System for editing the f508del mutation in the human CFTR gene for the cystic fibrosis treatment

A novel pegRNA system with defined structure and SpCas9 nickase mutations addresses the inefficiency of prime editing for the F508del mutation, achieving high efficiency and selectivity in editing the CFTR gene for cystic fibrosis treatment.

WO2026139885A1PCT designated stage Publication Date: 2026-07-02MEDICO DISTRIBUTION DMCC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
MEDICO DISTRIBUTION DMCC
Filing Date
2025-12-23
Publication Date
2026-07-02

Smart Images

  • Figure IB2025063381_02072026_PF_FP_ABST
    Figure IB2025063381_02072026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biotechnology, genetic engineering and medicine, in particular, to a highly efficient system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type, comprising a polynucleotide which comprises a nucleotide sequence, encoding the SpCas9 nickase recognizing PAM NGG or NG, and a prime editing guide RNA (pegRNA) comprising in its structure a sequence complementary to the target locus for editing the F508del mutation in human CFTR gene, a reverse transcription template (RTT) and a primer binding site (PBS), wherein the prime editing guide RNA (pegRNA) has sequence SEQ ID NO: 1-6 or a sequence comprising one or more replacements in the RTT compared to SEQ ID NO: 1-6, selected from SEQ ID NO: 7-168. The system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type provides more efficient editing of the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type and is a highly efficient cystic fibrosis treatment. The present invention also relates to the method of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene using the system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene according to the present invention and the use of the system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene for treating cystic fibrosis.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] SYSTEM FOR EDITING THE F508DEL MUTATION IN THE HUMAN CFTR GENE FOR THE CYSTIC FIBROSIS TREATMENT

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to the field of biotechnology, genetic engineering and medicine, in particular, to a highly efficient system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type, comprising a polynucleotide which comprises a nucleotide sequence, encoding the SpCas9 nickase recognizing PAM NGG or NG, and a prime editing guide RNA (pegRNA) comprising in its structure a sequence complementary to the target locus for editing the F508del mutation in human CFTR gene, a reverse transcription template (RTT) and a primer binding site (PBS), wherein the prime editing guide RNA (pegRNA) has sequence SEQ ID NO: 1-6 or a sequence comprising one or more replacements in the RTT compared to SEQ ID NO: 1-6, selected from SEQ ID NO: 7-168. The system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type provides more efficient editing of the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type and is a highly efficient cystic fibrosis treatment. The present invention also relates to the method of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene using the system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene according to the present invention and the use of the system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene for treating cystic fibrosis.

[0004] PRIOR ART

[0005] Cystic fibrosis (CF; mucoviscidosis) is an autosomal recessive monogenic inherited disease characterized by damage to all exocrine glands, as well as vital organs and systems. The disease is associated with dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR). CFTR is localized in the apical part of the membrane of epithelial cells lining the excretory ducts of excretory glands (sweat, salivary, bronchial, pancreatic, intestinal, and urogenital glands); it regulates the electrolyte transport (mainly chlorine) between these cells and the intercellular fluid. Recent studies have shown that CFTR is a chloride channel proper. CF gene mutations disrupt not only the transport but also the secretion of chloride ions. When their passage through the cell membrane is impeded, sodium reabsorption by glandular cells increases, the electrical potential of the lumen is disturbed, which causes changes in the electrolyte composition and dehydration of the secretion of excretory glands. As a result, excerned secretionbecomes excessively thick and viscous. The lungs, gastrointestinal tract, liver, pancreas, and genitourinary system are affected. CF incidence varies among Caucasians from 1:600 to 1:17000 newborns. In the Russian Federation, the cystic fibrosis incidence is 1 : 10000 newborns according to neonatal screening.

[0006] Various known mutations in the transmembrane conductance regulator (CFTR) CF gene cause CF. The most common CF cause is the F508del mutation (rsl 13993960), which results in phenylalanine deletion in position 508. Thus, editing the F508del mutation to the wild type is a promising method of treating cystic fibrosis.

[0007] Although technological advances have increased the life expectancy of patients with CF and pathogenetic therapy has demonstrated high efficiency, CF therapy is complex, is carried out over the patient's lifetime, and is associated with high annual financial costs and side effects. Therefore, the development of new CF treatments is of great interest.

[0008] Genome editing techniques that have emerged recently allow modifying genomes and correcting mutations that cause inherited diseases, or, conversely, introducing mutations by creating model organisms. Among these techniques, prime editing is the most promising technique to date. It is the modification of the CRISPR-Cas technique that involves the use of Cas9 nickase, reverse transcriptase (RT), and a complex RNA molecule called a single prime editing guide RNA (pegRNA). This complex provides both recognition of the target locus in the cell genome and synthesis of a donor molecule to modify the DNA fragment. Cas9 and RT combine to form a single protein molecule, and Cas9 in turn binds to pegRNA. pegRNA 5'-region comprises a fragment that has homology to the target locus and ensures that the Cas9-RT complex functions properly in the target locus. Furthermore, Cas9 has to bind to a short DNA sequence called a PAM (protospacer adjacent motif). Cas9 creates DNA single-strand break in the target locus, and RT synthesizes DNA using a fragment from the 3 '-terminus of the pegRNA, replacing the damaged DNA.

[0009] The source ANZALONE A. V. et al. Search-and-replace genome editing without doublestrand breaks or donor DNA. Nature, 2019, v.576, (7785), p.149-157. doi:10.1038 / s41586-019-1711-4 (abstract, Fig.1) describes the technique of prime editing that can correct any type of mutation, from selective replacements to insertions or deletions. Researchers have tested it on several types of human cells and claim that it works more accurately than standard CRISPR / Cas9 and base editors, does not require introduction of double-strand breaks, and, instead of the guide RNA, which uses CRISPR / Cas for targeting, it includes an extended guide RNA for prime editing (prime editing extended guide RNA, pegRNA, prgRNA). This RNA performs two functions at once: it determines the region where editing will take place and carries the information to be"written" into the gene. An important advantage of the new technique is its versatility. "Rewriting" the gene sequence, scientists have been able to eliminate any mutation, whether it is deletion, duplication or selective replacement. However, the disadvantage of this technique lies in its very versatility, as it does not allow achieving efficient editing of a specific mutation, in particular, the F508del mutation, the editing of which is necessary for efficient cystic fibrosis treatment. In the original art described by ANZALONE A. V. et al., the SpCas9 nickase was used, which required the presence of PAM NGG in the target locus. Subsequently, other editing alternatives were created using mutant SpCas9 forms that use other PAMs, for example, SpCas9-NG requires PAM NG, which expands greatly the use of prime editing.

[0010] In the source LIU P. ET AL. Improved prime editors enable pathogenic allele correction and cancer modeling in adult mice. Nat Commun. 2021 Apr 9; v.12, no.l, p.2121. doi:10.1038 / s41467-021-22295-w, the efficient use of SpCas9(H840A) optimized with NLS that improves genome editing efficiency is reported. Prime editors (PE) mediate genome modification without using DNA double-strand breaks or exogenous donor DNA as a template. Furthermore, it is described that the addition of an N-terminal c-Myc NLS and the inclusion, alternatively, of both a bipartite SV40 NLS (vBP-SV40) and an SV40 NLS at the C-terminus of the PE leads to almost complete nuclear localization of the prime editor (PE2*).

[0011] The source WO 2023015318 A2 (PRIME MEDICINE, INC.) discloses the use for prime editing of the mutation in Cas9(H840A) nickase genes comprising R221K, N394K, H840A amino acid replacements, and the M-MLV reverse transcriptase gene comprising D200N, T330P, T306K, W313F, and L603W amino acid replacements compared to wild-type M-MLV. Also, the Cas9 polypeptide is disclosed, comprising one or more mutations, for example, LI HR, DI 135V, G1218R, E1219Q, E1219V, E1219V, R1335V, T1337R. Furthermore, it is disclosed that the prime editor (PE) additionally comprises one or more nuclear localization sequences (NLS) that promote protein translocation into the cell nucleus, for example, SV40.

[0012] The source ZHIHAN ZHAO et al. Prime editing: advances and therapeutic applications. Trends in Biotechnology, March 29, 2023, D01:https: / / doi.org / 10.1016 / j.tibtech.2023.03.004, describes the problem consisting in that the main prime editing limitation is its low editing efficiency. According to ZHIHAN ZHAO et al., several strategies have been developed to improve it by using engineered prime editing protein, improving the prime editing guide RNA construct, controlling by repairing the nonconformity and optimizing the delivery strategy. Thus, the development of a universal mutation editing technique cannot lead to efficient editing of a specific mutation, in particular, the F508del mutation, which has to be edited for efficient cystic fibrosis treatment. Meanwhile, the prerequisites for the development of the very prime editingguide RNA for editing a specific mutation obviously follow from ZHIHAN ZHAO et al.

[0013] In the source SOUSA, A. A., et al. Systematic optimization of prime editing for the efficient functional correction of CFTRF508del in human airway epithelial cells. Nat. Biomed. Eng (2024), https: / / doi.org / 10.1038 / s41551-024-01233-3, spacer sequences in the guide RNA structure complementary to the target locus for editing the F508del mutation in the CFTR gene are disclosed.

[0014] The source GEURTS M. H., et al. Evaluating CRISPR-based prime editing for cancer modeling and CFTR repair in organoids. Life Science Alliance Aug 2021, 4(10) e202000940; DOI: 10.26508 / lsa.202000940, describes the use of prime editing in human organoids. GEURTS M. H., et al. repaired functionally the CFTR-F508del cystic fibrosis mutation and compared prime editing with CRISPR / Cas9-mediated homology-directed repair and adenine base editing in the CFTR-R785* mutation. Genome-wide sequencing of the organoids subjected to prime editing and repair showed no detectable side effects. Despite different editing efficiency and undesirable mutations in the target site, these results highlight the broad applicability of prime editing for modeling oncogenic mutations and demonstrate the potential clinical application of this technique pending further optimization. GEURTS M. H., et al. note the influence of RT and PBS lengths on the prime editing efficiency, in particular, the editing of the F508del mutation in the CFTR gene.

[0015] The source NELSON J.W., et al. Engineered pegRNAs improve prime editing efficiency. Nat Biotechnol. 2022 Mar;40(3):402-410. doi: 10.1038 / s41587-021-01039-7. Epub 2021 Oct 4. Erratum in: Nat Biotechnol. 2022 Mar;40(3):432. doi: 10.1038 / s41587-021-01175-0, discloses that the evopreQi motif enhances pegRNA stability and prevents 3' extension degradation, and the linker selected using the pegLIT tool enhances pegRNA performance. NELSON J.W., et al. also discloses the effect of RT and PBS lengths on gene editing efficiency. Furthermore, NELSON J.W., et al. discloses the pegRNA spacer-PBS-template-scaffold sequence. As a result of the study, NELSON J.W., et al. conclude that development and screening of many pegRNAs with different PBS and RT templates are an important first step in the successful use of prime editing. Although general rules for determining the length and composition of PBS and RT templates were described, extensive experimental screening of pegRNA constructs is often required to determine optimal pegRNAs.

[0016] Thus, extensive screening is required to develop a pegRNA that provides efficient editing of a specific F508del mutation in the CFTR gene, with both the sequence and the structure of the entire pegRNA as well as the combination of PBS and RT (RTT) lengths and sequences affecting the editing efficiency.The recently published source WO2024163680 Al (PRIME MEDICINE) discloses about 4000 pegRNA sequences for editing the F508del mutation in the CFTR gene comprising various PBS and RT (RTT) sequences and lengths, however, none of the examined sequences showed the editing efficiency of more than 50% for the F508del mutation in the CFTR gene, with most sequences showing the editing efficiency of 0.1% to 10% for the F508del mutation in the CFTR gene.

[0017] The described prior art shows that, to date, the objective of achieving high efficiency of editing the F508del mutation in the CFTR gene allowing to obtain an efficient cystic fibrosis treatment has not been accomplished. Moreover, neither the sequence and the structure of the entire pegRNA nor the combination of PBS and RT (RTT) lengths and sequences providing high efficiency of editing the F508del mutation in the CFTR gene have been developed.

[0018] Thus, the objective of the present invention consists in achieving high efficiency of editing the F508del mutation in the CFTR gene allowing to obtain an efficient cystic fibrosis treatment, namely, in providing the sequence and the structure of the entire pegRNA, and the combination of PBS and RT (RTT) lengths and sequences providing high efficiency of editing the F508del mutation in the CFTR gene.

[0019] BRIEF DISCLOSURE OF THE PRESENT INVENTION

[0020] The objective of the present invention has been accomplished by the authors of the present invention by providing a novel pegRNA sequence developed by the authors of the present invention, having a strictly defined structure, and a defined combination of PBS and RT (RTT) lengths and sequences, providing high efficiency of editing the F508del mutation in the CFTR gene.

[0021] Thus, according to the first aspect, the present invention relates to a system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type, comprising:

[0022] (a) a polynucleotide that comprises a nucleotide sequence, encoding the SpCas9 nickase recognizing PAM NGG or NG,

[0023] (b) a prime editing guide RNA (pegRNA) comprising in its structure a sequence complementary to the target locus for editing the F508del mutation in human CFTR gene, a reverse transcription template (RTT) and a primer binding site (PBS),

[0024] wherein the prime editing guide RNA (pegRNA) has sequence SEQ ID NO: 1-6 or a sequence comprising one or more replacements in the RTT compared to SEQ ID NO: 1-6,selected from SEQ ID NO: 7-168.

[0025] According to one embodiment of the first aspect, the present invention relates to a system for editing the F508del mutation according to the first aspect of the present invention, wherein a polynucleotide according to (a) comprises the first nucleotide sequence, encoding the SpCas9 nickase recognizing PAM NGG.

[0026] According to a particular embodiment of the first aspect, the present invention relates to a system for editing the F508del mutation according to the first aspect of the present invention, wherein a polynucleotide according to (a) comprises the first nucleotide sequence, encoding the SpCas9 nickase with R221K, N394K, H840A mutations, comprising an N-terminal NLS SV40 fused by a 34-amino acid linker comprising a bipartite NLS SV40 with a codon optimized human reverse transcriptase with D200N, T306K, W313F, T330P, and L603W mutations, comprising a C-terminal SV40 and a c-Myc NLS.

[0027] According to another embodiment of the first aspect, the present invention relates to a system for editing the F508del mutation according to the first aspect of the present invention, wherein a polynucleotide according to (a) comprises the first nucleotide sequence, encoding the SpCas9 nickase recognizing PAM NG.

[0028] According to a particular embodiment of the first aspect, the present invention relates to a system for editing the F508del mutation according to the first aspect of the present invention, wherein a polynucleotide according to (a) comprises the first nucleotide sequence, encoding the SpCas9 nickase with H840A, R1335V, Lil HR, DI 135V, G1218R, E1219F, A1322R, T1337R mutations, comprising an N-terminal SV40 NLS fused by a 30-amino acid linker with a human reverse transcriptase with D200N, T306K, W313F, T330P, and L603W mutations, comprising a C-terminal SV40 NLS.

[0029] According to another embodiment of the first aspect, the present invention relates to a system for editing the F508del mutation according to the first aspect of the present invention, wherein a polynucleotide according to (a) comprises the first nucleotide sequence, encoding the SpCas9 nickase, is arranged in the first vector and a prime editing guide RNA (pegRNA) according to (b) is arranged in the second vector.

[0030] According to a particular embodiment of the first aspect, the present invention relates to a system for editing the F508del mutation according to the first aspect of the present invention, wherein the first vector and the second vector are a non-viral vector system or a viral vector.

[0031] According to a particular embodiment of the first aspect, the present invention relates to a system for editing the F508del mutation according to the first aspect of the present invention,wherein the non-viral vector system comprises lipofection, electroporation, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, poly cationic or lipid-nucleic acid conjugates, nanoparticles, cell penetrating peptides and associated conjugates, naked DNA and artificial virions.

[0032] According to a particular embodiment of the first aspect, the present invention relates to a system for editing the F508del mutation according to the first aspect of the present invention, wherein the viral vector is a DNA vector or an RNA vector.

[0033] According to a particular embodiment of the first aspect, the present invention relates to a system for editing the F508del mutation according to the first aspect of the present invention, wherein the viral vector is a DNA vector or an RNA vector, based on modified recombinant retrovirus, lentivirus, adeno-associated, adenovirus, herpes virus, baculovirus systems.

[0034] According to a particular embodiment of the first aspect, the present invention relates to a system for editing the F508del mutation according to the first aspect of the present invention, wherein the viral vector is an adeno-associated viral (AAV) vector.

[0035] According to the second aspect, the present invention relates to a method of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type, providing for the contact of a cell carrying the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene with a system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene according to the first aspect of the present invention.

[0036] According to the third aspect, the present invention relates to the application of a system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene according to the first aspect of the present invention for the cystic fibrosis treatment.

[0037] The effect of the present invention is:

[0038] - providing novel prime editing guide RNAs (pegRNA) and prime editing guide RNA (pegRNA) systems for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type, providing highly efficient editing of the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type,

[0039] - achieving high efficiency of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene,

[0040] - enhancing editing of the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene,- achieving high selectivity of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene,

[0041] - achieving high complete response rate, high remission rate and low recurrence rate, - elimination of adverse effects inherent in the systems of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene of the prior art, namely, nonspecific editing (in the "wrong genomic loci"), which can lead to undesirable mutations disrupting functions of any important genes and genome stability as a whole,

[0042] - expansion of the store of the method of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type,

[0043] - high stability of the developed novel prime editing guide RNA.

[0044] BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Fig. 1A-F shows the structure of the DNA vector of the prime editing guide RNA (pegRNA) according to SEQ ID NO: 169-174.

[0046] Fig. 2A-F shows the structure of plasmids used as the second DNA vector of the editing system according to the present invention.

[0047] Fig. 3 shows electrophoresis results, in particular, the expected arrangement and number of bands in the agarose gel after electrophoresis of the pU6-pegRNA-GG-acceptor plasmid linearized with Eco3 II enzyme (Bsal).

[0048] Fig. 4A shows the results of Sanger sequencing of the pU6-pegRNA-GG-acceptor plasmid fragment with a DNA sequence, cloned therein, encoding SEQ ID NO: 173. Fig. 4B shows the results of Sanger sequencing of the pU6-pegRNA-GG-acceptor plasmid fragment with a DNA sequence, cloned therein, encoding SEQ ID NO: 174.

[0049] Fig. 5 A shows visualization of the human CFTR gene fragment with the F508del mutation and pegRNA fragments (SEQ ID NO: 173). Fig. 5B shows visualization of the human CFTR gene fragment with the F508del mutation and pegRNA fragments (SEQ ID NO: 174).

[0050] DETAILED DISCLOSURE OF THE PRESENT INVENTION

[0051] Terms and Definitions

[0052] Unless otherwise indicated, all terms, designations, and other scientific terms or terminology used herein have meanings generally understood by those skilled in the field the present invention relates to. In some instances, terms with commonly understood meanings are defined herein for clarity and / or for convenience of reference, and inclusion of such definitionsin the present description should not necessarily be construed as representing a significant difference from what is generally understood in the art.

[0053] In the context of the present invention, term "locus" represents a position on a chromosome where a gene or a marker is localized.

[0054] In the context of the present invention, term "pegRNA" represents a prime editing guide RNA. The present invention provides a genome-targeted nucleic acid, or an agent for obtaining the same (for example, a polynucleotide comprising a nucleotide sequence encoding an nRNA), which can direct the activity of a linked polypeptide (for example, an RNA-directed endonuclease) to a specific target sequence in the target nucleic acid.

[0055] As is clear to those skilled in the art, each pegRNA is designed to include a spacer sequence complementary to its target genomic sequence. See Jinek et al, Science, 337, 816-821 (2012) and Deltcheva et al, Nature, 471, 602-607 (2011). The spacer sequence is a sequence (for example, a sequence of 20 nucleotides) that is complementary to the target sequence locus. "Target sequence" is adjacent to the PAM sequence and is a sequence modified by an RNA-directed nuclease (for example, Cas9). "Target nucleic acid" is a double-strand molecule: One strand comprises the target sequence and is referred to as the "PAM strand" and the other complementary strand is referred to as the "non-PAM strand". Those skilled in the art will understand that the nRNA spacer sequence hybridizes with the reverse complement of the target sequence, which is located in the non-PAM strand of the target nucleic acid of interest. Thus, the pegRNA spacer sequence is the RNA equivalent of the target sequence.

[0056] In the context of the present invention, term "G" or "guanine" refers to a nucleotide required to initiate transcription from the U6 promoter.

[0057] In the context of the present invention, term "scaffold", or "scaffold sequence" means a sequence for binding to the Cas9 nickase, i.e., a guide RNA scaffold providing binding to Cas9, without the 20 nucleotides defining targeting.

[0058] In the context of the present invention, term "RTT" refers to "RT" reverse transcription template required to transcribe hereditary information from RNA to DNA.

[0059] In the context of the present invention, term "PBS" means a primer binding site required for the initiation of reverse transcription.

[0060] In the context of the present invention, term "linker" means a nucleotide sequence for linking elements of the guide RNA construct.

[0061] In the context of the present invention, term "evopreQl" means a sequence for protectingthe 5'-terminus of the pegRNA from degradation.

[0062] In the context of the present invention, term "CFTR" refers to the human cystic fibrosis transmembrane conductance regulator, also known as CF, MRP7, ABC35, ABCC7, CFTR / MRP, TNR-CFTR and dJ760C5.1.

[0063] The system of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type

[0064] Gene editing (including genome editing) is a genetic engineering type where nucleotide(s) / nucleic acid(s) are inserted, deleted, and / or replaced in a DNA sequence, for example, in the target cell genome. Targeted gene editing allows insertion, deletion, and / or replacement at pre-selected locations in the genome of the target cell (for example, in the target gene or target DNA sequence). When the endogenous gene sequence is edited, for example, by deletion, insertion, or replacement of nucleotide(s) / nucleic acid(s), the endogenous gene comprising the affected sequence may be knocked out or turned off due to the sequence change. Therefore, targeted editing can be used to disrupt the expression of endogenous genes. Alternatively or additionally, the desired nucleic acid may be inserted into the target site in the DNA sequence (for example, into the endogenous gene), which is known as targeted integration. "Targeted integration" refers to a process comprising insertion of one or more exogenous sequences with or without deletion of the endogenous sequence at the insertion site. Targeted integration may result from targeted gene editing in the presence of a donor template comprising the exogenous sequence.

[0065] The present invention is based, at least in part, on the development of efficient gene editing systems for correcting mutation(s) in the CF transmembrane conductance regulator (CFTR) gene.

[0066] Accordingly, this document presents gene editing systems for efficient modification of CFTR genes and their application for correcting mutations in the CFTR gene, which allows CF treatment. Components of the gene editing systems and genetically modified cells resulting from the application of the gene editing systems are also within the scope of the present invention.

[0067] Targeted gene editing can be achieved using either a nuclease-independent approach or a nuclease-dependent approach. In the nuclease-independent approach of targeted editing, homologous recombination is directed by homologous sequences flanking an exogenous polynucleotide to be introduced into the endogenous sequence by a host cell enzymatic mechanism.

[0068] RNA-directed endonucleases are enzymes that use RNA:DNA base coupling to target and cleave a polynucleotide. The RNA-directed endonuclease can cleave single-strand polynucleicacids or at least one strand of a double-strand polynucleotide. The gene editing system may comprise one RNA-directed endonuclease. Alternatively, the gene editing system may comprise at least two (for example, two, three, four, five, six, seven, eight, nine, ten or more than ten) RNA-guided endonucleases.

[0069] According to the present invention, the SpCas9 nickase is used, recognizing PAM NGG or NG, selected as the most efficient according to the prior art. According to the present invention, in particular, the SpCas9 nickase is used with R221K, N394K, H840A mutations, comprising an N-terminal NLS SV40 fused by a 34-amino acid linker comprising a bipartite NLS SV40 with a codon optimized human reverse transcriptase with D200N, T306K, W313F, T330P, and L603W mutations, comprising a C-terminal SV40 and a c-Myc NLS. Alternatively, according to the present invention, in particular, the SpCas9 nickase is used with H840A, R1335V, Lil HR, DI 135V, G1218R, E1219F, A1322R, T1337R mutations, comprising an N-terminal SV40 NLS fused by a 30-amino acid linker with human reverse transcriptase with D200N, T306K, W313F, T330P, and L603W mutations, comprising a C-terminal SV40 NLS.

[0070] As a result of prior art analysis, the authors of the present invention have hypothesized that the efficiency of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type depends on the structure and sequence of a prime editing guide RNA (pegRNA), comprising in its structure a sequence complementary to the target locus for editing the F508del mutation in human CFTR gene, a reverse transcription template (RTT) and a primer binding site (PBS), and a strictly defined combination of the lengths and sequences for the reverse transcription template (RTT) and the primer binding site (PBS).

[0071] PegRNA according to the present invention has a complex structure which consists of a spacer (a fragment complementary to the target DNA sequence), a scaffold (a sequence for binding to Cas9), a template for reverse transcription (RTT), a primer binding site (PBS), an 8-nucleotide linker for connection to the 3'-terminus of the tevopreQl sequence, which prevents RNA degradation.

[0072] As a result of extensive screening of pegRNA constructs, the authors of the present invention have selected a strictly defined pegRNA structure. PegRNA according to the present invention has a complex structure which consists of a guanine, a spacer (a fragment complementary to the target DNA sequence), a scaffold (a sequence for binding to Cas9), a template for reverse transcription (RTT), a primer binding site (PBS), an 8-nucleotide linker for connection to the 3 '-terminus of the evopreQl sequence, which prevents RNA degradation. The specified elements, only in the specified order of arrangement, ensure that highly efficient editing of the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene tothe wild type is achieved.

[0073] As a result of extensive screening of pegRNA constructs, the authors of the present invention have developed the lengths of the elements of the specified pegRNA structure, which ensure achieving highly efficient editing of the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type, which are as follows:

[0074] G (guanine) - a nucleotide required for the initiation of transcription from the U6 promoter spacer - a sequence of 20 nucleotides complementary to the target locus

[0075] scaffold - a sequence for connection with the Cas9 nickase, 76 nucleotides

[0076] RTT - a template for reverse transcription, varies from 10 to 17 nucleotides

[0077] PBS - a primer binding site, varies from 12 to 14 nucleotides

[0078] linker (pegLIT) - a sequence between PBS and evopreQl, 8 nucleotides

[0079] evopreQl - a sequence to protect the 5'-terminus of pegRNA from degradation, 37 nucleotides.

[0080] According to a particular embodiment, the RTT length is 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides, with the PBS length being 12, 13, or 14 nucleotides.

[0081] The authors of the present invention have unexpectedly found that only the specified ratio of the lengths of the RTT and PBS elements with the sequence according to the present invention, with the specified lengths and sequences of the other elements in the strictly defined pegRNA structure with the first discovered sequences of SEQ ID NO: 1 -6 according to the present invention, ensure that highly efficient editing of the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type is achieved.

[0082] As a result of extensive screening of pegRNA constructs, the authors of the present invention have developed sequences of elements of the specified pegRNA structure according to the present invention with the specified lengths of elements of the pegRNA structure according to the present invention, in particular, with the specified ratio of the lengths of the RTT and PBS elements with the sequence according to the present invention, which, in a strictly defined pegRNA structure according to the present invention, result in first discovered sequences of SEQ ID NO: 1-6 according to the present invention, ensuring that highly efficient editing of the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type is achieved. SEQ ID NO: 1-6 sequences are listed in Table 1, as well as in the XML sequence listing filed with this application.Table 1. SEQ ID NO: 1-6 sequences of a prime editing guide RNA (pegRNA) according to the present invention

[0083]

[0084]

[0085] The present invention also covers variant sequences according to the present invention. The variants are preferably at least 70% identical, more preferably at least 80% identical, even more preferably at least 90% identical, and most preferably at least 95% identical to the sequences according to the present invention. Two polynucleotide or polypeptide sequences are referred to as "identical" if the nucleotide or amino acid sequence in the two sequences is the same when aligned with the maximum number of matches as described below.

[0086] Comparison of two sequences is typically performed by comparing the sequences in a comparison window to identify and compare local regions with sequence similarity. The "comparison window" in this description means a segment having a length of at least 20 consecutive positions, typically from about 30 to about 75 or from about 40 to about 50, where a sequence can be compared to the reference sequence with the same number of consecutive positions after optimal alignment of the two sequences.

[0087] Optimal alignment of sequences for comparison can be performed using Megalign program of the Lasergene bioinformatic analysis software package (DNASTAR, Inc., Madison, WI) using default parameters. This program includes several alignment schemes described in the following references: Dayhoff, M.O., 1978, A model of evolutionary change in proteins - Matrices for detecting distant relationships. In Dayhoff, M.O. (ed.) Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington DC Vol. 5, Suppl. 3, pp. 345- 358; Hein J., 1990, Unified Approach to Alignment and Phylogenes pp. 626-645 Methods in Enzymology vol. 183, Academic Press, Inc., San Diego, CA; Higgins, D.G. and Sharp, P.M., 1989, CABIOS 5:151-153; Myers, E.W. and Muller W., 1988, CABIOS 4:11-17; Robinson, E.D., 1971, Comb. Theor. 11:105; Santou, N., and Nes, M., 1987, Mol. Biol. Evol. 4:406-425; Sneath, P.H.A. and Sokal, R.R., 1973, Numerical Taxonomy the Principles and Practice of Numerical Taxonomy, Freeman Press, San Francisco, CA; Wilbur, W.J. and Lipman, D.J., 1983, Proc. Natl. Acad. Sci. USA 80:726-730.Preferably, the "percent sequence identity" is defined by comparing two optimally aligned sequences in the comparison window, from at least 20 positions, where a portion of the polynucleotide or polypeptide sequence in the comparison window may contain additions or deletions (i.e., gaps) of 20 percent or less, typically 5 to 15 percent or 10 to 12 percent, relative to the reference sequences (which do not comprise additions or deletions) for optimal alignment of the two sequences. The percent is calculated by defining the number of the positions where the two sequences comprise identical bases or amino acid residues to obtain the number of matching positions, divide the number of matching positions by the total number of positions in the reference sequence (i.e., window size), and multiply the result by 100, obtaining the percent sequence identity.

[0088] The variants may also or alternatively be substantially homologous to the native gene or part thereof, or to the complement. Such polynucleotide variants are capable of hybridizing under moderately stringent conditions with naturally occurring DNA sequences, encoding a native antibody (or a complementary sequence).

[0089] Suitable "moderately stringent conditions" include pre-washing with a solution of 5 X SSC (sodium chloride / sodium citrate), 0.5% SDS (sodium dodecyl sulfate), 1.0 mM EDTA (ethylenediaminetetetraacetic acid) (pH 8.0); hybridization at 50-65 °C, 5 X SSC, overnight; followed by washing twice at 65 °C for 20 minutes with each of 2X, 0.5X, and 0.2X SSC comprising 0.1% SDS.

[0090] In the context of the present invention, "highly stringent conditions" or "high stringency conditions" are those in which (1) low ionic strength and high temperature are used for washing, for example, 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate at 50 °C; (2) a denaturing agent such as formamide is used during hybridization, for example, 50% (vol / vol.) formamide with 0.1% bovine serum albumin / 0.1% ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer with pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42 °C; or (3) using 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, ultrasonicated salmonid milt DNA (50 pg / mL), 0.1% SDS and 10% dextran sulfate at 42 °C, with washing at 42 °C in 0.2 x SSC (sodium chloride / sodium citrate) and 50% formamide at 55 °C, followed by washing in high stringency conditions with 0.1 x SSC comprising EDTA, at 55 °C. Those skilled in the art know how to adjust temperature, ionic strength, etc. depending on such factors as the probe length and the like.

[0091] It is understood by those skilled in the art that, due to the degeneracy of the genetic code, there are many nucleotide sequences encoding the polypeptide described herein. Some of suchpolynucleotides have minimal homology with the nucleotide sequence of some native gene. However, the present invention covers polynucleotides that vary due to differences in codon usage. Furthermore, the scope of the invention also includes alleles of the genes comprising the polynucleotide sequences described herein. Alleles represent endogenous genes that are altered by one or more mutations such as deletions, additions and / or nucleotide replacements. The resulting mRNA (template RNA) and protein may, but need not, have an altered structure or function. Alleles can be identified by standard methods (such as hybridization, amplification, and / or sequence comparison with a database).

[0092] The authors of the present invention unexpectedly found that the introduction of one or more defined nucleotide replacements in the RTT, which do not lead to changes in the amino acid sequence, leads to achievement of even greater efficiency in editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type. SEQ ID NO:7-168 sequences of a prime editing guide RNA (pegRNA) according to the present invention, having one or more defined nucleotide replacements in the RTT in SEQ ID NO: 1-6, are listed in Table 2.

[0093] Table 2. Modified prime editing guide RNA sequences (pegRNA) according to the present invention, having one or more defined nucleotide replacements in the RTT in SEQ ID NO: 1-6

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124] According to the present invention, achievement of high editing efficiency of the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene is ensured, as well as achievement of high selectivity of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene, which is directly related to improved editing efficiency.

[0125] Polynucleotides according to the present invention can be obtained using chemical synthesis methods, recombinant methods or PCR (polymerase chain reaction). Methods for the chemical synthesis of polynucleotides are well known in the art and need not be described in detail herein. Those skilled in the art can use the sequences disclosed herein and a commercial DNA synthesizer to obtain a desired DNA sequence. To obtain polynucleotides using recombinant methods, a polynucleotide comprising the desired sequence can be incorporated into a suitable vector, and the vector in turn can be introduced into a suitable host cell for replication and amplification, as described below.

[0126] Polynucleotides can be introduced into host cells by any method known in the field. Cells are transformed by introducing the exogenous polynucleotide by direct uptake, endocytosis, transfection, F-mating or electroporation. Once introduced, the exogenous polynucleotide can be maintained in the cell as a non-integrated vector (such as a plasmid) or integrated into the host cellgenome. Polynucleotides amplified in this manner can be isolated from the host cell by the methods well known in the field. See, for example, Sambrook et al, 1989. In an alternative embodiment, PCR allows for the DNA sequence reproduction. PCR technology is well known in the art and is described in U.S. Patents 4683195, 4800159, 4754065, and 4683202, as well as in the source PCR: The Polymerase Chain Reaction, Mullis et al. eds., Birkauswer Press, Boston, 1994.

[0127] RNA can be obtained by using isolated DNA and a suitable vector and incorporating it into a suitable host cell. When the cell replicates and the DNA is transcribed into the RNA, the RNA can then be isolated using methods well known to those skilled in the art, for example, as described by Sambrook et al., 1989, see above.

[0128] Suitable cloning vectors can be constructed according to standard techniques or can be selected from a large number of cloning vectors existing in the art. While the selected cloning vector may vary depending on the host cell intended to be used, useful cloning vectors will typically have the ability to self-replicate, may have a single target for a particular restriction endonuclease, and / or may carry genes for a marker that can be used in selection of the clones comprising the vector. Suitable examples include plasmids and bacteriophages, for example, pUC18, pUC 19, Bluescript (for example, pBS SK+) and derivatives thereof, mpl8, mpl9, pBR322, pMB9, ColEl, pCRl, RP4, phage DNA, and shuttle vectors such as pSA3 and pAT28. These and many other cloning vectors are available for purchase from companies, for example, BioRad, Stratagene, and Invitrogen.

[0129] Expression vectors are typically replicating polynucleotide constructs that comprise a polynucleotide according to the invention. It is assumed that the expression vector should be replicable in the host cell either as an episome or as a component of the chromosomal DNA. Suitable expression vectors include without limitation plasmids, virus-based vectors including adenoviruses, adeno-associated viruses, retroviruses, cosmids and expression vectors.

[0130] Vector components can typically include but not be limited to one or more of the following: a signal sequence, a replicator, one or more marker genes, suitable elements regulating transcription (such as promoters, enhancers, and a terminator). Expression (i.e., translation) also typically requires one or more elements that regulate translation, such as ribosome binding sites, translation initiation sites, and stop codons.

[0131] Vectors comprising the polynucleotide of interest can be introduced into a host cell by any of a variety of suitable methods, including electroporation, transfection using calcium chloride, rubidium chloride, calcium phosphate, DEAE(diethylaminoethyl)-dextran, or other substances;microparticle bombardment, lipofection, and infection (for example, when the vector is an infectious agent such as a cowpox virus). The choice of vectors or polynucleotides to be introduced often depends on the characteristics of the host cell.

[0132] According to the present invention, high and stable expression of the developed novel prime editing guide RNA (pegRNA) is achieved.

[0133] According to the present invention, the DNA vector of the prime editing guide RNA (pegRNA) has SEQ ID NO: 169-174 sequences listed in Table 3 and their modified SEQ ID NO: 175-336 sequences listed in Table 4.

[0134] Table3. SEQ ID NO: 169-174 sequences of a DNA vector of the editing system according to the present invention, encoding a prime editing guide RNA (pegRNA)

[0135]

[0136]

[0137] Table 4. DNA vector sequences of a guide RNA according to the present invention, having one or more defined nucleotide replacements in the RTT in SEQ ID NO: 169-174

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180] For cloning into a DNA vector, the sequences according to the present invention compriseadditional nucleotides at the 5'-terminus (CACC) and the 3'-terminus (TTTT), which are products of DNA hydrolysis by the restriction endonuclease Bsal.

[0181] The second DNA vector, encoding a prime editing guide RNA (pegRNA), comprising in its structure a sequence complementary to the target locus for editing the F508del mutation in human CFTR gene, a reverse transcription template (RTT) and a primer binding site (PBS), with a transcription terminator for stopping transcription, have the sequences listed in Table 5.

[0182] Table 5. DNA vector of a guide RNA according to the present invention with a transcription terminator for stopping transcription

[0183]

[0184]

[0185] Methods of introducing a polynucleotide construct into cells are well known in the art. According to some embodiments, stable transformation methods may be used to integrate the polynucleotide construct into the cell genome. According to other embodiments, transient transformation methods can be used to transiently express the polynucleotide construct, and the polynucleotide construct is not integrated into the cell genome.

[0186] According to other embodiments, virus-mediated techniques can be used.

[0187] The polynucleotides can be introduced into the cell by any suitable method, for example such as recombinant viral vectors (for example, retroviruses, adenoviruses), liposomes, and the like. Transient transformation methods include, for example, but are not limited to, microinjection, electroporation, or microparticle bombardment. Polynucleotides can be incorporated into vectors, for example, such as plasmid vectors or viral vectors.

[0188] The present invention also relates to a method of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type, providing for the contact of a cell carrying the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene with a system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene according to the present invention.

[0189] A method of editing the CFTR gene can include bringing a cell into contact with: a gene editing system described herein; a viral particle or set of viral particles comprising a gene editingsystem described herein; and / or a nucleic acid or set of nucleic acids comprising a gene editing system described herein. These methods may be performed, for example, on one or more cells, in a living subject (for example, in vivo). Alternatively or additionally, these methods may be performed on one or more cells existing in culture (for example, in vitro). In some instances, the cell edited in culture is then administered to the subject (referred to herein as a "cell-based therapy").

[0190] The present invention also relates to the use of a system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene according to the present invention for the cystic fibrosis treatment. Application according to the present invention results in the elimination of adverse effects inherent in the systems of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene of the prior art, namely, nonspecific editing (in the "wrong genomic loci"), which can lead to undesirable mutations disrupting functions of any important genes and genome stability as a whole. In a mouse model study, achievement of high complete response rate, high remission rate, and low recurrence rate have been shown in a mouse model.

[0191] Guide RNAs (pegRNAs) according to the present invention with SEQ ID NO: 1-168 were synthesized by a standard amidophosphite oligonucleotide synthesis technique. The synthesized sequences were cloned into the linearized pU6-pegRNA-GG-acceptor plasmid (Addgene #132777) using a standard restriction-ligation technique, E. coli bacteria were transformed with a ligase mixture, the grown colonies were grown in liquid nutrient medium, and the plasmids were isolated from the bacteria using a plasmid DNA isolation kit or by phenol-chloroform extraction. Confirmation of the correct DNA vector sequence was performed by Sanger sequencing.

[0192] The present invention also relates to an E. coli strain transfected in a system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene.

[0193] The present invention also relates to a human cell, such as, for example, fibroblasts, basal cells, secretory cells, epithelial cells, ionocytes, organoids, carrying the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene, after contacting a system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene according to the present invention.

[0194] Embodiments of the present invention and the effect to be achieved are illustrated and confirmed in the following examples.EXAMPLES

[0195] Example 1. Growing and isolation of a pU6-pegRNA-GG-acceptor plasmid into which DNA sequences encoding pegRNAs are cloned

[0196] Guide RNAs (pegRNAs) according to the present invention with SEQ ID NO: 169-336 were synthesized by a standard amidophosphite oligonucleotide synthesis technique.

[0197] For cloning into a DNA vector, the sequences comprise additional nucleotides at the 5'-terminus (CACC) and the 3'-terminus (TTTT), which are products of DNA hydrolysis by the restriction endonuclease Bsal. As complementary sequences are required to clone DNA fragments into a double-strand plasmid, for example, SEQ ID NO: 173 sequence is encoded in SEQ ID NO: 343, 344, 346, 347 sequences, and, for example, SEQ ID NO: 174 sequence is encoded in SEQ ID NO: 343, 345, 346, 348 sequences.

[0198] Thus, the DNA molecule sequences in the form of overlapping oligonucleotides for cloning to the expression vector are as follows:

[0199] 5’- CACCGTTCATCATAGGAAACACCAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATA AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCAC-3’ (SEQ ID NO: 343)

[0200] 5’- CGAGTCGGTGCATCATCTTTGGTGTTTCCTATGATCGTAATCGCGGTTCTATCTAGTT ACGCGTTAAACCAACTAGAA-3’ (SEQ ID NO: 344)

[0201] 5’- CGAGTCGGTGCTATCATCTTTGGTGTTTCCTATGTATAATTACGCGGTTCTATCTAGT T ACGCGTTAAACCAACTAGAA-3’ (SEQ ID NO: 345)

[0202] 5’- CTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCT AGCTCTAAAACTTGGTGTTTCCTATGATGAAC-3’ (SEQ ID NO: 346)

[0203] 5’- AAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGATTACGATCATAGGA AACACCAAAGATGATGCACCGA-3’ (SEQ ID NO: 347)

[0204] 5’- AAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTAATTATACATAGGAA ACACCAAAGATGATAGCACCGA-3’ (SEQ ID NO: 348)Example 2. Growing and isolation of a pU6-pegRNA-GG-acceptor plasmid into which DNA sequences encoding pegRNAs are cloned

[0205] The pU6-pegRNA-GG-acceptor plasmid (Addgene #132777) is used to assemble plasmids comprising pegRNA. It comprises the red fluorescent protein mRFPl gene at the insertion site of the pegRNA sequence, which allows picking selectively clones with successful insertion.

[0206] The plasmid can be ordered from the Addgene repository (https: / / www.addgene.org / 132777 / ). The plasmid is delivered in the form of a lyophilized spot on filter paper (usually in amounts of 10-50 ng of plasmid per sheet of paper in the form of two spots (circles)), which should be stored at +4 °C. To isolate the plasmid, one of the paper circles is cut with a clean razor blade, immersed in 30 pl TE (10 mM Tris-HCl c 1 mM EDTA-Na2) and stirred with a pipette. After waiting for at least 10 minutes, 2 pl are used to transform competent bacteria.

[0207] For transformation of competent bacteria, it is necessary to prepare Petri dishes with solid nutrient medium. To do this, the required mass of solid nutrient medium - LB agar - is weighed using a laboratory scale on the basis of 4 g per 100 ml of medium. The weighed quantity is transferred to a conical flask. Using a measuring cylinder, the required volume of distilled water is measured and poured into the same flask in portions, with vigorous stirring. The resulting mixture in a conical flask, closed with a lid, is heated in a microwave oven to boiling, visually prepared medium looks homogeneous, transparent. The medium is cooled to 50 °C in air, after which a solution of sodium salt of ampicillin is added thereto at the rate of 1 pl of antibiotic solution per 1 ml of medium, then the cooled medium is poured into an empty Petri dish. The cup is left ajar for 1-2 h for complete solidification of the medium - agar. The dish can be kept at 4 °C and covered with Parafilm to avoid contamination by other microorganisms from the air.

[0208] Transformation of competent cells (Escherichia coli strain XLl-Gold (chemically competent cells resistant to the tetracycline antibiotic)) is carried out according to the following technique:

[0209] 1) A suspension of chemically competent E. coli cells is thawed from -80 °C to a temperature close to 1 °C for 20-30 min on ice, where the plasmid solution is brought to a temperature close to 1 °C.

[0210] 2) A 2 pl solution of plasmid DNA is added to the E. coli cell suspension. For convenience, the competent cell suspensions are divided into 100 pl aliquots; half an aliquot, 50 pl, may be sufficient for efficient transformation. Stirring is accomplished by rotating the tube or gently vortexing at slow speed.

[0211] 3) The resulting mixture is incubated on an ice bath for 20-30 min.4) The cooled mixture of bacterial suspension and plasmid DNA is heat shocked (placed in a water bath, exposed for 45-60 s at 42 °C).

[0212] 5) The mixture of bacterial suspension and plasmid DNA is incubated on an ice bath for other 2-3 min.

[0213] 6) 800-1000 pl of previously prepared LB liquid nutrient medium (LB broth, Miller: tryptone, 10.0 g / 1; yeast extract, 5.0 g / 1; sodium chloride, 10 g / 1; pH is adjusted to 7.0±0.2) without an antibiotic is added to the suspension of bacteria and plasmid DNA.

[0214] 7) The resulting mixture is incubated for 40-60 min at 37 °C with vigorous stirring on a thermoshaker.

[0215] 8) After incubation, the mixture can be concentrated to a volume of 50-100 pl: the bacteria are precipitated from the suspension by centrifugation for 5 min at 2000-3000 rpm.

[0216] Example 3. Obtaining a transfected E. coli strain

[0217] 1) E. coli is inoculated into a prepared Petri dish with a solid nutrient medium and antibiotic. The volume of liquid suspension should not exceed 100 pl, the suspension is rubbed into the agar with a glass spatula.

[0218] 2) The inoculated Petri dishes are transferred to a thermostat where they are incubated at 37 °C for 16-18 h, after which colonies resistant to the antibiotic are formed therein due to the plasmid acquired during transformation.

[0219] 3) To preserve the Petri dish with colonies, it should be cooled to +4 °C and air access to the medium should be closed with Parafilm to avoid contamination of the medium in the dish with other microorganisms from the air.

[0220] After colonies appear in the dish (usually after 24-48 hours), it is necessary to grow the bacteria comprising the pU6-pegRNA-GG-acceptor plasmid. For this purpose, liquid nutrient medium should be prepared as described above.

[0221] Protocol for growing bacteria in liquid medium:

[0222] 1) To obtain the pU6-pegRNA-GG-acceptor plasmid in preparative amounts, a colony is transferred with a micropipette tip into 10 pl of mQ and then introduced into a conical flask containing 100 ml of LB liquid medium with ampicillin.

[0223] 2) In the flask incubated for 16 h in a thermoshaker, active bacterial growth occurs, causing the optical density of the medium to increase.

[0224] 3) To preserve a sample of liquid culture after the end of cultivation - up to 0.8 ml ofturbid medium is taken from the flask and mixed in a 1.5 ml tube with an equal volume of filtered sterile 50% glycerol solution. After stirring by vortexing, the resulting suspension is stored at -80 °C in a low-temperature freezer.

[0225] 4) The remaining medium in the flask is transferred to a 50 ml tube; the cells are settled by centrifugation at 4 °C in a high-speed centrifuge for 5 min at 7000 rpm, and the clarified medium is removed. Next, the plasmid DNA is isolated using solutions from the Zymopure MaxiPrep kit and ethanol DNA precipitation reagents (or any similar plasmid DNA isolation kit).

[0226] 5) The cell sediment in the tube is resuspended in 2-5 ml of resuspending buffer, then the same volume of lysing buffer is added to the suspension; stirring is performed by turning the tube. Thereat, the color of the solution changes from red to violet. The obtained suspension is incubated at room temperature for no longer than 2-3 minutes, after which the same volume of the neutralizing buffer is added, the mixture is stirred by turning. The color of the solution changes from violet to yellow with complete lysing buffer neutralization.

[0227] 6) The suspension is clarified by centrifugation in a high-speed centrifuge at 7000 rpm for 7 min at 4 °C. The clarified supernatant comprising the plasmid DNA is withdrawn into a clean f5 mL tube. The following purification steps are performed for additional plasmid DNA purification from impurities such as RNA.

[0228] 7) An equal volume of isopropanol is added to the tube with the clarified supernatant; the mixture is gently mixed by slow vortexing, then incubated for 30 min at room temperature, followed by centrifugation of the resulting mixture in a high-speed centrifuge for f0 min at 7000 rpm at 4 °C. The supernatant is removed and the precipitate is dried at room temperature for 5 min.

[0229] 8) The precipitate comprising plasmid DNA is washed off the walls by adding 2 ml mQ to the tube and thoroughly resuspended. 2 ml of 5M LiCl solution is added to the obtained suspension; the suspension is stirred by vortexing and then centrifuged at 8000 rpm for 5 min at 4 °C in a high-speed centrifuge. The supernatant is withdrawn into a clean 15 mL falcon tube.

[0230] 9) An equal volume of isopropanol is added to the supernatant comprising plasmid DNA; the mixture is gently vortexed, incubated for 20 min at room temperature, then centrifuged at 8000 rpm for 5 min at 4 °C in a high-speed centrifuge, and the supernatant is removed.

[0231] 10) 750 pl of 70% ethanol, cooled to +4 °C in advance, is added to the precipitate and the tube walls are slightly washed with it so that the entire precipitate is in contact with the ethanol. The mixture is centrifuged at 11000 rpm for 20 min at 4 °C in a high-speed centrifuge, then the supernatant is removed and the precipitate comprising the plasmid DNA is dried at roomtemperature until the precipitate is discolored, but not more than 5 min.

[0232] 11) 400 pl mQ is added to the precipitate, the plasmid DNA is thoroughly resuspended, the resulting solution is transferred to an endotoxin removal column from the ZymoPure MaxiPrep kit, and the column is placed in a collection tube. The column is centrifuged at 10000 rpm for 1 min in a benchtop centrifuge at room temperature.

[0233] 12) The analysis of the quantity and quality of the isolated plasmid DNA is carried out by the spectrophotometric technique using Nanodrop based on the compliance of the A260 / A230 and A260 / A280 ratios with the optimal values: from 2 to 2.2 and from 1.6 to 1.8, respectively.

[0234] Thus, at this stage, we have synthesized oligonucleotides encoding pegRNAs and the purified pU6-pegRNA-GG-acceptor plasmid to clone these fragments into it.

[0235] Example 4. Cloning of the DNA fragments encoding pegRNA into the pU6-pegRNA-GG-acceptor plasmid

[0236] For cloning, the pU6-pegRNA-GG-acceptor plasmid is linearized using the restriction endonuclease Bsal, which has two recognition sites in the plasmid: right after the U6 promoter and after the encoding sequence of the fluorescent reporter gene mRFPl.

[0237] Protocol for linearization of the pU6-pegRNA-GG-acceptor plasmid:

[0238] 1) The required components of the reaction mixture are thawed or cooled on an ice bath to less than 1 °C. The reaction mixture is also prepared thereon.

[0239] 2) The restriction mixture is prepared in a 0.6 mL tube according to Table 6.

[0240] Table 6. Restriction mixture composition

[0241]

[0242] 3) The reaction mixture is incubated in a solid-state thermostat for 1 hour, to stop the reaction, the reaction mixture is then inactivated by heating at 65 °C in a solid-state thermostat, after which it is stored frozen at -20 °C.Then preparative electrophoresis of the obtained restriction mixture is performed, followed by purification of the heavier fragment, the plasmid backbone, from the gel.

[0243] Preparation of the buffer concentrate for electrophoresis (TBE lOx). Using laboratory scales, the following weighed quantities are prepared: 86.4 g of Tris-OH and 44 g of H3BO3; the powders are mixed in a 1 L conical flask. EDTA solution (32 mL; 0.5 mol / L) is added thereto; then distilled water (768 mL) is added. The volume of the solutions is measured using measuring cylinders. While adding new portions of water, the solution is stirred vigorously until the precipitate is completely dissolved.

[0244] Preparation of the buffer solution for electrophoresis (TBE lx). Using measuring cylinders, 0.41 of TBE lOx and 3.61 of distillate solutions are mixed in a 41 volumetric flask. After dilution, the buffer is stirred vigorously.

[0245] Preparation of agarose gels for electrophoresis:

[0246] 1) 50 ml of agarose solution is sufficient to prepare a gel for analytical electrophoresis and 75-100 ml - for preparative electrophoresis.

[0247] 2) Using laboratory scales, the required mass of agarose is weighed, transferred it to a conical flask, and then buffer TBE lx is added to it in a volume measured using a measuring cylinder, the resulting suspension is stirred. Detailed information is given in Table 7.

[0248] Table 7. Preparation of agarose gels

[0249]

[0250] 3) The resulting suspension is heated in a microwave oven until visible agarose flakes disappear (about 20-30 s from the moment of boiling).

[0251] 4) The mixture is cooled to about 50 °C, after which a solution of ethidium bromide, an intercalating dye, is added at a ratio of 5 pl per 100 ml of the future gel, and the mixture is stirred vigorously.

[0252] 5) The mixture is poured into a pre-assembled gel preparation mold with the combs in place and incubated at room temperature until the gel solidifies (about 30-40 minutes).6) After gel solidification the combs are removed from the gel, the gel itself is transferred to the buffer solution of the chamber.

[0253] Electrophoresis is carried out according to the following protocol:

[0254] 1) Mixtures of sample solutions and 4x application buffer (1:3 ratio) are applied to the agarose gel wells in the chamber under TBE lx buffer. Commercial molecular mass markers are used as positive control for electrophoresis: DNA MW ladder M50bp (comprises DNA fragments of 50 to 500 bps in length), Sky-High S-8000 (comprises DNA fragments of 250 to 10000 bps in length).

[0255] 2) After the samples are applied, electrophoresis is performed using Elf-4 power source until the target DNA fragments are completely separated in the gel.

[0256] 3) The gel is visualized using a transilluminator and / or gel documentation system. After the gel image is saved, the target fragment is cut out of the gel with a blade and cleaned.

[0257] 4) The target fragment is about 2.2 Kb in size, whereas the non-target fragment is 825 bp in size (Fig. 3)

[0258] To purify nucleic acid fragments from a loose agarose gel, reagents and chromatography columns from the commercially available Evrogen Clean-Up Mini kit are used. The following purification protocol is followed:

[0259] 1) After completion of electrophoresis, a stained band corresponding to the target fragment (approximately 2.2 Kb) is visually identified using a transilluminator, then the gel fragment comprising it is cut out with a blade in such a way as to minimize the mass of this fragment, after which it is transferred to a pre-weighed Eppendorf tube (1.7 ml) on an analytical scale, its mass is recorded to the nearest 0.1 pg.

[0260] 2) The mass of the cut-out gel is calculated by weighing the tube with gel on an analytical scale and subtracting the smaller mass from the larger one.

[0261] 3) The gel volume is equated to the measured mass, a threefold volume of binding solution is added, and incubation at 55 °C in a solid-state thermostat is performed until the gel is completely dissolved. To accelerate its dissolution, shaking and vortexing are performed periodically.

[0262] 4) After complete dissolution of the gel, the solution is transferred to the column inside the collection tube and centrifuged at a speed of 8000-10000 rpm using an Eppendorf Mini Spin centrifuge for 30-45 seconds. The part of the solution that has passed through the column is poured out of the collection tube and the target DNA fragment is sorbed on the column.5) 700 pl of washing solution is added to the column, it is centrifuged at 10,000 rpm using an Eppendorf Mini Spin for 30 s. The part of the solution that has passed through the column is poured out of the collection tube, and the empty column is centrifuged (10,000 rpm) using an Eppendorf Mini Spin for 60 s to remove residual washing solution.

[0263] 6) The empty column is transferred to a clean 1.7 mL Eppendorf tube and incubated for about 3 min at 37 °C in a solid-state thermostat for complete ethanol evaporation (a component of the washing solution).

[0264] 7) 15-30 pl of mQ is added to the column, and 1 min after application, the column is centrifuged at 10000 rpm using an Eppendorf Mini Spin for 30s. The part of the solution that has passed through the column is transferred to the column for another 1 min, after which another centrifugation of the empty column (14000 rpm) is carried out using an Eppendorf Mini Spin for 60-120 s to maximize the eluate yield from the column.

[0265] 8) The analysis of the quantity and quality of the isolated DNA fragment is carried out by the spectrophotometric technique using Nanodrop according to the compliance of the ratios A260 / A230 and A260 / A280 with the optimal values: from 2 to 2.2 and from 1.6 to 1.8, respectively.

[0266] Two pairs of oligonucleotides, SEQ ID NO: 343 and 346, SEQ ID NO: 344 and 347, SEQ ID NO: 345 and 348, are annealed in parallel in separate tubes.

[0267] 1) The oligonucleotides are mixed in equimolar ratios, twice the total amount of the insert, in a 0.6 mL tube.

[0268] 2) The reaction mixture is transferred to the Eppendorf MasterCycle amplifier (or any similar one with a heated lid), program parameters are given in Table 8.

[0269] Table 8. Program parameters for annealing of complementary oligonucleotide pairs

[0270]

[0271] 3) After the end of the program, the reaction mixture is stored cooled to +4 °C or frozen at -20 °C for long-term storage.

[0272] Then, phosphorylation the 5 '-terminus by T4 polynucleotide kinase of the obtained oligonucleotide dimers is carried out.1) The required components of the reaction mixture are thawed or cooled on an ice bath to less than 1 °C. The reaction mixture is also prepared thereon.

[0273] 2) In a 0.6 mL test tube, the reaction mixture is prepared according to Table 9.

[0274] Table 9. Preparation of the reaction mixture for 5'-kinylation of the template.

[0275]

[0276] 3) The prepared mixture is incubated for 30 min in a solid-state thermostat at 37 °C. 4) After completion of incubation, T4 polynucleotidine kinase is inactivated for 20 min at 65 °C in a solid-state thermostat.

[0277] 5) The reaction mixture is stored frozen at -20 °C.

[0278] Next, the pU6-pegRNA-GG-acceptor backbone is ligated with two pegRNA fragments: SEQ ID NO: 343, 344, 346, 347 and SEQ ID NO: 343, 345, 346, 348

[0279] 1) The required components of the reaction mixture are thawed or cooled on an ice bath to less than 1 °C.

[0280] 2) The mixture for ligation of two pegRNA fragments and a plasmid vector is prepared according to Table 10.

[0281] Table 10. Reaction mixture composition in the ligation reaction

[0282]

[0283] 3) Ligation takes place in an Eppendorf amplifier at 16 °C for 12 hr.

[0284] 4) The ligase mixture is stored frozen at -20 °C or used immediately for transformation of competent E. coli, temperature inactivation of this enzyme is not necessary.

[0285] Next, chemical transformation of Escherichia coli (XL 1 -Gold strain) with the obtained ligase mixture and inoculation on Petri dishes (LB agar + ampicillin) are performed. The protocol is specified above.

[0286] The next day, PCR screening of the grown white colonies is performed for insertion of the sequence encoding pegRNA.

[0287] 1) The colonies formed as a result of transformation of competent E. coli are tested for the target plasmid content using the PCR technique: each colony is transferred with a micropipette tip into 10 pl of mQ.

[0288] 2) The required components of the reaction mixture are thawed or cooled on an ice bath to a temperature close to 1 °C.

[0289] 3) The PCR mixture is prepared according to Table 11. Negative control (a sample to which no DNA template is added) must be used in each reaction.

[0290] Table 11. Preparation of the PCR mixture (calculations for 1 sample are specified)

[0291]

[0292] Table 12. Primers for the plasmid fragment amplification to confirm DNA fragment insertion

[0293]

[0294] 4) The reaction mixtures are transferred to the amplifier with the set amplification parameters of the target site of 273 bps in length, according to Table 13.

[0295] Table 13. PCR parameters for the plasmid fragment amplification to confirm DNA fragment insertion

[0296]

[0297] 5) After completion of PCR, the presence of amplicons and compliance of their lengths with the expected ones were checked qualitatively by analytical electrophoresis using 5 pl of the reaction mixture.

[0298] 6) The remaining part of the reaction mixture together with primers diluted with mQ to a concentration of 3.33 pmol / L is used for Sanger sequencing.

[0299] 7) The chromatograms obtained after sequencing are analyzed using any program that allows opening files with the .abl extension, for example, Chromas (https: / / technelysium.com.au / wp / chromas / ).

[0300] 8) Alignment of the insert of the DNA fragment encoding pegRNA to the expected sequence is performed using Benchling (https: / / www.benchling.com) or SnapGene (https: / / www.snapgene.com) software.

[0301] Fig. 4 A and B show chromatograms aligned to the expected sequence (SEQ ID NO: 173) and (SEQ ID NO: 174), respectively.In case of a positive result (the sequence after sequencing matches the expected sequence), colonies are grown in liquid medium (LB + ampicillin medium) and plasmids are isolated using the phenol-chloroform method as described previously for the growth and isolation of the original pU6-pegRNA-GG-acceptor plasmid. This is followed by additional verification of the insertion of the sequence encoding the pegRNA by Sanger sequencing of the plasmid amplicon from saCas9-sgRNA-seq-F (5'-TGGACTATCATATGCTTACCG-3') and mRFP.R (51-GTACCTCGAGCGGCCCA-3') primers, as described above, pegl (encoding SEQ ID NO: 169 sequence) and peg2 (encoding SEQ ID NO: 170 sequence) plasmids are obtained in this manner.

[0302] pegl 71-336 (encoding SEQ ID NO: 171-336 sequence) plasmids are obtained in a similar manner.

[0303] Example 5. Achieving high efficiency and selectivity of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type

[0304] Briefly, one day before transfection, HEK293T mutant cells carrying the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene were inoculated in a 96-well plate at a density of approximately 7213 cells per well. Cells were approximately 60-70% confluent prior to transfection. Cells were transfected using Lipofectamine 2000 with a transfection cocktail comprising a pegRNA test plasmid with SEQ ID NO 1-168 and a plasmid, encoding the Cas9 nickase, compatible with PAM of the pegRNA spacer. Three days after transfection, the genomic DNA was collected by removing the medium from the cells and treating each well with 50 pL of QuickExtract solution (Lucigen). Cells were resuspended in this solution and transferred to a new 96-well plate for PCR. PCR reactions were performed. DNA samples were then subjected to sequencing using MiSeq application. NGS results were analyzed using CRISPResso2 to measure correction percent and indel percent for each mutation in the CFTR gene. The correction percent values were defined based on the sequencing read percent. A total of 168 pegRNAs were tested, each designed to repair the wild-type CFTR amino acid sequence. The results are shown in Table 14.

[0305] Table 14. Efficiency of editing the NM_000492.3(CFTR):c.l521_1523del (F508del) mutation in endogenous CFTR genes of HEK293T cells using PEgRNA with SEQ ID NO: 1-168

[0306]

[0307]

[0308] Thus, the results obtained show that only the ratio of the lengths of the RTT and PBS elements according to the present invention with the sequences according to the present invention, with the specified lengths and sequences of the other elements in the strictly defined pegRNA structure with the first discovered SEQ ID NO: 1-168 sequences according to the present invention, ensure that highly efficient editing of the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type up to and over 70% is achieved.

Claims

CLAIMS1. The system of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type, comprising:(a) a polynucleotide that comprises a nucleotide sequence, encoding the SpCas9 nickase recognizing PAM NGG or NG,(b) a prime editing guide RNA (pegRNA) comprising in its structure a sequence complementary to the target locus for editing the F508del mutation in human CFTR gene, a reverse transcription template (RTT) and a primer binding site (PBS),wherein the prime editing guide RNA (pegRNA) has sequence SEQ ID NO: 1-6 or a sequence comprising one or more replacements in the RTT compared to SEQ ID NO: 1-6, selected from SEQ ID NO: 7-168.

2. The system for editing the F508del mutation according to cl. 1, wherein the polynucleotide according to (a) comprises the first nucleotide sequence encoding the SpCas9 nickase recognizing PAM NGG.

3. The system for editing the F508del mutation according to cl. 2, wherein the polynucleotide according to (a) comprises the first nucleotide sequence, encoding the SpCas9 nickase with R221K, N394K, H840A mutations, comprising an N-terminal NLS SV40 fused by a 34-amino acid linker comprising a bipartite NLS SV40 with a codon optimized human reverse transcriptase with D200N, T306K, W313F, T330P, and L603W mutations, comprising a C-terminal SV40 and a c-Myc NLS.

4. The system for editing the F508del mutation according to cl. 1, wherein the polynucleotide according to (a) comprises the first nucleotide sequence encoding the SpCas9 nickase recognizing PAM NG.

5. The system for editing the F508del mutation according to cl. 4, wherein the polynucleotide according to (a) comprises the first nucleotide sequence, encoding the SpCas9 nickase with H840A, R1335V, LI 1 HR, DI 135V, G1218R, E1219F, A1322R, T1337R mutations, comprising an N-terminal SV40 NLS fused by a 30-amino acid linker with a human reverse transcriptase with D200N, T306K, W313F, T330P, and L603W mutations, comprising a C-terminal SV40 NLS.

6. The system according to any of cl. 1 to 5, wherein the polynucleotide according to (a) comprising the first nucleotide sequence encoding the SpCas9 nickase is arranged in the firstvector, and the prime editing guide RNA (pegRNA) according to (b) is arranged in the second vector.

7. The system according to cl. 6, wherein the first vector and the second vector are a non-viral vector system or a viral vector.

8. The system according to cl. 7, wherein the non-viral vector system comprises lipofection, electroporation, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycationic or lipid-nucleic acid conjugates, nanoparticles, cell penetrating peptides and associated conjugates, naked DNA and artificial virions.

9. The system according to cl. 7, wherein the viral vector is a DNA vector or an RNA vector.

10. The system of according to cl. 9, wherein the viral vector is a DNA vector or RNA vector based on modified recombinant retrovirus, lentivirus, adeno-associated, adenovirus, herpes virus, baculovirus systems.

11. The system according to cl. 7, wherein the viral vector is an adeno-associated viral (AAV) vector.

12. The method of editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene to the wild type, providing for the contact of a cell carrying the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene with a system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene according to any of cl. 1 to 11.

13. Application of the system for editing the F508del mutation in the cystic fibrosis transmembrane regulator (CFTR) gene according to any of cl. 1 to 11 for the cystic fibrosis treatment.