Antisense oligonucleotide targeting interleukin 4 receptor and use thereof
By designing antisense oligonucleotide molecules that target the interleukin-4 receptor, the expression of IL-4Rα is specifically inhibited, which solves the problem of poor treatment effect in severe asthma and provides an efficient and economical treatment option.
Patent Information
- Application Number
- PCT/CN2025/140152
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-25
- Filing Date
- 2025-12-04
- Publication Date
- 2026-07-02
AI Technical Summary
Existing technologies are not ideal for the treatment of severe asthma, especially for T2 asthma. Furthermore, existing targeted drugs require long-term administration and there is a lack of treatment options for small airways, resulting in high treatment costs and poor efficacy.
Design antisense oligonucleotide (ASO) molecules that target the interleukin-4 receptor (IL-4Rα) and inhibit its expression by pairing with specific regions of IL-4Rα mRNA and Pre-mRNA to develop drugs suitable for non-T2 type severe asthma.
Significantly inhibiting IL-4Rα expression provides an effective treatment for severe asthma, reducing treatment costs and improving treatment outcomes.
Smart Images

Figure PCTCN2025140152-FTAPPB-I100001 
Figure PCTCN2025140152-FTAPPB-I100002 
Figure PCTCN2025140152-FTAPPB-I100003
Abstract
Description
Antisense oligonucleotides targeting interleukin-4 receptor and their applications Technical Field
[0001] This invention relates to the field of biomedicine, specifically to antisense oligonucleotides targeting interleukin-4 receptors and their applications. Background Technology
[0002] Asthma, especially severe asthma, is extremely expensive to treat, both domestically and internationally, resulting in a significant drain on public health resources during diagnosis and treatment. While severe asthma affects approximately 3.6% of the population, representing only a small fraction of the total population, the medical costs are substantial and treatment outcomes are often unsatisfactory. Therefore, the treatment of severe asthma remains a crucial area of clinical need in asthma treatment. In recent years, the development of various biologics, particularly antibodies targeting the interleukin pathway in inflammatory responses, has provided highly effective treatments for severe asthma. However, monoclonal antibodies are not only ineffective in treating severe asthma but also require long-term and repeated administration. Furthermore, there is an urgent need to develop drugs and treatment regimens suitable for non-T2 type severe asthma, while also emphasizing the role of small airways in asthma treatment. In conclusion, the future of asthma treatment urgently requires the development of drugs and drug forms targeting novel targets to meet the vast unmet clinical and market needs.
[0003] IL-4 is a pleiotropic immune cytokine involved in the survival and development of various immune cells, regulating B cell development and maturation, and influencing the proliferation and differentiation of type II helper T cells. Inhibition of the IL-4 / IL-13 / IL-4R pathway can affect various immune cells, thereby suppressing immune responses such as allergic asthma. IL-4 and IL-13 are key cytokines in Th2 immune responses, mainly produced by activated type II helper T cells, basophils, and mast cells. The IL-4 / IL-13 / IL-4R pathway is downstream of the TSLP pathway in the Th2 asthma inflammatory response. IL-4 and IL-4Rα (interleukin 4 receptor)... The alpha chain interacts with the γ co-(γc) chain to form a type 1 receptor. IL-4Rα interacts with IL-13Rα1 to form a type 2 receptor complex. The IL-4Rα chain emits signals through the JAK1 / STAT6 pathway. JAK3 is associated with the γc chain, and IL-13Rα1 is associated with JAK2. Type 1 and type 2 receptors share a common receptor subunit, IL-4Rα. Therefore, this application selects to target the degradation of IL-4Rα, thereby inhibiting the signaling pathways initiated by the two receptors to achieve the treatment of asthma.
[0004] mRNA-based gene-targeted therapy is one of the methods of specific targeted therapy, and it is currently under intense research and development. It works by endogenously splicing and inhibiting the expression of disease-causing genes in patients, and has made good progress. Existing gene therapy products are mainly for rare disease indications, but are gradually expanding to common indications, indicating that gene therapy can be a potential treatment for cancer. Currently, antisense oligonucleotides (ASOs) that specifically degrade target mRNA and thereby reduce the expression of regulatory proteins are among the competitive technologies for targeted gene therapy, and have enormous development potential.
[0005] To date, there are in-process pipelines for targeting IL-4Rα, including inhaled formulations and transdermal delivery systems.
[0006] Based on this, the present invention is proposed. Summary of the Invention
[0007] This invention first relates to a set of antisense oligonucleotide (ASO) molecules targeting interleukin 4 receptor alpha (IL-4Rα) mRNA. The ASO molecules are 16-22 bases in length and specifically pair with a specific region of the target gene. The start site of the specific region of the target gene that specifically pairs with the ASO is located at the following position on the IL-4Rα mRNA:
[0008] (1) Bits 1 to 60 of 5UTR EXON1 / 5UTR EXON1_2;
[0009] (2) Bits 56 to 103 of 5UTR EXON2;
[0010] (3) Bits 168 to 193 of 5UTR EXON2_3;
[0011] (4) Bits 181 to 206 of EXON2_3EXON3 / EXON3;
[0012] (5) EXON3_4EXON4 / EXON4 bits 270-398;
[0013] (6) 400-538 bits of EXON4_5 / EXON5;
[0014] (7) Bits 539 to 703 of EXON5_6 / EXON6;
[0015] (8) Bits 690 to 841 of EXON6 EXON6_7 / EXON6_7 / EXON7;
[0016] (9) Bits 854 to 926 of EXON7_8 / EXON8;
[0017] (10) Bits 968 to 1030 of EXON8_9 / EXON9;
[0018] (11) EXON9_10EXON10 / EXON10 bits 1050-1084;
[0019] (12) Bits 1100 to 2681 of EXON10_11 / EXON11;
[0020] (13) Bits 2709 to 3604 of EXON113UTR;
[0021] The mRNA sequence of the IL-4Rα is shown in SEQ ID NO: 403;
[0022] Preferably, the start site of a specific region of the target gene that specifically pairs with the ASO is located at the following position on the IL-4Rα mRNA:
[0023] (1) EXON2_3 EXON3 bits 183-203
[0024] (2) Bits 563-801 of EXON6;
[0025] (3) Bits 1252 to 1280 of EXON11;
[0026] (4) Bits 2537 to 2574 of EXON11;
[0027] (5) Bits 3107 to 3169 of EXON113UTR;
[0028] Most preferably, the initiation site of a specific region of the target gene that specifically pairs with the ASO is located at the following position on the IL-4Rα mRNA:
[0029] (1) EXON5_6 EXON6 bits 561-581
[0030] Preferably, the ASO molecule is selected from at least one of the following: any nucleotide sequence shown in SEQ ID NO:1 to 402;
[0031] More preferably, the sequence of the ASO molecule is selected from: SEQ ID NO:230,240,241,242,246,249,259,260,287,288,299,301.
[0032] This invention also relates to a group of antisense oligonucleotide (ASO) molecules targeting interleukin 4 receptor alpha (IL-4Rα) pre-mRNA. The ASO molecules specifically target interleukin 4 receptor pre-mRNA. Each ASO molecule is 16-22 bases in length and specifically pairs with a specific region of the target gene. The start site of the specific region of the target gene specifically paired with the ASO is located at the following position in the IL-4Rα pre-mRNA:
[0033] (1) Bits 339 to 371 of EXON1 / INTRON 1-2;
[0034] (2) Bits 420 to 16136 of INTRON 1-2;
[0035] (3) EXON2_INTRON2-3 INTRON2-3 / bits 16532 to 26498 of INTRON2-3;
[0036] (4) Bits 26605 to 28229 of EXON3_INTRON3-4 / INTRON3-4;
[0037] (5) Bits 28581 to 30862 of EXON4_INTRON4-5 / INTRON4-5;
[0038] (6) Bits 31611 to 32720 of INTRON5-6;
[0039] (7) Bits 32939 to 38663 of EXON6_INTRON6-7 / INTRON6-7;
[0040] (8) Bits 39022 to 42049 of EXON7_INTRON7-8 / INTRON7-8;
[0041] (9) Bits 42230 to 45206 of EXON8_INTRON8-9 / INTRON8-9;
[0042] (10) Bits 45323 to 46898 of EXON9_INTRON9-10 / INTRON9-10;
[0043] (11) Bits 47134 to 48604 of EXON10_INTRON10-11 / INTRON10-11;
[0044] Preferably, the Pre-mRNA sequence of IL-4Rα is as shown in SEQ ID NO: 404;
[0045] More preferably, the start site of a specific region of the target gene that specifically pairs with the ASO is located at the following position in the pre-mRNA of IL-4Rα:
[0046] (1) Bits 834 to 10659 of INTRON1-2
[0047] (2) Bits 16909 to 22340 of INTRON2-3
[0048] (3) Bits 27743 to 28128 of INTRON3-4
[0049] (4) Bits 40677 to 40937 of INTRON 7-8
[0050] (5) Bits 42358 to 42378 of INTRON 8-9
[0051] (6) Bits 45433 to 46195 of INTRON 9-10
[0052] (7) Bits 47247 to 47267 of INTRON 10-11
[0053] Most preferably, the initiation site of a specific region of the target gene that specifically pairs with the ASO is located at the following position in the pre-mRNA of IL-4Rα:
[0054] (1) Bits 29228 to 30842 of INTRON4-5;
[0055] (2) Bits 32364 to 32384 of INTRON5-6
[0056] Preferably, the ASO molecule is selected from at least one of the following: any nucleotide sequence shown in SEQ ID NO:1 to 402;
[0057] More preferably, the sequence of the ASO molecule is selected from: SEQ ID NO:72, 83, 102, 109, 118, 132, 151, 154, 157, 159, 161, 164, 180, 336, 339, 343, 352, 357, 363, 369, 373, 387, 390, 399.
[0058] Furthermore, the ASO molecule is a chemically modified form containing chemical modifications;
[0059] The chemically modified nucleotide is selected from at least one of the following: 5'-thiophosphate nucleotide, 5-methylated cytosine nucleotide, 2'-O-methyl modified nucleotide, 2'-O-2-methoxyethyl modified nucleotide, 2'-fluoro modified nucleotide, 3'-nitrogen-substituted modified nucleotide, 2'-deoxy-2'-fluoro modified nucleotide, 2'-deoxy modified nucleotide, locked nucleotide, debase nucleotide, 2'-amino modified nucleotide, morpholino nucleotide, polypeptide nucleotide, aminophosphate, 2'-cEt modified;
[0060] Preferably, the chemical modification of the ASO molecule is: thio- or methoxyethyl modification of the phosphate ester bond (MOE modification) and 5-methyl modification of cytosine, and restriction ethyl-bridged nucleic acid (cEt modification);
[0061] More preferably, the chemical modification of the ASO molecule is as follows: the phosphate ester bonds of all nucleotides in the ASO sequence are thiolated, and the 3' and 5' ends are respectively modified with 3 to 5 bases by MOE or cEt and all cytosine by 5-methyl modification.
[0062] Furthermore, the modification of the ASO molecule refers to...
[0063] (1) All nucleotides in the 20nt ASO sequence are 5'-thiophosphate nucleotides, and the 5 nucleotides at the 5' and 3' ends are modified with methoxyethyl (MOE).
[0064] (2) All nucleotides in the 16nt ASO sequence are 5'-thiophosphate nucleotides, and the three nucleotides at the 5' and 3' ends are restricted ethyl-bridged nucleic acid modified (cEt).
[0065] Furthermore, the present invention also relates to the following uses of the ASO molecule.
[0066] (1) Prepare a formulation that inhibits the expression of IL-4Rα; or
[0067] (2) Preparing a drug or pharmaceutical composition for treating diseases associated with IL-4Rα, including but not limited to asthma (including eosinophilic type), atopic dermatitis, eosinophilic esophagitis, sinusitis, nasal polyps, nodular prurigo, urticaria, COPD, bullous pemphigoid, pruritus, and gastritis; preferably asthma (including eosinophilic type); or
[0068] (3) Treatment of diseases associated with IL-4Rα; said diseases include, but are not limited to, asthma (including eosinophilic type), atopic dermatitis, eosinophilic esophagitis, sinusitis, nasal polyps, nodular prurigo, urticaria, COPD, bullous pemphigoid, pruritus, and gastritis; preferably asthma (including eosinophilic type); or
[0069] (4) Inhibit the expression of IL-4Rα protein.
[0070] Furthermore, the present invention also relates to a medicament or pharmaceutical composition comprising the aforementioned ASO molecule, wherein the medicament or pharmaceutical composition comprises a therapeutically effective amount of the aforementioned ASO molecule, and necessary pharmaceutical excipients; the medicament is used to treat diseases related to IL-4Rα; the diseases include, but are not limited to, asthma (including eosinophilic types), atopic dermatitis, eosinophilic esophagitis, sinusitis, nasal polyps, nodular prurigo, urticaria, COPD, bullous pemphigoid, pruritus, and gastritis; preferably, the disease is asthma.
[0071] The drug or drug composition is an aqueous solvent or an injection; the drug or drug composition is administered via local, intravenous, intramuscular, subcutaneous, or intradermal routes. Detailed Implementation
[0072] Example 1: Design, synthesis and modification of ASO targeting target genes
[0073] The IL-4Rα mRNA (ENST00000395762.7) from the Ensembl database was selected as the target gene, and its sequence is shown in SEQ ID NO.403:
[0074] SEQ ID NO.403:
[0075] The IL-4RαPre-mRNA (ENSG00000077238) from the Ensembl database was selected as the target gene, and its sequence is shown in SEQ ID NO.404.
[0076] Forty-two antisense oligonucleotide sequences (ASOs) were designed targeting IL-4Rα mRNA and Pre mRNA genes. These ASO molecular sequences are shown in Table 1.
[0077] Furthermore, the 402 ASO sequences were chemically modified, specifically as follows:
[0078] (1) Monothiolation of phospholipase bonds in all nucleotides in the sequence;
[0079] (2-1) The modification method for 20nt ASO is MOE modification of 5 bases at both the 3' and 5' ends (i.e., methoxyethyl modification at the 2' position of the base, 5-10-5), or
[0080] (2-2) The modification method of 18nt ASO is MOE modification of 4 bases at both the 3' and 5' ends (i.e., methoxyethyl modification at the 2' position of the base, 4-10-4).
[0081] in,
[0082] ASO sequences numbered 20_212~20_217 targeting IL-4Rα serve as positive controls; their sequences are as follows:
[0083] TGGAAAGGCTTATAACCCTC (SEQ ID NO.406),
[0084] GAGGATTTACTCTTCCTGA (SEQ ID NO.407),
[0085] AGCCACCCCATTGGGAGATG (SEQ ID NO.408),
[0086] AGCCCTTCCACAGCAGCTGC (SEQ ID NO.409),
[0087] TACTCTTCTCTGAGATGCCC (SEQ ID NO.410),
[0088] CTCCACTCACTCCAGGTG(SEQ ID NO.411);
[0089] ASO1, which does not target IL-4Rα, served as a negative reference. [1] The sequence is CCTATAGGACTATCCAGGAA (SEQ ID NO.405);
[0090] The modification method for positive or negative references is also 5-10-5 or 4-10-4.
[0091] Table 1. Detailed information on ASO molecules (the underlined parts of the sequences in the table represent the loop regions of ASO).
[0092] Note: The information shown in Table 1 is determined based on the corresponding position of the sequence in the ensembl database.
[0093] Example 1: Testing the activity of antisense oligonucleotides (ASO) in an in vitro cell model (A549 human non-small cell lung cancer).
[0094] In this embodiment, the inhibitory effect of the ASO molecules shown in Table 1 on the expression of the A549 interleukin-4 receptor protein gene (IL-4Rα) was verified. The specific experimental procedure is as follows:
[0095] (1) Preparation of suspension transfection reagent: Dissolve ASO dry powder in sterile water to a concentration of 10 μM. Dilute 10 μM ASO stock solution to the required concentration using serum-reduced medium (basalmedia, L530KJ). Dilute Lipofectamine 2000 transfection reagent (Invitrogen, 11668-019) with serum-reduced medium. Mix the transfection reagent dilution and ASO dilution separately to prepare the preset concentrations. Prepare ASO transfection complexes with corresponding concentration gradients. Mix by pipetting and aspirating 3-5 times and let stand at room temperature for 20 min.
[0096] (2) Cell treatment: Under a microscope, the confluence rate of A549 cells was observed to be >70%. Cells were plated one day before transfection at a concentration of 5 × 10⁶ cells / year. 3 Cells were seeded into 96-well plates, and 100 μl of F12K medium containing 10% FBS was added to each well. Before transfection, the medium was replaced with 50 μl of F12K medium containing 10% FBS. The transfection complex with the set ASO concentration prepared in step (1) was added to the 96-well plates and incubated at 37°C in a 5% CO2 incubator. After 5 h, the medium was replaced with 100 μl of F12K medium containing 10% FBS.
[0097] (3) After 24 hours, total RNA was extracted from the cells, and the expression of IL-4Rα mRNA in the cells was detected by quantitative real-time PCR. The qPCR primers used to amplify the internal reference genes ACTB and IL-4Rα are shown in Table 2.
[0098] Table 2 qPCR primer and probe sequences
[0099] Relative gene expression was calculated using the 2^-ΔΔCT method (Livak method), and the inhibition rate of antisense oligonucleotide mRNA expression level was calculated according to the following equation:
[0100] Inhibition rate = (1 - 2^-ΔΔCT) × 100%.
[0101] The experimental groups are as follows:
[0102] Cells treated with modified ASO as indicated by their respective numbers;
[0103] Blank, the blank control group, consists of cells that have not undergone any ASO treatment.
[0104] The efficiency of the ASO sequences described in Table 1 in inhibiting IL-4Rα mRNA in human non-small cell lung cancer A549 cells is shown in Table 3 below. The results show that the ASO sequences shown in Table 1 have a significant inhibitory effect on IL-4Rα mRNA transcription.
[0105] Table 3-1 Antisense oligonucleotide treatment mRNA inhibition rate in A549 cells
[0106] Table 3-2 Antisense oligonucleotide treatment mRNA inhibition rate in A549 cells
[0107] Finally, it should be noted that the above embodiments are only used to help those skilled in the art understand the essence of the present invention, and are not intended to limit the scope of protection of the present invention.
[0108] References
[0109] [1]Karras JG,Gregory S,Crosby JR,et al.COMPOSITIONS AND THEIR USES DIRECTED TO IL-4R ALPHA:AU20060216514[P].AU2006216514A1[2024-07-26].DOI:US8153603 B2.
Claims
1. A set of antisense oligonucleotide (ASO) molecules targeting interleukin 4 receptor alpha (IL-4Rα) mRNA, wherein the ASO molecule is 16-22 bases in length and specifically pairs with a specific region of the target gene, and the start site of the specific region of the target gene specifically paired with the ASO is located at the following position on the IL-4Rα mRNA: (1) Bits 1 to 60 of 5UTR EXON1 / 5UTR EXON1_2; (2) Bits 56 to 103 of 5UTR EXON2; (3) Bits 168 to 193 of 5UTR EXON2_3; (4) Bits 181 to 206 of EXON2_3EXON3 / EXON3; (5) EXON3_4EXON4 / EXON4 bits 270-398; (6) 400-538 bits of EXON4_5 / EXON5; (7) Bits 539 to 703 of EXON5_6 / EXON6; (8) Bits 690 to 841 of EXON6 EXON6_7 / EXON6_7 / EXON7; (9) Bits 854 to 926 of EXON7_8 / EXON8; (10) Bits 968 to 1030 of EXON8_9 / EXON9; (11) EXON9_10EXON10 / EXON10 bits 1050-1084; (12) Bits 1100 to 2681 of EXON10_11 / EXON11; (13) Bits 2709 to 3604 of EXON113UTR; The mRNA sequence of the IL-4Rα is shown in SEQ ID NO:
403.
2. The antisense oligonucleotide (ASO) molecule according to claim 1, characterized in that, The start site of a specific region of the target gene that specifically pairs with the aforementioned ASO is located at the following position on the mRNA of IL-4Rα: (1) EXON2_3 EXON3 bits 183-203 (2) Bits 563-801 of EXON6; (3) Bits 1252 to 1280 of EXON11; (4) Bits 2537 to 2574 of EXON11; (5) Bits 3107 to 3169 of EXON113UTR; Preferably, the start site of a specific region of the target gene that specifically pairs with the ASO is located at the following position on the IL-4Rα mRNA: (1) EXON5_6 EXON6 bits 561 to 581.
3. The antisense oligonucleotide (ASO) molecule according to claim 1 or 2, characterized in that, The sequence of the ASO molecule is selected from at least one of the following: any nucleotide sequence shown in SEQ ID NO:1 to 402; Preferably, the sequence of the ASO molecule is selected from: SEQ ID NO:230,240,241,242,246,249,259,260,287,288,299,301.
4. A set of antisense oligonucleotide (ASO) molecules targeting interleukin 4 receptor alpha (IL-4Rα) pre-mRNA, wherein the ASO molecules specifically target interleukin 4 receptor pre-mRNA, the ASO molecules are 16-22 bases in length, and specifically pair with a specific region of the target gene. The start site of the specific region of the target gene that specifically pairs with the ASO is located at the following position in the IL-4Rα pre-mRNA: (1) Bits 339 to 371 of EXON1 / INTRON 1-2; (2) Bits 420 to 16136 of INTRON 1-2; (3) EXON2_INTRON2-3 INTRON2-3 / bits 16532 to 26498 of INTRON2-3; (4) Bits 26605 to 28229 of EXON3_INTRON3-4 / INTRON3-4; (5) Bits 28581 to 30862 of EXON4_INTRON4-5 / INTRON4-5; (6) Bits 31611 to 32720 of INTRON5-6; (7) Bits 32939 to 38663 of EXON6_INTRON6-7 / INTRON6-7; (8) Bits 39022 to 42049 of EXON7_INTRON7-8 / INTRON7-8; (9) Bits 42230 to 45206 of EXON8_INTRON8-9 / INTRON8-9; (10) Bits 45323 to 46898 of EXON9_INTRON9-10 / INTRON9-10; (11) Bits 47134 to 48604 of EXON10_INTRON10-11 / INTRON10-11; The Pre-mRNA sequence of IL-4Rα is shown in SEQ ID NO:
404.
5. The antisense oligonucleotide (ASO) molecule according to claim 4, characterized in that, The start site of a specific region of the target gene that specifically pairs with the aforementioned ASO is located at the following position in the pre-mRNA of IL-4Rα: (8) Bits 834 to 10659 of INTRON1-2; (9) Bits 16909 to 22340 of INTRON2-3; (10) Bits 27743 to 28128 of INTRON3-4; (11) Bits 40677 to 40937 of INTRON 7-8; (12) Bits 42358 to 42378 of INTRON8-9; (13) Bits 45433 to 46195 of INTRON9-10; (14) Bits 47247 to 47267 of INTRON10-11; Preferably, the start site of a specific region of the target gene that specifically pairs with the ASO is located at the following position in the pre-mRNA of IL-4Rα: (3) Bits 29228 to 30842 of INTRON4-5; (4) Bits 32364 to 32384 of INTRON5-6.
6. The antisense oligonucleotide (ASO) molecule according to claim 5 or 6, characterized in that, The ASO molecule is selected from at least one of the following: any nucleotide sequence shown in SEQ ID NO:1 to 402; Preferably, the sequence of the ASO molecule is selected from: SEQ ID NO:72, 83, 102, 109, 118, 132, 151, 154, 157, 159, 161, 164, 180, 336, 339, 343, 352, 357, 363, 369, 373, 387, 390, 399.
7. The antisense oligonucleotide (ASO) molecule according to any one of claims 1-6, characterized in that, The ASO molecule is a chemically modified version containing chemical modifications; The chemically modified nucleotides are selected from: 5'-thiophosphate nucleotides, 5-methylated cytosine nucleotides, 2'-O-methyl modified nucleotides, 2'-O-2-methoxyethyl modified nucleotides, 2'-fluoro modified nucleotides, 3'-nitrogen-substituted modified nucleotides, 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, debased nucleotides, 2'-amino modified nucleotides, morpholino nucleotides, polypeptide nucleotides, aminophosphates, and 2'-cEt modified nucleotides. Preferably, the chemical modification of the ASO molecule is: thio- or methoxyethyl modification of the phosphate ester bond (MOE modification) and 5-methyl modification of cytosine, and restriction ethyl-bridged nucleic acid (cEt modification); More preferably, the chemical modification of the ASO molecule is as follows: The phosphate ester bonds of all nucleotides in the ASO sequence are thiolated, and the 3' and 5' ends are respectively symmetrically modified with 3 to 5 bases for MOE or cEt modification and all cytosine for 5-methyl modification. Most preferably, the chemical modification of the ASO molecule is as follows: (1) All nucleotides in the 20nt ASO sequence are 5'-thiophosphate nucleotides, and the 5 nucleotides at the 5' and 3' ends are modified with methoxyethyl (MOE). (2) All nucleotides in the 16nt ASO sequence are 5'-thiophosphate nucleotides, and the three nucleotides at the 5' and 3' ends are restricted ethyl-bridged nucleic acid modified (cEt).
8. The following uses of the ASO molecule according to any one of claims 1-7: (1) Prepare a formulation that inhibits the expression of IL-4Rα; or (2) Preparing a drug or pharmaceutical composition for treating diseases associated with IL-4Rα, including but not limited to asthma (including eosinophilic type), atopic dermatitis, eosinophilic esophagitis, sinusitis, nasal polyps, nodular prurigo, urticaria, COPD, bullous pemphigoid, pruritus, and gastritis; preferably asthma (including eosinophilic type); or (3) Treatment of diseases associated with IL-4Rα; said diseases include, but are not limited to, asthma (including eosinophilic type), atopic dermatitis, eosinophilic esophagitis, sinusitis, nasal polyps, nodular prurigo, urticaria, COPD, bullous pemphigoid, pruritus, and gastritis; preferably asthma (including eosinophilic type); or (4) Inhibit the expression of IL-4Rα protein.
9. A pharmaceutical product or pharmaceutical composition comprising the ASO molecule according to any one of claims 1-7, characterized in that, The drug or pharmaceutical composition contains a therapeutically effective amount of the ASO molecule, as well as necessary pharmaceutical excipients; The drug is used to treat diseases associated with IL-4Rα; The diseases mentioned include, but are not limited to, asthma (including eosinophilic type), atopic dermatitis, eosinophilic esophagitis, sinusitis, nasal polyps, nodular prurigo, urticaria, COPD, bullous pemphigoid, pruritus, and gastritis; preferably, the disease mentioned is asthma.
10. The medicament or pharmaceutical composition according to claim 9, characterized in that, The drug or drug composition is an aqueous solvent or an injection; the drug or drug composition is administered via local, intravenous, intramuscular, subcutaneous, or intradermal routes.