, a 2’-sugar modification is 2'-OMe. In some embodiments, a 2'-sugar modification is 2'-MOE. In some embodiments, a 2'-sugar modification is 2'-OR, wherein R is substituted C1-10 aliphatic. In some embodiments, a 2’-sugar modification is 2’-F. In some embodiments, a 2’-sugar modification is 2'-FANA.
[0118] In a preferred embodiment, a mixture of 2’-F- and 2’-O-alkyl-modifications is beneficial to editing and that a minimum of 10% of each is desirable. In some embodiments, the oligonucleotide comprises a mixture of 2’-F- and 2’-O-alkyl-modifications and a minimum of 15% of each 2’-F- and 2’-O-alkyl-modifications. In some embodiments, the oligonucleotide comprises a mixture of 2’-F- and 2’-O-alkyl-modifications and a minimum of 20% of each 2’-F-and 2’-O-alkyl-modifications. In some embodiments, the oligonucleotide comprises a mixture of 2’-F- and 2’-O-alkyl-modifications and a combined minimum of 15%-20%, 20-30%, 30%-40%, 40-50% or 40-60% of 2’-F- and 2’-O-alkyl-modifications.
[0119] In some embodiments, the oligonucleotide comprises at least 10% of 2’-F, 2’-OMe, 2’-MOE and / or 2'-FANA modifications. In some embodiments, the oligonucleotide comprises at least 15%, 20%, 25%, 30%, 35%, 40% of 2’-F, 2’-OMe, 2’-MOE or 2'-FANA modifications. In some embodiments, the oligonucleotide comprises at least 15%, 20%, 25%, 30%, 35%, 40% of 2’-F, 2’-OMe, 2’-MOE and 2'-FANA modifications.
[0120] The oligonucleotides of the invention may not carry a 2’-sugar modification in some of the positions. In one embodiment, not all nucleotides comprise a 2’-alkyl modification. In some instances, the 2’-O-alkyl modification is not a 2'-MOE. In some instances, the 2’-modification is not a 2'-OMe, 2’-F or 2’-LNA modification. In some embodiments, not all 2’-sugar modifications are 2’-O-alkyl modifications. In some embodiments, not all 2’-sugar modifications are 2’-F modifications. In some embodiments, not all 2’-sugar modifications are 2’-MOE modifications.
[0121] The oligonucleotides of the invention may comprise RNA and / or DNA. Also, the oligonucleotides may comprise modifications at the 2’-position of the sugar residue. In one embodiment, 20-100%, 30-100%, 40-100%, 50-100%, 60-100%, 70-100%, 80-100%, or 90-100% of nucleotides are DNA or 2’-modified. In one embodiment, 20-100% of nucleotides are DNA or 2’-modified. In one embodiment, 50-100% of nucleotides are DNA or 2’-modified nucleotides. In one embodiment, 100% of nucleotides are DNA or 2’-modified nucleotides. In one embodiment, 30-95%, 40-95%, 40-90%, 50-95%, 50-90%, 60-95% or 60-90% of nucleotides are DNA or 2’-modified nucleotides. In some embodiments, the DNA content of the oligonucleotide is between 0-10%. In one embodiment, the DNA content is between 1-9%, preferably between 1-7%. In one embodiment, the DNA content is between 1-6%, Preferably between 1-5%. In one embodiment, the DNA content is between 1-4%, optionally between 1-3%. In one embodiment, the DNA content is less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, or 3%.
[0122] In one embodiment, no more than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10% of nucleotides outside the CBT are deoxynucleotides. In some embodiment, no more 10%, optionally no more than 8%, optionally no more than 6% of nucleotides outside the CBT are deoxynucleotides. In one embodiment the above percentages are satisfied with only 2’-modified nucleotides and no DNA. In some embodiments, the oligonucleotide comprises no DNA. In one embodiment, only 1 nucleotide outside the CBT is deoxynucleotide. In one embodiment, no more than 2 nucleotides outside the CBT are deoxynucleotides. In one embodiment, no more than 4 nucleotides outside the CBT are deoxynucleotides. In one embodiment, no more than 3 nucleotides outside the CBT are deoxynucleotides. In one embodiment, no more than 5 nucleotides outside the CBT are deoxynucleotides. In one embodiment, no more than 6 nucleotides outside the CBT are deoxynucleotides. In some embodiment, no more than 7 nucleotides outside the CBT are deoxynucleotides.
[0123] The oligonucleotides of the invention may specifically comprise 2’-F and / or 2’-OMe modifications. In one embodiment, the oligonucleotide comprises one or more 2’-F modifications. In one embodiment, no more than 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of nucleotides are 2’-F-modified. In one embodiment, at least 5%, 10%, 20%, 30%, 40%, 50%, or 60% of nucleotides are 2’-F-modified. In one embodiment, no more than 35% of nucleotides are 2’-F modified. In one embodiment, 30-60% of nucleotides are 2’-F-modified. In one embodiment, 20-70%, preferably 30-45%, of nucleotides are 2’-F-modified. In one embodiment, 35-65% of nucleotides are 2’-F-modified.
[0124] Oligonucleotides may also comprise 2’-O-methyl (2’-OMe) modifications. In one embodiment, the oligonucleotide comprises one or more 2’-OMe modifications. In one embodiment, no more than 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of nucleotides are 2’-OMe-modified. In one embodiment, 20-60% of nucleotides are 2’-OMe-modified. In oneembodiment, 5-55%, preferably 25-55% of nucleotides are 2’-OMe-modified. In one embodiment, at least 20%, preferably 30-70%, more preferably 40-60% of the chemical modifications outside the CBT are 2'-O-methyl substituents.
[0125] The chemically modified oligoribonucleotide according to the invention may comprise a general core sequence of formula I: 5’- > N+saN+4bN+3cN+2dN+i6NofN-igN-2hN-3 ' N-4jN-5 -3’ (formula I). In this formula I there is a Central Base Triplet (CBT) of three nucleotides, whereby the central nucleotide is designated by "0". The nucleotide designated as "0" and the two nucleotides directly adjacent to nucleotide "0" having the number -1 and +1 are designated as a Central Base Triplet, whereby the central nucleotide designated as "0" is directly opposite to the target adenosine in the target RNA. The nucleotide of formula I is flanked at the 5'-and (adjacent to nucleotide +5) and at the 3'-end (adjacent to nucleotide -4) with further oligonucleotide sequences, which may have either the same length or different lengths.
[0126] In one embodiment the ASO has a length of 20-80 nucleotides (nt) comprising: (i) a nucleic acid sequence substantially complementary to the target RNA sequence derived from the endogenous apoB gene; and (ii) a central base triplet (CBT) of 3 nucleotides (5’ - N+iNQ N-I - 3’) with a central nucleotide (No) that is directly opposite to the target adenosine to be edited when the ASO is hybridised to the target RNA sequence.
[0127] The positioning of additional, chemically distinct internucleoside linkages within the oligonucleotide of the invention plays an important role when determining a balance between high editing yields, a long half-life and cytotoxicity. To obtain improved stabilization and editing, oligonucleotide linkages may be modified at particular positions within the oligonucleotide sequence (formula I). In one embodiment, the oligonucleotide comprises one or more chemical modifications. In one embodiment, the oligonucleotide comprises a chemical modification at the 2’-postiion of the sugar residue.
[0128] Oligonucleotides of different lengths may require a different mixture of particular 2’-modifications and internucleoside linkage modifications in order to provide optimal RNA editing. The shorter the oligonucleotide, the better may be the endosomal escape. Moreover, cytotoxicity of the particular oligonucleotide may also depend on its length. Also, shorter oligonucleotides may experience higher specificity. On the other hand, while longer oligonucleotides may bind stronger or faster to their respective RNA target, editing-boosting bulges, mismatches and wobbles may also work better in long oligonucleotides. As a result, there is a benefit and / or trade-off for both long and short oligonucleotides of the invention.
[0129] A higher 2’-F content may improve editing and may compensate for shortening of the overall length of the oligonucleotide. In some embodiments, at least 10%, 20%, 30%, 40%, 50% or 60% nucleotides are fluoro (F)-modified at the 2’ position of the sugar residue, optionally wherein the 2’-F modification is at one or more of the following positions: 29, 28, 25,.23, 21, 17, 15, 14, 13, 9, 7, 6, 5, 4, 3, 1, -3, -6, -7, -8, -10, -12, -13, -14, and -15. In one embodiment, the 2’-F modification is at one or more of the foliowing positions: 29, 28, 25, 23, 21 , 17, 15, 14, 13, 9, 7, 6, 5, 4, 3, 1, -3, -6, -7, -8, -10, -12, -13, -14, and -15. In a preferred embodiment, the 2’-F modification is at one or more of the following positions: 29, 28, 23, 21, 15, 9, 7, 6, 5, 3, 1, -10, -13, -14, and -15. In one embodiment, the 2’-F modification is at one or more of the following positions: 28, 23, 21 , 9, 1 , -13 and -14. In some embodiments, about 10%-20%, 20%-30%, 30%-40%, or 50%-60% nucleotides are F-modified at the 2’ position of the sugar residue. In one embodiment, the oligonucleotide has a length of 30-50nt and 4-20 2’-F modifications. In one embodiment, the oligonucleotide has a length of 40-50nt and 2-19 2’-F modifications.
[0130] In one embodiment, the oligonucleotide comprises an internucleoside linkage modification selected from the group consisting of PS, 3'-methylenephosphonate, 5'-methylenephosphonate, 3'-phosphoroamidate, 2'-5'-phosphodiester, and PN. In a preferred embodiment, the internucleoside linkage modification is a PS linkage. In one embodiment, the internucleoside linkage modification is a 3'-methylenephosphonate linkage. In one embodiment, the internucleoside linkage modification is a 5'-methylenephosphonate linkage. In one embodiment, the internucleoside linkage modification is a 3'-phosphoroamidate linkage. In one embodiment, the internucleoside linkage modification is a 2'-5'-phosphodiester linkage. In one embodiment, the internucleoside linkage modification is a PN linkage. In one embodiment, the nucleic acid analogue is a PNA (peptide nucleic acid). In one embodiment, the nucleic acid analogue is PMO (phosphorodiamidate linked morpholino). In one embodiment, the at least one internucleoside linkage modification is PS. In one embodiment, the oligonucleotide contains a continuous stretch of PS linkages. In one embodiment, the continuous stretch of PS linkages is 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 or more linkages long.
[0131] 2’-MOE residues are used for splice switching oligonucleotides and typically have very low cytotoxicity. However, due to their bulkiness they are not well accepted in larger quantities. The inventors of the invention have realized that 2’-MOE modifications could be placed 5’ and 3’ of the CBT and / or at the termini of the oligonucleotides without reducing the overall editing of the ASO. Specifically, the inventors realised that the amount of 2’-MOE modifications could be limited to about no more than about 6, 7, or 8 nucleotides to still obtain good RNA editing. Therefore, the oligonucleotide may comprise no more than 6, 7, or 82’-MOE modifications. In one embodiment, the oligonucleotide comprises 2’-MOE terminal blocks at the 5’ and 3’ termini, wherein at each terminus there are no more than 4 nucleotides with 2’-MOE, preferably no more than 3 nucleotides with 2’-MOE. In one embodiment, at each terminus there are no more than 4 nucleotides with 2’-MOE, preferably no more than 3 nucleotides with 2’-MOE. In one embodiment, the oligonucleotide comprises 2’-MOE terminal blocks at the 5’and 3’ termini, wherein at each terminus there are no more than 4 nucleotides with 2’-MOE. In one embodiment, the oligonucleotide comprises 2’-MOE terminal blocks at the 5’ and 3’ termini, wherein at each terminus there are no more than 3 nucleotides with 2’-MOE. Notably, 2’-MOE modification may also be located at internal positions within the ASOs of the invention. In one embodiment, there is a 2’-MOE at position +17. In one embodiment, there is a 2’-MOE at position +14. In one embodiment, there is a 2’-MOE at position +12. In one embodiment, there is a 2’-MOE at position +8. In one embodiment, there is a 2’-MOE at position +6. In one embodiment, there is a 2’-MOE at position +3. In one embodiment, there is a 2’-MOE at position +1. In one embodiment, there is a 2’-MOE at position -4. In one embodiment, there is a 2’-MOE at positions +17, +14, +8, +6, +3, +1 , and -4.
[0132] In one embodiment, the oligonucleotide does not comprise any 2’-O-methoxyethyl (2’-MOE) modifications at the outermost three nucleotides of the 3’ terminus and / or the 5’ terminus.
[0133] In one embodiment, the oligonucleotide comprises an iso-uridine (SbU) modification, optionally wherein the SbU modification is at position zero (0; No).
[0134] In one embodiment, the oligonucleotide does not comprise any PN modifications at the outermost three nucleotides of the 3’ terminus and / or the 5’ terminus.
[0135] In one embodiment, the oligonucleotide does not comprise any methylphosphonate (MP) linkage modifications.
[0136] Locked nucleic acid (LNA) is a structurally rigid modification that increases the binding affinity of a modified oligonucleotide. In one embodiment, the oligonucleotide comprises terminal LNAs, wherein the oligonucleotide comprises 2 to 5 LNAs at each terminus. In one embodiment, the oligonucleotide comprises 2 LNAs at each terminus. In one embodiment, the oligonucleotide comprises 2 LNAs at the 5’ terminus. In one embodiment, there is no 2’-MOE modification within the CBT.
[0137] Oligonucleotides may have a general structure of (length of 5’ terminus) - (1) -(length of 3’ terminus), wherein 1 corresponds No or to the central nucleotide of the CBT opposite of the target A. The region 3’ to No is referred to as the “3’ flanking region” or “3’ terminus flanking region”. The region 5’ to No is referred to as the “5’ flanking region” or “5’ terminus flanking region”. In one embodiment, the 3' terminus flanking region comprises the terminal 6, 5, 4, 3, 2 or 1 nucleotide(s) of the 3’ end of the oligonucleotide; and the 5' terminus flanking region comprises the terminal 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) of the 5’ end of the oligonucleotide. In one embodiment, the 5’ terminal flanking region(s) is the outermost 1-5, 1- 6, 1-7, 1-8, 1-9, 1-10, 1-11, or 1-12 nucleotides. In one embodiment, the 5’ terminal flanking region(s) is the outermost 1-4, 1-5, 1-6, 1-7, or 1-8 nucleotides.
[0138] Uniform blocks or stretches of large 2’-sugar modifications within the ASO tend to interfere with the binding of ADAR's dsRNA binding proteins (dsRBDs). Hence, the oligonucleotides of the invention may be modified in a way to avoid such interference. For example, the oligonucleotides are modified such that they do not comprise continuous stretches or uniform blocks of nucleotides carrying the same chemical modification ( / .e., avoidance of a block-like modification structure). Avoiding uniform blocks of more than 6 nucleotides with the same 2’-modification prevented a strong loss of editing activity with natural ADARs. Hence, in one embodiment, the oligonucleotide is not uniformly modified. In one embodiment, the oligonucleotide contains no uniform blocks and / or no block-like modification structure. In one embodiment, the oligonucleotide does not comprise continuous stretches or uniform blocks of nucleotides carrying the same chemical modification at the 2’ position of the sugar moiety. A “block” or “stretch” may, e.g., not comprise more than 4, 5 or 6 nucleotides with the same 2’-sugar modification. In some instances, the block or stretch may be shorter or longer. In one embodiment, the oligonucleotide contains only 1 block of no more than 6, 5, 4, or 3 nucleotides with the same 2’-sugar modification. In one embodiment, the oligonucleotide contains 2 blocks, separated by one or more oligonucleotides having a different 2’-sugar modification. In order embodiments, the oligonucleotides comprise at least 1 block of nucleotides with the same 2’-sugar modification. In another embodiment, the oligonucleotide comprises 1 , 2, 3, or more blocks of nucleotides with the same 2’-sugar modification.
[0139] Specifically, stretches of more than 6 nucleotides with the same 2’-modification should be avoided. Avoiding uniform blocks of more than 6 nucleotides with the same 2’-modification prevented a strong loss of editing activity with natural ADARs. Hence, the oligonucleotides of the invention may be modified to not include uniform blocks or a continuous stretch of the same 2’-sugar modification. In one embodiment, the oligonucleotide comprises one or more 2’-sugar modifications, optionally wherein no more than 6 consecutive nucleotides have the same 2’-modification. In one embodiment, no more than 5 consecutive nucleotides have the same modification. In one embodiment, no more than 4 consecutive nucleotides have the same modification. In one embodiment, no more than 3 consecutive nucleotides have the same modification. In one embodiment, no more than 2 consecutive nucleotides have the same modification. In one embodiment, less than 6, 5, 4, or 3 consecutive nucleotides have the same 2’-modification. Hence, in one embodiment, the 2’-sugar modification is 2’-deoxyribose (DNA). In one embodiment, no more than 6 consecutive nucleotides are 2’-H (DNA) modified. In one embodiment, no more than 5 consecutive nucleotides are 2’-H-modified. In one embodiment, no more than 4 consecutive nucleotides are 2’-H-modified. The 2’-sugar modification may be 2’-ribose. In one embodiment, no more than 6 consecutive nucleotides are 2’-H (DNA) modified. In one embodiment, no more than 5 consecutive nucleotides are 2’-H-modified. Inone embodiment, no more than 4 consecutive nucleotides are 2’-H-modified. In one embodiment, no more than 6 consecutive nucleotides are 2’-F-modified. In one embodiment, no more than 5 consecutive nucleotides are 2’-F-modified. In one embodiment, no more than 4 consecutive nucleotides are 2’-F-modified. In one embodiment, no more than 6 consecutive nucleotides are 2’-O-alkyl-modified. In one embodiment, no more than 5 consecutive nucleotides are 2’-O-alkyl-modified. In one embodiment, no more than 4 consecutive nucleotides are 2’-O-alkyl-modified, optionally wherein no more than 4 consecutive nucleotides are 2’-OMe-modified. In one embodiment, the oligonucleotide comprises 2, 3, 4, 5, or 6 consecutive nucleotides with the same 2’-modification, e.g., 5 consecutive nucleotides are 2’-F-modified.
[0140] The oligonucleotide of the invention may contain some “continuous stretch(es)” or “uniform block(s)” of a certain length. In one embodiment, the size or length of the “continuous stretch(es)” or “uniform block(s)” is 2, 3, 4, 5, or 6 nucleotides long. In one embodiment, the size or length of the “continuous stretch(es)” or “uniform block(s)” is no more than 2, 3, 4, 5, or 6 nucleotides long. In one embodiment, the oligonucleotide comprises no more than 2, 3, 4, 5, or 6 consecutive nucleotides comprising a 2’-F modification. In one embodiment, the oligonucleotide comprises no more than 2, 3, 4, 5, or 6 consecutive nucleotides comprising a 2’-OMe modification. In one embodiment, one or more uniform blocks are interrupted. Interruption can take place by any other chemical modification (e.g., DNA, RNA, 2’-F, 2’-OMe, 2’-MOE, LNA, etc.). In one embodiment, one or more uniform blocks of 2’-F-modified nucleotides are interrupted, preferably by 2'-OMe-modified nucleotides. In one embodiment, one or more uniform blocks of 2'-OMe-modified nucleotides are interrupted, preferably by 2’-F-modified nucleotides. In some embodiments the blocks are disrupted by DNA.
[0141] DNA oligonucleotides are relatively stable molecules, while RNA oligonucleotides are much more unstable due to their chemical structure. It is commonly known that RNA is subject to autocatalysis and degradation by RNases. To achieve the necessary stability of an oligonucleotide, the final oligonucleotide ideally should not contain any unmodified RNA nucleobases. In one embodiment, the oligonucleotide contains no unmodified RNA nucleobases. In one embodiment, the oligonucleotide contains more than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or more than 90% modified RNA nucleobases. In one embodiment, the oligonucleotide comprises more than 90% modified RNA nucleobases. In one embodiment, the oligonucleotide contains less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or less than 10 % unmodified RNA nucleobases.
[0142] In certain cases, the ASO targeting domain, or nucleobase opposite to the target nucleobase that is to be edited, comprises, one or more wobble bases (e.g., including, or in addition to that at the N.2position) to compensate for the variability in the target sequence. Thatis, the less stringent base-pairing requirement of the wobble base (e.g., G-U, l-A, G-A, l-U, l-C, etc.) allows the ASO to pair with more than just one target nucleic acid. Accordingly, in some embodiments, mismatches and / or wobbles enable targeting of different target nucleic acids. In one embodiment, the oligonucleotide comprises one or more additional mismatches, wobble base and / or bulges. In some embodiments, the oligonucleotides of the invention may contain bulges of 1, 2, 3 or more nucleotides. In one embodiment, the oligonucleotide comprises one or more mismatches, wobble base, and / or bulges with respect to its target, and / or a mismatch at No. In one embodiment, the oligonucleotide comprises one or more mismatches, wobble base, and / or bulges with respect to its target. In one embodiment, the oligonucleotide comprises a mismatch at No.
[0143] In one embodiment, there is a wobble base pairing between the modified oligonucleotide and the target RNA at N.2, when the oligonucleotide is aligned with its target RNA. In one embodiment, there is a wobble base pairing between the modified oligonucleotide and the target RNA at N.2and the nucleobase in the oligonucleotide at position N.2is hypoxanthine. In one embodiment, the oligonucleotide comprises a mismatch at No and at position N-2. In one embodiment, the inosine at N.2is 2’-O-methyl-inosine.
[0144] The targeting sequence of the artificial nucleic acid typically comprises a nucleic acid sequence complementary or at least partially complementary to a nucleic acid sequence in the target RNA. In some embodiments, the targeting sequence comprises a nucleic acid sequence complementary or at least 60%, 70%, 80%, 90%, 95% or 99% of a nucleic acid sequence in the target RNA.
[0145] Also provided herein are antisense oligonucleotides (ASOs) comprising a sequence having at least 80% complementarity to a target RNA sequence derived from a sequence of the endogenous apoB gene, optionally wherein the gene encodes SEQ ID NO: 13 and / or SEQ ID NO: 14, wherein the ASO mediates A-to-l editing of one or more target adenosines in the target RNA such that protein translation subsequently leads to a decrease in ApoB protein secretion.
[0146] The oligonucleotides provided herein target RNA sequences derived from a sequence encoding an apoBprotein, e.g., a gene or allele encoding apoB. The apoB sequence may be endogenous or exogenous. The specific oligonucleotides of the invention may comprise deoxyribonucleotides (DNA) and / or ribonucleotides (RNA) as well as a mixture of chemical modifications, including internucleoside linkage modifications and modifications at the 2’-position of the sugar residue. In some embodiments, the oligonucleotide is an oligonucleotide as listed in Table 2. In some embodiments, the oligonucleotide sequence is selected from the group consisting of SEQ ID NOs: 1-9, 11, and 12. In some embodiments, the oligonucleotide sequence is selected from the group consisting of SEQ ID NOs: 1-9, and 11 .
[0147] In some embodiments, the oligonucleotide is an oligonucleotide as listed in Table 11 or Table 12. In some embodiments, the oligonucleotide sequence is selected from the group consisting of SEQ ID NOs: 77-90.
[0148] The oligonucleotides of the invention are used to mediate A-to-l editing of protein coding or protein non-coding RNAs. Specifically, the oligonucleotides of the invention are used to mediate A-to-l editing of ApoB encoding RNA.
[0149] In one embodiment, the oligonucleotide mediates A-to-l editing of a target RNA sequence derived from an apoB gene resulting in the amino acid substitution Y1014C. In one embodiment, the oligonucleotide is AI-2771. In one embodiment, the oligonucleotide comprises the sequence 5’ lnT*ln(MeC)*mU*fG*fG*fA*mG*fC*mU*fC*fA*fU*fA*fG*mG*fU*mU*fG*fC*fG*mC*fU*mG*fA*m C*mAmGfA*dA*dC*dAmCfllfG*fC*mU*fC*fA*fA*mU*fC*fU*mC*lnT*ln(MeC) - 3’ (SEQ ID NO: 1), wherein m = 2’-O-methyl; f = 2’-fluoro; & = mesyl, * = PS linkage, I = inosine, MeC = 5’-methylcytidine, In = locked nucleic acid, and wherein dN is deoxy-N.
[0150] In one embodiment, the oligonucleotide mediates A-to-l editing of a target RNA sequence derived from an apoB gene resulting in the amino acid substitution K1344R. In one embodiment, the oligonucleotide is AI-2772. In one embodiment, the oligonucleotide comprises the sequence 5’ ln(MeC)*ln(MeC)*mA*fG*fG*fA*mG*fA*mG*fG*fC*fA*fC*fU*mll*fG*mC*fA*fG*fU*mU*fG*mA*f U*mA*mCmAfA*dC*dC*dTmlfGfG*fA*mA*fll*fG*fG*mU*fA*fA*mA*lnA*lnG - 3’ (SEQ ID NO: 2), wherein m = 2’-O-methyl; f = 2’-fluoro; & = mesyl, * = PS linkage, I = inosine, MeC = 5’-methylcytidine, In = locked nucleic acid, and wherein dN is deoxy-N.
[0151] In one embodiment, the oligonucleotide mediates A-to-l editing of a target RNA sequence derived from an apoB gene resulting in the amino acid substitution K1474R. In one embodiment, the oligonucleotide is AI-2780. In one embodiment, the oligonucleotide comprises the sequence 5’ ln(MeC)*lnT*mU*fC*fU*fU*mU*fG*mA*fC*fA*fA*fA*fC*mA*fA*mA*fU*fG*fC*mU*fG*mU*fU*mU *mCmllfU*dT*dC*dTmlfGfA*fG*mU*fC*fC*fA*mA*fA*fU*mG*lnA*lnA - 3’ (SEQ ID NO: 3), wherein m = 2’-O-methyl; f = 2’-fluoro; & = mesyl, * = PS linkage, I = inosine, MeC = 5’-methylcytidine, In = locked nucleic acid, and wherein dN is deoxy-N.
[0152] In one embodiment, the oligonucleotide mediates A-to-l editing of a target RNA sequence derived from an apoB gene resulting in the amino acid substitution N1523S. In one embodiment, the oligonucleotide is AI-2781. In one embodiment, the oligonucleotide comprises the sequence 5’wherein m = 2’-0-methyl; f = 2’-fluoro; & = mesyl, * = PS linkage, I = inosine, MeC = 5’-methylcytidine, In = locked nucleic acid, and wherein dN is deoxy-N.
[0153] In one embodiment, the oligonucleotide mediates A-to-l editing of a target RNA sequence derived from an apoB gene resulting in the amino acid substitution T1796A. In one embodiment, the oligonucleotide is AI-2773. In one embodiment, the oligonucleotide comprises the sequence 5’ mU&mC*mCfA*fC*mU*fG*mGmoeAfA*fC*moeT*fC*mUfC*mA*fGmoe(MeC)*fC*moeTfC*mA moeTfA*moeG*dC*dT&mlfU*moeA*mU*mG*mll&mG - 3’ (SEQ ID NO: 5), wherein m = 2’-O-methyl; f = 2’-fluoro; & = mesyl, * = PS linkage, I = inosine, MeC = 5’-methylcytidine, In = locked nucleic acid, moe = 2’-O-methoxyethyl, and wherein dN is deoxy-N.
[0154] In one embodiment, the oligonucleotide mediates A-to-l editing of a target RNA sequence derived from an apoB gene resulting in the amino acid substitution T1883A. In one embodiment, the oligonucleotide is AI-2774. In one embodiment, the oligonucleotide comprises the sequence 5’ lnG*lnA*mA*fA*fU*fG*mC*fA*mG*fU*fG*fA*fG*fU*mC*fU*mG*fA*fA*fU*mU*fA*mU*fA*mG*mU mUfU*dG*dC*dlmCfllfC*fA*mU*fG*fU*fC*mA*fA*fU*mG*lnG*ln(MeC) - 3’ (SEQ ID NO: 6), wherein m = 2’-O-methyl; f = 2’-fluoro; & = mesyl, * = PS linkage, I = inosine, MeC = 5’-methylcytidine, In = locked nucleic acid, and wherein dN is deoxy-N.
[0155] In one embodiment, the oligonucleotide mediates A-to-l editing of a target RNA sequence derived from an apoB gene resulting in the amino acid substitution S2947G. In one embodiment, the oligonucleotide is AI-2775. In one embodiment, the oligonucleotide comprises the sequence 5’ lnG*lnG*mA*fA*fG*fU*mG*fA*mG*fG*fG*fG*fU*fC*mC*fU*mU*fC*fU*fA*mU*fG*mG*fU*mG*m AmAfA*dC*dC*dAmAfUfU*fU*mG*fU*fG*fA*mll*fU*fC*mA*lnT*lnG - 3’ (SEQ ID NO: 7), wherein m = 2’-O-methyl; f = 2’-fluoro; & = mesyl, * = PS linkage, I = inosine, MeC = 5’-methylcytidine, In = locked nucleic acid, and wherein dN is deoxy-N.
[0156] In one embodiment, the oligonucleotide mediates A-to-l editing of a target RNA sequence derived from an apoB gene resulting in the amino acid substitution N3465S. In one embodiment, the oligonucleotide is AI-2776. In one embodiment, the oligonucleotide comprises the sequence 5’ ln(MeC)*lnT*mU*fU*fA*fG*mC*fG*mG*fU*fA*fG*fA*fG*mU*fA*mC*fA*fG*fC*mA*fU*mU*fG*m A*mAmGfA*dA*dC*dTmlfAfA*fA*mU*fC*fA*fU*mA*fC*fU*mll*lnA*lnA - 3’ (SEQ ID NO: 8), wherein m = 2’-O-methyl; f = 2’-fluoro; & = mesyl, * = PS linkage, I = inosine, MeC = 5’-methylcytidine, In = locked nucleic acid, and wherein dN is deoxy-N.
[0157] In one embodiment, the oligonucleotide mediates A-to-l editing of a target RNA sequence derived from an apoB gene resulting in the amino acid substitution T4093A. In oneembodiment, the oligonucleotide is AI-2779. In one embodiment, the oligonucleotide comprises the sequence 5’ lnT*lnG*mA*fA*fG*fA*mC*fA*mC*fU*fU*fC*fU*fC*mU*fC*mA*fG*fG*fG*mU*fG*mA*fG*mC*mC mCfll*dG*dC*dlmUfGfU*fU*mC*fC*fC*fA*mG*fU*fG*mG*lnT*lnA- 3’ (SEQ ID NO: 9), wherein m = 2’-O-methyl; f = 2’-fluoro; & = mesyl, * = PS linkage, I = inosine, MeC = 5’-methylcytidine, In = locked nucleic acid, and wherein dN is deoxy-N.
[0158] In one embodiment, the oligonucleotide mediates A-to-l editing of a target RNA sequence derived from an apoB gene resulting in the amino acid substitution K1474R. In one embodiment, the oligonucleotide is AI-3075. In one embodiment, the oligonucleotide comprises the sequence 5’ ln(MeC)&lnT*mU*fC*fU*fU*mU*fG*mA*fC*fA*fA*fA*fC*mA*fA&mA*fU*fG*fC*mU*fG*mU*fU*m U*mCmUfU*dT*dC*dT&mlfGfA*fG*mU*fC*fC*fA*mA*fA*fU*mG*lnA&lnA- 3’ (SEQ ID NO: 11), wherein m = 2’-O-methyl; f = 2’-fluoro; & = mesyl, * = PS linkage, I = inosine, MeC = 5’-methylcytidine, In = locked nucleic acid, and wherein dN is deoxy-N.
[0159] Hence, in one embodiment, the modified ApoB protein comprises one or more amino acid substitutions selected from the group consisting of: Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A.
[0160] In some embodiments, the oligonucleotide comprises a sequence that is at least 70% identical to any one of the sequences selected from: SEQ ID NOs: 1-9 and 11. In some embodiments, the oligonucleotide comprises a sequence that is at least 80% identical to any one of the sequences selected from: SEQ ID NOs: 1-9 and 11. In some embodiments, the oligonucleotide comprises a sequence that is at least 90% identical to any one of the sequences selected from: SEQ ID NOs: 1-9 and 11. In one embodiment, the oligonucleotide comprises any one of the sequences selected from; SEQ ID NOs: 1-9, 11, and 12.
[0161] In some embodiments, the oligonucleotide comprises a sequence that is at least 70% identical to any one of the sequences selected from: SEQ ID NOs: 77-90. In some embodiments, the oligonucleotide comprises a sequence that is at least 80% identical to any one of the sequences selected from: SEQ ID NOs: 77-90. In some embodiments, the oligonucleotide comprises a sequence that is at least 90% identical to any one of the sequences selected from: SEQ ID NOs: 77-90. In one embodiment, the oligonucleotide comprises any one of the sequences selected from; SEQ ID NOs: 77-90.
[0162] In one embodiment, the ASO is selected form a list consisting of AI-2771 (Y1014C), AI-2772 (K1344R), AI-2780 (K1474R), AI-2781 (N1523S), AI-2773 (T1796A), Al-2774 (T1883A), AI-2775 (S2947G), AI-2776 (N3465S), AI-2779 (T4093A), AI-3075 (K1474R), andAI-2763 (Y52C).
[0163] In one embodiment, the amino acid substitution is caused by an A-to-l editing the amino acid substitution is caused by A-to-l editing in the RNA which corresponds to position 1014, at position 1344, at position 1474, at position 1523, at position 1796, at position 1883, at position 2947, at position 3465, and / or at position 4093 of the ApoB coding sequence SEQ ID NO: 13.
[0164] In one embodiment, the target adenosine (A) to be edited is located within a coding region of the ApoB target RNA transcript. In one embodiment, the modified ApoB protein comprises a functionally preserved amino acid substitution. In one embodiment, the amino acid substitution prevents or reduces ApoB protein secretion when compared to wild-type ApoB protein. In one embodiment, the amino acid substitution prevents or reduces ApoB protein secretion and reduces LDL-C.
[0165] Guide RNA (gRNA) or single guide RNA (sgRNA) is a short sequence of RNA that may function as a guide for various protein, including Cas-proteins or ADAR proteins (Mali et al., 2013). It has been shown that genetically encodable guide RNAs may be used to re¬ address ADAR enzymes toward specific sites in user-defined mRNA targets (Wettengel et al., 2017). Hence, in one embodiment, an ASO comprises a genetically encodable guide RNA. Moreover, it has previously been shown that CLUSTER guide RNAs enable precise and efficient RNA editing with endogenous ADAR enzymes in vivo (Reautschnig et al., 2022). In some instances, the ASOs can be designed to comprise CLUSTER guide RNAs. The CLUSTER guide RNAs bind their target RNAs in a multivalent fashion, achieve editing with high precision and efficiency. In one embodiment, the ASOs is designed to comprise a CLUSTER guide RNA. In one embodiment the ASO comprises a cluster of recruitment sequences. In one embedment, editing is by an ADAR enzyme. In one embodiment, the ADAR enzyme is an endogenous ADAR enzyme, an exogenous ADAR enzyme, or an engineered ADAR enzyme. In a preferred embodiment, the ASAR enzyme is an endogenous ADAR enzyme. In one embodiment, the ADAR enzyme is mammalian, optionally wherein the ADAR enzyme is human ADAR. In one embodiment, the ADAR is ADAR1 or ADAR2.
[0166] While the oligonucleotides may comprise DNA and / or RNA, they may also comprise additional modifications. Locked nucleic acids (LNAs or “In”) improve the binding power of ASOs by preserving the nucleoside in a preferred sugar confirmation. However, this preorganisation of the sugar by the additional bridge also reduces flexibility. Double-stranded RNA (dsRNA) structures are strongly perturbed in the active site of ADAR (flip-out mechanism). LNA may interfere with this process and thus it is desirable to place any LNAs in positions that are not inside or too close to the CBT. In one embodiment, the oligonucleotide comprises one or more LNA(s). In one embodiment, the oligonucleotide does not comprise an LNA modification at the outermost position of the 5’ and / or 3’ terminal ends.
[0167] The oligonucleotides of the invention may be modified at their 5’ and / or 3’ termini. For instance, targeted delivery of oligonucleotides to liver hepatocytes using N-acetylgalactosamine (GalNAc) conjugates has previously described for, e.g., treating liver diseases, including non-alcoholic Fatty Liver Disease.
[0168] Hence, oligonucleotides of the invention may comprise a moiety, which enhances cellular uptake of the oligonucleotide, e.g., N-acetylgalactosamine (GalNAc). Hence, in some embodiments, the chemically modified oligonucleotide comprises a moiety or is conjugated to a moiety that enhances cellular uptake of the oligonucleotide. In one embodiment, the moiety enhancing cellular uptake is a N-acetyl galactosamine (GalNAc). In one embodiment, GalNAc is conjugated to the 3' terminus of the oligonucleotide. In one embodiment, GalNAc is conjugated to the 5' terminus of the oligonucleotide.
[0169] Loop-hairpin structured oligonucleotides have previously been described (WO 2020 / 001793) and used successfully to harness ADARs with oligonucleotides. However, they are comparably large and - without being bound by any theory— the inventors believe that a more intelligent design of the ASO can form a substrate duplex that is also very well and quickly recognized by endogenous ADAR so that the large recruitment motifs can be omitted. For the delivery and manufacture this is a clear advantage as much shorter ASOs can be designed. Hence, the oligonucleotides may or may not include a recruitment motif for a deaminase. The oligonucleotides for use of the invention form an RNA duplex to which the ADAR enzyme adheres, whereby the editing efficiency is increased. In one embodiment, the oligonucleotide does not comprise a loop-hairpin structured ADAR recruitment motif.
[0170] In some embodiments, the present disclosure provides oligonucleotides (and compositions thereof), that do not include chirally controlled oligonucleotides or compositions thereof. In one embodiment, an internucleoside linkage is not chirally controlled. In one embodiment, an internucleoside linkage is not a chirally controlled PS linkage. In one embodiment, the oligonucleotide does not comprise independently controlled chiral phosphates. In some embodiments, one or more internucleoside linkage is not independently chirally controlled. In some embodiments, at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or all internucleoside linkages are not chiral internucleoside linkages.
[0171] Oligonucleotides may be expressed by a vector. The oligonucleotide may be expressed by an expression construct, a viral vector, a virus-like particle vector, or a bacterial vector. Hence, also provided herein is an expression construct comprising a nucleotide sequence encoding human ApoB, wherein the nucleotide sequence is at least 60%, at least 70%, at least 80%, at least 90, at least 95% or is 100% identical to SEQ ID NO: 13 and / or SEQ ID NO: 14. In one embodiment, the sequence contains an A-to-G nucleotide mutation in SEQ ID NO: 13 at one of the following positions selected from the group consisting of: 3169 (Y1014Cin protein), 4159 (K1344R in protein), 4549 (K1474R in protein), 4696 (N1523S in protein), 5514 (T1796A in protein), 5775 (T1883A in protein), 8967 (S2947G in protein), 10522 (N3465S in protein), and 12405 (T4093A in protein).
[0172] In one embodiment, the oligonucleotide of the invention target a RNA sequence comprising or consisting of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 or SEQ ID NO: 16. In one embodiment, the oligonucleotide of the invention target a RNA sequence that is at least 60%, at least 70%, at least 80%, at least 90, at least 95% identical to SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 or SEQ ID NO: 16.
[0173] In some embodiments, the inclusion of non-canonical bases such as inosine may influence the performance of A-to-l RNA editing oligonucleotides. This may particularly be the case for targets with a G:C-rich sequence around the editing site, i.e., in and around the central base triplet (CBT), since it is known that the oligonucleotide is distorted in this area during the base-flipping mechanism (Matthews etal., 2016). Hence, oligonucleotides were generated that comprise additional sequential modifications, e.g., additional inosines. For instance, in one embodiment, the oligonucleotide comprises a total of 1 , 2, 3, or 4 non-canonical nucleobases or nucleoside analogues. In one embodiment, the non-canonical nucleobase is hypoxanthine. In one embodiment, the oligonucleotide contains a single hypoxanthine nucleobase in the CBT. In one embodiment, the oligonucleotide contains hypoxanthine at position N-i. In one embodiment, the oligonucleotide contains hypoxanthine at position N-2. In one embodiment, the oligonucleotide contains hypoxanthine at position No. In one embodiment, the oligonucleotide contains hypoxanthine at position N+i. In one embodiment, the oligonucleotide contains hypoxanthine at position N+2. In one embodiment, position -2 (N-2) is 2’-O-methyl-inosine. In one embodiment, position -2 (N-2) is inosine and 2’F-modified. In one embodiment, position -2 (N.2) is DNA. In one embodiment, position -2 (N.2) is inosine and 2’MOE modified. In some embodiments, the oligonucleotide comprises several non-canonical nucleobases or nucleoside analogues.
[0174] In some embodiments, the chemically modified oligonucleotide is a chemically modified oligonucleotide capable of binding to a target sequence in a target RNA, comprising a central base triplet (CBT) of 3 nucleotides (5’- N+ieNofN-1 - 3’) with the central nucleotide (No) directly opposite to the target adenosine in the target RNA, wherein the core oligonucleotide comprises the following sequence: 5’- N+5aN+4bN+3cN+2dN+ieNofN-1gN.2hN.3' N.4' N.5k-3’; and wherein at position -2 (N.2) there is a non-canonical nucleobase or nucleoside analogue, which would otherwise form a G:C bond when hybridised to its target RNA sequence.
[0175] In some embodiments, the oligonucleotide comprises a sequence with a length of 25 to 95 nucleotides,(a) at least two of the three nucleotides of the CBT are chemically modified at the 2' position of the sugar moiety, are deoxyribonucleosides, or a combination thereof and wherein d and e are internucleoside linkage modifications;(b) the N-2 nucleotide carries a 2’-O-alkyl-modification; and wherein the N.3 nucleotide carries a 2'-fluoro (2’-F)-modification;(c) at least 10% of nucleotides are 2’-F-modified, wherein no more than 4, 5 or 6 consecutive nucleotides are 2’-F-modified;(d) at least 10% of nucleotides are 2’-O-alkyl-modified, wherein no more than 3, 4, or 5 consecutive nucleotides are 2’-O-alkyl-modified; and(e) the internucleoside linkage modification content is at least 70%; and(f) linkage g is not a phosphorothioate (PS) linkage.
[0176] In some embodiments, position -2 (N-2) is 2’-O-methyl-inosine. In one embodiment, position -2 (N-2) is 2’-O-methyl-modified. In one embodiment, position -2 (N.2) is DNA. In one embodiment, position -2 (N.2) is 2-MOE. In one embodiment, position -2 (N-2) is 2’-O-methyl-guanosine.ln some embodiments, position -3 (N-3) is 2’F-modified.Compositions
[0177] The chemically modified oligonucleotides of the invention may be incorporated into compositions of the invention. Accordingly, provided herein is a composition containing the oligonucleotide(s) of the invention. In some embodiments, the compositions are pharmaceutical compositions. In the context of the invention, the term composition and pharmaceutic compositions are used interchangeably. Hence, in some embodiments, the present disclosure provides oligonucleotide compositions of oligonucleotides described herein. In one embodiment, the composition contains one or more oligonucleotides of the invention. In some embodiments, the present disclosure provides a composition comprising a plurality of oligonucleotides. As used herein, pharmaceutical composition means a substance or a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents (such as an oligonucleotide) and a sterile aqueous solution. The compositions provided herein can be in any form that allows for the composition to be administered to a subject. The compositions may be used in methods of treating and / or preventing a genetic disorder, condition, or disease.
[0178] In one embodiment, the composition comprises an oligonucleotide of the invention or a pharmaceutically acceptable salt thereof. In one embodiment, a composition comprises an oligonucleotide of the invention in an admixture with a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier can simply be a saline solution. This can be isotonic or hypotonic.
[0179] In one embodiment, the composition is for veterinary and / or human administration. In some embodiments, a pharmaceutical composition comprises one or more other therapies in addition to an oligonucleotide of the invention.
[0180] The amount of an oligonucleotide or composition which will be effective in the treatment and / or prevention of a disease or disorder will depend on the nature of the disease and can be determined by standard clinical techniques. Exemplary doses for oligonucleotides range from about 10ng to 1 g, 10Ong to 10Omg, 1 pg to 10mg, or 30-300pg oligonucleotide, e.g., RNA, per patient. In one embodiment, the oligonucleotide is present at a concentration of 4nM to 100nM, optionally at 20nM or 25nM. In one embodiment, the oligonucleotide is present at a concentration of 0.8nM. In one embodiment, the oligonucleotide is present at a concentration of 4nM. In one embodiment, the oligonucleotide is present at a concentration of 20nM. In one embodiment, the oligonucleotide is present at a concentration of 25nM.
[0181] In certain embodiments, the compositions of the invention include diluents of various buffer content (e.g., Tris-HCI, acetate, phosphate), pH, and ionic strength, and additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol), and bulking substances (e.g., lactose, mannitol). In some embodiments, the material is incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. In some embodiments, hyaluronic acid is used. Such compositions may influence the physical state, stability, rate of in vivo release, and / or rate of in vivo clearance of the oligonucleotides and / or derivatives and / or pharmaceutically acceptable salt thereof. In some embodiments, the compositions are in liquid form or in dried powder, such as lyophilized form.
[0182] In certain embodiments, the compositions additionally comprise one or more salts, e.g., sodium chloride, calcium chloride, sodium phosphate, monosodium glutamate, and aluminium salts (e.g., aluminium hydroxide, aluminium phosphate, alum (potassium aluminium sulfate), or a mixture of such aluminium salts). In other embodiments, the compositions described herein do not comprise salts.
[0183] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
[0184] The oligonucleotides or compositions thereof can be tested for in vivo toxicity in animal models. For example, animal models, described herein and / or others known in the art, used to test the activities of active compounds can also be used to determine the in vivo toxicity of these compounds. For example, animals are administered a range of concentrations of active compounds. Subsequently, the animals are monitored over time for lethality, weight loss or failure to gain weight, and / or levels of serum markers that may be indicative of tissue damage.These in vivo assays may also be adapted to test the toxicity of various administration mode and / or regimen in addition to dosages.Prophylactic and Therapeutic Uses
[0185] The invention describes the use of chemically modified oligonucleotides and compositions comprising the same in the medical setting, specifically, for site-directed editing of a target RNA (e.g., binding to the target RNA via the targeting sequence and by recruiting to the target site a deaminase). The invention describes chemically modified oligonucleotides and compositions comprising said oligonucleotides for use in the treatment or prevention of a cardiovascular or liver disease.
[0186] A chemically modified oligonucleotide of the invention or composition comprising the same may be used in the treatment and / or prevention of a medical condition associated with LDL-C and / or apoB. In one aspect provided herein is a chemically modified oligonucleotide of the invention or a composition comprising the same for use in therapy. In another aspect provided herein is an oligonucleotide of the invention or a composition comprising the same for use in the treatment or prevention of a genetic disorder, condition, or disease. In some embodiments, the disease or disorder is selected form the group consisting of liver or metabolic diseases and / or cardiac or cardiovascular diseases. In one embodiment, the disease or condition is dyslipidaemia, optionally wherein the dyslipidaemia is primary (genetic) dyslipidaemia, secondary (acquired) dyslipidaemia, mixed or combined dyslipidaemia, and / or dyslipoproteinemia (lipoprotein disorders). In one embodiment, the disease or condition is selected from a group consisting of metabolic syndrome, atherosclerosis, coronary heart disease, bile acid-related liver disease, cholestasis; hypertriglyceridemia or hyperlipidaemia, hypercholesterolemia, non-alcoholic fatty liver disease (NAFLD), non-alcohol steatohepatitis (NASH), steatosis or cirrhosis, hepatocellular carcinoma (HCC), and homozygous or heterozygous familial hypercholesterolaemia (FH).
[0187] The chemically modified oligonucleotide of the invention or the composition may be administered, for example, orally in any orally acceptable dosage form including, but not limited to, capsules, tablets, aqueous suspensions, or solutions, or parenterally, e.g., by parenteral injection. In some embodiments, formulations suitable for parenteral administration comprise sterile aqueous preparations of at least one embodiment of the present disclosure, which are approximately isotonic with the blood of the intended recipient. The amount of oligonucleotide or composition to be administered, the dosage and the dosing regimen can vary from cell type to cell type, the disease to be treated, the target population, the mode of administration (e.g., systemic versus local), the severity of disease and the acceptable level of side activity. In some embodiments, the amount of one or more oligonucleotide administered ina pharmaceutical composition is dependent on the subject being treated, the subject's weight, and / or the manner of administration.
[0188] Various delivery systems can be used to deliver the oligonucleotides of the invention. An oligonucleotide according to the invention can be delivered as is, i.e., naked and / or in isolated form to an individual, through an organ, e.g., mucosa of the eye, or directly to a cell. Hence, in a preferred embodiment, the oligonucleotide of the invention is administered and delivered ‘as is’, also referred to as ‘naked’. When administering an oligonucleotide of the invention, it is preferred that the oligonucleotide is dissolved in a solution that is compatible with the delivery method. Such delivery may be in vivo, in vitro or ex vivo. Hence, depending on the disease, disorder or infection that needs to be treated, or on the cell, tissue or part of the body that needs to be reached by the oligonucleotides (e.g., in case of beneficial editing), a different administration route or delivery method may be selected. Examples for delivery when an oligonucleotide is not delivered naked, are delivery agents or vehicles such as nanoparticles, like polymeric nanoparticles, microparticles, micelles, liposomes, antibody-conjugated liposomes, cationic lipids, polymers, or cell-penetrating peptides.
[0189] Use of an excipient or transfection reagents may be used in the delivery of each of the oligonucleotides or compositions to a cell and / or into a cell Preferred are excipients or transfection reagents capable of forming complexes, nanoparticles, micelles, vesicles and / or liposomes that deliver each oligonucleotide or composition as defined herein, complexed or trapped in a vesicle or liposome through a cell membrane. Many of these excipients are known in the art. Suitable excipients or transfection reagents comprise polyethylenimine (PEI; ExGen500 (MBI Fermentas)), LipofectAMINE™ 2000 (Invitrogen), lipofectin™, or derivatives thereof, and / or viral capsid proteins that are capable of self-assembly into particles that can deliver each constituent as defined herein to a target cell.
[0190] Oligonucleotides of the invention may be linked to a moiety that enhances uptake of the ASO in cells. Examples of such moieties are cholesterols, carbohydrates, vitamins, biotin, lipids, phospholipids, cell-penetrating peptides including but not limited to antennapedia, TAT, transportan and positively charged amino acids such as oligoarginine, poly-arginine, oligolysine or polylysine, antigen-binding domains such as provided by an antibody, a Fab fragment, or a single chain antigen binding domain such as a cameloid single domain antigen-binding domain. Accordingly in some embodiments, the ASO is delivered using drug conjugates with antibodies, nanobodies, cell penetrating peptides and aptamers. In one embodiment, the oligonucleotide is conjugated to an antibody, preferably a Fab fragment.
[0191] The oligonucleotide or composition may be administered as a monotherapy or in combination with a further different medicament
[0192] The compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be by inhalation (e.g., through nebulization), intranasally, orally, by injection or infusion, intravenously, subcutaneously, intra-dermally, intra-cranially, intramuscularly, intra-tracheally, intra-peritoneally, intra-rectally, and the like. Administration may be in solid form, in the form of a powder, a pill, or in any other form compatible with pharmaceutical use in humans. In some embodiments the oligonucleotide construct can be delivered systemically.Patient Population
[0193] The oligonucleotides of the invention of compositions comprising the same may be administered to various groups of subjects or patients. In certain embodiments, the patient is in need of treatment. In other embodiments, the patient is not in need of treatment (“beneficial editing”). That is, the subject receives the oligonucleotide or composition to edit an RNA derived from a wildtype allele (not a mutated allele) in order to modulate the function of the wildtype protein in a useful way.
[0194] In certain embodiments, an oligonucleotide is administered to a subject, wherein the subject does not have a genetic mutation in the endogenous apoB gene. In one embodiment, a subject is at risk of having high levels of ApoB and / or LDL-C. In certain embodiments, an oligonucleotide is administered to a subject who has or has not been diagnosed with a disease associated with elevated or high levels of ApoB and / or LDL-C. In one embodiment, the subject is human.
[0195] In certain embodiments, an oligonucleotide is administered to a subject that does have a genetic mutation in the wild-type or endogenous apoB gene. In certain embodiments, an oligonucleotide is administered to a subject, wherein the subject does not have a genetic mutation in the apoB gene.
[0196] In some embodiments, the subject to be administered an oligonucleotide is any individual at increased risk of developing high levels of LDL-C. In some embodiments, an oligonucleotide is administered to a subject who has elevated or high levels of LDL-C (compared to control). In certain embodiments, an oligonucleotide is administered to a subject who has been diagnosed with a disease associated with elevated or high levels of LDL-C.
[0197] In some embodiments, the subject to be administered an oligonucleotide (or composition comprising the same) is an individual affected by any condition associated with LDL or LDL-C. In some embodiments, the subject to be administered an oligonucleotide is an individual affected by any condition associated with increased or elevated levels of LDL or LDL-C. In some embodiments, the subject to be administered an oligonucleotide is an individualaffected by any condition associated with increased or elevated levels of LDL or LDL-C compared to control.
[0198] In some embodiments, the subject to be administered an oligonucleotide (or composition comprising the same) suffers from or is at a risk of suffering from a cardiovascular or liver disorder, including one or more of hypercholesterolemia (including familial hypercholesterolaemia), hypertriglyceridemia, non-alcoholic fatty liver disease (NAFLD), acute pancreatitis, non-alcoholic steatohepatitis (NASH) without or with hepatic fibrosis, cirrhosis or hepatocellular carcinoma. In one embodiment, the patient suffers or is affected by a disease or condition selected from the list comprising dyslipidaemia. In one embodiment, the dyslipidaemia is primary (genetic) dyslipidaemia, secondary (acquired) dyslipidaemia, mixed or combined dyslipidaemia. In one embodiment, the dyslipidaemia is dyslipoproteinemia (lipoprotein disorders). In one embodiment, the disease or condition is selected from a group consisting of metabolic syndrome, atherosclerosis, coronary heart disease, bile acid-related liver disease, cholestasis; hypertriglyceridemia or hyperlipidaemia, hypercholesterolemia, nonalcoholic fatty liver disease (NAFLD), non-alcohol steatohepatitis (NASH), steatosis or cirrhosis, hepatocellular carcinoma (HCC), and homozygous or heterozygous familial hypercholesterolaemia (FH). In one embodiment, the disease or disorder is homozygous or heterozygous familial hypercholesterolaemia (FH).
[0199] Assays for testing the expression of an oligonucleotide may be conducted using any assay known in the art. Likewise, if the oligonucleotide is expressed by a vector, assays for testing the expression of the oligonucleotide may be conducted using any assay known in the art. For example, an assay for testing the expression of the oligonucleotide may include PCR. Functional analysis of the oligonucleotide may be done by assessing for target protein expression by Western Blotting.
[0200] Oligonucleotides for use of the invention are preferably assayed in vitro and / or in vivo for the desired therapeutic or prophylactic activity prior to use in humans. For example, in vitro and / or in vivo assays can be used to determine whether it is preferable to administer an oligonucleotide and / or another therapy.
[0201] Also provided herein are methods of preventing or treating a disease or condition associated with ApoB in a subject. In one embodiment, the ASO effects site-directed adenosine-to-inosine (A-to-l) editing of a target adenosine in a target RNA sequence derived from a sequence of an endogenous apoB gene such that there is a reduction in ApoB protein secretion. In some embodiments, a method can be for the treatment of a condition, disorder or disease associated with apoB in a subject, wherein the method comprises administering to a subject a therapeutically effective amount of an oligonucleotide or a pharmaceuticalcomposition thereof. In one embodiment, the resulting modified ApoB protein has reduced synthesis and / or reduced secretion levels.
[0202] Provided herein is also a modified ApoB protein comprising one or more amino acid substitutions selected from the group consisting of Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A, optionally wherein the mutation has been introduced by A-to-l editing using one or more oligonucleotides selected from the list consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 11.
[0203] In one embodiment, the oligonucleotides of the invention target mRNA coding for wildtype ApoB. In one embodiment, the oligonucleotides of the invention target mRNA coding for wildtype human ApoB (hApoB). In one embodiment, the oligonucleotides of the invention target mRNA coding for an ApoB protein as listed in Table A. In one embodiment, the oligonucleotides of the invention target mRNA coding for ApoB-205. In one embodiment, the oligonucleotides of the invention target mRNA coding for ApoB-206. In one embodiment, the oligonucleotides of the invention target mRNA coding for ApoB-207. In one embodiment, the oligonucleotides of the invention target mRNA coding for ApoB-208.
[0204] Treatment of the subject is intended to reduce the level of circulating ApoB and / or LDL-C. A further benefit of the therapy is that the treatment avoids or reduces the risk of hepatotoxicity and / or liver steatosis.
[0205] In one embodiment, an oligonucleotide or composition containing the same is administered to a subject. In some embodiments, an oligonucleotide or composition containing the same is administered to a mammal, preferably a human. In certain embodiments, an oligonucleotide or composition containing the same is administered to a naive subject, i.e., a subject that does not have a disease or disorder. In one embodiment, an oligonucleotide or composition containing the same is administered to a naive subject that is at risk of developing a disease or disorder. In some embodiments, an oligonucleotide or composition containing the same is administered to a patient before symptoms manifest or symptoms become severe. In certain embodiments, an oligonucleotide or composition containing the same is administered to a patient who has been diagnosed with a disease or disorder.
[0206] In some embodiments, the subject to be administered an oligonucleotide or composition containing the same is any individual at risk of developing a disease or disorder. In one embodiment, the subject suffers from a disease or disorder.
[0207] Also provided herein are methods of treating a subject suffering from a disease or disorder, comprising administering an effective amount of the chemically modified oligonucleotide of the invention or the composition of the invention In one embodiment, the disease or disorder is a liver or metabolic diseases and / or cardiac or cardiovascular disease.
[0208] Also provided herein is the use of an oligonucleotide of the invention in therapy.
[0209] The composition of the invention comprises the oligonucleotide of the invention. According to a further aspect, the invention relates to a kit or kit of parts comprising an oligonucleotide of the invention and / or the (pharmaceutical) composition of the invention. The kit additionally comprises instructions for use.Methods for ApoB target editing
[0210] The present invention provides a method for altering a target polynucleotide sequence in a primary cell. The invention is used to make desired changes, e.g., an A-to-l or A-to-G change, in a target sequence in a cell or a subject. The target sequence may be edited through an adenosine deamination reaction mediated by ADAR, converting adenosines into inosine. Alternatively, the target sequence may be edited using gene therapy. This site-directed editing may take place in vitro, in situ, in vivo or ex vivo.
[0211] The present invention relates, inter alia, to methods for editing a target adenosine in a target nucleic acid. For example, the present invention provides methods of editing an ApoB polynucleotide, e.g., a wild-type ApoB encoding polynucleotide to generate a ApoB variant. The polynucleotide can be RNAor DNA. For instance, the present invention relates to in vitro methods for editing a target adenosine in a target RNA sequence derived from a sequence of an endogenous ApoB gene. The present invention also relates to methods for deaminating at least one adenosine present in a target RNA sequence derived from a sequence of an endogenous ApoB gene in a cell.
[0212] In one aspect provided herein is a method for mutating an endogenous ApoB allele in a cell, wherein the method comprises delivering to the cell a non-naturally occurring composition that can modify the ApoB allele at one or more of the positions such that there are induced mutations in the ApoB protein at one or more of the following positions Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A.
[0213] In one embodiment, the method comprises introducing into the cell (i) one or more ribonucleic acid (RNA) sequences that comprise a portion that is complementary to the ApoB protein coding sequence and comprise a binding site for a CRISPR associate (Cas) protein; (ii) a Cas nucleic acid sequence or a variant thereof that encodes the Cas protein that targets but does not cleave the target nucleic acid sequence; and wherein the coding sequence is to be edited such that the ApoB protein has decreased synthesis and / or decreased secretion levels.
[0214] In one embodiment, the method for mutating the endogenous ApoB allele comprises delivery of mRNA. In one embodiment, the method for mutating the endogenous ApoB allele comprises gene therapy.
[0215] In one embodiment, the mutation results in a decrease in ApoB expression. In one embodiment, the mutation results in a decrease in ApoB secretion. In one embodiment, the A-to-l editing results in a mutation in the ApoB amino acid sequence that is different from the native sequence, optionally wherein ApoB is human ApoB (hApoB).
[0216] In another aspect provided herein is a method for editing a target adenosine in a target nucleic acid, wherein the method comprises contacting the target nucleic acid with an oligonucleotide described herein. In one embodiment, the method is used in vitro. In one embodiment, the method is used in vivo. In one embodiment, the method is used ex vivo. In one embodiment, the method is used in situ.
[0217] In another aspect provided herein is a method for deaminating at least one specific adenosine present in a target RNA sequence derived from an endogenous ApoB gene in a cell, wherein the method comprises the steps of:(a) contacting the target nucleic acid with an oligonucleotide;(b) allowing uptake by the cell of the oligonucleotide;(c) allowing annealing of the oligonucleotide to the target RNA sequence; and(d) allowing a mammalian ADAR enzyme comprising a natural dsRNA binding domain as found in the wildtype enzyme to deaminate the target adenosine in the target RNA sequence to an inosine.
[0218] In one embodiment, the method comprises after step (d), a step of identifying the presence of the inosine in the RNA sequence. The editing reaction is preferably monitored or controlled by sequence analysis of the target RNA.
[0219] Introducing a single A-to-l substitution in the target RNA decreases ApoB expression and / or secretion. In one embodiment, a single A-to-l substitution in the target RNA causes a decrease in ApoB expression. In one embodiment, a single A-to-l substitution in the target RNA causes a decrease in ApoB secretion. Introducing a single A-to-G substitution decreases ApoB expression and / or secretion. In one embodiment, a single A-to-G substitution causes a decrease in ApoB expression. In one embodiment, a single A-to-G substitution causes a decrease in ApoB secretion.
[0220] The methods of the present invention can be used with cells from any organ, e.g., skin, lung, heart, kidney, liver, pancreas, gut, muscle, gland, eye, brain, blood and the like. The invention is particularly suitable for modifying ApoB derived sequences in cells, tissues or organs implicated in a diseased state associated with LDL-C. In particular, the invention may be used with liver cells, bronchial epithelial cells and adrenal gland and cortex tissue. For example, such cells may include, but are not limited, to hepatocytes and / or hepatocyte like cells. In one embodiment, the ApoB is derived from a tissue or organ selected from the group consisting of: brain, eye, endocrine tissue, respiratory tissue, liver, pancreas, kidney, connectiveand soft tissue. The methods described herein may be used to target different sites or domains within the ApoB transcript to produce a modified ApoB protein.
[0221] The invention also provides an in vitro method for deaminating at least one specific adenosine present in a target RNA sequence in a cell. Hence, in on aspect provided herein is an in vitro method for deaminating at least one specific adenosine present in a target RNA sequence in a cell, wherein the method comprises the steps of: (a) contacting the target nucleic acid with a chemically modified oligonucleotide of the invention; (b) allowing uptake by the cell of the chemically modified oligonucleotide; (c) allowing annealing of the chemically modified oligonucleotide to the target RNA sequence; and (d) allowing a mammalian ADAR enzyme comprising a natural dsRNA binding domain as found in the wild type enzyme to deaminate the target adenosine in the target RNA sequence to an inosine.
[0222] In one embodiment, the method comprises after step (d), a step of identifying the presence of the inosine in the RNA sequence.
[0223] The editing reaction is preferably monitored or controlled by sequence analysis of the target RNA.
[0224] Also, a chemically modified oligonucleotide of the invention or a (pharmaceutical) composition may be used in the diagnosis of a genetic condition, disease or disorder. Therein, the disease or disorder is preferably selected from the group consisting of cardiovascular diseases and liver diseases.
[0225] The invention is used to make desired changes in a target sequence in a cell or a subject by site-directed editing of nucleotides using an oligonucleotide that is capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated adenosine to inosine. As a result, the target sequence is edited through an adenosine deamination reaction mediated by ADAR, converting adenosines into inosine.
[0226] The specific target sites in ApoB are targeted using the oligonucleotides of the invention. The different target sites in ApoB can also be targeted using various alternative methods described herein.
[0227] In one embodiment, the specific ApoB target sites are edited using CRISPR / Cas9 (clustered regularly interspaced short palindromic repeat / CRISPR-associated 9) or derivatives thereof.
[0228] In one embodiment, the specific ApoB target sites are edited using adenine base editors (ABE).
[0229] In one embodiment, the specific ApoB target sites are edited using transcription¬ activator like effector nucleases (TALEN).
[0230] In one embodiment, the specific ApoB target sites are edited using Zinc-finger nucleases (ZFNs).EXAMPLES
[0231] The present invention shall be described in more detail by the following Examples. The examples shown in the following are merely illustrative and shall describe the present invention in a further way. These examples shall not be construed to limit the present invention thereto.
[0232] The sequences disclosed herein are also shown in the enclosed sequence listing. However, the sequence listing shows only the sequence of nucleotides, whereas the modification of the nucleotides and of the bonds between the nucleotides is not shown in the sequence listing. The relevant modifications associated with the sequences are disclosed in the tables below and, to some extent, in the Figures of this application.
[0233] For all experiments, target editing efficacy is expressed as the percentage [%] of edited target sites found in all detected target sites in the target transcript.Example 1. Single variants can be efficiently introduced into ApoB in vitro by RNA editing with RESTORE+ platform.
[0234] Apolipoprotein B (ApoB) is an important structural component of low-density lipoprotein cholesterol (LDL-C) and plays a key role in LDL-C transport and removal. Reduction in ApoB synthesis is expected to reduce circulating LDL-C, a proven risk factor of cardiovascular disease (Kastelein et al., 2006). It was found that multiple A-to-G sites within the ApoB coding region are associated with low LDL-C and a decrease in liver steatosis risk (FIG. 1A). Each site corresponds to a specific amino acid change in the ApoB protein caused by an A-to-G change in the ApoB coding sequence.
[0235] The human ApoB (hApoB) coding sequence and reference transcripts are listed in Table A:Table A: Human ApoB (hApoB) coding sequence.Table B. DNA coding region for ApoB protein. APOB-205 coding sequence. Target adenosine sites to introduce the APOB variants has been marked in bold and underlined.Table C. DNA coding region for ApoB protein. APQB-208 coding sequence.
[0236] The different ApoB A-to-G missense variants found to reduce the total LDL-C level without increasing alanine transaminase (ALT), a marker for liver steatosis, are shown in Table 1. All values belong to heterozygous genotype.Table 1. APOB A-to-G missense variants.
[0237] To determine the effect of a single A-to-G mutation within ApoB on protein stability, different ApoB protein variants were generated and screened for their stability. This was done by generating different oligonucleotides that target ApoB coding mRNA and mediate A-to-l editing at one of those specific sites. The different oligonucleotides, carrying different chemical modification patterns were subsequently assayed for their in vitro RNA editing efficacy. The different oligonucleotide constructs and their respective modification patterns are listed in Table 2.Table 2. Oligonucleotide constructs and modifications. Corresponding amino acid change is shown in bracket, d = 2’-H (deoxyribose; DNA); * = phosphorothioate (PS); & = (mesyl) methanesulfonyl; m = 2’-OMe; f = 2’-fluoro; I = inosine; MeC = 5’-methylcytidine; In = LNA, locked nucleic acid; moe = 2’-O-methoxyethyl.&&&
[0238] Oligonucleotide synthesis: Oligonucleotides were synthesized DMT-ON on a 200 nmol scale using 1000A CPG supports from Glen Research: either standard or universal (loading of ca. 30 pmol / g) on a MerMade48 oligonucleotide synthesizer. Fully protected nucleoside phosphoramidites were incorporated using standard solid-phase oligonucleotide synthesis, i.e., 3% dichloroacetic acid in DCM for deblocking, 0.25 M ETT in acetonitrile as activator for amidite couplings, 20% acetic anhydride in THF and 10% 1- methylimidazole in THF / pyridine for capping, 0.02M iodine in THF / water / pyridine for oxidation and 0.1 M xanthane hydride in pyridine:acetonitrile 1 :1 (v:v) forthiolation. The mesyl phosphoramidate linkages were obtained via Staudinger reaction, which was carried out with 0.5 M solution of mesyl azide (Aurum Pharmatech) in dry acetonitrile for 15 min at ambient temperature. The guanidine phosphoramidate linkages were also obtained via Staudinger reaction, from 0.5 M solution of 2-azido-1,3- dimethylimidazolinium hexafluorophosphate (abcr GmbH) in dry acetonitrile for 15 min at ambient temperature. Amidites were dissolved to 0.1 M in acetonitrile and incorporated using 3 min. coupling time for DNA amidites and 6 min. coupling time for all other amidites. After synthesis, oligonucleotides were cleaved from CPG and deprotected at room temperature in 28%-30% ammonium hydroxide and / or 50% / 50% mixture of 28%-30% ammonium hydroxide / 40% aqueous methylamine (AMA) for 36 hours or 2 h, respectively. Deprotected oligonucleotides were directly adsorbed on GlenPak cartridges and purified DMT-ON. Purified oligonucleotides were dried down, desalted, quantified by means of UV-Vis spectrophotometry and reconstituted in 1xPBS for use in biological experiments. Compound identity was confirmed by LC-MS (Column: DNA-Pac RP; Total flow: 0.5 mL / min.; Oven temperature: 50°C; Total run time: 10 min.; Eluent gradient: 15-60% B in A; Mobile Phase A: 8 mM Triethylamine (TEA) and 200 mM HFIP in LC-MS grade water; Mobile Phase B: LC-MS grade MeOH).
[0239] Oligonucleotide Dilutions: All ASOs were diluted to 1 pM with PBS. The ASOs were further diluted 1 :2 in Opti-MEM (500 nM) giving a final concentration of 50 nM (10 pl ASO in Opti-MEM + 10 pl RNAiMAX mix in 80pl medium) and / or diluted 1 :5 and 1 :25 in Opti-MEM (200 nM, 40 nM) giving a final concentration of 20 nM and 4 nM (10 pl ASO in Opti-MEM + 10 pl RNAiMAX mix in 80pl medium).
[0240] Transfection: Transfection of oligonucleotides was performed on Huh-7 cells. Cells were transfected with 20 nM of the respective oligonucleotide. A transfection mix was prepared by mixing equal volumes of 10x concentrated ASO and transfection reagent, and 20 pl of transfection mix was transferred to cells containing 80 pl fresh culture medium. If not statedotherwise, cells were washed with PBS and harvested 24 hours after transfection in 125 pl / well lysis buffer (Dynabeads mRNA direct kit, Invitrogen). Lysates of 96-well plates were transferred to a384-plate and mRNA was isolated using the Dynabeads mRNA direct kit and an automated plate washer (Cytena C. Wash).
[0241] RNA isolation / Lysis: RNA isolation took place with Dynabeads® mRNA Purification Kit and Qiagen RNeasy Minikit (Qiagen, cat: 74106) according to the manufacturer’s protocol.
[0242] qPCR: qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, cat: E3005E). For qPCR, for each primer a qPCR Master mix was prepared on ice (Table 3). The qPCR primers are listed in Table 4. 7 pl / well of Master mix was used. Next, 3 pl / well mRNA template were added. qPCR was measured using Started QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific) and data was analyzed using QuantStudio Design & Analysis Software v1 .5.3. Double delta ct- Analysis was subsequently performed.Table 3: qPCR Master MixTable 4: qPCR Primers[002431 Sequencing PCR: The following primers were used for sequencing PCR of the different target sites.Table 5: Editing Primer pairs - Sense Primer reaction.
[0244] The 5'Adapter - Forward Primer is: tcgtcggcagcgtcagatgtgtataagagacag (SEQ ID NO: 75) and the 5'Adapter - Reverse Primer is : gtctcgtgggctcggagatgtgtataagagacag (SEQ ID NO: 76)
[0245] As shown in FIG. 1A, several A-to-G sites in the ApoB coding region are associated with low LDL-C and decreased liver steatosis risk. Targeting these specific sites with the oligonucleotides of the invention, it was possible to induce RNA editing of at least 20% (FIG. 1B). Specifically, there was a marked increase in RNA editing for AI-2771 , AI-2772, Al-2775, and AI-2779 reaching RNA editing levels of more than 50%. Dashed line marks 50% editing threshold to achieve heterozygosity (FIG. 1B).
[0246] The results demonstrate that oligonucleotides can be effectively used to mediate A-to-l editing of the target RNA, introducing an A-to-G change that generates ApoB protein variants. The data further demonstrate that variants were efficiently introduced into ApoB in vitro by RNA editing with RESTORE+ platform.Example 2. A-to-l editing of ApoB target sites K1474R and N3465S induces a reduction in ApoB mRNA and ApoB protein secretion.
[0247] While A-to-l editing was achievable using the oligonucleotides of the invention as described in Example 1 , further studies were conducted to determine the immediate effects of this A-to-l editing on mRNA levels and ApoB protein secretion. To do so, the mRNA levels and amount of ApoB protein secretion was determined for targets K1474R and N3465S. RNAiMax served as negative control. “ASO dead” (AI-3257) was designed to bind the target site without enabling editing and served as negative control.
[0248] Transfection: Transfection of oligonucleotides was performed on Huh-7 cells. Cells were transfected with 20 nM of the respective oligonucleotide. Briefly, _Huh-7 cells were grown in 5 mM glucose DMEM (1 g / l Glucose, Thermo #11885084) supplemented with 10% FBS, 2 mM Gluta-Max (Gibco). Cells were cultured at 37°C and 5% CO2. 50,000 Huh-7 cells were seeded in 24-well plates and transfected 24 hours later with the respective construct and Lipofectamine 3000 (Thermo #L3000008), following manufacturer’s instructions. 24 hrs after transfection, cell culture media was removed, and 96-well plates were directly frozen at -80°C for up to 1 week.
[0249] RNA isolation was performed as described for Example 1.
[0250] ApoB ELISA: ApoB secretion was measured via ELISA. ELISA kit was Proteintech (#KE00158) was used according to the manufacturer’s protocol. Briefly, standard working solution was prepared by centrifuging at 1000 x g, 1 min. The standard stock was reconstituted with 1 mL of Sample Diluent Buffer PT 1-ec (for human serum, human plasma and cell culture supernatant samples). The stock (Std7) is 250 ng / mL. The reconstituted Standard was kept for 10 minutes at room temperature, shaking gently (avoid foaming). Dilution were subsequently prepared by micing and gentle vortexing. 500 pL were transferred from higher concentration to next lower concentration, replacing the pipette tip for each dilution (Table 8).The first tube (Std #0) serves as the Blank. Fresh standards were used for every ELISA assay.Table 8: Standard solution and dilutions.
[0251] Sample preparation: Sample were prepared by caculating the total number of wells required for assay. Samples were performed in triplicates. ELISA sample volume is 100 pL; if needed residual volume was made up with dilution buffer.Table 9: ELISA summary.
[0252] ELISA Procedure: 100 pL of lysate was added to each well and add 100 pL of samples into the appropriate wells. Cover with the Plate Cover and incubate for 2h at 37°C. Next, antibody solutions were prepared. This was performed 1h after sample incubation. Antibodies were initially centrifuged to precipitate to the bottom. Antibody working solutions with dilutions were prepared as listed in Table 10. Dilutions were kept at room temperature to equilibrate till use (~30 mins).Table 10. Antibody solutions.
[0253] Liquid was removed from each well and washed 4 times, with 350 pL of 1 x Wash Solution for 1-2 mins. Detection was done by adding 100 pL of Biotinylated Antibody Working Solution to each well. The plates were then covered with the Plate Cover and incubated for 1h at 37°C. The samples were then washed again as described above. Subsequently, 100 pL of Streptavidin-HRP Working Solution were added to each well. The wells were then covered with the plate sealer and incubated for 40 mins at 37°C. Next, 100 pL of Stop Solution were added on top of each well and plates shaken for 1 min to mix well. Samples were measured immediately after. A double wavelength readout was performed (450 nm and 630 nm).
[0254] Statistical Analysis: One-way ANOVA with Tukey’s multiple comparison test, significance to RNAiMax and AI-3075 (“ASO dead”); p < 0.05.
[0255] The different oligonucleotide constructs used, and their respective modification patterns are listed in Table 11. The results are shown in FIGs. 2A-2F.Table 11. Oligonucleotide candidates targeting used. Corresponding amino acid substitution is shown in bracket, d = 2’-H (deoxyribose; DNA); * = phosphorothioate (PS); & = (mesyl) methanesulfonyl; m = 2’-OMe; f = 2’-fluoro; I = inosine; MeC = 5’-methylcytidine; In = LNA, locked nucleic acid; moe = 2’-O-methoxyethyl.&&&&& &&&&&&&&&&&&&&&&&&&&& &&& && &&&
[0256] As shown in FIGs. 2A and 2B, for site K1474R, AI-2780 showed about 15% increase, AI-3075 showed about 10-20% increase and AI-3437 showed about 40% increase in apoB RNA editing at the RNA level, while for site N3465S, AI-2776 showed about 10% increase, AI-3811 showed about 30% increase and AI-3810 showed about 40% increase in apoB RNA editing at the RNA level. Importantly, as shown in FIGs. 2C and 2D, editing the K1474R and N3465S sites resulted in a significant reduction in ApoB protein section as compared to controls. Secretion was normalized against the controls scramble control (KD), catalytically dead AI-3257 (K1474R) and AI-4140 (N3465S). These data show that apoB secretion was reduced by 59% in cells transfected with AI-3437 targeting K1474R compared to AI-4140 control. Interestingly, at the same time, the editing did not cause a significant change in the overall ApoB mRNA levels when compared to RNAiMax and AI-3257 (“ASO dead”) (FIG. 2E). FIG. 2F shows the editing efficiency of AI-3075 compared to AI-3084. Both ASOs target APOB site K1474R, however AI-3075 contains the non-canonical nucleobase inosine at the -2 position (N-2) and AI-3084 does not. AI-3075 shows improved editing efficiency compared to AI-3084.
[0257] Overall, the result show that AI-3075 could be used to efficiently target and mediate editing of ApoB mRNA at target site 1474 (K1474R). This editing did not reduce the relative amount of ApoB mRNA, indicating there was no detrimental effect or degradation of the mRNA. However, a decrease in ApoB protein secretion was observed, suggesting that the reduction in ApoB protein is regulated downstream at the protein level.Example 3. Introducing ApoB variants in vivo shows reduced LDL-C levels.
[0258] To further evaluate the efficacy of various oligonucleotides for targeting and editing specific sites in ApoB, in vivo studies were conducted in mice to assess editing efficiency and the overall impact on LDL-C levels.
[0259] In vivo study: In vivo study was conducted in the hApoB / hCETP mouse model. This model is used as it mirrors human HDL / LDL distribution. Oligonucleotides were formulated with lipid nano particles (LNPs). Mice were administered the oligonucleotide at day 0 (dO) at a concentration of 3 mg / kg intravenously. Samples were collected on days 3, 5 and 7. Vehicle served as negative control.
[0260] The different oligonucleotide constructs and their respective modification patterns are listed in Table 12. The results are shown in FIGs. 3A-3D.Table 12. Oligonucleotide candidates targeting used. Corresponding amino acid change is shown in bracket, d = 2’-H (deoxyribose; DNA); * = phosphorothioate (PS); & = (mesyl) methanesulfonyl; m = 2’-OMe; f = 2’-fluoro; I = inosine; MeC = 5’-methylcytidine; In = LNA, locked nucleic acid; moe = 2’-O-methoxyethyl.& && && & &&&&& && &&&&&&&&& &&&&&&&& &&&& &&&&&& &&&&&&&&&&& &&&&
[0261] As shown in FIGs. 3A-3D, there was an increase in ApoB target editing (%) when compared to the control site. Specifically, there was efficient editing of target site K1474R and target site T4093A at d3 (FIG. 3A). Editing was specifically prominent for target site T4093A with editing levels of about 40%. Notably, this increase in target editing coincided with a decrease in LDL-C levels (FIG. 3B). However, while there was higher increase in ApoB target editing (%) for site T4093A, this higher percentage editing was not reflected in proportionally lower LDL-C level. As shown in FIG. 3B, targeting site K1474R and site T4093A, an about 25% reduction in LDL-C levels could be observed. Further enhancing the results of RNA editing at site K1474R, RNA editing of sites N1523S and N3465S can also be efficiently edited in hAPOB / hCETP mouse livers at day 5 (FIG. 3C) and day 7 (FIG. 3D), post-treatment with LNP-ASO.
[0262] These data show that the oligonucleotides can be used to specifically target the ApoB transcripts to mediate A-to-l editing. These data further demonstrate the potential of ASOs to mediate efficient ApoB editing in lipid nanoparticle (LNP) format leading to 25% LDL-C lowering.Example 4. Genetic link between ApoB variants and reduced LDL-C levels
[0263] Blood biochemistry data were examined for UK BioBank (UKBB) participants who were not taking cholesterol lowering medications and who were identified as having Caucasian ethnic background.
[0264] Method: Individual-level data from UK Biobank was filtered to select participants who indicated they were not taking cholesterol lowering medications (p6153, p6177), identified their ethnic background (p21000) as “British”, “Irish”, “White”, or “any other white background”, and for whom blood biochemistry measurements from their initial assessment were available for all of serum LDL cholesterol (LDL direct, p30780), alanine aminotransferase (ALT, p30620), aspartate aminotransferase (AST, p30650), and gammaglutamyl transferase (GGT, p30730). This group of participants were then split into four subsets according to their genotypes for the R46L variant in the gene PCSK9, rs11591147, and the K1474R variant in the gene APOB, rs759246439, with participants who carried both variants being excluded:1. Homozygous wildtype for R46L and heterozygous alternate for K1474R, n = 872. Homozygous alternate for R46L and homozygous wildtype for K1474R, n = 121 3. Heterozygous alternate for R46L and homozygous wildtype for K1474R, n = 12,535 4. Homozygous wildtype for both R46L and K1474R, n = 347,976The significance of the differences between the groups was evaluated by one-way ANOVA followed by pairwise comparisons performed using Tukey’s HSD test (a = 0.05).
[0265] As seen in FIG. 4A, serum LDL cholesterol (LDL-C) levels for participants heterozygous for the K1474R variant in APOB (n=87), participants heterozygous (n=12,535) or homozygous (n=121 ) for the well-known R46L variant in PCSK9, and UKBB participants who did not carry either variant (n=347,976) were examined. Serum LDL levels in APOB K1474R carriers were lower than in PCSK9 R46L homozygotes, and significantly lower than in both PCSK9 R46L heterozygotes (p « 1 E-6) and UKBB participants who did not carry the variants (p « 1 E-6). Further, as seen in FIG. 4B, the liver enzymes alanine aminotransferase (ALT), aspartate aminotransferase (AST), and gamma-glutamyl transferase (GGT) were compared between carriers of the APOB K1474R variant and UKBB participants who did not carry either variant. The data showed that for all three enzymes the levels were not significantly different between the two groups of participants.
[0266] Those having ordinary skill in the art will appreciate that the disclosure can be modified in ways not specifically described herein.REFERENCES. Agrawal, S.; and Kandimalla, E. R. (2004). Antisense and siRNA as agonists of Toll-like receptors. Nature Biotechnol. 22: 1533-1537.. Bass, B.L.; Weintraub H. (1987). A developmentally regulated activity that unwinds RNA duplexes. Cell. 48:607-13.. Behbodikhah, J., S. Ahmed, A. Elyasi, L. J. Kasselman, et al. (2021). Apolipoprotein B and Cardiovascular Disease: Biomarker and Potential Therapeutic Target. Metabolites. 11(10): 690.. Bittner, Z. A.; Liu, X.; Shankar, S.; Tapia-Abelian, A.; Kalbacher, H.; Andreeva, L.; Mangan, M.; Duwell, R; Lovotti, M.; Bosch, K.; Dickhdfer, S.; Marcu, A.; etc. (2021). BTK operates a phospho-tyrosine switch to regulate NLRP3 inflammasome activity. JEM. 218(11): e20201656.. Chambergo-michilot, D.,A. Alur, S. Kulkarni, and A. Agarwala (2022). Mipomersen in Familial Hypercholesterolemia: An Update on Health-Related Quality of Life and Patient-Reported Outcomes. Vase Health Risk Manag. 18: 73-80.. Cideciyan, A. V.; Jacobson, S. G.; Drack, A. V.; Ho, A. C.; Charng, J.; Garafalo, A. V.; et al.(2019). Effect of an intravitreal antisense oligonucleotide on vision in Leber congenital amaurosis due to a photoreceptor cilium defect. Nat. Med. 25(2): 225-228.. Crooke, S. T.; Vickers, T. A.; and Liang, X. (2020). Phosphorothioate modified oligonucleotide-protein interactions. Nucleic Acids Research. 48(10): 5235-5253.Debacker, A. J.; Voutila, J.; Catley, M.; Blkey, D.; and Habib, N. (2020). Delivery of Oligonucleotides to the Liver with GalNAc: From Research to Registered Therapeutic Drug. Molecular Therapy. 28(8): 1759-1771.Gabriel, C. M.; Pimentel, B. R.; Gomez, C. A.; Cedillo, I.; A. A. Rodriguez. (2022). Improved Purification of GalNAc-Conjugated Antisense Oligonucleotides Using Boronic Acids’; Org. Process Res. Dev. 26: 413-421Gagliardi, M., and Ashizawa, A. T. (2021). The Challenges and Strategies of Antisense Oligonucleotide Drug Delivery. Biomedicines. 9(4): 433.Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012).Iwamoto, N.; Butler, D. C. D.; Svrzikapa, N.; Mohapatra, S.; Zlatev, I.; Sah, D. W. Y; Meena, Standley, S. M. et al. (2017). Control of phosphorothioate stereochemistry substantially increases the efficacy of antisense oligonucleotides. Nat. Biotech. 35: 845-851 .Janas, M. M.; Jiang, Y; Schlegel, M. K.; Waldron, S.; Kuchimanchi, S.; and Barros, S. A.. (2017). Impact of Oligonucleotide Structure, Chemistry, and Delivery Method on In Vitro Cytotoxicity. Nucleic Acid Therapeutics. 27(1):Kastelein, J. J. P., M. K. wedel, B. F. Baker, J Su et al., (2006). Potent Reduction of Apolipoprotein B and Low-Density Lipoprotein Cholesterol by Short-Term Administration of an Antisense Inhibitor of Apolipoprotein B. Circulation. 114(16): 1729-1735.Kosmas, C. E., A. Munoz Estrella, A. Sourlas, D. Silverio, E. Hilario, P. D. Montan, E. Guzman. (2018). Inclisiran: A New Promising Agent in the Management of Hypercholesterolemia. 6(3): 63.Lorenz, P.; Baker, B. F; Bennett, C. F.; and Spector, D. L. (1998). Phosphorothioate antisense oligonucleotides induce the formation of nuclear bodies. Mol. Biol. Cell. 9: 1007-1023.Lehmann, K. A. and B. L. Bass (1999). The importance of internal loops within RNA substrates of ADARI. JMB. 291(1): 1-13.Merkle, T.; Merz, S.; Reautschnig, P.; Blaha, A.; Li, Q.; Vogel, P.; Wettengel, J; Li, J. B.; Stafforst, T. (2019). Precise RNA editing by recruiting endogenous ADARs with antisense oligonucleotides. Nature Biotechnol. 37: 133-138.Miroshnichenko, S. K.; Patutina, O. A.; Burakova, E. A.; Chelobanov, B. P.; Fokina, A. A.; Vlassov, V. V.; Altman, A.; Zenkova, M. A.; and Stetsenko, D. A. (2019). Mesyl phosphoramidate antisense oligonucleotides as an alternative to phosphorothioates with improved biochemical and biological properties. Proc. Natl. Acad. Sci. USA. 116(4): 1229-1234.Monian, P.; C. Shivalila; G. Lu; M. Shimizu; D. Boulay; K. Bussow; et al., (2022). Endogenous ADAR-mediated RNA editing in non-human primates using stereopure chemically modified oligonucleotides. Nature Biotech. 40: 1093-1102.Nabel, E. G. (2003). Cardiovascular Disease. Genomic Medicine. N Engl J Med. 349:60-72. Olofsson S.O., Boren J. Apolipoprotein B: A clinically important apolipoprotein which assembles atherogenic lipoproteins and promotes the development of atherosclerosis. J. Intern. Med. 258: 395-410.Patutina, O. A.; Gaponova (Miroshnichenko), S. K.; Sen’kova, A. V.; and Zenkova, M. A. (2020). Mesyl phosphoramidate backbone modified antisense oligonucleotides targeting miR-21 with enhanced in vivo therapeutic potency. PNAS. 117(51): 32370-32379.Quemener, A. M.; Bachelot, L.; Forestier, A.; Donnou-Fournet, E.; Gilot, D.; and Galibert, M.-D. (2019). The powerful world of antisense oligonucleotides: From bench to bedside. Wiley Interdiscip. Rev. RNA. 11(5): e1594.Rebagliati, M.R.; Melton D. A. (1987). Antisense RNA injections in fertilized frog eggs reveal an RNA duplex unwinding activity. Cell. 48: 599-605.Reynolds, M. A.; Hogrefe, R. I.; Jaeger, J. A.; Schwartz, D. A.; Riley, T. A.; et al. (1996). Synthesis and Thermodynamics of Oligonucleotides Containing Chirally Pure RP Methylphosphonate Linkages. Nucleic Acids Research 24(22): 4584-4591.Shen, W.; De Hoyos, C. L.; Migawa, M. T.; Vickers, T. A.; Sun, H.; Low, A.; Bell III, T. A.; Rahdar, M.; Mukhopadhyay, S.; Hart, C. E.; Bell, M.; Riney, S.; Murray, S. F; Greenlee, S.; Crooke, R. M.; Liang, X.; Seth, S. S., and Crooke, S. T. (2019). Chemical modification of PS-ASO therapeutics reduces cellular protein-binding and improves the therapeutic index. Nat. Biotech. 37: 640-650.Sothilingham, V.; Garrido, M. G.; Jiao, K.; Buena-Atienza, E.; Sahaboglu, A. et al. (2015). Retinitis pigmentosa: impact of different Pde6a point mutations on the disease phenotype. Human Mol. Genetics. 24(19): 5486-5499.Stephenson, M. L; Zamecnik, P. C.. (1978). Inhibition of Rous sarcoma viral RNA translation by a specific oligodeoxyribonucleotide. Proc. Natl. Acad. Sci. USA. 75(1): 285-288.Thomas, J. M.; and Beal, P. A. (2017). How do ADARs bind RNA? New protein-RNA structures illuminate substrate recognition by the RNA editing ADARs. Bioassays. 39(4): 1-17.Tomaselli, S.; Locatelli, F.; Gallo, A. (2014). The RNA editing enzymes ADARs: mechanism of action and human disease. Cell and Tissue Research. 356: 527-532.Vogel, R; Schneider, M. F.; Wettengel, J.; and Stafforst, T. (2014). Improving site-directed RNA editing in vitro and in cell culture by chemical modification of the guideRNA. Angew. Chem. Int. Ed. Engl. 53(24): 6267-6271.Wooddell, C. I.; Blomenkamp, K.; Peterson, R. M.; Subbotin, V. M.; Schwabe, C.; Hamilton J.; etc. (2020). Development of an RNAi therapeutic for alpha-1 -antitrypsin liver disease. JCI.5(12): e135348.Wulff, B.-E.; and Nishikura, K. (2010). Substitutional A-to-l RNA editing. Interdiscip. Rev. RNA. 1(1): 90-101.Zinshteyn, B., and Nishikura, K. (2009). Adenosine-to-inosine RNA editing. Rev. Syst. Biol. Med. 1(2): 202-209.
Claims
CLAIMSWhat is claimed is:
1. An antisense oligonucleotide (ASO) for use in the prevention or treatment of a disease or a condition associated with ApoB in a subject, wherein the ASO effects site-directed adenosine-to-inosine (A-to-l) editing of a target adenosine in a target RNA sequence derived from a sequence of an endogenous ApoB gene.
2. The ASO for use of claim 1 , where the target RNA encoding a modified ApoB protein shows reduced ApoB protein secretion, and / or reduced ApoB protein synthesis.
3. The ASO for use of claim 1 or claim 2, wherein the use of the oligonucleotide results in a reduced level of circulating LDL (LDL-C) in the subject.
4. The ASO for use of any one of claims 1 -3, wherein the subject is human.
5. The ASO for use of any one of claims 1-4, wherein the A-to-l editing results in a mutation in the ApoB amino acid sequence that is different from the native sequence, optionally wherein ApoB is human ApoB (hApoB).
6. The ASO for use of any one of claims 1-5, wherein the ApoB is derived from a tissue or organ selected from the group consisting of: brain, eye, endocrine tissue, respiratory tissue, liver, pancreas, kidney, connective and soft tissue.
7. The ASO for use of any one of claims 1-6, wherein the disease or condition is a cardiovascular disease or liver disease.
8. The ASO for use of any one of claims 1-7, wherein the disease or condition is dyslipidaemia, optionally wherein the dyslipidaemia is primary (genetic) dyslipidaernia, secondary (acquired) dyslipidaemia, mixed or combined dyslipidaemia, and / or dyslipoproteinemia (lipoprotein disorders).
9. The ASO for use of claim 7 or claim 8, wherein the disease or condition is selected from a group consisting of metabolic syndrome, atherosclerosis, coronary heart disease, bile acid-related liver disease, cholestasis; hypertriglyceridemia or hyperlipidaemia, hypercholesterolemia, non-alcoholic fatty liver disease (NAFLD), non-alcohol steatohepatitis (NASH), steatosis or cirrhosis, hepatocellular carcinoma (HCC), and homozygous or heterozygous familial hypercholesterolaemia (FH).
10. The ASO for use of any one of claims 1-9, wherein at least one target adenosine in the target RNA sequence is to be edited, optionally wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 adenosine(s) is / are to be edited in the target RNA.
11. The ASO for use of any one of claims 1-10, wherein the use comprises editing by an ADAR enzyme, optionally wherein the ADAR enzyme is an endogenous ADAR enzyme, an exogenous ADAR enzyme, or an engineered ADAR enzyme.
12. The ASO for use of claim 11, wherein the ADAR enzyme is mammalian, optionally wherein the ADAR enzyme is human ADAR.
13. The ASO for use of claim 12, wherein the ADAR is ADAR1 or ADAR2.
14. The ASO for use of claim 11, wherein the target adenosine (A) to be edited is located within a coding region of the ApoB target RNA transcript.
15. The ASO for use of any one of claims 1-14, wherein the modified ApoB protein comprises a functionally preserved amino acid substitution.
16. The ASO for use of claim 15, wherein the amino acid substitution prevents or reduces ApoB protein secretion when compared to wild-type ApoB protein.
17. The ASO for use of claim 16, wherein the amino acid substitution prevents or reduces ApoB protein secretion and reduces LDL-C.
18. The ASO for use of any one of claims 15-17, wherein the amino acid substitution is mediated by A-to-l editing in the target RNA, which corresponds to position 1014, at position 1344, at position 1474, at position 1523, at position 1796, at position 1883, at position 2947, at position 3465, and / or at position 4093 of the ApoB coding sequence by SEQ ID NO: 13.
19. The ASO for use of claims 15-18, wherein the modified ApoB protein comprises one or more amino acid substitutions selected from the group consisting of: Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A.
20. The ASO for use of any one of claims 1-19, wherein the editing decreases ApoB protein expression.
21. The ASO for use of any one of claims 1-20, wherein the ASO has a length of 20-80 nucleotides (nt) comprising:(i) a nucleic acid sequence substantially complementary to the target RNA sequence derived from the endogenous apoB gene; and(ii) a central base triplet (CBT) of 3 nucleotides (5’ - N+iNoN-i - 3’) with a central nucleotide (No) that is directly opposite to the target adenosine to be edited when the ASO is hybridised to the target RNA sequence.
22. The ASO for use of any one of claims 21, wherein the ASO comprises one or more chemical modifications.
23. The ASO for use of claim 22, wherein the ASO comprises a chemical modification at the 2’-position of the sugar residue.
24. The ASO for use of claims 1-23, wherein the oligonucleotide has an editing efficacy of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70%.
25. The ASO for use of claim 21-24, wherein the oligonucleotide contains an iso-uridine (Sbll) modification, optionally wherein the Sbll is at No.
26. The ASO for use of claim 1 -25, wherein the oligonucleotide is 30-50 nt long.
27. The ASO for use of claim 1-26, wherein the oligonucleotide is asymmetrical, optionally wherein the ASO has an asymmetry of:a) 29-1-15;b) 25-1-8c) 29-1-8; ord) 24-1-15.
28. The ASO for use of any one of claims 22-27, wherein no more than 6 consecutive nucleotides have the same 2’-modification, preferably wherein(a) no more than 4, 5, or 6 consecutive nucleotides are 2’-F-modified; and / or (b) no more than 4, 5, or 6 consecutive nucleotides are 2’-O-alkyl-modified.
29. The ASO for use of any one of claims 22-28, wherein the ASO comprises at least one internucleoside linkage modification selected from the group consisting of phosphorothioate (PS), 3'-methylenephosphonate, 5'-methylenephosphonate, 3'- phosphoroamidate, 2'-5'phosphodiester, methanesulfonyl (mesyl) and phosphoryl guanidine (PN).
30. The ASO for use of claim 29, wherein the oligonucleotide contains at least one methanesulfonyl (mesyl) linkage modification and / or at least one PS linkage modification.31 . The ASO for use of claim 30, wherein the internucleoside linkage modification content is at least 15%, preferably at least 30%.
32. The ASO for use of any one of claims 22-31 , wherein the regions 3’ and 5’ to the CBT do not contain more than a total of 6 deoxyribonucleosides or have a total deoxyribonucleoside content of 5-50%.
33. The ASO for use of any one of claims 22-32, wherein each of the three nucleosides of the CBT is either singularly or a combination of:(i) a deoxyribonucleotide; and / or(ii) 2’-FANA-modification; and / or(iii) 2’-O-methyl-modification; and / or(iv) 2’-F-modification.
34. The ASO for use of any one of claims 22-33, wherein(i) N+iis 2'-F, 2’-FANA, DNA, or 2'-O-methyl; and / or(ii) No is 2'-FANA or DNA, optionally No is deoxycytidine, or FANA-cytidine; and / or (iii) N-i is 2'-FANA, DNA, or 2’-O-methyl.
35. The ASO for use of any one of claims 22-34, wherein the oligonucleotide does not comprise a loop-hairpin structured ADAR recruitment motif.
36. The ASO for use of any one of claims 1-35, wherein the oligonucleotide comprises a moiety, which enhances cellular uptake of the artificial nucleic acid.
37. The ASO for use of claim 36, wherein the moiety enhancing cellular uptake is a triantennary N-acetyl galactosamine (GalNAc3).
38. The ASO for use of claim 37, wherein the GalNac is attached to the 3’ terminus of the oligonucleotide.
39. An ASO that comprises or consists of one of the sequences selected from: SEQ ID NO:1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81 , SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO:
89. SEQ ID NO: 90.
40. A composition comprising an ASO of claim 39.41 . An ASO of claim 39 or composition of claim 40, for therapeutic use.
42. The ASO or composition for use of claim 41 , wherein the therapeutic use is for treating or preventing a disorder or condition in a subject, wherein the disorder or condition is associated with ApoB, optionally wherein 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 adenosine(s) is / are to be edited in the target RNA.
43. The ASO or composition for use of claim 41 or 42, wherein the therapeutic use is for treating or preventing a disorder or condition in a subject, wherein the disorder or condition associated with LDL-C in a subject.
44. The ASO or composition for use of any one of claims 41-43, wherein the disorder or condition associated with LDL-C in a subject is dyslipidaemia, wherein the dyslipidaemia is primary (genetic) dyslipidaemia, secondary (acquired) dyslipidaemia, mixed or combined dyslipidaemia, and / or dyslipoproteinemia (lipoprotein disorders).
45. The ASO or composition for use of any one of claims 41-44, wherein the disorder or condition is hypertriglyceridemia or hypercholesterolemia, hypertriglyceridemia, nonalcoholic fatty liver disease (NAFLD), acute pancreatitis, non-alcoholic steatohepatitis (NASH) without or with hepatic fibrosis, cirrhosis and / or hepatocellular carcinoma.
46. An expression construct comprising a nucleotide sequence encoding human ApoB, wherein the nucleotide sequence is at least 60%, at least 70%, at least 80%, at least 90, at least 95% or is 100% identical to SEQ ID NO: 13 and / or SEQ ID NO: 14.
47. The expression construct of claim 46, wherein the sequence contains an A-to-G nucleotide mutation in SEQ ID NO: 13 at one of the following positions selected from the group consisting of: 3169 (Y1014C in protein), 4159 (K1344R in protein), 4549 (K1474R in protein), 4696 (N1523S in protein), 5514 (T1796Ain protein), 5775 (T1883Ain protein), 8967 (S2947G in protein), 10522 (N3465S in protein), and 12405 (T4093A in protein).
48. Acell comprising an oligonucleotide as defined in any one of claims 1-39, or an expression construct of claim 46 or 47.
49. A modified ApoB protein comprising one or more amino acid substitutions selected from the group consisting of Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A, optionally wherein the mutation has been introduced by A-to-l editing using one or more oligonucleotides selected from the list consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 11 .
50. A method for mutating an endogenous ApoB allele in a cell, wherein the method comprises delivering to the cell a non-naturally occurring composition that can modify the ApoB allele at one or more of the positions corresponding to 3169 (Y1014C in protein), 4159 (K1344R in protein), 4549 (K1474R in protein), 4696 (N1523S in protein), 5514 (T1796Ain protein), 5775 (T1883Ain protein), 8967 (S2947G in protein), 10522 (N3465S in protein), and 12405 (T4093A in protein) of SEQ ID NO: 13.51 . The method of claim 50, wherein the method comprises one of the following selected from:(i) CRISPR / Cas9 (clustered regularly interspaced short palindromic repeat / CRISPR-associated 9) components;(ii) adenine base editors (ABE);(iii) transcription-activator like effector nucleases (TALEN); or(iv) Zinc-finger nucleases (ZFNs); and uses(v) an ASO as defined in any one of claims 1 to 39;(vi) a composition of claim 40; and / or(vii) an expression construct of claim 46 or 47.
52. The method of claim 50 or claim 51 , wherein the ApoB allele is to be mutated such that the ApoB protein has reduced secretion.
53. The method of any one of claims 50-52, wherein the method comprises introducing into the cell(i) one or more ribonucleic acid (RNA) sequences that comprise a portion that is complementary to the ApoB protein coding sequence and comprise a binding site for a CRISPR associate (Cas) protein; and(ii) a Cas nucleic acid sequence or a variant thereof that encodes the Cas protein that targets but does not cleave the target nucleic acid sequence.
54. The method of any one of claims 50-53, wherein the method for mutating the endogenous ApoB allele comprises delivery of RNA.
55. The method of any one of claims 50-54, wherein the method for mutating the endogenous ApoB allele comprises gene therapy.
56. The method of any one of claims 50-55, wherein the mutation results a decrease in ApoB secretion.
57. The method of any one of claims 50-56, wherein the mutation results a decrease in LDL- C.
58. The method of any one of claims 50-57, wherein the A-to-G nucleotide change is at one of the following positions such that there is a conserved amino acid change in the ApoB protein at one of the positions selected from: Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A.
59. A method of treating or preventing a disease or condition associated with ApoB in a subject, comprising administering to said subject an oligonucleotide as defined in any of claims 1-39 to modify the ApoB transcript at one or more positions such that the resulting modified ApoB protein comprises one or more of the following substitutions selected from Y1014C, K1344R, K1474R, N1523S, T1796A, T1883A, S2947G, N3465S, and T4093A.
Citation Information
Patent Citations
Artificial nucleic acids for RNA editing
WO2020001793A1
Methods and compositions for the ADAR-mediated editing of serpina1
WO2021243023A1
Antisense oligonucleotides (ASO) for efficient and precise RNA editing with endogenous adenosine deaminase acting on RNA (ADAR)
WO2022253810A1
Antisense oligonucleotides for the treatment of cardiovascular disease
WO2024121373A1
Site-directed editing of RNA
WO2025231085A1