Genetic sequence identification by restriction-ligation coupled amplification

The restriction-ligation coupled amplification method addresses the limitations of existing diagnostics by enabling sensitive and specific detection of SNPs and antibiotic resistance in pathogens, enhancing diagnostic accuracy and treatment efficacy.

WO2026150400A1PCT designated stage Publication Date: 2026-07-16KANSO DIAGNOSTICS LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
KANSO DIAGNOSTICS LTD
Filing Date
2026-01-08
Publication Date
2026-07-16

AI Technical Summary

Technical Problem

Existing diagnostic methods, such as PCR, lack sensitivity and specificity to detect small genetic changes like single-nucleotide polymorphisms (SNPs) and antibiotic resistance mutations in pathogens, particularly in Neisseria gonorrhoeae, necessitating the development of novel diagnostic tools for accurate and rapid detection.

Method used

A method involving restriction-ligation coupled amplification, where a target DNA molecule is amplified with primers, cleaved by a restriction enzyme, ligated with an adapter, and detected using tags and capturing moieties, enabling the detection of SNPs and antibiotic resistance.

Benefits of technology

This method provides accurate and rapid detection of SNPs and antibiotic resistance with single-nucleotide resolution, facilitating effective treatment decisions and epidemiological surveillance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IL2026050017_16072026_PF_FP_ABST
    Figure IL2026050017_16072026_PF_FP_ABST
Patent Text Reader

Abstract

Methods of detecting a target sequence of a nucleic acids molecule in a sample comprising amplifying an amplicon, contacting the amplicon with a restriction enzyme, incubating with a nucleic acid molecule adapter and a ligase, applying to a capturing moiety and detecting a tag in complex with the capturing moiety are provided. Methods of detecting single nucleotide polymorphisms (SNPs) by generating a de novo restriction enzyme cite or a non-canonical PAM are also provided, as are methods of designing a primer pair.
Need to check novelty before this filing date? Find Prior Art

Description

GENETIC SEQUENCE IDENTIFICATION BY RESTRICTION-LIGATION COUPLED AMPLIFICATION CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 743,246 filed January 9, 2025, and Israeli Patent Application No. 318281 filed January 9, 2025, the contents of which are all incorporated herein by reference in their entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (KDX-P-003-PCT.xml; Size: 32,849 bytes; and Date of Creation: December 4, 2025) is herein incorporated by reference in its entirety.FIELD OF INVENTION

[0003] The present invention is in the field of nucleic acid diagnostics.BACKGROUND OF THE INVENTION

[0004] Neisseria gonorrhoeae (N. gonorrheae), the causative agent of gonorrhea, is a significant public health concern due to its high prevalence and the severe complications it can cause if left untreated, including pelvic inflammatory disease, infertility, and an increased risk of HIV transmission. The treatment of gonorrhea has become increasingly challenging due to the emergence of antibiotic-resistant strains of N. gonorrhoeae.

[0005] Ciprofloxacin, a fluoroquinolone antibiotic, was once a first-line treatment for gonorrhea due to its high efficacy and oral administration route. However, over the past few decades, the widespread use and misuse of ciprofloxacin have led to the rapid emergence of ciprofloxacin-resistant N. gonorrhoeae strains. Resistance to ciprofloxacin in N. gonorrhoeae is primarily mediated by mutations in the genes encoding DNA gyrase (gyrA) and topoisomerase IV (parC), which are the target enzymes of fluoroquinolones. These mutations reduce the binding affinity of ciprofloxacin to its target, thereby diminishing itsbactericidal activity. About 35% of gonorrhea infections in the US are resistant to ciprofloxacin.

[0006] The global spread of ciprofloxacin-resistant N. gonorrhoeae has necessitated changes in treatment guidelines, with many health authorities now recommending the use of cephalosporins, such as ceftriaxone, often in combination with azithromycin, as the preferred treatment regimen. Despite these changes, the continued evolution of antibiotic resistance in N. gonorrhoeae poses a significant threat to public health, underscoring the urgent need for new diagnostic methods, treatment options, and strategies to monitor and control the spread of resistant strains.

[0007] Rapid diagnostics have a great potential in many fields, including detection of pathogens (infectious diseases), agricultural pests, genetic variants and more. Enabling rapid molecular testing technologies allow improved accuracy and response-time of treatment decisions. Lab-on-a-chip (LOC) designs implement biological workflows within a compact device, which does not require laboratory equipment and facilities. Existing technologies incorporate processes such as PCR amplification on a LOC. However, PCR may have insufficient specificity to detect small changes such as point mutations (genetic variants and antibiotic resistance mutations). Though amplification with primers to a predefined region increases assay specificity, it alone cannot provide sensitivity at single-nucleotide resolution.

[0008] In light of the growing challenge of ciprofloxacin-resistant N. gonorrhoeae, and other resistant pathogens emerging all the time, there is a critical need for innovative approaches to detect and manage antibiotic resistance. Further, mutational detection has uses in disease diagnostics and treatment selection. Accurate and rapid detection methods are essential for guiding appropriate treatment decisions and for epidemiological surveillance to track the spread of resistant pathogens. The development of novel diagnostic tools is crucial in addressing ongoing threats, making accurate diagnoses and in ensuring effective treatment in the future. Methods of in vitro testing nucleic acid molecules with single-nucleotide resolution are greatly needed.SUMMARY OF THE INVENTION

[0009] The present invention provides methods of detecting a target double stranded DNA (dsDNA) molecule in a sample comprising amplifying an amplicon, contacting the amplicon with a restriction enzyme, incubating with a nucleic acid molecule adapter, applying to acapturing moiety and detecting a tag in complex with the capturing moiety. The present invention further provides methods of detecting single nucleotide polymorphisms (SNPs) by generating a de novo restriction enzyme site or a non-canonical PAM are provided. Methods of designing a primer pair are also provided.

[0010] According to a first aspect, there is provided a method of detecting a target DNA molecule in a sample, the method comprising:a) receiving a sample comprising nucleic acid molecules;b) amplifying an amplicon from the target dsDNA molecule with a pair of primers, wherein the amplicon comprises a restriction enzyme recognition sequence and a primer of the pair of primers comprises a first tag;c) contacting the amplicon with the restriction enzyme to produce a cleavage product comprising the first tag and a single stranded DNA (ssDNA) overhang;d) providing a DNA adapter comprising, a second tag and a ssDNA region, wherein the overhang of the cleavage product and the ssDNA region of the adapter are complementary;e) incubating the cleavage product, the DNA adapter and a ligase for a time sufficient to ligate the DNA adapter to the cleavage product thereby producing a ligation product; andf) detecting the first tag and the second tag in the ligation product;thereby detecting a target DNA molecule in a sample.[Oil] According to some embodiments, the target DNA molecule is a target double stranded DNA (dsDNA) molecule.

[0012] According to some embodiments, the target DNA molecule comprises only 1 occurrence of the restriction enzyme recognition sequence.

[0013] According to some embodiments, the ssDNA overhang of the cleavage product and the ssDNA region of the adapter are equal in length and perfectly reverse complementary.

[0014] According to some embodiments, the DNA adapter further comprises a double stranded region, optionally wherein the second tag is attached to the double stranded region.

[0015] According to some embodiments, the double stranded region of the DNA adapter is between 4 and 50 bases long.

[0016] According to some embodiments, the first tag or the second tag is a capture moiety, and wherein the detecting comprising applying the ligation product to a capturing moiety, wherein the capturing moiety specifically binds to the capture moiety to produce a capturing moiety -ligation product complex and detecting the other tag in the capturing moiety-ligation product.

[0017] According to some embodiments, the capturing moiety is immobilized on a solid support and the ligation product becomes immobilized to the solid support upon binding the capturing moiety.

[0018] According to some embodiments, the detecting comprises contacting the ligation product with a labeled antibody specific to the first tag, a labeled antibody specific to the second tag or both, wherein the labeled antibody comprises or is conjugated to a fluorescent or visible label.

[0019] According to some embodiments, the detecting comprises contacting the capturing moiety-ligation product complex with a labeled antibody specific to the other tag, wherein the labeled antibody comprises or is conjugated to a fluorescent or visible label.

[0020] According to some embodiments, the labeled antibody is conjugated to a gold nanoparticle.

[0021] According to some embodiments, the double stranded region of the DNA adapter comprises a sequence adjacent to the single stranded overhang that when ligated to the cleavage product does not recreate the restriction enzyme recognition sequence.

[0022] According to some embodiments, step (f) comprises applying the ligation product to a lateral flow device, wherein the lateral flow device comprises a test line comprising an immobilized agent that binds either the first or second tag and the detecting comprises applying a labeled antibody specific to the other tag to the lateral flow device, wherein the antibody comprises or is conjugated to a fluorescent or visible label.

[0023] According to some embodiments, steps (c) to (f) comprise applying the amplicon to a lateral flow device, wherein the lateral flow device comprises: a loading area comprising the restriction enzyme, the adapter and the ligase, and a test line comprising an immobilized agent that binds either the first or second tag and the detecting comprises applying a labeledantibody specific to the other tag to the lateral flow device, wherein the antibody comprises or is conjugated to a fluorescent or visible label.

[0024] According to some embodiments, the immobilized agent is immobilized capturing moieties, the first tag or the second tag is a capture moiety, and wherein the capturing moiety specifically binds to the capture moiety.

[0025] According to some embodiments, the lateral flow device further comprises a control line comprising immobilized antibody that binds to the labeled antibody or to a control DNA molecule.

[0026] According to some embodiments, the capture moiety is biotin and the capturing moiety is streptavidin.

[0027] According to some embodiments:i) a first primer of the pair of primers is reverse complementary to a first sequence 3’ to the target base and wherein the first sequence is not more than 7 bases 3’ to a target base;ii) a second primer of the pair of primers is at least 85% identical to a second sequence 5’ to the target base; andiii) the first primer is less than 100% reverse complementary to the first sequence and produces an artificial restriction enzyme recognition sequence in the amplicon, wherein at least one base reverse complementary to a base in the first primer mismatched with the first sequence.

[0028] According to some embodiments, the second primer is less than 100% identical to the second sequence and wherein the artificial restriction enzyme recognition sequence comprises at least one base reverse complementary to a base in the first primer mismatched with the first sequence and at least one base in the second primer mismatched with the second sequence.

[0029] According to some embodiments, the amplification is isothermal amplification.

[0030] According to some embodiments, the method is a method of detecting a SNP of a target base in a sample.

[0031] According to some embodiments, the first primer produces the artificial restriction enzyme recognition site in the amplicon when the SNP is present, the artificial restriction enzyme recognition site comprises the SNP, and a restriction enzyme recognition sequence is not present in the amplicon when the target base is present.

[0032] According to some embodiments, the amplification, the contacting and the incubating are all done in a single solution and / or in a single container and wherein the restriction enzyme produces a single stranded 3’ overhang.

[0033] According to some embodiments, the method does not comprise denaturing enzymes within the single solution and / or single container.

[0034] According to some embodiments, the SNP is indicative of the presence of a pathology, the sample is from a subject and the method is a method of diagnosing the pathology in the subject.

[0035] According to some embodiments, the SNP is in nucleic acid molecule of a pathogen, the sample is from a subject, the SNP is indicative of the pathogen being resistant to a treatment and the method is a method of diagnosing a subject suffering from the pathogen as being resistant to treatment.

[0036] According to some embodiments, the sample comprises a target RNA molecule, the method further comprising before the amplifying, reverse transcribing the target RNA molecule into the target dsDNA molecule and wherein detecting the target dsDNA molecule is indicative or detection of the target RNA molecule.

[0037] According to some embodiments, the method is a method of simultaneously detecting a plurality of target nucleic acid molecules in a sample, whereina) an amplicon is amplified from each target nucleic acid molecule of the plurality with a pair of primers specific to the each target nucleic acid molecule to produce a plurality of amplicons;b) each amplicon of the plurality of amplicons comprises a restriction enzyme recognition sequence of a unique restriction enzyme such that each amplicon of the plurality of amplicons comprises a target sequence of a different enzyme;c) the contacting comprises contacting the plurality of amplicons with a plurality of restriction enzymes that cleave the unique restriction enzymerecognition sequences to produce a plurality of cleavage products wherein the cleavage product of the plurality comprises a unique single stranded overhang;d) the providing comprises providing a plurality of adapters, wherein each adapter of the plurality comprises a unique single stranded overhang complementary to the unique ssDNA overhangs and a unique second tag of a plurality of second tags such that each adapter comprises a different second tag of the plurality;e) the contacting produces a plurality of ligation products; andf) the detecting is simultaneously detecting the first tag and each of the plurality of second tags.

[0038] According to another aspect, there is provided a method of detecting a single nucleotide polymorphism (SNP) of a target base in a sample comprising nucleic acid molecules, the method comprising:a) amplifying from the sample with a pair of primers an amplicon comprising the target base or a SNP of the target base, wherein:i) a first primer of the pair of primers is reverse complementary to a first sequence 3’ to the target base and wherein the first sequence is not more than 7 bases 3’ to the target base;ii) a second primer of the pair of primers is at least 85% identical to a second sequence 5’ to the target base; andiii) the first primer is less than 100% reverse complementary to the first sequence and produces an artificial restriction enzyme recognition site in the amplicon when the SNP is present, wherein the artificial restriction enzyme recognition site comprises the SNP and at least one base reverse complementary to a base in the first primer mismatched with the first sequence and wherein a restriction enzyme recognition site of the restriction enzyme is not present in the amplicon when the target base is present;b) contacting the amplicon with the restriction enzyme under conditions sufficient to produce cleavage by the restriction enzyme at restriction enzyme recognition sites; andc) detecting cleavage of the amplicon, wherein cleavage of the amplicon indicates the presence of the SNP and lack of cleavage of the amplicon indicates absence of the SNP;thereby detecting a SNP in a sample.

[0039] According to some embodiments, the second primer is less than 100% identical to the second sequence and wherein the artificial restriction enzyme recognition site comprises the SNP, at least one base reverse complementary to a base in the first primer mismatched with the first sequence and at least one base in the second primer mismatched with the second sequence.

[0040] According to some embodiments, the first primer comprises a first portion of the restriction enzyme recognition site; a second sequence directly 5’ to the first sequence comprises the SNP and consists of a second portion of the restriction enzyme recognition site; and wherein the first portion and the second portion together produce the restriction enzyme recognition site.

[0041] According to some embodiments, steps (a) and (b) are performed simultaneously in a single container and wherein the amplifying is additionally with a third primer, wherein the third primer is an intermediate first primer comprising at least one fewer mismatch with the first sequence than the first primer, and wherein amplification with the intermediate first primer and the second primer does not produce the restriction enzyme recognition site.

[0042] According to some embodiments, a ratio of the first primer to the first intermediate primer is at least 10:1, optionally wherein the ratio is between 100: 1 and 5000: 1.

[0043] According to another aspect, there is provided a method of detecting a single nucleotide polymorphism (SNP) of a target base in a sample comprising nucleic acid molecules, the method comprising:a) amplifying from the sample with a pair of primers an amplicon comprising the target base or a SNP of the target base, wherein:i) a first primer of the primer pair is reverse complementary to a first sequence 3’ to the target base and wherein the first sequence is not more than 25 bases 3 ’ to the target base; andii) the first primer is less than 100% reverse complementary to the first sequence and produces an artificial non-canonical TRTV PAM sequence in the amplicon not more than 25 bases 5’ to the complementary base to the target base or SNP of the target base;b) contacting the amplicon with a CAS 12 enzyme and a guide RNA (gRNA) under conditions sufficient to produce cleavage by the CAS 12 enzyme, wherein the gRNA is 100% identical to a second sequence directly 3’ to the TRTV sequence and comprising the complementary base to the target base or the SNP; andc) detecting cleavage of the amplicon;thereby detecting a SNP in a sample.

[0044] According to some embodiments, the TRTV is TGTV.

[0045] According to some embodiments, the second sequence comprises the complementary base to the SNP and cleavage of the amplicon indicates presence of the SNP and absence of cleavage of the amplicon indicates absence of the SNP or the second sequence comprises the complementary base to the target base and cleavage of the amplicon indicates absence of the SNP and lack of cleavage of the amplicon indicates presence of the SNP.

[0046] According to some embodiments, a 3’ end of the first sequence is not more than 20 bases 3’ to the target base.

[0047] According to some embodiments, the artificial TRTV sequence is not more than 8 bases 5’ to the complementary base.

[0048] According to some embodiments, the artificial TRTV sequence is adjacent to the complementary base.

[0049] According to some embodiments, the first primer comprises the TRTV sequence and the TRTV sequence comprises one or two mismatches with the first sequence.

[0050] According to some embodiments, the first primer comprises 16-45 bases.

[0051] According to some embodiments, the CAS 12 is CAS 12a.

[0052] According to some embodiments, the gRNA comprises at least a mismatch at the target base.

[0053] According to some embodiments, the first sequence is adjacent to the target base.

[0054] According to some embodiments, the sample is a biological sample obtained from a subject and the method is a method of detecting the SNP in the subject.

[0055] According to some embodiments, the amplicon consists of not more than 3000 bases.

[0056] According to some embodiments, the detecting cleavage comprises determining the length of nucleic acid molecules produced after the contacting.

[0057] According to some embodiments, the first primer comprises a detectable moiety and the second primer comprises a capture moiety or the second primer comprises the detectable moiety and the first primer comprises the capture moiety and wherein the detecting comprises:a) contacting a solution comprising the amplicon with a capturing moiety configured to bind the capture moiety;b) isolating from the solution the capturing moiety and amplicon or fragments thereof bound to the capturing moiety to produce a depleted solution; andc) detecting the detectable moiety is the depleted solution, wherein the presence of the detectable moiety in the depleted solution is indicative of cleavage of the amplicon.

[0058] According to some embodiments, the capturing moiety is conjugated to a surface of a lateral flow device, the contacting comprises loading the solution to the lateral flow device and wherein the detecting occurs at a test region downstream of the capturing moiety in the lateral flow device.

[0059] According to some embodiments, the capturing moiety is conjugated to a support, wherein the support comprises a diameter larger than a pore of a membrane and the detectable moiety comprises a diameter smaller than the pore, wherein the isolating comprises passing the solution through the membrane such that the capturing moiety stays on a first side of the membrane and the detectable moiety after cleavage passes to a second side of the membrane and wherein the detecting the detectable moiety occurs on the second side of the membrane.

[0060] According to some embodiments, the support is a bead.

[0061] According to some embodiments, the detectable moiety is a fluorescent molecule.

[0062] According to some embodiments, the detecting the detectable moiety comprises binding the detectable moiety with a labeled antibody specific to the detectable moiety and detecting the label.

[0063] According to some embodiments, the amplifying is isothermal amplification, optionally wherein the amplification is recombinase polymerase amplification (RPA).

[0064] According to some embodiments, the SNP is indicative of the presence of a pathology, the sample is from a subject and the method is a method of diagnosing the pathology in the subject.

[0065] According to some embodiments, the SNP is in nucleic acid molecule of a pathogen, the sample is a from a subject, the SNP is indicative of the pathogen being resistant to a treatment and the method is a method of diagnosing a subject suffering from the pathogen as being resistant to treatment.

[0066] According to another aspect, there is provided a method of designing a primer pair, the method comprising:a) identifying a target base in a region of a target nucleic acid molecule, wherein a single nucleotide polymorphism (SNP) of the target base is known;b) selecting a first sequence 3’ to the target base in the target nucleic acid molecule, wherein the first sequence is not more than 25 bases 3’ to the target base;c) producing a sequence of a first primer that hybridizes to the first sequence and is less than 100% reverse complementary to the first sequence, comprises a TRTV sequence that comprises one or two mismatches with the first sequence or a first portion of a TRTV sequence comprising one or two mismatches with the first sequence wherein a second portion of the TRTV is a reverse complement of a sequence directly 5’ to the first sequence and a full TRTV sequence is produced by the first portion and the second portion when the primer hybridizes and amplifies, and whereinthe TRTV sequence is not more than 25 bases 5’ to the complementary base to the target base when hybridized to the first sequence; andd) producing a sequence of a second primer capable of amplifying with the first primer the region of the target nucleic acid molecule, wherein the first primer and the second primer are the primer pair;thereby producing a primer pair.

[0067] According to another aspect, there is provided a method of designing a primer pair, the method comprising:a) identifying a target base in a region of a target nucleic acid molecule, wherein a single nucleotide polymorphism (SNP) of the target base is known;b) determining a restriction enzyme recognition site that is not present in the region and wherein the restriction enzyme recognition site comprises a first portion that includes the SNP and a second portion that includes at least 1 mismatch to the region;c) selecting a first sequence 3’ to the target base in the target nucleic acid molecule, wherein the first sequence is not more than 7 bases 3’ to the target base;d) producing a sequence of a first primer that hybridizes to the first sequence and is less than 100% reverse complementary to the first sequence, comprises the second portion of the restriction enzyme recognition site that comprises at least one mismatch with the first sequence, and wherein when the first primer is hybridized to the first sequence, the first portion is adjacent to the second portion to produce the restriction enzyme recognition site; ande) producing a sequence of a second primer capable of amplifying with the first primer the region of the target nucleic acid molecule, wherein the first primer and the second primer are the primer pair;thereby producing a primer pair.

[0068] According to some embodiments, the method further comprises producing an intermediate first primer, wherein the intermediate first primer hybridizes to the firstsequence and is identical to the first primer except that is comprises at least 1 few mismatch to the first sequence, and wherein when the intermediate first primer is hybridized to the first sequence the restriction enzyme recognition site is not produced.

[0069] According to some embodiments, the restriction enzyme recognition site comprises 1 or 2 mismatches with the region comprising the SNP and comprises 2 or 3 mismatches with the region comprising the target base.

[0070] According to some embodiments, step (b) comprises determining a restriction enzyme recognition site that can be produced by mutating bases 5’, 3’ or both to the SNP, but which will not be produced when the target base is present and the mutating is performed.

[0071] According to some embodiments, step (d) comprises producing a sequence of the first primer that when used to amplify an amplicon of the region comprising the SNP mutates the bases 5’ or 3’ to the SNP to produce the restriction enzyme recognition site in the amplicon.

[0072] According to some embodiments, the primer pair is for use in a performing a method of the invention.

[0073] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figures 1A-1B: Diagrams showing embodiments of the amplification part of the method of the invention resulting in (1A) generation of a restriction enzyme recognition site when the SNP is present and (IB) no recognition site being generated when the SNP is absent. The restriction enzyme EcoRI and its recognition site are depicted purely as an example. For the detection of a SNP, any restriction enzyme can be used given its recognition site sequence does not already exist in the amplicon.

[0075] Figures 2A-2E: Diagram showing embodiments of the amplification -restriction-ligation-detection method of the invention. (2A) Primers and template for amplification and generation of a de novo EcoRI recognition stie. (2B) Post amplification amplicon containingthe EcoRI site at one end and a tag (FITC) at the other. (2C) Cleaved fragment of the amplicon containing the tag and a dsDNA adapter comprising a capture moiety (biotin) and an overhang complementary to the cleaved fragment’s overhang. The adapter comprises protection “T” base so that an EcoRI site is not remade. (2D) The ligation product produced with the capture moiety at one end and the tag at the other. (2E) The capture moiety is captured on the test line by a capturing molecule (streptavidin) and detected by a detectable moiety (gold nanoparticle) that recognizes the tag (sheep-anti-FITC antibody). The control line contains a molecule that binds the detectable moiety molecule (anti-sheep antibody).

[0076] Figures 3A-3F: Photos of lateral flow strips detecting the mutation in the gyrA-S91F template, but not in the WT template after a protocol with (3A) RPA amplification or (3B) PCR amplification. (3C-E) Photos of lateral flow strips with results from (3C) samples containing cDNA, (3D) urine samples and (3E) vaginal swab samples. (3F) Bar graph of fluorescence from amplification product produced in a SNP positive and SNP negative sample immobilized on magnetic beads.

[0077] Figures 4A-4E: (4A) Photos of lateral flow strips after performance of an all-in-one procedure with (right) and without (left) a 95 -degree denaturation step following RPA reaction. (4B) Photos of lateral flow strips after a procedure run with restriction enzyme and ligase added to amplicon in the individual presence of various enzymes from the RPA reaction. (4C) Photo of lateral flow strip after performance of an all-in-one procedure with a generated de novo restriction site of a 3’ overhang producing restriction enzyme and without a denaturation step. (4D) Photo of lateral flow strip after performance of an all-in-one procedure with an endogenous restriction site of a 3’ overhang producing restriction enzyme and without a denaturation step. (4E) Photos of lateral flow strips after performance of an all-in-one procedure comparing the generation of a de novo restriction stie of a 5’ overhang producing restriction enzyme and an endogenous restriction site of a 3’ overhang producing restriction enzyme.

[0078] Figures 5A-B: (5A) Photos of lateral flow readouts for the detection of the chlamydia genome in clinical matrix (SVF) in different concentrations. (5B) Dot plot of a quantification of the test bands at the various concentrations (converted to copies / ml). Band intensities were calculated, averaged and plotted (+SEM). The dashed gray line represents the target sensitivity of 5000 copies / ml. The shaded area represents the target area of sensitivity, where data points within this area demonstrate the feasibility to detect target sequences in the required sensitivity.

[0079] Figure 6: Photos of lateral flow strips from a multiplex assay with two unique restriction enzymes and two matching adapters, but with different inputs.

[0080] Figure 7: A bar graph showing cutting of target DNA (WT, or comprising S91F mutation, S91F and D95A mutation or S91F and D95G mutation) by various gRNAs. Cutting is not specific as it occurs even when there are two mismatches in the gRNA. A scrambled gRNA is used as a negative control.

[0081] Figure 8: Schematic of the target gyrA sequence and the primers used for amplification and creation of the non-canonical PAM (above). The post amplification sequence is shown below.

[0082] Figures 9A-9B: Plots showing fluorescent signal after cutting of target DNA with the PAMin method (integration of a non-canonical PAM via site-directed mutagenesis) using the non-canonical PAM (9A) TGTG or (9B) TATC. Collateral Casl2 activity (cleavage of ssDNA fluorescent probes) occurs only when a perfect match between the gRNA and the target exists in the presence of the non-canonical PAM.

[0083] Figure 10: Schematic of the target gyrA sequence and the primers used for amplification and creation of a de novo restriction enzyme site (Nrul).

[0084] Figure 11: Bar graph showing cutting by Nrul only of the S91F mutant DNA after amplification with the primers shown in Figure 10.

[0085] Figures 12A-12B: (12A) Schematic of the target gyrA sequence and the primers used for amplification and creation of a de novo restriction enzyme site (SacI). (12B) Image of a lateral flow strip after amplification of the S91F mutant template followed by cleavage with SacI.

[0086] Figure 13: Schematic of the target gyrA sequence and the primers used for amplification and creation of a de novo restriction enzyme site (PstI).

[0087] Figures 14A-14E: (14A-D) Images of lateral flow strips from all-in-one amplification and cleavage (14A) without an intermediate forward primer, (14B) with an intermediate forward primer present at a ratio of 1:40 as compared to the final forward primer, (14C) with an intermediate forward primer present at a ratio of 1:160 as compared to the final forward primer, (14D) with an intermediate forward primer present at a ratio of 1 :640 as compared to the final forward primer. (14E) Schematic of the target gyrA sequence and the primers used for amplification with an intermediate forward primer and creation of a de novo restriction enzyme site (SacI).

[0088] Figures 15A-15B: Diagrams showing embodiments of the CRISPR based method of the invention resulting in (15A) cleavage when the SNP is present and (15B) no cleavage when the SNP is absent.

[0089] Figures 16A-16B: Diagrams showing embodiments of the restriction enzyme-based method of the invention resulting in (16A) generation of a restriction enzyme recognition site when the SNP is present and (16B) no recognition site being generated when the SNP is absent. The restriction enzyme Nrul and its recognition site are depicted purely as an example. Any restriction enzyme can be used given its recognition site sequence does not already exist in the amplicon.

[0090] Figures 17A-17B: Diagrams showing embodiments of the 2-sided restriction enzyme-based method of the invention resulting in (17A) generation of a restriction enzyme recognition site when the SNP is present and (17B) no recognition site being generated when the SNP is absent. The restriction enzyme PstI and its recognition site are depicted purely as an example. Any restriction enzyme can be used given its recognition site sequence does not already exist in the amplicon and a mutation is needed on each side of the SNP base.DETAILED DESCRIPTION OF THE INVENTION

[0091] The present invention, in some embodiments, provides methods of detecting a target sequence of a nucleic acids molecule in a sample comprising amplifying an amplicon, contacting the amplicon with a restriction enzyme, incubating with a nucleic acid molecule adapter and a ligase, applying to a capturing moiety and detecting a tag in complex with the capturing moiety are provided. Methods of detecting single nucleotide polymorphisms (SNPs) by generating a de novo restriction enzyme cite or a non-canonical PAM are also provided, as are methods of designing a primer pair.

[0092] By a first aspect, there is provided a method of detecting a target nucleic acid molecule, the method comprising:a) receiving a sample comprising nucleic acid molecules;b) contacting the nucleic acid molecules with a restriction enzyme to produce a cleavage product comprising a first tag and a single stranded overhang;c) providing a nucleic acid adapter comprising a second tag and a single stranded region, wherein the overhang of the cleavage product and the single stranded region of the adapter are complementary;d) ligating the adapter to the cleavage product thereby producing a ligation product; ande) detecting the first tag and the second tag in the ligation product; thereby detecting a target nucleic acid molecule.

[0093] By another aspect, there is provided a method of detecting a single nucleotide polymorphism (SNP) of a target base in a sample, the method comprising:a) amplifying from the sample with a pair of primers an amplicon comprising the target base or a SNP of the target base, wherein:i) a first primer of the pair of primers is reverse complementary to a first sequence that is not more than 7 bases 3’ to the target base; andii) the first primer produces an artificial restriction enzyme recognition site in the amplicon when the SNP is present; b) contacting the amplicon with the restriction enzyme to produce cleavage at recognition sites of the restriction enzyme; andc) detecting cleavage of the amplicon;thereby, detecting a SNP in a sample.

[0094] By another aspect, there is provided a method of detecting a single nucleotide polymorphism (SNP) of a target base in a sample, the method comprising:a) amplifying from the sample with a pair of primers an amplicon comprising the target base or a SNP of the target base, wherein:i) a first primer of the pair of primers is at least 85% identical to a first sequence that is not more than 7 bases 5’ to the target base; andii) the first primer produces an artificial restriction enzyme recognition site in the amplicon when the SNP is present;b) contacting the amplicon with the restriction enzyme to produce cleavage at recognition sites of the restriction enzyme; andc) detecting cleavage of the amplicon;thereby, detecting a SNP in a sample.

[0095] By another aspect, there is provided a method of detecting a single nucleotide polymorphism (SNP) of a target base in a sample, the method comprising:a) amplifying from the sample with a pair of primers an amplicon comprising the target base or a SNP of the target base, wherein:i) a first primer of the pair of primers is reverse complementary to a first sequence that is not more than 25 bases 3’ to the target base; andii) the first primer produces a TRTV sequence in the amplicon not more than 25 bases 5’ to the complementary base to the target base or SNP of the target base;b) contacting the amplicon with a CAS 12 enzyme and a guide RNA (gRNA), wherein the gRNA is 100% reverse complementary to a second sequence 3’ to the TRTV sequence and comprising the SNP; and c) detecting cleavage of the amplicon;thereby, detecting a SNP in a sample.

[0096] In some embodiments, the method is an in vitro method. In some embodiments, the method is an ex vivo method. In some embodiments, the method is a diagnostic method. In some embodiments, the method is a prognostic method. In some embodiments, the sample is a from a subject. In some embodiments, the sample is from the subject and the method is a method of diagnosing the subject. In some embodiments, the method is a method of detecting a single nucleotide polymorphism (SNP). In some embodiments, the method is a method of detecting the SNP in the subject. In some embodiments, the diagnosing is in the subject.

[0097] As used herein, the term “single nucleotide polymorphism” or “SNP” refers to a single base change from a canonical sequence. Generally speaking, the canonical sequence is the WT sequence in an organism, but it will be understood that the method can detect any single base change from a given sequence. That is the given sequence will contain the targetbase and the SNP will be an alternative base to the target base. It will be understood that the term “target base” is agnostic to the strand. Thus, while a SNP is often identified on one strand (generally the positive strand, like a284g), the target base can be the nucleotide on the positive strand or the negative strand. In the example of the a284g SNP, the “g” on the positive strand can be the target base or the “c” on the negative strand can be the target base. Thus, when a location 3’ to the target base is referred to, it can be 3’ on the positive strand or 3’ on the negative strand. It is merely a matter of defining which nucleotide is considered the “target base” and which the “complement to the target base”. In some embodiments, the SNP is a different base than the target base. In some embodiments, the SNP is informative of a pathology. In some embodiments, the presence of the SNP is indicative of a pathology. In some embodiments, a pathology is a disease or condition. In some embodiments, the SNP is a marker of a pathology. In some embodiments, the method is a method of diagnosing the pathology. In some embodiments, the diagnosing is in the subject. In some embodiments, the method is a method of detecting a drug -resistant disease or condition. In some embodiments, the method is a method of detecting a drug -resistant pathogen. In some embodiments, the disease or condition is a drug-resistant disease or condition. In some embodiments, the disease or condition is a drug -resistant pathogen. In some embodiments, the presence of the SNP is a marker for drug-resistance. In some embodiments, the presence of the SNP is a marker for a drug-resistant pathogenic infection. In some embodiments, the sample is from the subject and the method is a method of diagnosing a subject suffering from a drug-resistant pathogen. In some embodiments, the sample is from the subject and the method is a method of diagnosing a subject suffering from the pathogen as being resistant to treatment.

[0098] In some embodiments, the sample is a sample from a subject. In some embodiments, the method is a method of detecting the SNP in the subject. In some embodiments, the diagnosing is in the subject. In some embodiments, the sample is a biological sample. In some embodiments, a biological sample is a bodily fluid. In some embodiments, the sample is a fluid sample. In some embodiments, the sample comprises nucleic acid molecules. In some embodiments, the bodily fluid is selected from whole blood, serum, plasma, gastric fluid, intestinal fluid, saliva, bile, tumor fluid, breast milk, urine, secretions, interstitial fluid, cerebral spinal fluid and stool. In some embodiments, the bodily fluid is selected from whole blood, serum, plasma, gastric fluid, intestinal fluid, saliva, bile, tumor fluid, breast milk, urine, interstitial fluid, cerebral spinal fluid and stool. In some embodiments, the sample isa swab comprising the bodily fluid. In some embodiments, the swab is an oral swab, an anal swab or a vaginal swab. In some embodiments, the sample comprises nucleic acid molecules.

[0099] In some embodiments, the nucleic acid molecules are DNA or RNA. In some embodiments, the nucleic acid molecules are DNA. In some embodiments, the DNA is cell-free DNA (cfDNA). In some embodiments, the nucleic acid molecules are RNA. In some embodiments, the RNA is mRNA. In some embodiments, the RNA is a miRNA. In some embodiments, the DNA is genomic DNA. In some embodiments, the DNA is plasmid DNA. In some embodiments, the DNA is mitochondrial DNA. In some embodiments, the DNA is single stranded DNA (ssDNA). In some embodiments, the DNA is double stranded DNA (dsDNA). In some embodiments, the RNA is double stranded RNA. In some embodiments, the RNA is single stranded RNA. In some embodiments, the target molecule is a target dsDNA molecule. In some embodiments, the nucleic acid molecules are from the subject. In some embodiments, the nucleic acid molecules are from a pathogen. In some embodiments, the pathogen is a pathogen that has infected the subject. In some embodiments, the subject is a pathogen. In some embodiments, a pathogen is selected from a virus, a bacterium, a fungus and a parasite. In some embodiments, the pathogen is a bacterium. In some embodiments, the virus is a DNA virus. In some embodiments, the virus is a double stranded DNA virus. In some embodiments, the virus is a double stranded RNA virus. In some embodiments, the virus is a single stranded virus. In some embodiments, the sample comprises cells. In some embodiments, the sample is devoid of cells. In some embodiments, cells are intact cells. In some embodiments, cells are cells from the subject.

[0100] In some embodiments, the nucleic acid molecules comprise single stranded nucleic acid molecules. In some embodiments, the nucleic acid molecules comprise single stranded DNA (ssDNA). In some embodiments, the target molecule is a target ssDNA molecule. In some embodiments, the method further comprises converting the target ssDNA molecule into a target dsDNA molecule. In some embodiments, converting comprises amplification of the ssDNA molecule into a dsDNA molecule. In some embodiments, the nucleic acid molecules comprise RNA. In some embodiments, the target molecule is a target RNA molecule. In some embodiments, the RNA molecule is a single stranded RNA molecule. In some embodiments, the RNA molecule is a double stranded RNA molecule. In some embodiments, the method further comprises converting the target RNA molecule into a target dsDNA molecule. In some embodiments, converting comprises reverse transcription of the RNA molecule into a dsDNA molecule. In some embodiments, converting comprises amplifying of the RNA molecule into a dsDNA molecule. In some embodiments, detectingthe target dsDNA molecule is indicative of detecting the target ssDNA or target RNA molecule. In some embodiments, the converting is before the amplifying. In some embodiments, the reverse transcribing is before the amplifying.

[0101] In some embodiments, the method further comprises amplifying an amplicon from the target molecule. In some embodiments, the amplifying is with a pair of primers. In some embodiments, the amplicon comprises a restriction enzyme recognition sequence. In some embodiments, the amplicon comprises at least one copy of a restriction enzyme recognition sequence. In some embodiments, restriction enzyme recognition sequence is a restriction enzyme recognition site. In some embodiments, the amplicon comprises exactly one copy of a restriction enzyme recognition sequence. The selection of primer pairs for nucleic acid amplification is well known in the art. There are several programs available for primer selection, such as Primer3, Primer-BLAST (NCBI), OligoAnalyzer (IDT), PrimerQuest (IDT), Geneious, SnapGene, Benchling and CLC Genomics Workbench (Qiagen) and a skilled artisan would be able to select primers that amplify the desired amplicon. As such, the skilled artisan can design primer and an amplicon such that the amplicon contains a specific restriction enzyme recognition sequence as desired. By shifting the primers and amplifying a different region of the target molecule, the amplicon can be designed to contain a wide variety of restriction sites. Further, the size of the amplicon can be limited such that only one cut site for the given enzyme is present. In some embodiments, the primer pair is sufficient to produce an amplicon.

[0102] In some embodiments, a pair of primers is a primer pair. In some embodiments, the pair of primers comprises a forward primer and a reverse primer. In some embodiments, the pair of primers comprises a first primer and a second primer. Herein, when the first primer is described as being reverse complementary to a first sequence, it will be understood that the first primer is being considered a reverse primer. When the first primer is described as being identical to a first sequence, it will be understood that the first primer is being considered a forward primer. However, it will be understood by a skilled artisan that a primer that is reverse complementary to a sequence of a forward strand will also be the same (identical) as the sequence on the other strand (or the same but with specific mismatches as described herein). So, while the first primer is described as being reverse complementary to a sequence 3 ’ to the target base / SNP it could also be described as being the same as (but with the specific mismatches described herein) a sequence 5’ to the target base / SNP (if the target base / SNP is simply considered as being on the other strand) (see 16A-16B). Similarly, if the primer is identical (or with specific mismatches as described herein) to a sequence of aforward strand it will also be reverse complementary to the sequence on the other strand (with specific mismatches). So when the first primer is described as being identical to a sequence 5’ to the target base / SNP it could also be described as being reverse complementary (with specific mismatches) to a sequence 3’ to the target base / SNP (if the target base / SNP is simply considered as being on the other strand). The first and second primers will invariably produce a double stranded molecule and so the first primer can bind to either of those strands and still function in the method of the invention. In some embodiments, the first primer is a forward primer and the second primer is a reverse primer. In some embodiments, the first primer is a reverse primer and the second primer is a forward primer.

[0103] It must, however, be that in embodiments related to CRISPR, the non-canonical PAM (TRTV) is produced on the strand with the sequence that will be identical to the gRNA. That is the gRNA must have a sequence reverse complementary to the strand that is opposite the produced PAM, such that the 5’ end of the gRNA is directly 3’ to the end of the PAM. The gRNA will contain the complementary base to the SNP so that there will be 100% identity to the complementary strand when the SNP is present (see Fig. 15A). This will produce cutting (e.g., collateral cleavage) when the SNP is present and no cutting when the SNP is not present (being less than 100% identity to the complementary strand, see Fig.15B) In this way cleavage will occur when the SNP is present, but if the gRNA were designed to comprise the complementary base to the target base, then cutting would occur when the target base, and not the SNP, was present. Both are to be understood to be part of the invention.

[0104] For embodiments related to restriction enzymes, though Figures 16A-16B depict a mutation being generated on the reverse strand, 5’ to the complement of the target base, it is just as possible to generate a mutation 5’ to the target base itself, or even 3’ to the target base or complement to the target base. All that is required is that a restriction enzyme recognition site be generated that comprises the SNP (Fig. 16A) and not the target base (Fig. 16B) (or vice versa). The SNP can be 5’ to the alteration that generates the recognition site, 3’ to the alternation, or from both 5’ and 3’ to the alteration. All possibilities are viable embodiments of the invention. In some embodiments, a recognition site is a recognition sequence.

[0105] Figures 17A-17B show a representative embodiment of 2-sided mutagenesis for generating the restriction enzyme target site. In this example, both the forward and reverse primers contain mismatches and the mismatches 5’ and 3’ to the SNP generate the PstI restriction site. This demonstrates how alterations can be made upstream, downstream orboth to the SNP so as to generate a restriction site when the SNP is present (Fig. 17A) but not when the target base is present (Fig. 17B).

[0106] In some embodiments, the primer pair comprises a first primer and a second primer. In some embodiments, the first primer is the reverse primer and the second primer is the forward primer. In some embodiments, the first primer is the forward primer and the second primer is the reverse primer. In some embodiments, the primer pair is sufficient to produce an amplicon. In some embodiments, the primer pair can hybridize to nucleic acid molecules in the sample. In some embodiments, the primer pair can hybridize to a nucleic acid molecule in the sample. In some embodiments, the nucleic acid molecule is the target nucleic acid molecule. In some embodiments, the amplifying is under conditions sufficient for hybridization of the primer pair to the nucleic acid molecules. In some embodiments, the amplifying is under conditions sufficient for amplifying an amplicon. In some embodiments, the amplifying is under conditions sufficient for elongation of the primer after hybridization. In some embodiments, the amplifying is by polymerase. In some embodiments, the method comprises contacting the sample with the primer pair and polymerase. In some embodiments, the method comprises contacting the nucleic acid molecules with the primer pair and polymerase.

[0107] The term “complementary” refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. However, when a U is denoted in the context of the present invention, the ability to substitute a T is implied, unless otherwise stated. Perfect complementarity or 100% complementarity refers to the situation in which each nucleotide unit of one polynucleotide strand can hydrogen bond with a nucleotide unit of a second polynucleotide strand. Less than perfect complementarity refers to the situation in which some, but not all, nucleotide units of two strands can hydrogen bond with each other. For example, for two 20-mers, if only two base pairs on each strand can hydrogen bond with each other, the polynucleotide strands exhibit 10% complementarity. In the same example, if 18 base pairs on each strand can hydrogen bond with each other, the polynucleotide strands exhibit 90% complementarity.

[0108] In some embodiments, the amplifying is PCR amplifying. In some embodiments, the amplifying is isothermal amplifying. Examples of isothermal amplification include but are not limited to: loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), Rolling circle amplification (RCA), strand displacement amplification (SDA), and Helicase-dependent amplification (HD A). In some embodiments, the isothermal amplifying is RPA.

[0109] In some embodiments, the amplifying produces an amplicon. In some embodiments, the amplicon is double stranded. The amplicon can be denatured into single strands. In some embodiments, the amplicon comprises or consists of not more than 5000, 4500, 4000, 3500, 3000, 2500, 2000, 1750, 1500, 1250, 1000, 900, 800, 700, 600, 500, 400, 300, 250, 225, 200, 175, 150, 125 or 100 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, the amplicon comprises or consists of not more than 3000 bases. In some embodiments, the amplicon comprises or consists of not more than 1000 bases. In some embodiments, the amplicon comprises or consists of not more than 500 bases. In some embodiments, the amplicon comprises or consists of not more than 250 bases. In some embodiments, the amplicon comprises or consists of at least 25, 50, 75, 100, 125, 150, 200, 225, 250, 275, 300, 350, 400, 450 or 500 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, the amplicon comprises or consists of at least 50 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, the amplicon comprises or consists of at least 100 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, the amplicon comprises or consists of at least 150 bases.

[0110] In some embodiments, the primer is aDNA primer. As used herein, the term “primer” refers to a short, single-stranded nucleic acid molecule also known as an oligonucleotide. In some embodiments, a primer comprises at least 7, 10, 12, 14, 15, 16, 18, 20, 22, 24, 25, 26, 28, or 30 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, a primer is at least 7, 10, 12, 14, 15, 16, 18, 20, 22, 24, 25, 26, 28, or 30 bases long. Each possibility represents a separate embodiment of the invention. In some embodiments, a primer is at least 16 bases long. In some embodiments, a primer is at least 18 bases long. In some embodiments, a primer is at least 25 bases long. In some embodiments, a primer is at least 30 bases long. In some embodiments, a primer comprises at most 25, 26, 28, 30, 32, 34, 35, 40, 42, 44, 45, 46, 48 or 50 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, a primer is at most 25, 26, 28, 30, 32, 34, 35, 40, 42, 44, 45, 46, 48 or 50 bases long. Each possibility representsa separate embodiment of the invention. In some embodiments, a primer is at most 35 bases long. In some embodiments, a primer is at most 40 bases long. In some embodiments, a primer is at most 45 bases long. In some embodiments, a primer is 16-45, 18-45, 20-45, 25-45, 28-45, 30-45, 16-42, 18-42, 20-42, 25-42, 28-42, 30-42, 16-40, 18-40, 20-40, 25-40, 28-40, 30-40, 16-38,18-38, 20-38, 25-38, 28-38, 30-38, 16-35, 18-35, 20-35, 25-35, 28-35, 30-35, 16-32, 18-32, 20-32, 25-32, 28-32, 30-32, 16-30, 18-30, 20-30, 25-30, or 28-30 bases long. Each possibility represents a separate embodiment of the invention. In some embodiments, a primer is 16-45 bases long. In some embodiments, a primer is 25-45 bases long. In some embodiments, a primer is 30-45 bases long. In some embodiments, a primer is 30-35 bases long. A skilled artisan will appreciate that different amplification methods come with different ideal primer lengths and that for example PCR amplification generally calls for primers of 18-22 bases and RPA generally calls for primers of 25-35 bases. As such a skilled artisan will be able to select the proper primer length for the used amplification method.

[0111] In some embodiments, the pair of primers is a group of primers. In some embodiments, the pair of primers is at least 2 primers. In some embodiments, the pair of primers is 3 primers. In some embodiments, the primer pair comprises a first primer and a second primer. In some embodiments, the first primer is a forward primer and the second primer is a reverse primer. In some embodiments, a primer of the pair of primers comprises a tag. In some embodiments, the tag is a first tag. In some embodiments, only one primer of the pair of primers comprises a tag. In some embodiments, the two primers of the pair of primers do not both comprise a tag. In some embodiments, the first primer comprises a tag. In some embodiments, the second primer comprises a tag. In some embodiments, the first primer comprises a tag and the second primer does not, or the second primer comprises a tag and the first does not. In some embodiments, the two primers of the pair of primers comprise a tag. In some embodiments, both primers of the primer pair comprise a tag.

[0112] As used herein, the term “tag” refers to a moiety that can be later detected to identify that the target molecule was present. In some embodiments, a tag is a detectable moiety. In some embodiments, the tag is not a nucleic acid tag. In some embodiments, the tag is not a nucleic acid sequence. It will be understood by a skilled artisan that the tag is added to the primer and is not a sequence within the primer, thus the tag is a moiety that can be detected but which is not part of the primer sequence or backbone. In some embodiments, the tag is attached to the primer. In some embodiments, the tag is conjugated to the primer. In some embodiments, the tag is linked to the primer. In some embodiments, the linkage is a covalentlinkage. In some embodiments, the tag is detectable by eye. In some embodiments, the tag is a dye. In some embodiments, the tag is detectable in a reaction. In some embodiments, the tag is a ligand for a reaction that produces a signal. In some embodiments, the tag is a substrate for a reaction that produces a signal. In some embodiments, the reaction is a chemical reaction. In some embodiments, the reaction is a biological reaction. For example, horseradish peroxidase is able to oxidize a variety of substrates to produce a signal (e.g., color). Examples of such substrates include, but are not limited to, DAB, ABTS, AEC, AmplexRed, Homovanillic acid, Luminol, OPD and TMB. In some embodiments, the tag produces color in solution. In some embodiments, the tag is a nanoparticle. In some embodiments, the tag is a microsphere. In some embodiments, the microsphere is a colored microsphere. In some embodiments, a colored microsphere is a gold microsphere. In some embodiments, the tag is a magnetic bead. In some embodiments, the tag comprises gold. In some embodiments, the tag is a gold nanoparticle. In some embodiments, the tag is a fluorophore. In some embodiments, the tag is fluorescent. In some embodiments, the fluorophore is a fluorescent dye. Fluorophores are well known in the art and include for example, FITC, GFP, YFP, RFP, Cy5, Cy7, PerCP, Atto, PerCy5, PerCy7, BODIPY, Pacific Blue, PI, and the various Alexa fluor fluorophores to name but a few. Examples of potential fluorophores can be found for example at: thermofisher.com / il / en / home / life-science / cell-analysis / fluorophores.html, abcam.com / ps / pdf / protocols / Fluorophore%20table.pdf, and en.wikipedia.org / wiki / Fluorophore all of which are hereby incorporated herein by reference. It will be understood that fluorophores have a natural color which can be detected by eye but also can be excited by a laser and their fluorescence can also be detected. Each type of detectable signal may be used as part of the invention. In some embodiments, the tag is FITC. In some embodiments, the tag is charged. In some embodiments, the tag is a capture moiety. In some embodiments, the second tag is a capture moiety.

[0113] In some embodiments, the first tag and the second tag are different tags. In some embodiments, different tags are differentially detectable. In some embodiments, the first tag and the second tag can each be uniquely detected. In some embodiments, differentially detectable is uniquely detectable. In some embodiments, the first or second tag is a capture moiety. In some embodiments, the first and second tag are both capture moieties and are different capture moieties. In some embodiments, the first and second tag are different types of tags. Types of tags include, fluorophores, capture moieties, tags detectable by the eye, etc. In some embodiments, one of the first tag and the second tag are a capture moiety and the other is not. It will be understood that when defining either the first or second tag, the tagthat does not meet this definition will be known as the “other tag”. Thus, if one of the two tags is a capture moiety and the other is not, then either the first tag is a capture moiety and the second tag is not a capture moiety or the second tag is a capture moiety and the first tag is not a capture moiety.

[0114] In some embodiments, the first and second tag are both detected. In some embodiments, the tags are detected sequentially. In some embodiments, the tags are detected simultaneously. In some embodiments, one of the tags is a capture moiety and the detecting comprises applying the ligation product to a capturing moiety. In some embodiments, the capturing moiety specifically binds to the capture moiety. In some embodiments, the binding produces a capturing moiety-ligation product complex. In some embodiments, the other tag that is not the capture moiety is detected in the capturing moiety-ligation product complex. In some embodiments, detecting the tag comprises contacting the tag with a labeled antibody. In some embodiments, the labeled antibody is specific to the first tag. In some embodiments, the labeled antibody is specific to the second tag. In some embodiments, detecting comprises contacting the ligation product with a labeled antibody specific to the first tag and a labeled antibody specific to the second tag. In some embodiments, contacting with the antibody is binding with the antibody. In some embodiments, the antibody is specific to the tag. In some embodiments, the detecting is detecting the label. In some embodiments, the label is a fluorophore. In some embodiments, the label is a separate tag. In some embodiments, the label is different than the tag. In some embodiments, the antibody is an anti-FITC antibody. In some embodiments, the antibody is conjugated to a nanoparticle. In some embodiments, the nanoparticle is a gold nanoparticle.

[0115] In some embodiments, the first primer is reverse complementary to the first sequence. In some embodiments, the first primer is the same as the first sequence. In some embodiments, the first primer is at least 70, 75, 80, 85, 90, or 95% identical to the first sequence. Each possibility represents a separate embodiment of the invention. In some embodiments, the first primer is at least 70% identical to the first sequence. In some embodiments, the first primer is at least 85% identical to the first sequence. In some embodiments, the first primer hybridizes to the first sequence. In some embodiments, the first primer is less than 100% reverse complementary to the first sequence. In some embodiments, the first primer is less than 100% identical to the first sequence. In some embodiments, the first primer has at least one mismatch to the first sequence. In some embodiments, the first primer has exactly one mismatch to the first sequence. In some embodiments, the first primer has 1 or 2 mismatches to the first sequence. In someembodiments, the first primer has 1, 2 or 3 mismatches to the first sequence. In some embodiments, the first sequence is 70-99, 75-99, 80-99, 85-99, 90-99, 91-99, 92-99, 93-99, 94-99, 95-99, 96-99, 70-98, 75-98, 80-98, 85-98, 90-98, 91-98, 92-98, 93-98, 94-98, 95-98, 96-98, 70-97, 75-97, 80-97, 85-97, 90-97, 91-97, 92-97, 93-97, 94-97, 95-97, 96-97, 70-96, 75-96, 80-96, 85-96, 90-96, 91-96, 92-96, 93-96, 94-96, or 95-96% reverse complementary to the first sequence. Each possibility represents a separate embodiment of the invention. In some embodiments, the first sequence is 70-99% reverse complementary to the first sequence. In some embodiments, the first sequence is 80-98% reverse complementary to the first sequence. In some embodiments, the first sequence is 90-97% reverse complementary to the first sequence. In some embodiments, the first sequence is 70-99, 75-99, 80-99, 85-99, 90-99, 91-99, 92-99, 93-99, 94-99, 95-99, 96-99, 70-98, 75-98, 80-98, 85-98, 90-98, 91-98, 92-98, 93-98, 94-98, 95-98, 96-98, 70-97, 75-97, 80-97, 85-97, 90-97, 91-97, 92-97, 93-97, 94-97, 95-97, 96-97, 70-96, 75-96, 80-96, 85-96, 90-96, 91-96, 92-96, 93-96, 94-96, or 95-96% identical to the first sequence. Each possibility represents a separate embodiment of the invention. In some embodiments, the first sequence is 70-99% identical to the first sequence. In some embodiments, the first sequence is 80-98% identical to the first sequence. In some embodiments, the first sequence is 90-97% identical to the first sequence.

[0116] In some embodiments, the first sequence is 3’ to the target base. In some embodiments, the first sequence is 3’ to the SNP. In some embodiments, the first sequence is 5’ to the target base. In some embodiments, the first sequence is 5’ to the SNP. It will be understood that generally throughout when position is given with respect to the target base or the SNP it is given in regard to both, as the position is simply in reference to the location where there can be either the target base or the SNP. In some embodiments, the first sequence does not comprise the target base or the SNP.

[0117] In some embodiments, the first sequence is not more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases away from the target base. Each possibility represents a separate embodiment of the invention. In some embodiments, the first sequence is not more than 25 bases away from the target base. In some embodiments, the first sequence is not more than 20 bases away from the target base. In some embodiments, the first sequence is not more than 7 bases away from the target base. In some embodiments, the first sequence is not more than 2 bases away from the target base. In some embodiments, the first sequence is not more than 1 base away from the target base. In some embodiments, the first sequence is adjacent to the target base. In some embodiments, away is 3’ to. In some embodiments, away is 5’ to. It will be understood thatwhen a distance is given for the first sequence it refers to the end of the sequence that is closest to the target base or SNP. Thus, a first sequence that is 25 bases 3’ to the target base is a sequence that starts at the 25thbase after the target base. Similarly, if the first sequence is 7 bases 5’ to the SNP then the last base of the sequence (from 5’ to 3’) will be the 7thbase before the SNP. In some embodiments, the first sequence is not more than 20 bases away from the target base. In some embodiments, the distance of the first sequence is the distance of the end of the first sequence.

[0118] In some embodiments, the first primer produces a de novo sequence in the amplicon. As the first primer is not 100% identical or complementary to the nucleic acid molecules, when amplification occurs the mismatch from the primer is incorporated into the amplicon and then is included in all subsequent rounds of amplification. Thus, the mismatch in the first primer produces a de novo sequence in the amplicon, specific in the region that used to have the first sequence (there is a de novo sequence in place of the first sequence). In some embodiments, the first and second primers produce a de novo sequence in the amplicon. If the second primer is also not 100% identical or complementary to the nucleic acid molecule, when amplification occurs the mismatches from the primers are incorporated into the amplicon and then are included in all subsequence rounds of amplification. In some embodiments, the artificial restriction enzyme recognition site comprises the SNP, and at least one base reverse complementary to a base in the first primer mismatched with the first sequence. In some embodiments, the artificial restriction enzyme recognition site comprises the SNP, at least one base reverse complementary to a base in the first primer mismatched with the first sequence and at least one base in the second primer mismatched with the second sequence.

[0119] In some embodiments, the canonical PAM is TTTV. In some embodiments, the canonical PAM of CAS 12 is TTTV. In some embodiments, the de novo sequence is a non-canonical PAM. In some embodiments, the de novo sequence is TRTV. In some embodiments, the non-canonical PAM is TRTV. It will be known to a skilled artisan that the base “R” is A or G. In some embodiments, TRTV is TGTV. In some embodiments, TRTV is TATV. It will be known to a skilled artisan that the base “V” is A, C or G. In some embodiments, TRTV is TRTA. In some embodiments, TRTV is TRTC. In some embodiments, TRTV is TRTG. In some embodiments, TRTV is TGTA. In some embodiments, TRTV is TGTC. In some embodiments, TRTV is TGTG. In some embodiments, the de novo sequence is a non-canonical PAM. In some embodiments, a noncanonical PAM is a PAM with at least one mismatch to a canonical PAM. In someembodiments, at least one is one. In some embodiments, the non-canonical PAM is TRTV. The generation of the TRTV sequence will depend on the sequence it is replacing. Within a region up to 25 bases 3’ to the target base there will be a sequence that can be converted into TRTV with at the most 3 alterations (only in a case of a sequence of all “C” bases is three alterations needed), generally the TRTV sequence can be generated with only 2 alterations and indeed in most cases a single alteration can be incorporated in order to produce TRTV. A skilled artisan would certainly be able to produce a first primer that will hybridize to the first sequence and will have at least one mismatch such that the sequence TRTV is produced in the amplicon.

[0120] In some embodiments, the produced TRTV is not more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases away from the target base or SNP. Each possibility represents a separate embodiment of the invention. In some embodiments, the produced TRTV is not more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases away from the complementary base to the target base or SNP. Each possibility represents a separate embodiment of the invention. In some embodiments, the produced TRTV is not more than 25 bases 5’ to the complementary base to the target base or SNP. In some embodiments, the produced TRTV is not more than 20 bases 5’ to the complementary base to the target base or SNP. In some embodiments, the produced TRTV is not more than 8 bases 5’ to the complementary base to the target base or SNP. In some embodiments, the produced TRTV adjacent to the complementary base to the target base or SNP. Depending on which direction the gRNA is designed, the PAM can be placed on either side of the target base / SNP, but since the gRNA must hybridize directly 3’ to the PAM but to the opposite strand, the PAM’s position is given with respect to the complementary base to the SNP / target base (the PAM is on one strand and the gRNA hybridizes to the other strand). The complementary base to the target base / SNP can be located anywhere in the gRNA (that is any part of the gRNA can hybridize to the target base / SNP) and as the gRNA generally has a maximum length of 25 bases it should be that the non-canonical PAM is not more than 25 bases away from the target base / SNP or its complementary base. gRNAs for Cast 2 are usually limited to 23 bases in length so in preferred embodiments, the non-canonical PAM is not more than 23 bases away from the target base / SNP or its complementary base. Further, it is even more preferred that the target base / SNP hybridize to the seed region. Therefore, it is an even more preferred embodiment that the non-canonical PAM is not more than 8 bases (the size of the seed) away from the target base / SNP or its complementary base.

[0121] In some embodiments, the amplicon comprises a restriction enzyme recognition sequence and a tag. In some embodiments, the amplicon comprises one restriction enzyme recognition sequence and one tag. In some embodiments, the amplicon comprises only one restriction enzyme recognition sequence and only one tag. As used herein, the term “restriction enzyme recognition sequence” refers to the sequence that is bound by specific restriction enzymes. Often the enzyme cuts within the sequence, though there are some enzymes that cut down / up stream to the sequence. The sequence confers specificity to the restriction enzyme, as the enzyme will only bind at this sequence and will only cut the molecules that comprise the sequence. In some embodiments, the tag is proximal to a first end of the amplicon. In some embodiments, the tag is internal to the amplicon. In some embodiments, the restriction enzyme recognition sequence is proximal to a second end of the amplicon. In some embodiments, the end of the amplicon is the first or last base of the amplicon. In some embodiments, the first end is the first base of the amplicon and the second end is the last base of the amplicon. In some embodiments, the first end and second end are different ends. In some embodiments, proximal to is not more than 100, 90, 80, 75, 70, 60, 50, 40, 30, 25, 20, 15, 10, or 5 bases from. Each possibility represents a separate embodiment of the invention. In some embodiments, proximal to is not more than 10 bases from. In some embodiments, proximal to is not more than 50 bases from.

[0122] In some embodiments, the sample is contacted with the restriction enzyme. In some embodiments, the nucleic acid molecules are contacted with the restriction enzyme. In some embodiments, the amplicon is contacted with the restriction enzyme. In some embodiments, the restriction enzyme is the enzyme for which the amplicon comprises a recognition sequence. In some embodiments, cleavage by the restriction enzyme produces a cleavage product. In some embodiments, the cleavage product comprises the tag. In some embodiments, the cleavage product comprises a single stranded overhang. It will be understood that when the amplicon is cleaved, two separate pieces of the amplicon will be produced. Each piece will have a single stranded overhang. If only one of the primers comprises the tag, then only one of the pieces will comprise the tag. If both primers comprise the tag, then both pieces will comprise the tag. In some embodiments, the cleavage product comprises the tag and a single stranded overhang. In some embodiments, the overhang is a single stranded DNA (ssDNA) overhang.

[0123] In some embodiments, the de novo sequence is a restriction enzyme recognition site. In some embodiments, restriction enzyme recognition site is an artificial restriction enzyme recognition site. In some embodiments, the restriction enzyme is a DNA restriction enzyme.In some embodiments, the restriction enzyme is an RNA restriction enzyme. In some embodiments, the restriction enzyme does not produce a blunt end. In some embodiments, the restriction enzyme produces an overhang. In some embodiments, the restriction enzyme produces a sticky end.

[0124] A list of possible restriction enzymes and their recognition sites are provided in Table 1. In some embodiments, a recognition site of the restriction enzyme is not present in the amplicon when the target base is present. In some embodiments, a recognition site of the restriction enzyme is not present in the amplicon in any region that does not include the target base or SNP. It will be understood that a restriction enzyme must be selected that will not cut in the rest of the amplicon (away from the target base / SNP) as in such cases there will always be cleavage.

[0125] Table 1 : List of restriction enzymes and their recognition sites. The point of cleavage is indicated by aNumbers in parentheses indicate the point of cleavage for non-palindromic enzymes.

[0126] As used herein, the term “adapter” refers to a nucleic acid molecule that comprises a single stranded region. In some embodiments, the single stranded region is an overhang. In some embodiments, the adapter is a DNA adapter. In some embodiments, the adapter is an RNA adapter. In some embodiments, the adapter is a dsDNA adapter. In some embodiments, the adapter comprises a double stranded region. In some embodiments, the adapter comprises a double stranded region and a single stranded region. In some embodiments, the adapter consists of a double stranded region, a single stranded region and a second tag. In some embodiments, the adapter comprises a dsDNA region and a ssDNA region. In some embodiments, the double stranded region of the adapter is at least 3, 4, 5, 6, 7, 8, 9 or 10 bases long. Each possibility represents a separate embodiment of the invention. In some embodiments, the double stranded region of the adapter is at least 5 bases long. In some embodiments, the double stranded region of the adapter is at most 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 750, 800, 900 or 10000 bases long. Each possibility represents a separate embodiment of the invention.In some embodiments, the double stranded region of the adapter is at most 50 bases long. Each possibility represents a separate embodiment of the invention. In some embodiments, the double stranded region of the adapter is at most 100 bases long. In some embodiments, the double stranded region of the adapter is between 5 and 50 bases long. In some embodiments, the double stranded region of the adapter is between 5 and 100 bases long.

[0127] In some embodiments, the adapter is a single stranded region attached to a second tag. In some embodiments, the adapter is a single stranded region, a double stranded region and a second tag attached to the double stranded region. In some embodiments, attached is conjugated to. It will be understood that the single stranded region can be present without a double stranded region, but when the double stranded region is present the single stranded region can be referred to as an overhang. In some embodiments, the single stranded region of the adapter is complementary to the overhang of the cleavage product. In some embodiments, the adapter overhang and the cleavage product overhang are 5’ overhangs. In some embodiments, the adapter overhang and the cleavage product overhang are 3’ overhangs. In some embodiments, complementary is reverse complementary. In some embodiments, complementary is perfectly complementary. In some embodiments, complementary is 100% complementary. In some embodiments, the overhang of the adapter and the overhang of the cleavage product are equal in length. The overhangs of the adapter and cleavage product are commonly referred to as “sticky ends” and they can be joined by a ligase by the formation of a phosphodiester bond between the 3'-hydroxyl end of one nucleotide and the 5'-phosphate end of another.

[0128] In some embodiments, the adapter comprises a second tag. In some embodiments, the adapter is conjugated to a second tag. In some embodiments, the second tag is linked to the double stranded region. In some embodiments, the second tag is conjugated to the double stranded region. In some embodiments, the adapter comprises a capture moiety. In some embodiments, the adapter is conjugated to a capture moiety. In some embodiments, the capture moiety is linked to the double stranded region. In some embodiments, the capture moiety is conjugated to the double stranded region. As used herein, a “capture moiety” and “capturing moiety” are configured to bind to each other. In some embodiments, the capturing moiety specifically binds to the capture moiety. In some embodiments, the capturing moiety and capture moiety specifically bind to each other. In some embodiments, contacting the capturing moiety with the capture moiety produces a complex. In some embodiments, the complex is a capturing moiety-capture moiety complex. Binding pairs that can be used as capture and capturing moieties (i.e., as second tags and for detecting the second tag) are wellknown in the art and any such pairs can be used. Indeed, essentially any protein and a highly specific antibody against that protein can be used as the binding pair. Examples of binding pairs that can be used as the capture and capturing moiety include, but are not limited to: biotin and streptavidin or avidin, digoxigenin (DIG) and anti-DIG antibody, MS2 and MS2 binding protein (MCP), fluorescein (FAM) and anti-FAM antibody, Cy3 dye and anti-Cy3 antibody, Cy5 dye and anti-Cy5 dye, dinitrophenol (DNP) and anti-DNP antibody, acrydite and acrylamide or acrylamide-containing matrices, aptamers and their binding target, and an antibody and anti-Fc antibody. In some embodiments, the capture moiety is a protein or proteinaceous moiety. In some embodiments, the capture moiety comprises biotin and the capturing moiety comprises avidin. In some embodiments, avidin is selected from streptavidin and neutravidin. In some embodiments, the capture moiety and capturing moiety bind covalently. In some embodiments, the binding pair is not a nucleic acid sequence and its reverse complement. In some embodiments, the capturing moiety is a nucleic acid molecule reverse complementary to the sequence of the capture moiety. In some embodiments, the capturing moiety is perfectly complementary to the capture moiety. In some embodiments, the capturing moiety comprises at least 80, 85, 90, 92, 95, 97, 99 or 100% complementarity to the capture moiety. Each possibility represents a separate embodiment of the invention. In some embodiments, the capturing moiety comprises at least 5, 7, 10, 12, 15, 17, 20 or 25 complementary bases to the capture moiety. Each possibility represents a separate embodiment of the invention.

[0129] In some embodiments, ligating the adapter to the cleavage product comprises incubating the cleavage product and the adapter with a ligase. In some embodiments, ligating the adapter to the cleavage product comprises contacting the cleavage product and the adapter with a ligase. In some embodiments, the incubating is for a time sufficient to ligate the adapter to the cleavage product to produce a ligation product. In some embodiments, the incubating is in conditions sufficient to ligate the adapter to the cleavage product to produce a ligation product. In some embodiments, the ligase is a DNA ligase. In some embodiments, the ligase is an RNA ligase. Examples of DNA ligases that can be used include, but are not limited to T4 ligase, E. coli ligase, T7 ligase, Taq ligase, and ampiligase. Methods of ligation are well known in the art. Ligation can be performed at room temp (20-25°C) for short periods of time (5-15 minute) or for longer periods (1 hour to overnight). Ligations can also be performed at 37°C for short time periods. Ligation can also be done at lower temperatures (16°C or 4°C), but then times must be extended. For ligations on ice (4°C) ligation should be extended to 16-24 hours or even longer. In some embodiments, ligation is essentiallyinstantaneous. In some embodiments, ligation occurs while flowing on a lateral flow device. A skilled artisan will be able to select suitable ligation conditions. In some embodiments, ligation comprises adding a cofactor of the ligase. In some embodiments, the cofactor is ATP. In some embodiments, ligation comprises adding a ligation buffer. In some embodiments, ligation is in the presence of the cofactor. In some embodiments, the cofactor is NAD+.

[0130] In some embodiments, the cutting and ligation are performed in separate containers. In some embodiments, the cutting and ligation are performed in a separate solution. In some embodiments, the ligation occurs without restriction enzyme present. In some embodiments, the ligation and cutting are performed in the same container. In some embodiments, the ligation and cutting are performed in the same solution. In some embodiments, the ligation occurs in the presence of the restriction enzyme.

[0131] In some embodiments, the double stranded region of the DNA adapter comprises a protection base. In some embodiments, the double stranded region of the DNA adapter comprises a protection sequence. In some embodiments, the protection base is adjacent to the single stranded overhang. In some embodiments, the protection sequence is adjacent to the single stranded overhang. In some embodiments, protection comprises not producing a restriction enzyme recognition sequence upon ligation. In some embodiments, the double stranded region of the adapter comprises a sequence adjacent to the single stranded overhang that when ligated to the cleavage product does not recreate the restriction enzyme recognition sequence. In some embodiments, the sequence adjacent to the single stranded overhang does not contain a first portion of the recognition sequence, wherein the cleavage product if its overhang is filled in contains a second portion of the recognition sequence such that the first portion and second portion combine to make the full recognition sequence. It will be understood by a skilled artisan that ligation can recreate the restriction site if the sequence directly adjacent to the sticky ends reproduces the recognition sequence. To avoid this, the sequence of the adapter is selected such that the double stranded sequence adjacent to the overhang is not one that would produce the restriction site after ligation. In the example provided in Figures 2B-2C, enzyme EcoRI cuts at GAATTC which produces a AATT 5’ overhang in the cleavage product. Adapter therefore has a 5’ overhang that consists of TTAA. If the base direct adjacent to this overhang were a C (this is on the reverse strand, it would have a G on the forward strand) then the GAATTC site would be reproduced upon ligation. To protect against this, the adj acent base in the double stranded region of the adapter must be A, T or G (in the reverse strand), this would produce in the forward strand TAATTC,AAATTC or CAATTC all of which would not be recognized by EcoRI. Because the EcoRI site is only 6 bases with 4 overhanging after the cut, it must be the most adjacent base that is a protection base. However, if an enzyme recognized 8 bases with a 4 base overhang, then either of the two closest bases (the adjacent or the next one) could be made to disrupt reformation of the cut site.

[0132] In some embodiments, applying the ligation product to a capturing moiety comprises contacting the capturing moiety with the ligation product. In some embodiments, applying the ligation product to a capturing moiety comprises incubating the capturing moiety with the ligation product. In some embodiments, the applying results in the production of a ligation product-capturing moiety complex. In some embodiments, the complex is a capturing moiety-ligation product complex. In some embodiments, applying the ligation product is applying a solution comprising the ligation product. In some embodiments, the capturing moiety is configured to bind the capture moiety. In some embodiments, the detecting comprises contacting the ligation product with an agent that binds the first tag, the second tag or both. In some embodiments, the capturing moiety comprises or is a physical support. In some embodiments, the agent comprises or is a physical support. In some embodiments, the capturing moiety is conjugated to a physical support. In some embodiments, the agent is conjugated to a physical support. In some embodiments, the capturing moiety is immobilized on a physical support. In some embodiments, the agent is immobilized on a physical support. In some embodiments, a physical support is a solid support. In some embodiments, the physical support is a bead, resin or surface. In some embodiments, the physical support is a bead. In some embodiments, the physical support is a pad. In some embodiments, the physical support is a lateral flow device. In some embodiments, the bead is an avidin bead. In some embodiments, the bead is a magnetic or paramagnetic bead. In some embodiments, the ligation product becomes immobilized to the solid support upon binding to the capturing moiety.

[0133] In some embodiments, the detecting comprises isolating the capturing moiety. In some embodiments, the isolating is after applying to the capturing moiety. In some embodiments, the detecting comprises isolating the capture moiety. In some embodiments, the isolating is isolating from the solution. In some embodiments, the isolating is isolating the capturing moiety and nucleic acid molecules bound thereto. In some embodiments, nucleic acid molecules bound thereto are ligation products bound thereto. In some embodiments, the isolating is isolating the capturing moiety and ligation product.

[0134] In some embodiments, the ligation product is isolated. In some embodiments, the isolating is by size. In some embodiments, isolating by size comprises size exclusion. In some embodiments, the isolating is by contact to a silica membrane or resin. It is well known that DNA binds to silica and thus isolation can be carried out.

[0135] In some embodiments, detecting comprises detecting the tag. In some embodiments, detecting comprises detecting the tag after isolation of the ligation product. In some embodiments, detecting comprises detecting the tag after isolation of the capturing moiety. In some embodiments, the tag is fluorescent and the detecting is detecting fluorescence. In some embodiments, detecting is with a fluorescent reader. In some embodiments, the tag is charged and the detecting is detecting the charge of the ligation product (e.g., a difference in charge). In some embodiments, detecting comprises contacting the ligation product with an antibody specific to the tag. In some embodiments, detecting the tag comprises contacting the tag with an antibody specific to the tag. In some embodiments, detecting comprises contacting the capturing moiety-ligation product complex with an antibody specific to the tag. In some embodiments, the tag is the other tag. In some embodiments, other is other than the tag which is a capture moiety. In some embodiments, detecting comprises contacting the complex with an antibody specific to the tag. In some embodiments, the antibody is an antitag antibody. In some embodiments, the antibody is labeled with a label. In some embodiments, the antibody is conjugated to a label. In some embodiments, the antibody is a labeled antibody. In some embodiments, the label is a visible label. In some embodiments, the label is a fluorescent label. In some embodiments, the label is a nanoparticle. In some embodiments, the nanoparticle is a gold nanoparticle.

[0136] In some embodiments, the method comprises applying the ligation product to a lateral flow device. In some embodiments, the method comprises applying the amplicon to a lateral flow device. In some embodiments, the lateral flow device comprises a loading area. In some embodiments, the ligation product is loaded to the loading area. In some embodiments, the amplicon is loaded to the loading area. In some embodiments, the lateral flow device comprises the restriction enzyme. In some embodiments, the lateral flow device comprises the adapter. In some embodiments, the lateral flow device comprises the ligase. In some embodiments, the lateral flow device comprises conditions sufficient for restriction enzyme cutting. In some embodiments, the lateral flow device comprises conditions sufficient for ligation. In some embodiments, the lateral flow device comprises a cofactor of the ligase. It will be understood that the various components needed for performing the method can be included in the flow device itself. They can be within the loading area orwithin a downstream area (a separate pad or chamber). In some embodiments, the various components are present between the loading area and the test area. In some embodiments, the test area is the test strip. In some embodiments, the test area comprises the capturing moiety. In some embodiments, the adapter comprises a protection sequence and the amplicon is applied to the lateral flow device. In some embodiments, the amplicon is applied to the lateral flow device comprising the restriction enzyme, adapter and ligase. In some embodiments, the restriction enzyme is immobilized in / on the lateral flow device. In some embodiments, the adapter is immobilized in / on the lateral flow device. In some embodiments, the ligase is immobilized in / on the lateral flow device. In some embodiments, immobilized is coupled. In some embodiments, immobilized is deposited. In some embodiments, the agents are in a lyophilized form when added to the lateral flow device. In some embodiments, the agents are lyophilized in / on the lateral flow device.

[0137] In some embodiments, the lateral flow device comprises a test line. In some embodiments, the test line comprises agents that bind the first tag or the second tag. In some embodiments, the test line comprises capturing moieties. In some embodiments, the agents are capturing moieties. In some embodiments, the agents are antibodies. In some embodiments, the test line comprises immobilized agents. In some embodiments, the test line comprises immobilized capturing moieties. In some embodiments, the agents are conjugated to the test line. In some embodiments, the capturing moieties are conjugated to the test line. In some embodiments, the agents are conjugated to the lateral flow device at the test line. In some embodiments, the capturing moieties are conjugated to the lateral flow device at the test line. In some embodiments, the agents are conjugated to beads located at the test line. In some embodiments, the capturing moieties are conjugated to beads located at the test line. In some embodiments, the detecting comprises applying a molecule specific to the tag to the lateral flow device. In some embodiments, the tag is the other tag. In some embodiments, the other tag is the tag not bound by the agents. In some embodiments, the molecule is an anti-tag antibody. Any binding molecule may be used so long as it is specific to the tag. Thus, for example biotin can be the tag and it can be detected with avidin or its derivatives. In some embodiments, the anti-tag antibody is applied to the test line. In some embodiments, the anti-tag antibody is labeled. In some embodiments, the label is a fluorescent label. In some embodiments, the label is a visible label. In some embodiments, the label is conjugated to the antibody. In some embodiments, the label is a nanoparticle. In some embodiments, the nanoparticle is a gold nanoparticle.

[0138] In some embodiments, the lateral flow device further comprises a control line. In some embodiments, the control line comprises an antibody that binds to the antibody. In some embodiments, the control line comprises an antibody that binds to a control target from the sample. In some embodiments, the control target is a human DNA target. In some embodiments, the human DNA target also comprises a tag. In some embodiments, the human DNA target is also amplified. In some embodiments, the human DNA target is also cut by a restriction enzyme. In some embodiments, an adapter is also ligated to the human DNA target to produce a control product. In some embodiments, the adapter ligated to the cleaved human DNA target is a different adapter than the one ligated to the cleavage product. In some embodiments, the different adapters comprise different capture moieties. In some embodiments, the control product is also applied to the lateral flow device. In some embodiments, an antibody is immobilized at the control line. In some embodiments, an antibody is conjugated or immobilized to the lateral flow device at the control line. In some embodiments, the antibody at the control line is not labeled. In some embodiments, the control line antibody is an anti-Fc antibody.

[0139] In some embodiments, the amplification produces the restriction enzyme recognition sequence in the amplicon. In some embodiments, the producing is producing an artificial restriction enzyme recognition sequence. In some embodiments, artificial is de novo. In some embodiments, the target nucleic acid molecule does not comprise the restriction enzyme recognition sequence and the amplification produces the restriction enzyme recognition sequence. In some embodiments, the region between where the primers bind the target nucleic acid molecule is devoid of the restriction enzyme recognition sequence and the amplificant produces the restriction enzyme recognition sequence in the amplicon.

[0140] In some embodiments, the first primer of the pair of primers is at least 85% identical to a first sequence in the target molecule. In some embodiments, the second primer is at least 85% identical to a second sequence in the target molecule. In some embodiments, at least 85% is at least 90%, 92%, 95%, or 97%. Each possibility represents a separate embodiment of the invention. In some embodiments, the first primer is less than 100% complementary to its target sequence in the target molecule. In some embodiments, the second primer is less than 100% complementary to its target sequence in the target molecule. In some embodiments, one of the primers comprises a mismatch to the target sequence, wherein the mismatch produces the artificial restriction enzyme recognition sequence. It will be understood that a mismatch or mismatches in the primers will produce amplification-based mutagenesis that can produce the recognition sequence.

[0141] In some embodiments,i) a first primer of the pair of primers is at least 85% identical to a first sequence that is not more than 7 bases 5’ to a target base; ii) the second primer is at least 85% identical to a second sequence 5’ to the target base; andiii) the first primer is less than 100% reverse complementary to the first sequence and produces an artificial restriction enzyme recognition sequence in the amplicon, wherein at least one base reverse complementary to a base in the first primer mismatched with the first sequence.In some embodiments, the second primer is less than 100% identical to the second sequence. In some embodiments, the artificial restriction enzyme recognition sequence comprises at least one base reverse complementary to a base in the first primer mismatched with the first sequence and at least one base in the second primer mismatched with the second sequence.

[0142] In some embodiments, the restriction enzyme recognition site is produced in a region that comprises the first sequence and the target base / SNP. In some embodiments, the recognition site comprises the SNP and at least one base in the first primer that is mismatched with the first sequence. In some embodiments, the recognition site comprises the SNP and at least one base reverse complementary to a base in the first primer that is mismatched with the first sequence. In some embodiments, the recognition site comprises the SNP, at least one base in the first primer that is mismatched with the first sequence and at least one base reverse complementary to a base in the second primer that is mismatched with the second sequence. In some embodiments, the recognition site comprises the SNP, at least one base reverse complementary to a base in the first primer that is mismatched with the first sequence and at least one base in the second primer mismatched with the second sequence. In some embodiments, the recognition site is produced in the amplicon only when the SNP is present. In some embodiments, the recognition site is produced in the amplicon only when the target base is present. The method produces a recognition site that includes the target base / SNP and which is only present in the case where only one of the target base or SNP is present. That is the recognition site may be present when the SNP is present and absent when the target base is present or the recognition site may be present when the target base is present and absent when the SNP is present. Because the SNP may be present only on one allele it is generally better to produce the recognition site when the SNP is present. In this way cuttingwill occur when the SNP is present on one allele or on both alleles. If instead the recognition site is produced when the target base is present, then cutting will occur when the SNP is absent but also when the SNP is present on 1 allele. Thus, for SNP detection it is generally preferred that the recognition site includes the SNP and not includes the target base.

[0143] In some embodiments, the first primer comprises a first portion of the restriction enzyme recognition site. In some embodiments, a first sequence reverse complementary to the first primer comprises a first portion of the restriction enzyme recognition site. In some embodiments, a second sequence comprises a second portion of the restriction enzyme recognition site. In some embodiments, a second sequence consists of a second portion of the restriction enzyme recognition site. In some embodiments, the second primer comprises a third portion of the restriction enzyme recognition site. In some embodiments, a third sequence reverse complementary to the second primer comprises a third portion of the restriction enzyme recognition site. In some embodiments, the second sequence is directly adjacent to the first sequence. In some embodiments, the second sequence is directly 5’ to the first sequence. In some embodiments, the second sequence is directly 3’ to the first sequence. In some embodiments, the second sequence is directly adjacent to the third sequence. In some embodiments, the second sequence is directly 5’ to the third sequence. In some embodiments, the second sequence is directly 3’ to the first third. In some embodiments, the second sequence comprises the SNP. In some embodiments, the second sequence comprises the target base. In some embodiments the second sequence comprises the SNP or the target base. In some embodiments, the first portion and second portion together produce the recognition site. In some embodiments, the first portion, second portion and third portion together produce the recognition site. In some embodiments, when the second sequence comprises the SNP the first portion and second portion together produce the recognition site. In some embodiments, when the second sequence comprises the SNP the first portion, second portion and third portion together produce the recognition site. In some embodiments, when the second sequence comprises the target base the first portion and second portion together do not produce the recognition site. In some embodiments, when the second sequence comprises the target base the first portion, second portion and third portion together do not produce the recognition site. In some embodiments, when the second sequence comprises the target base the first portion and second portion together produce the recognition site. In some embodiments, when the second sequence comprises the target base the first portion, second portion and third portion together produce the recognition site. In some embodiments, when the second sequence comprises the SNP the first portion andsecond portion together do not produce the recognition site. In some embodiments, when the second sequence comprises the SNP the first portion, second portion and third portion together do not produce the recognition site. In some embodiments, the entire recognition site is not present in the first primer. In some embodiments, the entire recognition site is not present in the first sequence. It will be understood that the first primer contains a mismatch that produces in the amplicon one part of the recognition site. The second part of the recognition site, which when combined with the first part produces a full recognition site (or produces a full recognition site in combination with the third part), is present in the amplicon and includes the SNP / target base. This second part is only present in one case or the other, when the SNP is present or when the target base is present, but not both. Thus, the recognition site is produced in the amplicon only when either the SNP is present or the target base. Either way, cleavage will be informative as to what sequence is present. As discussed above, it is generally preferable that the recognition site be produced, and cleavage occur, when the SNP is present as this way the SNP can be detected even when it is present only on one allele (heterozygous SNP).

[0144] In some embodiments, the contacting occurs under conditions sufficient to produce cleavage. The conditions for cleavage by a restriction enzyme are well known and buffers for restriction enzyme cutting are commercially available. Thus, a skilled artisan can certainly produce the conditions for restriction enzyme cutting. Similarly, the conditions for cleavage by a CAS enzyme and a gRNA are also well known and the proper buffers can be purchased or produced.

[0145] In some embodiments, the CAS is CAS12. In some embodiments, CAS12 is CAS 12a. CRISPR-associated protein 12a (CAS 12a) is also known as Cpfl. The canonical PAM sequence for CAS12a is TTTV, which is disclosed in Nguyen et al., “CRISPR-Casl2a exhibits metal-dependent specificity switching”, Nucleic Acids Research, Volume 52, Issue 16, 9 September 2024, 9343-9359, the contents of which are hereby incorporated by reference in their entirety. In some embodiments, CAS12 is CAS12b. The canonical PAM sequence for CAS12b is TTN. In some embodiments, CAS12 is CAS12c. The canonical PAM sequence for CAS 12c is TG. In some embodiments, CAS 12 is CAS12e. The canonical PAM sequence for CAS12e is TTCN. In some embodiments, CAS 12 is CAS12f. The canonical PAM sequence for CAS12f is TTTR. In some embodiments, CAS12 is CAS12i. The canonical PAM sequence for CAS12i is TTN. In some embodiments, CAS12 is CAS 12k. The canonical PAM sequence for CAS 12k is GGTT. In some embodiments, CAS 12 is CAS12j. The canonical PAM sequence for CAS 12j is TTN. In some embodiments,CAS 12 is CAS 12m. The canonical PAM sequence for CAS 12m is TTN. In some embodiments, the CAS 12 is selected from CAS 12a, CAS 12b, CAS12e, CAS12f, CAS12i, CAS12j and CAS12m.

[0146] In some embodiments, the amplicon is contacted with the restriction enzyme. In some embodiments, the amplicon is contacted with the CAS 12. In some embodiments, the amplicon is contacted with a gRNA. In some embodiments, the amplicon is contacted with the CAS 12 and the gRNA. The guide RNA (gRNA) or CRISPR RNA (crRNA) is a short sequence of RNA that functions as a guide for the Cas-endonuclease. gRNAs can be as long as 25 bases but are usually about 20. The first 8 bases (from the 5 ’ end) line up just after the PAM and are called the seed region. Seed region hybridization is generally considered more important for accurate targeting of the Cas complex. In some embodiments, the gRNA is 100% identical to a second sequence. In some embodiments, the gRNA is 100% reverse complementary to a second sequence. In some embodiments, the second sequence is 3’ to the TRTV. In some embodiments, the second sequence is directly 3’ to the TRTV. In some embodiments, the second sequence comprises the complementary base to the target base. In some embodiments, the second sequence comprises the complementary base to the SNP. In some embodiments, the second sequence comprises the target base. In some embodiments, the second sequence comprises the SNP. In some embodiments, the gRNA comprises the SNP or the complementary base to the SNP and cleavage occurs in amplicons comprising the SNP and does not occur in amplicons comprising the target base. In some embodiments, the gRNA comprises the target base or the complementary base to the target base and cleavage occurs in amplicons comprising the target base and does not occur in amplicons comprising the SNP. In some embodiments, the gRNA comprises at least a mismatch at the target base. In some embodiments, the gRNA comprises at least a mismatch at the SNP. It will be understood that there can be additional mismatches in one of the cases so long as they are not present in the other case. That is, the gRNA must be able to 100% hybridize (100% identical or reverse complementary) with one of the amplicons (the SNP or target base amplicon). It will be understood that a mismatch in the gRNA when combined with the non-canonical PAM abrogates cleavage. Thus, when the gRNA hybridizes 100% (a perfect match) it generates cleavage. If the gRNA is designed to have 100% hybridization to the SNP, then cleavage will indicate the presence of the SNP. If the gRNA is designed to have 100% hybridization to the target base, then cleavage will indicate the presence of the target base. As discussed for restriction enzymes, as it may be valuable to detect the SNP even when it is heterozygous (only on one allele) it is generally preferable to design a gRNA with100% hybridization to the SNP rather than 100% hybridization to the target base. In some embodiments, the gRNA has a single base mismatch at the SNP or target base. Depending on the position of the PAM, the gRNA can be designed as identical to the second sequence or the reverse complement of the second sequence.

[0147] In some embodiments, the amplification and contact with the restriction enzyme are done in different containers. In some embodiments, the amplification and contact with the restriction enzyme are done in the same container. In some embodiments, the amplification and contact with the restriction enzyme are done sequentially. In some embodiments, the amplification and contact with the restriction enzyme are done simultaneously. In some embodiments, the amplification and contact with the CAS are done in different containers. In some embodiments, the amplification and contact with the CAS are done in the same container. In some embodiments, the amplification and contact with the CAS are done sequentially. In some embodiments, the amplification and contact with the CAS are done simultaneously. In some embodiments, step (a) and step (b) are done in different containers. In some embodiments, step (a) and step (b) are done in the same container. In some embodiments, step (a) and step (b) are done sequentially. In some embodiments, step (a) and step (b) are done simultaneously.

[0148] In some embodiments, the amplifying is with a third primer. In some embodiments, the third primer is a second forward primer. In some embodiments, the third primer is a second reverse primer. In some embodiments, the third primer is a second first primer. In some embodiments, the amplification is with a first primer and a second first primer. In some embodiments, the third primer is an intermediate primer. In some embodiments, the intermediate primer with the second primer produce an intermediate amplicon. In some embodiments, the intermediate amplicon does not comprise the restriction enzyme recognition site. In some embodiments, amplification with the intermediate first primer and the second primer does not produce the restriction enzyme recognition site. In some embodiments, the intermediate first primer comprises at least one fewer mismatch with the first sequence than the first primer. In some embodiments, the intermediate first primer is more reverse complementary (higher percent complementarity) to the first sequence that the first primer. In some embodiments, the intermediate first primer is more identical (higher percent identity) to the first sequence that the first primer. In some embodiments, the first intermediate primer is identical to the first primer except that it comprises at least one fewer mismatch with the first sequence. In some embodiments, at least one fewer is one fewer. Insome embodiments, a mismatch is a base that is not reverse complementary. In some embodiments, a mismatch is a base that is not identical.

[0149] In some embodiments, the first primer is present at a higher concentration than the intermediate first primer. In some embodiments, the ratio of first primer to intermediate first primer is greater than 1. In some embodiments, the ratio of first primer to intermediate first primer is greater than 1:1, 5:1 ,10:1, 40:1, 50:1, 60:1, 70:1, 75:1, 80:1, 90:1, 100:1, 110:1, 120:1, 125:1, 130:1, 140:1, 150:1, and 160:1. Each possibility represents a separate embodiment of the invention. In some embodiments, the ratio of the first primer to intermediate primer is greater than 10:1. In some embodiments, the ratio of the first primer to intermediate primer is at least 10:1. In some embodiments, the ratio of first primer to intermediate first primer is greater than 40:1. In some embodiments, the ratio of the first primer to intermediate primer is at least 40: 1. In some embodiments, the ratio of first primer to intermediate first primer is greater than 100: 1. In some embodiments, the ratio of the first primer to intermediate primer is at least 100: 1. In some embodiments, the ratio of first primer to intermediate first primer is greater than 160:1. In some embodiments, the ratio of first primer to intermediate first primer is less than 10000:1, 7000:1, 5000:1, 4500:1, 4000:1, 3500:1, 3000:1, 2560:1, 2500:1, 2000:1, 1750:1, 1500:1, 1250:1, 1000:1, 950:1, 900:1, 850:1, 800:1, 750:1, 700:1, 650:1, and 640:1. Each possibility represents a separate embodiment of the invention. In some embodiments, the ratio of first primer to intermediate first primer is less than 2560: 1. In some embodiments, the ratio of first primer to intermediate first primer is less than 5000: 1. In some embodiments, the ratio of first primer to intermediate first primer is less than 1000:1. In some embodiments, the ratio of first primer to intermediate first primer is less than 640: 1. In some embodiments, the ratio of first primer to intermediate first primer is between 2560:1 and 40:1. In some embodiments, the ratio of first primer to intermediate first primer is between 20:1 and 40:1. In some embodiments, the ratio of first primer to intermediate first primer is between 1000:1 and 40:1. In some embodiments, the ratio of first primer to intermediate first primer is between 640:1 and 40:1. In some embodiments, the ratio of first primer to intermediate first primer is between 2560:1 and 100: 1. In some embodiments, the ratio of first primer to intermediate first primer is between 20: 1 and 100: 1.In some embodiments, the ratio of first primer to intermediate first primer is between 1000:1 and 100:1. In some embodiments, the ratio of first primer to intermediate first primer is between 6100:1 and 100:1. In some embodiments, the ratio of first primer to intermediate first primer is between 2560:1 and 160:1. In some embodiments, the ratio of first primer to intermediate first primer is between 20:1 and 160:1. In some embodiments,the ratio of first primer to intermediate first primer is between 1000:1 and 160:1. In some embodiments, the ratio of first primer to intermediate first primer is between 640:1 and 160:1.

[0150] In some embodiments, the amplification and restriction / cutting are done in a single container. In some embodiments, the amplification and restriction / cutting are done in a single solution. In some embodiments, the amplification and incubating are done in a single container. In some embodiments, the amplification and incubating are done in a single solution. In some embodiments, the amplification and restriction / cutting / incubating are done in the loading area of a lateral flow device. In some embodiments, when the amplification and restriction / cutting / incubating are done together the restriction enzyme produces a 3’ overhang. In some embodiments, the restriction enzyme is a 3’ enzyme. Restriction enzymes that produce 3’ overhangs are less common than those that produce 5’ overhangs, but they are still known in the art. A list of such 3’ restriction enzymes are provided in Table 2 along with their recognition sequence and the overhang they produce. In some embodiments, the method does not comprise denaturing the enzyme. In some embodiments, the enzyme in the single solution or single container is not denatured.

[0151] Table 2: Restriction enzymes that produce a 3’ overhang and their recognition sites and overhangs. “A” indicates the cut site.

[0152] In some embodiments, the method is a method of detecting a plurality of target nucleic acid molecules. In some embodiments, the detecting is simultaneous detecting. In some embodiments, the method is a multiplex method. In some embodiments, an amplicon is amplified from each target molecule of the plurality to produce a plurality of amplicons. In some embodiments, the pair of primers for each target molecule is specific to the target molecule. Thus, each pair produces only their amplicon from their target molecule. In some embodiments, each amplicon of the plurality comprises a different restriction enzyme recognition sequence. In some embodiments, each amplicon of the plurality comprises a restriction enzyme target sequence of a unique restriction enzyme. Some enzymes have a degenerate target sequence, thus it is not enough that each recognition sequence be unique but the enzyme that will cut each sequence must also be unique. In some embodiments, each amplicon of the plurality comprises a target sequence of a different enzyme. In some embodiments, the contacting is contacting the plurality of amplicons with a plurality of restriction enzymes. In some embodiments, the plurality of enzymes cleaves the unique restriction enzyme recognition sequences. In some embodiments, a plurality of cleavage products is produced. In some embodiments, each cleavage product of the plurality comprises a unique single stranded overhang. In some embodiments, the providing comprises providing a plurality of adapters. In some embodiments, each adapter of the plurality comprises a unique overhang complementary to the unique overhang of a cleavage produce. In some embodiments, each adapter of the plurality comprises a unique second tag of a plurality of second tags. In some embodiments, each adapter of the plurality comprises a unique capture moiety of a plurality of capture moieties. In some embodiments, each adapter comprises a different second tag of the plurality. In some embodiments, each adapter comprises a different capture moiety of the plurality. In some embodiments, the incubating produces a plurality of ligation products. In some embodiments, applying is to a plurality of agents that bind the second tag or the first tag. In some embodiments, applying is to a plurality of capturing moieties. In some embodiments, the plurality comprises an agent that binds to each second tag of the plurality. In some embodiments, the plurality comprises acapturing moiety that binds to each capture moiety of the plurality. In some embodiments, the detecting is detecting the first tag in complex with at least two agents. In some embodiments, the detecting is simultaneously detecting the first tag in complex with at least two agents. In some embodiments, the detecting is detecting the first tag in complex with at least two capturing moieties. In some embodiments, the first tag is the other tag. In some embodiments, the detecting is simultaneous detecting of the first tag in complex with at least two capturing moieties. In some embodiments, the detecting is detecting the first tag in complex with the plurality of agents. In some embodiments, the detecting is detecting the first tag in complex with the plurality of capturing moieties. In some embodiments, the detecting is simultaneous detecting of the first tag in complex with the plurality of agents. In some embodiments, the detecting is simultaneous detecting of the first tag in complex with the plurality of capturing moieties. In some embodiments, the plurality of agents is immobilized at distinct locations on the lateral flow device. In some embodiments, the plurality of capturing moieties is immobilized at distinct locations on the lateral flow device. In some embodiments, each distinct location is a different line. In some embodiments, detection at each line indicates the presence of a different target molecule.

[0153] In some embodiments, cleavage is detected. In some embodiments, the method comprises assaying for cleavage of the nucleic acid molecules. In some embodiments, the method comprises measuring cleavage of the nucleic acid molecules. Methods of measuring cleavage of nucleic acids are well known in the art and any such method can be used. These include for example, gel electrophoresis, northern blotting, southern blotting, PCR, and sequencing. In some embodiments, detecting cleavage comprises determining the length of nucleic acid molecule produced after the contacting. In some embodiments, the length is the relative length as compared to before the contacting.

[0154] In some embodiments, cleavage indicates the presence of the SNP. In some embodiments, cleavage above a predetermined threshold indicates the presence of the SNP. In some embodiments, the absence of cleavage indicates absence of the SNP. In some embodiments, cleavage below a predetermined threshold indicates absence of the SNP. These embodiments are when the de novo recognition stie comprises the SNP or the gRNA comprises the SNP or the base complementary to the SNP. In some embodiments, cleavage indicates the presence of the target base. In some embodiments, cleavage above a predetermined threshold indicates the presence of the target base. In some embodiments, the absence of cleavage indicates absence of the target base. In some embodiments, cleavage below a predetermined threshold indicates absence of the target base. These embodimentsare when the de novo recognition site comprises the target base or the gRNA comprises the target base or the base complementary to the target base. In some embodiments, the second sequence comprises the complementary base to the SNP or the SNP and cleavage of the amplicon indicates the presence of the SNP and absence of cleavage of the amplicon indicates absence of the SNP. In some embodiments, the second sequence comprises the complementary base to the target base or the target base and cleavage of the amplicon indicates the presence of the target base and absence of cleavage of the amplicon indicates absence of the target base.

[0155] In some embodiments, the second primer of the primer pair is configured to amplify with the first primer. In some embodiments, the second primer of the primer pair is configured to produce an amplicon with the first primer. In some embodiments, the second primer of the primer pair is configured to amplify an amplicon that contains the target base or SNP. The selection of a second primer for a given first primer and a given amplification method is well known in the art. Further, programs and services are available for designing such second primers such as Primer3 and PrimedRPA. In some embodiments, the second primer does not comprise nor is it reverse complementary to the target base of SNP. The second primer’s primary role is to facilitate amplification. It may not be involved in conferring specificity or introducing mismatches and is merely there to pair with the first primer and produce amplification. Alternatively, such as in 2-sided mutagenesis, the second primer may introduce another change in the sequence (i.e., another mismatch) that is needed to produce the restriction enzyme recognition site.

[0156] In some embodiments, the first primer comprises a detectable moiety. In some embodiments, the second primer does not comprise the detectable moiety. In some embodiments, the first and second primer do not comprise the same detectable moiety. In some embodiments, the detectable moiety is detectable by eye. In some embodiments, the detectable moiety is a dye. In some embodiments, the detectable moiety is detectable in a reaction. In some embodiments, the detectable moiety is a ligand for a reaction that produces a signal. In some embodiments, the detectable moiety is a substrate for a reaction that produces a signal. In some embodiments, the reaction is a chemical reaction. In some embodiments, the reaction is a biological reaction. For example, horseradish peroxidase is able to oxidize a variety of substrates to produce a signal (e.g., color). Examples of such substrates include, but are not limited to, DAB, ABTS, AEC, AmplexRed, Homovanillic acid, Luminol, OPD and TMB. In some embodiments, the detectable moiety produces color in solution. In some embodiments, the detectable moiety is a nanoparticle. In someembodiments, the detectable moiety comprises gold. In some embodiments, the detectable moiety is a gold nanoparticle. In some embodiments, the detectable moiety is a fluorophore. In some embodiments, the detectable moiety is fluorescent. In some embodiments, the fluorophore is a fluorescent dye. Fluorophores are well known in the art and include for example, FITC, GFP, YFP, RFP, Cy5, Cy7, PerCP, Atto, PerCy5, PerCy7, BODIPY, Pacific Blue, PI, and the various Alexa fluor fluorophores to name but a few. Examples of potential fluorophores can be found for example at: thermofisher.com / il / en / home / life-science / cell-analy si s / fluorophores . html , ab cam . com / p s / pdf / protocol s / Fluorophore%20tabl e .pdf, and en.wikipedia.org / wiki / Fluorophore all of which are hereby incorporated herein by reference. It will be understood that fluorophores have a natural color which can be detected by eye but also can be excited by a laser and their fluorescence can also be detected. Each type of detectable signal may be used as part of the invention. In some embodiments, detecting the detectable moiety comprises contacting the detectable moiety with a labeled antibody. In some embodiments, contacting with the antibody is binding with the antibody. In some embodiments, the antibody is specific to the detectable moiety. In some embodiments, the detecting is detecting the label. In some embodiments, the label is a fluorophore. In some embodiments, the label is a separate detectable moiety. In some embodiments, the label is different than the detectable moiety. In some embodiments, detecting cleavage comprises detecting cleavage of the detectable moiety from the amplicon.

[0157] In some embodiments, the second primer comprises a capture moiety. As used herein, a “capture moiety” and “capturing moiety” are configured to bind to each other. In some embodiments, the capture moiety comprises biotin and the capturing moiety comprises avidin. In some embodiments, avidin is selected from streptavidin and neutravidin. Other examples of binding partners which can be the capture and capturing moieties include but are not limited to: MS2 and MS2 binding protein (MCP), antibody and antigen, aptamers and their binding target, and the like. In some embodiments, the capture moiety and capturing moiety bind covalently. Any binding pair known in the art may be used for the capture / capturing substrates. Such binding pairs are well known in the art. In some embodiments, the binding pair is not a nucleic acid sequence and its reverse complement. In some embodiments, the capturing moiety is a nucleic acid molecule reverse complementary to the sequence of the capture moiety. In some embodiments, the capturing moiety is perfectly complementary to the capture moiety. In some embodiments, the capturing moiety comprises at least 80, 85, 90, 92, 95, 97, 99 or 100% complementarity to the capture moiety. Each possibly represents a separate embodiment of the invention. In some embodiments, thecapturing moiety comprises at least 5, 7, 10, 12, 15, 17, 20 or 25 complementary bases to the capture moiety. Each possibility represents a separate embodiment of the invention.

[0158] Although it has been described hereinabove that the first primer comprises the detectable moiety and the second primer the capture moiety, the reverse is also envisioned. In some embodiments, the first primer comprises the capture moiety and the second primer comprises the detectable moiety. It must be that the two primers do not both comprise the capture moiety and do not both comprise the detectable moiety, but which comprises which is not essential. Because the cleavage will always occur very close to the first primer and generally far from the second primer (depending on how big the amplicon is) it can be advantageous to have the detectable moiety on the first primer. Large fragments of DNA need not be isolated, and the detectable moiety can be filtered from the capture complex by its small size. Finally, cleavage must occur near the first primer and this requires access for the CAS or restriction enzyme to the cut site. If the capturing moiety is a resin, bead or some other structure it may causes steric difficulty in the enzyme or CAS reaching the cut site. But if the capturing complex is attached at the second primer then the first primer and the cut site are much more accessible.

[0159] In some embodiments, the detecting comprises contacting the amplicon with a capturing moiety. In some embodiments, the detecting comprises contacting a solution comprising the amplicon with a capturing moiety. In some embodiments, the capturing moiety is configured to bind the capture moiety. In some embodiments, the capturing moiety comprises or is a physical support. In some embodiments, the physical support is a bead, resin or surface. In some embodiments, the physical support is ahead. In some embodiments, the bead is an avidin bead. In some embodiments, the bead is a magnetic or paramagnetic bead. In some embodiments, the contacting with a capturing moiety is before the contacting with the restriction enzyme. In some embodiments, the contacting with a capturing moiety is after the contacting with the restriction enzyme. In some embodiments, the contacting with a capturing moiety is before the contacting with the CAS12 and gRNA. In some embodiments, the contacting with a capturing moiety is after the contacting with the CAS 12 and gRNA.

[0160] In some embodiments, the detecting comprises isolating the capturing moiety. In some embodiments, the isolating is after contacting with the capturing moiety. In some embodiments, the detecting comprises isolating the capture moiety. In some embodiments, the isolating is isolating from the solution. In some embodiments, the isolating is isolating the capturing moiety and nucleic acid molecules bound thereto. In some embodiments, theisolating is isolating the capturing moiety and amplicon or a fragment thereof. In some embodiments, the isolating is done before the contacting with the restriction enzyme. In some embodiments, the isolating is done before the contacting with the CAS 12 and gRNA. In some embodiments, the restriction enzyme is contacted to the isolated capturing moiety and amplicon or fragments thereof bound to the capturing moiety. In some embodiments, the restriction enzyme is contacted to the isolated capturing moiety and nucleic acid molecules bound thereto. In some embodiments, the CAS 12 and gRNA are contacted to the isolated capturing moiety and amplicon or fragments thereof bound to the capturing moiety. In some embodiments, the CAS 12 and gRNA are contacted to the isolated capturing moiety and nucleic acid molecules bound thereto. In some embodiments, the supernatant from the isolated capturing moiety after contact with the restriction enzyme or CAS12 / gRNA is collected to produce a depleted solution.

[0161] In some embodiments, the isolating is done after the contacting with the restriction enzyme. In some embodiments, the isolating is done after the contacting with the CAS 12 and gRNA. In some embodiments, the isolating from the solution produces a depleted solution. In some embodiments, depleted is depleted of the capturing moiety. In some embodiments, depleted is depleted of the capture moiety. In some embodiments, the depleted solution comprises the detectable moiety. In some embodiments, the depleted solution retains the detectable moiety. In some embodiments, the depleted solution comprises the detectable moiety if cleavage occurred.

[0162] It will be understood by a skilled artisan that isolation of the amplicon can be performed before or after contact with the enzyme or CAS. If it is done first, then unreacted primers and other components of the original solution can be removed. The isolated material is then contacted with the enzyme or CAS and if cleavage occurs the detectable moiety will be freed from the capturing complex and released into solution where it can be detected. Alternatively, isolation can be performed after contact with the enzyme or CAS. In this case the detectable moiety is isolated as well if cleavage has not occurred, but when cleavage has already occurred the detectable moiety will remain in the solution and thus can be detected.

[0163] In some embodiments, the detecting further comprises detecting the detectable moiety. In some embodiments, detecting the detectable moiety is in the depleted solution. In some embodiments, the presence of the detectable moiety indicates cleavage of the amplicon. In some embodiments, the detecting the detectable moiety is in supernatant from the capturing complex. In some embodiments, the detecting the detectable moiety is after the capturing complex has been removed.

[0164] In some embodiments, the capturing moiety is conjugated to a support. In some embodiments, the support is a bead. In some embodiments, the support is a surface. In some embodiments, the surface is a surface of a microfluidic device. In some embodiments, the surface is a surface of a lateral flow device. In some embodiments, the contacting comprises loading the solution to the lateral flow device. In some embodiments, the detecting occurs at a test region of the lateral flow device. In some embodiments, the test region is downstream of the capturing moiety in the lateral flow device.

[0165] In some embodiments, the capturing moiety is conjugated to a support. In some embodiments, the support is a bead. In some embodiments, the support is a bulky molecule. In some embodiments, the bulky molecule is inert. In some embodiments, the bulky molecule is a bead. In some embodiments, the bulky molecule comprises avidin. In some embodiments, avidin is streptavidin. In some embodiments, the bulky molecule is any molecule too large to pass through the pores of a membrane. In some embodiments, the support comprises a dimension larger than a pore of a membrane. In some embodiments, the detectable moiety comprises a dimension smaller than a pore of the membrane. In some embodiments, the dimension is diameter. In some embodiments, the support can not pass through the membrane and the detectable moiety can pass through the membrane. In some embodiments, isolating comprises passing the solution through the membrane. In some embodiments, the passing is such that the capturing moiety stays on a first side of the membrane and the detectable moiety after cleavage passes to a second side of the membrane. In some embodiments, the detecting is detecting the detectable moiety on the second side of the membrane.

[0166] By another aspect, there is provided a method of designing a primer pair, the method comprising:a) identifying a target base in a region of a target nucleic acid molecule; b) selecting a first sequence 3’ to the target base in the target nucleic acid molecule;c) producing a sequence of a first primer that hybridizes to the first sequence with less than 100% reverse complementarity and comprises a TRTV sequence or a first portion of a TRTV sequence; and d) producing a sequence of a second primer capable of amplifying with the first primer the region of the target nucleic acid molecule;thereby producing a primer pair.

[0167] By another aspect, there is provided a method of designing a primer pair, the method comprising:a) identifying a target base in a region of a target nucleic acid molecule; b) determining a restriction enzyme recognition site that is not present in the region and wherein the restriction enzyme recognition site comprises at least a first portion that includes the target base or a SNP of the target base and a second portion that includes at least 1 mismatch to the region; c) selecting a first sequence 3’ to the target base in the target nucleic acid molecule;d) producing a sequence of a first primer that hybridizes to the first sequence with less than 100% reverse complementarity, and comprises the second portion of the restriction enzyme recognition site that comprises at least one mismatch with the first sequence;e) producing a sequence of a second primer capable of amplifying with the first primer the region of the target nucleic acid molecule;thereby producing a primer pair.

[0168] By another aspect, there is provided a method of designing a primer pair, the method comprising:a) identifying a target base in a region of a target nucleic acid molecule; b) determining a restriction enzyme recognition site that is not present in the region and wherein the restriction enzyme recognition site comprises at least a first portion that includes the target base or a SNP of the target base and a second portion that includes at least 1 mismatch to the region; c) selecting a first sequence 5’ to the target base in the target nucleic acid molecule;d) producing a sequence of a first primer that is at least 85% but less than 100% identical to the first sequence, and comprises the second portion of the restriction enzyme recognition site that comprises at least one mismatch with the first sequence;e) producing a sequence of a second primer capable of amplifying with the first primer the region of the target nucleic acid molecule;thereby producing a primer pair.

[0169] In some embodiments, the first primer and the second primer are the primer pair. In some embodiments, the produced first primer and the produced second primer are the primer pair. In some embodiments, the SNP is a SNP of a target base. In some embodiments, a SNP of the target base is known. In some embodiments, a SNP of the target base is suspected. In some embodiments, there is a putative SNP of the target base. In some embodiments, detecting a DNA molecule in a sample is detecting a DNA molecule comprising the SNP in the sample. In some embodiments, the method of detecting a SNP comprising performing a method of detecting a nucleic acid molecule of the invention. In some embodiments, the method of detecting a SNP comprising performing a method of detecting a target nucleic acid molecule of the invention. In some embodiments, the primer pair are for use in detecting a SNP of the target base. In some embodiments, the primer pair are for use in performing a method of the invention.

[0170] In some embodiments, the TRTV sequence comprises at least one mismatch with the first sequence. In some embodiments, the TRTV sequence comprises 1-3 mismatches with the first sequence. In some embodiments, the TRTV sequence comprises one or two mismatches with the first sequence. In some embodiments, the TRTV sequence comprises one mismatch with the first sequence. In some embodiments, the first portion of the TRVT comprises at least one mismatch with the first sequence. In some embodiments, the first portion of the TRTV sequence comprises 1-3 mismatches with the first sequence. In some embodiments, the first portion of the TRTV sequence comprises one or two mismatches with the first sequence. In some embodiments, the first portion of the TRTV sequence comprises one mismatch with the first sequence.

[0171] In some embodiments, a second portion of the TRTV is a reverse complement of a sequence directly adjacent to the first sequence. In some embodiments, adjacent is 5’ to. In some embodiments, adjacent is 3’ to. In some embodiments, a full TRTV sequence is produced by the first portion and the second portion. In some embodiments, joining the first portion and the second portion produces a full TRTV sequence. In some embodiments, the full TRTV sequence is produced when the primer hybridizes and amplifies. In some embodiments, the full TRTV sequence is produced when the primer hybridizes and is extended.

[0172] In some embodiments, the TRTV sequence is not more than 30, 28, 25, 22, 20, 18, 16, 15, 14, 12, 10, 8, 7, 6, 5, 4, 3, 2 or 1 base 5’ to the complementary base to the target base or SNP when hybridized to the first sequence. Each possibility represents a separate embodiment of the invention. In some embodiments, the TRTV sequence is not more than 30, 28, 25, 22, 20, 18, 16, 15, 14, 12, 10, 8, 7, 6, 5, 4, 3, 2 or 1 base 5’ to the target base or SNP when hybridized to the first sequence. Each possibility represents a separate embodiment of the invention.

[0173] In some embodiments, the restriction enzyme recognition site comprises a first portion that includes the target base or a SNP of the target base, a second portion 3’ to the target base or SNP of the target base that includes at least 1 mismatch to the region and a third portion 5’ to the target base or SNP of the target base that includes at least 1 mismatch to the region. In some embodiments, the method further comprises selecting a second sequence 5’ to the target base in the target nucleic acid molecule. In some embodiments, producing a sequence of a second primer comprises producing a sequence that is less than 100% identical to the second sequence and comprises a third portion of the restriction enzyme recognition site. In some embodiments, the third portion comprises at least one mismatch with the second sequence.

[0174] In some embodiments, when the first primer is hybridized to the first sequence the first portion is adjacent to the second portion. In some embodiments, the first portion adjacent to the second portion produces the recognition site. In some embodiments, hybridization of the first primer produces the recognition site. In some embodiments, when the second primer is hybridized to a sequence reverse complementary to the second sequence the third portion is adjacent to the second portion. In some embodiments, the first portion adjacent to the second portion which is adjacent to the third portion produces the recognition site. In some embodiments, hybridization of the first primer and second primer produces the recognition site. In some embodiments, hybridization is hybridization and elongation. In some embodiments, hybridization is hybridization and amplification. In some embodiments, the recognition site is produced in the amplicon. In some embodiments, the restriction enzyme recognition site comprises a mismatch to the region. In some embodiments, the recognition site comprises 1 or more mismatches to the region comprising the target base as to the region comprising the SNP. In some embodiments, the recognition site comprises 1 or more mismatches to the region comprising the SNP as to the region comprising the target base. In some embodiments, 1 or more is 2. In some embodiments, 1 or more is 2 or more. In some embodiments, at least one mismatch is 5’ to the SNP or target base and at least onemismatch is 3; to the SNP or target base. It will be understood that the site will only be produced in one instance and not the other, and so there will be 1 more mismatch with the region that contains the sequence that will not be cleaved. In some embodiments, the recognition site comprises 1 or 2 mismatches with the region comprising the SNP and comprises 2 or 3 mismatches with the region comprising the target base. In some embodiments, the recognition site comprises 1 mismatch with the region comprising the SNP and comprises 2 mismatches with the region comprising the target base. In some embodiments, the recognition site comprises 2 mismatches with the region comprising the SNP and comprises 3 mismatches with the region comprising the target base.

[0175] In some embodiments, step (b) comprises determining a restriction enzyme recognition site that can be produced by mutating bases in the region. In some embodiments, step (b) comprises determining a restriction enzyme recognition site that can be produced by mutating bases around the SNP. In some embodiments, around is 5’, 3’ or both 5’ and 3’. In some embodiments, step (b) comprises determining that the restriction enzyme recognition site is not produced when mutating the bases around the target base. In some embodiments, step (b) comprises determining that the restriction enzyme recognition site is produced when mutating bases round the SNP, but not produced when mutating the same bases around the target base.

[0176] In some embodiments, step (d) comprises producing a sequence of the first primer that when used to amplify an amplicon comprising the SNP mutates bases around the SNP to produce the recognition site in the amplicon. In some embodiments, step (d) comprises producing a sequence of the first primer that when used to amplify an amplicon comprising the target base mutates bases around the target base to produce the recognition site in the amplicon. In some embodiments, the amplicon is of the region. In some embodiments, the amplicon comprises the region. In some embodiments, around is 5’, 3’ or both 5’ and 3’. In some embodiments, around is directly adjacent to.

[0177] As used herein, the term "about" when combined with a value refers to plus and minus 10% of the reference value. For example, a length of about 1000 nanometers (nm) refers to a length of 1000 nm+- 100 nm.

[0178] It is noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the polypeptide" includes reference to one or more polypeptides andequivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

[0179] In those instances where a convention analogous to "at least one of A, B, and C, etc." is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., "a system having at least one of A, B, and C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B."

[0180] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

[0181] As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents, unless the context clearly dictates otherwise. The terms “a” (or “an”) as well as the terms “one or more” and “at least one” can be used interchangeably.

[0182] Furthermore, “and / or” is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” is intended to include A and B, A or B, A (alone), and B (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intendedto include A, B, and C; A, B, or C; A or B; A or C; B or C; A and B; A and C; B and C; A (alone); B (alone); and C (alone).

[0183] Wherever embodiments are described with the language “comprising,” otherwise analogous embodiments described in terms of “consisting of’ and / or “consisting essentially of’ are included.

[0184] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

[0185] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.EXAMPLES

[0186] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference. Other general references are provided throughout this document.Example 1: 2-step verification of a sequence

[0187] Amplification based methods of nucleic acid identification are very well known in the art, but when a single base pair change (a single nucleotide polymorphism or SNP) must be detected, the level of specificity provided by amplification alone is usually not sufficient. Further, even when primers are carefully designed, off target amplification can still occur. Thus, a 2-step verification method was designed that allows for rapid and more accurate nucleic acid sequence identification. The method relies on a first step of amplification followed by a second step of sequence specific cleavage and ligation.

[0188] Amplification: In the first step, a primer pair is designed to target and amplify a target region containing the mutation / polymorphism. One primer is modified with a detectable tag (e.g., a FITC moiety) and the other is designed to install / create a de novo restriction enzyme recognition sequence. The restriction enzyme recognition sequence is generated in part from the point mutation base and in part by the mutagenesis process (i.e., by an alteration produced by the primer). It is important that the recognition sequence is not already present within the amplified sequence, so that cleavage only occurs when the recognition sequence is produced by the primer mutagenesis and the SNP. While RPA, an isothermal amplification approach, was used for amplification, other amplification methods can also be used, such as PCR.

[0189] Restriction: After a de novo restriction enzyme recognition site is produced the restriction enzyme is added and a sticky end is made at the end opposite to the tag.

[0190] Ligation: An adapter and a ligase are introduced to the reaction. The adapter is a double-stranded DNA molecule with a matching overhang to the sticky end produced by the restriction enzyme. Biotin or another capturing moiety is conjugated to the non-overhang end of the adapter (the end not involved in the ligation). At the base immediately before the single-stranded DNA overhang (the last double stranded base of the adapter), a “protection base” is placed. This nucleotide is chosen so as to not reform the restriction enzyme recognition site and avoid a new cleavage of the ligation product. The protection base can be any base that does not recreate the original recognition site. This protection base abrogates the need to remove the enzyme from the reaction, since the ligation product cannot be cleaved. The ligase glues together the capture moiety comprising (biotinylated) adapter and the tag (FITC)-modified amplicon to form a single dsDNA molecule with a capture moiety at one end and a tag at the other. The successful formation of this product indicates both the amplification of the desired region, and the sequence specific cleavage by the restriction enzyme has occurred.Example 2: Readout of the produced molecule

[0191] The molecule produced by this novel restriction-ligation method can be easily detected by visual readout using a lateral flow device (i.e., a strip). Fluorescent detection after capture of the capturing moiety is also envisioned.

[0192] A lateral flow strip was produced with gold nanoparticles (AuNPs) conjugated to Sheep anti-FITC antibodies for detection. The test line is made of streptavidin because it will only capture molecules that underwent successful amplification, cleavage and ligation. The control line is immobilized anti-Sheep antibodies and will bind the sheep anti-FITC antibodies used. Since the detecting molecule (AuNPs conjugated anti-FITC antibody) recognizes FITC, only a molecule with both biotin and FITC will form a visible test line indicating the positive presence of the sequence being investigated.

[0193] As a proof of concept, the S91F mutation within Neisseria gonorrhoeae was used for assessing SNP detection. Neisseria gonorrhoeae (N. gonorrhoeae) is a gram-negative diplococcus bacterium responsible for the sexually transmitted infection gonorrhea. The first line treatment for gonorrhea has been ciprofloxacin (cipro), however, the emergence of resistant strains of the bacteria has led to use of ceftriaxone or ceftriaxone with azithromycin as a treatment. About 35% of all gonorrhea infections in the US are cipro-resistant. Ciprofloxacin and ceftriaxone are both broad-spectrum antibiotics; however, cipro can be administered orally, while ceftriaxone must be injected. Further, as a generic form of cipro is available it is significantly cheaper than ceftriaxone. Finally, the broad use of ceftriaxone risks the development of newly multidrug resistant forms of gonorrhea, and indeed several cases have been reported in recent years. As such, it is vitally important to be able to quickly determine if a subject suffering from gonorrhea is resistant to cipro. The most common cirpo-resistant mutations in gonorrhea are in the gyrA gene. Specifically, the double mutations S91F / D95A and S91F / D95G are both known to result in a high likelihood of cipro-resistant gonorrhea. However, as the S91F mutation has not been reported by itself (without mutation of D95), it is sufficient to just detect the “c” to “f ’ mutation at position 272 (c272t) that causes the serine to phenylamine change.

[0194] The gyrA sequence and specifically the c272t mutation that produces the S91F mutation was scanned for a restriction enzyme site that could be synthetically generated, and which would include the “T” of the mutant. The restriction site was created de novo during the amplification by using a primer with a mismatch. The mismatch in combination with the mutant “T” would produce a de novo restriction site within the amplicon (Fig. 1A). Thisrestriction site would not be present in the WT amplicon due to the presence of the WT “C” (Fig. IB)

[0195] The c272t mutation produces a sequence GATTTCGCAG (SEQ ID NO: 7) with the underlined T being the mutant base. A search for a restriction enzyme recognition site similar to this sequence and including the mutant T produced EcoRI. The EcoRI recognition site is the palindrome GAATTC. In order to produce this sequence, the T (base 270) in the gyrA sequence must be converted to A. In the mutant sequence such a conversion would produce an EcoRI recognition site, while in the WT sequence it would produce GAATCC which would not be recognized by the enzyme. Further, an amplicon can be produced in which there is not an EcoRI site already present. A Forward primer and Reverse primer were designed to produce this amplicon via RPA. The Forward primer (catcggtaaataccaccccacggcgaat; SEQ ID NO: 14, underlined and bolded bases are mismatches) was unconjugated and the Reverse primer (gaagttgccctgtccgtctatcagcacataac;SEQ ID NO: 10) was conjugated to FITC (Fig. 2A). The resulting amplicon has a single EcoRI recognition site near the unlabeled end and a FITC label at the distal end (Fig. 2B).

[0196] Addition of the EcoRI enzyme results in cleavage just after the G in the EcoRI recognition site and a 5’ overhang of AATT. A biotinylated double stranded DNA adapter was added to the reaction with a 5’ TTAA overhang such that it has a matching end to the cleaved amplicon (Fig. 2C). A protection “T” base was placed at the 3’ end of the nonoverhang strand of the adapter such that after ligation, the sequence TAATTC is produced which is not recognized by EcoRI. Addition of ligase produces a ligation product labeled at one end with biotin and at the other end with FITC (Fig. 2D). This was then run on a lateral flow strip as described herein above (Fig. 2E). The biotin end of the ligation product is captured at the test line and the molecule is visualized with the anti-FITC AuNPs. The antisheep antibodies at the control line capture the anti-FITC AuNPs as well resulting in a positive control line.

[0197] This procedure was run with a synthetic dsDNA fragment (gBlock, IDT) containing WT gyrA and gyrA containing the S91F (c272t) mutation. Amplification was carried out by RPA. Amplicon was cut, ligated and then run on a flow device. When WT DNA was used, only the control line was visible, while the test line was clearly visible when the mutant DNA was used (Fig. 3A). The assay was repeated using PCR and the same result was observed (Fig. 3B)

[0198] An EcoRI site was also generated in an amplicon from the DR9 region of the Neisseria gonorrhea (NG) genome (SEQ ID NO: 33). The Forward primer (cgtcaacatcttctacggtttatctaatctgcgaa; SEQ ID NO: 31, underlined and bolded bases are mismatches) was unconjugated and the Reverse primer (gaagcacaaatccccgccgaatttatgcgt; SEQ ID NO: 32) was conjugated to FITC. The DR9 region is commonly used for NG detection and there are multiple repeats of the region in the NG genome. The amplicon was easily detectable when NG DNA was added (Fig.3C). Moreover, the NG target DNA could be detected in urine samples (Fig. 3D) and vaginal swabs (Fig. 3E) from subjects suffering from gonorrhea. This indicates that the methodology can work in practice with samples with low starting levels of DNA.

[0199] As an alternative detection method to a lateral flow device, the final fluorescent product was also immobilized on magnetic beads (via the biotin and fluorescent signal was detected with a fluorescent plate reader Fluorescence was only detected from sample containing the target DNA (Fig. 3F).Example 3: All-in-one procedure

[0200] The procedure is designed such that it can be performed all together in one container, with the reagents for RPA, restriction and ligation all present at the same time. However, when this was attempted without cleanup or isolation between steps, but with all reagents added from the beginning, detection of the mutant did not occur (Fig. 4A, left). No test line was observed as had been the case when the steps were performed sequentially (Fig. 3A).Unexpectedly, when a 3-minute denaturing step at 95° was included after the RPA at 37° the assay was functional (Fig. 4B, right). This indicates that there is an RPA enzyme that is interfering with the downstream restriction-ligation. Inactivation of this enzyme by raising the temperature allows the restriction and ligation to proceed.

[0201] In order to determine which enzyme was responsible, isolated amplification product was incubated with the restriction enzyme, ligase and adapter in the presence of each enzyme from RPA separately (Fig. 4B). The addition of polymerase to the reaction was found to abolish the restriction-ligation reaction. It was therefore concluded that the polymerase acted on the overhangs of both the cleaved amplicon and the adapter and its binding (and possible induced elongation) inhibited ligation.

[0202] Polymerase is known to bind single stranded DNA with a free 5’ end in order to facilitate elongation. Therefore, to overcome the polymerase interference, a restriction enzyme that produces a 3’ overhang was selected for testing. A 3’ overhang should beinaccessible to the polymerase. The protocol was redesigned to produce the SacI binding site (GAGCTC). SacI cuts after the first “G” base and produces a 3’ overhang. In order to produce this sequence, the TT (bases 270-271) in the gyrA sequence must be converted to GC. In the mutant sequence such a conversion would produce the SacI recognition site, while in the WT sequence it would produce GAGCCC which would not be recognized by the enzyme. Further, an amplicon can be produced in which there is not a SacI site already present.

[0203] An all-in-one RPA-cleavage-ligation procedure was run at 37° without a denaturation step using the SacI enzyme. The use of an enzyme that produced a 3 ’ overhang abrogated the polymerase interference, and a band was clearly visible at the test line location, indicating the presence of the mutation (Fig.4C). There are a limited number of 3 ’ overhangproducing restriction enzymes, but in most cases one of the recognition sites for these enzymes can be created with the SNP base via amplification-based mutagenesis, thus allowing for all-in-one performance of the assay.

[0204] The all-in-one protocol was also tested with an endogenous restriction site. A sequence within the PanD gene from NG contains an endogenous Pstl site. Pstl binds to the sequence CTGCAG and produces a 3’ overhang. The RPA reaction to amplify the sequence (Forward primer- tcggaaagttggatataagacataatga-SEQ ID NO: 28; Reverse primer-gccgatttaaactacgtcggcagcattac-SEQ ID NO: 29 conjugated to FITC) and add the FITC tag was performed in a single container with the Pstl enzyme, the biotinylated probe and the ligase. Samples bearing this DNA sequence (SEQ ID NO: 30) showed a positive signal at the test line, while samples negative for this DNA did not (Fig. 4D).

[0205] A direct comparison of a 5’ overhang producing enzyme and a 3’ overhang producing enzyme used in the all-in-one procedure was also conducted in NG. The endogenous Pstl site was directly compared to the engineered ECORI site. As can be seen in Figure 4E only the 3’ overhang producing enzyme generated a signal in the all-in-one procedure.Example 4: Determining the limit of detection of the assay

[0206] In order to determine the limit of detection of the assay primers were selected for amplifying a fragment from the 23S-rRNA region of the chlamydia genome (forward primer-ggtcttaacaagctgggaatct-SEQ ID NO: 34; reverse primer-ctatcttatacctttacgctctactcg-SEQ ID NO: 35). The amplicon contains one endogenous Hindlll site which was used for cutting and adapter ligation. Genomic DNA from chlamydia was diluted in 50 ul simulated vaginal fluid (SVF) such that the following numbers of copies of the genome were tested fordetection: 1,000, 500, 250, 125, and 62 copies. A no-template control was also detected. A clear positive band could be detected even when only 62 copies of the genome were used (Fig. 5A). The target sensitivity of the assay is 5000 / copies per ml. The tested number of copies are equivalent to 1,240, 2,500, 5,000, 10,000 and 20,000 copies per ml. It is readily apparent that the assay has acceptable detection at the target sensitivity (Fig. 5B).Example 5: Multiplexed detection

[0207] This setup for labeling and detection easily lends itself to multiplexing. This can be achieved by producing different restriction enzyme recognition sequences at different DNA locations (i.e., SNPs) and then labeling the adapter uniquely to each cut site with a different capture moiety (e.g., biotin and digoxin). The lateral flow strip can then have multiple test lines, each one containing immobilized capturing molecules specific to the different capture moieties (e.g., streptavidin and anti-digoxin antibody). Each adapter is designed with an enzyme-specific overhang and a unique oligo sequence to avoid pairing with adapters of different enzymes. The adapter also guides the amplicon to the relevant test line by having a unique binding molecule on each barcode (i.e., the capture moiety). This principle can be applied to a larger number of targets using a lateral flow strip with additional unique test lines and enzymes.

[0208] As a proof of concept, both gonorrhea (porA gene) and ciprofloxacin resistance (S91F mutation) were simultaneously detected on a single lateral flow strip. A SacI cut site was produced at the S91F mutation as described above and an EcoRI cut site was produced in the porA gene. In this experiment the PCR amplification was done separately for each target. Later, the restriction-ligation was done the same way for each group. Three conditions were tested with all enzymes (SacI and EcoRI) and adapters present: having only porA, only S91F or both targets in the reaction. As can be seen in Figure 6, the procedure was highly specific, producing the expected test lines for all conditions. RPA amplification is performed in a multiplex all-in-one experiment with 2 3’ overhang producing enzymes. This result demonstrates the specificity of the system and its potential to reduce elements and simplify the diagnostics product.Example 6: Standard CRISPR cannot differentiate a WT sequence from one containing a SNP

[0209] Neisseria gonorrhoeae (N. gonorrhoeae) is a gram-negative diplococcus bacterium responsible for the sexually transmitted infection gonorrhea. This pathogen primarily infects the mucous membranes of the reproductive tract, but it can also affect the mucousmembranes of the mouth, throat, eyes, and rectum. It has been reported that over 87 million new cases are diagnosed each year globally. The first line treatment for gonorrhea has been ciprofloxacin (cipro), however, the emergence of resistant strains of the bacteria has led to use of ceftriaxone or ceftriaxone with azithromycin as a treatment. About 35% of all gonorrhea infections in the US are cipro. resistant. Ciprofloxacin and ceftriaxone are both broad-spectrum antibiotics however, cipro can be administered orally, while ceftriaxone must be injected. Further, as a generic form of cipro is available it is significantly cheaper than ceftriaxone. Finally, the broad use of ceftriaxone risks the development of newly multidrug resistant forms of gonorrhea, and indeed several cases have been reported in recent years. As such, it is vitally important to be able to quickly determine if a subject suffering from gonorrhea is resistant to cipro.

[0210] The most common ciprofloxacin-resistant mutations in gonorrhea are in the gyrA gene. Specifically, the double mutations S91F / D95A and S91F / D95G are both known to result in resistant gonorrhea. It is generally sufficient to identify the D95 mutation in order to determine resistance, as the S91F mutation has not been reported by itself. One suggested method for rapid identification of a point mutation in a sample is to use CRISPR to cleave a target DNA / RNA molecule when the mutation is present. To test the use of CRISPR cleavage for SNP detection a test was carried out with 4 different DNA templates (synthetic DNA gene fragments, gBlocks from IDT), 1) a wild type gyrA, 2) gyrA with a S91F mutation, 3) gyrA with a S91F and D95A mutation and 4) gyrA with a S91F and D95G mutation. Each DNA was labeled with a FITC and incubated with LbCAS12a (IDT) with one of four guide RNAs (gRNAs). CAS 12 produces collateral cleavage of single stranded DNA (ssDNA) once it recognizes its target. To this end, a fluorescent ssDNA probe (Quencher-ssDNA-Fluorophore - 56-FAM / TTATTATT / 3BHQ 1) was added. The gRNAs were 100% reverse complementary to the wild type gyrA sequence, the S91F sequence, the S91F and D95A sequence and the S91F and D95G sequence. If CRISPR had the sensitivity to distinguish between single nucleotide differences, then one would expect cleavage and thus fluorescent detection to occur only when the gRNA was incubated with DNA with perfect complementarity. However, as can be seen in Figure 7, this was not the case. All CAS-gRNA complexes (RNPs) were able to induce collateral cleavage of the DNA probe in the presence of all the DNAs, indicating that 1 or even 2 mismatches in the gRNA did not inhibit cleavage. A scrambled gRNA was used as a negative control and did not produce significant fluorescence. These results show that CRISPR does not have the capability to distinguish point mutations based solely on mismatches in the gRNA.Example 7: PAMin allows for CRISPR based detection of SNPs

[0211] A technique called PAM-in was created in order to provide the necessary specificity to CRISPR such that single nucleotide polymorphisms (SNPs) could be detected. The technique is based on the low dependence of CAS 12 enzymes on their canonical PAM sequence (TTTV). It has been found that single mismatches within the PAM did not greatly inhibit cutting by the enzyme. Even double mismatches, one in the PAM and one in the gRNA, did not greatly inhibit cutting, except when the mismatch was at position -3 in the PAM. When the PAM was TRTV and the gRNA was a perfect match cutting occurred (Fig.12A), but when the PAM was TRTV and the gRNA contained even a single mismatch cleavage was greatly inhibited (Fig. 12B).

[0212] This feature of CAS12 enzymes was exploited to identify SNPs and was exemplified with the D95G mutation in gyrA. The D95G mutation is caused by an “a” to “g” mutation of the second base of codon 95 (a284g). The guide RNA (gRNA) for CRISPR cleaving of this sequence was designed to bind the forward strand and thus would span base 284 as well as base 272 which is the cause of the S91F mutation (“c” to “t” mutation, c272t). Since the forward strand is targeted, the sequence on the reverse strand 5’ to the G mutation’s counterpart C base was scanned for a sequence that could be converted into a non-canonical PAM of the sequence TRTV. The sequence GGTG is directly 5’ to the mutant C base and mutation of the first G to T produces the desired non-canonical PAM (TGTG) (Fig. 8).Primers were designed for amplifying the gyrA locus including the possible mutation site (nucleotide 284). The Forward primer began near the start of the gyrA sequence (gacgcaaccatccgccacgaccacaaattc; SEQ ID NO: 1) and was a perfect match for the gene. The Reverse primer was placed so that it did not overlap with base 284 but rather was reverse complementary to the sequence just 3’ to it. Further the Reverse primer had a single mismatch of a T instead of G such that upon amplification the sequence TGTG would be produced on the reverse strand (gcgaaattttgcgccatacggacgattgtg; SEQ ID NO: 2, the underlined and bolded “t” is the mismatch to the gyrA sequence). The gRNA directly followed the reverse primer and included the sequence reverse complementary to the A284G and C272T mutant sequence (ccgtaaactgcgaaatcgccg; SEQ ID NO: 3, underlined and bolded bases are mismatches for the WT sequence and matches for the mutant sequence) and which had two mismatches to the WT sequence.

[0213] RPA isothermal amplification was performed with the forward and reverse primers on synthetic double-stranded DNA gene fragments containing the WT sequence, a sequencewith just the S91F mutation and a sequence with the D95G and S91F mutations. This resulted in amplicons with a non-canonical PAM just after base 284. A control amplification was also performed with a Reverse primer that was a perfect match to the gyrA sequence (gcgaaattttgcgccatacggacgatggtg; SEQ ID NO: 4, the underlined and bolded base is the difference with SEQ ID NO: 2) resulting in an amplicon with no PAM after base 284. CAS 12 and the gRNA were then added, and cleavage was monitored by the DETECTR assay. As expected, in the no-PAM control no cleavage was observed and the result was indistinguishable from the control without a probe (Fig. 9A). Importantly, even when the non-canonical PAM was generated, the WT template and the template with the S91F mutation but not the D95G mutation did not produce substantial cleavage even after 45 minutes. Only a very low background cutting was observed and even that only became observable after 30 minutes of incubation. That is, the combination of the non-canonical PAM and a single mismatch in the gRNA essentially abolished CAS 12 activity. In contrast, when the D95G mutation was present, resulting in a perfectly matched gRNA and a non-canonical PAM, robust signal was observed (Fig. 9A). This signal was clearly detectable as early as 16 minutes into the incubation and reached a plateau by about 37 minutes. At only 18 minutes the level of cleavage was already higher than the background cleavage produced in the absence of the D95G mutation.

[0214] A second non-canonical PAM, TATC, was also tested. A de novo TATC PAM was generated 5 base pairs 5’ to the SNP base and amplification, CAS 12 cutting and detection were performed as before. As before, when the SNP was present, resulting in a perfectly matched gRNA, robust signal was observed (Fig. 9B). When the WT base was present, resulting in a single mismatch with the gRNA, no signal was observed.

[0215] Taken together this data indicates that the generation of a non-canonical PAM (TRTV) allows for the use of CRISPR to detect even SNPs with a high level of fidelity. This is because the non-canonical PAM alone still produces robust cleavage so long as the gRNA is a perfect match, however, when a mismatch is present in the gRNA (especially when it is in the seed region), its combination with the non-canonical PAM abolishes cleavage. This is only possible because with a canonical PAM, mutations in the gRNA are tolerated and specifically the non-canonical TRTV sequence is a functional PAM when the gRNA is a perfect match. Thus, PAMin is a viable technique for SNP detection.Example 8: Restriction enzyme based detection of SNPs

[0216] An alternative technique for detecting SNPs that does not make use of CRISPR was also tested. Mutations within gyrA were again used as a proof of concept. The gyrA sequence and specifically the c272t mutation that produces the S91F mutation was scanned for a restriction enzyme site that could be synthetically generated and which would include the “T” of the mutant. As with the non-canonical PAM, the restriction site would be created de novo during the amplification by using a primer with a mismatch. The mismatch in combination with the mutant “T” would produce a de novo restriction site within the amplicon (Fig. 13A). This restriction site would not be present in the WT amplicon due to the presence of the WT “C” (Fig. 13B). It was also essential that the restriction site would not be present already somewhere else in the amplicon.

[0217] The c272t mutation produces a sequence GATTTCGCAG (SEQ ID NO: 7) with the underlined T being the mutant base. A search for a restriction enzyme recognition site similar to this sequence and including the mutant T produced Nrul. The Nrul recognition site is the palindrome TCGCGA. In order to produce this sequence, the AG (bases 276-277) in the gyrA sequence must be converted to GA. In the mutant sequence such a conversion would produce the Nrul recognition site, while in the WT sequence it would produce CCGCGA which would not be recognized by the enzyme. Further, there is no Nrul site already present in gyrA. A new Forward primer and Reverse primer were designed, and this time a shorter amplicon was produced by RPA. The Forward primer (ctaaagccggtgcaccggcgcgtactgtac; SEQ ID NO: 5) was conjugated to biotin and the Reverse primer (cgccatacggacgatggtgtcgtaaatcgcg; SEQ ID NO: 6, underlined and bolded bases are mismatches) was conjugated to FITC for easy detection after cleavage (Fig. 10). Since the reverse primer had two mismatches in a row, it was important that they were not at the very 3’ end of the molecule, as this would have reduced fidelity of the primer and led to incorrect or absent amplification.

[0218] RPA amplification was performed with a WT template and one bearing the c272t mutation. The resulting amplicons were incubated with Nrul enzyme followed by removal of uncut molecules with magnetic streptavidin beads. The supernatant was measured using a plate reader for FITC, although many possibilities exist for the detecting mechanism (a lateral flow detection mechanism for example. A positive FITC signal was detected from the S91F (c272t) template, while the WT sequence produced no detectable cleavage (Fig. 12).This demonstrates that the de novo production of a sequence specific restriction enzyme site is also a viable methodology for SNP detection.

[0219] A similar identification was performed for the S91F mutation but using an alteration made 5’ to the SNP. The search for a restriction enzyme recognition site similar to SEQ ID NO: 7 and including the mutant T also produced Sacl. The SacI recognition site is the palindrome GAGCTC. In order to produce this sequence, the TT (bases 270-271) in the gyrA sequence must be converted to GC. In the mutant sequence such a conversion would produce the Sacl recognition site, while in the WT sequence it would produce GAGCCC which would not be recognized by the enzyme. Further, there is no Sacl site already present in the amplicon. A new Forward primer (ggcgacgtcatcggtaaataccacccccacggcgagc; SEQ ID NO: 9, underlined and bolded bases are mismatches) and Reverse primer (gaagttgccctgtccgtctatcagcacataac; SEQ ID NO: 10) were designed, and the amplicon was produced by RPA (Fig. 12A). Following RPA the Sacl enzyme was added.

[0220] For the purposes of detection, a lateral flow step up was used. The cleaved product was isolated and run on the flow devise. The test line detected the FITC molecule that was added to the amplicon by the second primer. As can be seen in Figure 12B, mutagenesis 5’ to the target base also produces a restriction site uniquely when the SNP is present, and this cleavage product can be detected by lateral flow.Example 9: Two-sided mutagenesis for restriction enzyme-based detection of SNPs

[0221] It may not always be easy or even possible to generate a unique restriction site by only using mismatches in one primer. Thus, it is additionally possible to create a de novo restriction site using both primers and a very short amplicon. The D95G mutation is caused by an “a” to “g” mutation (a284g), which produces a sequence TACGGCACCA (SEQ ID NO: 8) with the underlined G being the mutant base. A search for a restriction enzyme recognition site similar to this sequence and including the mutant G produced Pstl. The PstI recognition site is the palindrome CTGCAG. In order to produce this sequence, the G directly 5’ to the mutant G (base 283) in the gyrA sequence must be converted to T and the C three bases downstream of the mutant G (base 287) in the gyrA sequence must be converted to G. In the mutant sequence such a two-sided conversion would produce the Pstl recognition site, while in the WT sequence it would produce CTACAG which would not be recognized by the enzyme. A new Forward primer and Reverse primer were designed to produce an even shorter amplicon. The Forward primer (cggcgatttcgcagtttact; SEQ ID NO: 11, underlined and bolded base is a mismatch) was conjugated to biotin and the Reverse primer (gcgccatacggacgatgctg; SEQ ID NO: 12, underlined and bolded base is a mismatch) was conjugated to FITC for easy detection after cleavage (Fig. 13). Thus, it is possible togenerate the de novo restriction site using mutagenesis 5’ to the target base, 3’ to the target base or on both sides of the target base.Example 10: Installing a de-novo restriction site by sequential amplification-based mutagenesis

[0222] For all previous restriction enzyme assays, amplification was performed followed by addition of the restriction enzyme. However, in order to streamline the process and allow for an all-in-one assay it was tested if amplification reagents and the restriction enzyme could be added all together to the template molecules. Although this method was successful and a line at the test location was clearly visible (Fig. 14A) it was also clearly significantly fainter than the line observed when the restriction enzyme was added after amplification (compared to Figure 12B). This poor detection is not ideal as in a real world setting the amount of sample may be very low.

[0223] It was hypothesized that the presence of the enzyme led to cleavage of the amplicon before amplification could ramp up. Thus, in order to improve the all-in-one assay, a two-part sequential mutagenesis was tried with two different forward primers (Fig. 14A, 14E).It is necessary to mutate the bases TT to GC. Rather than do this with a single primer (as described above), two forward primers were added with the one reverse primer (SEQ ID NO: 10). A first intermediate forward primer that produced only the T to G change was used (ggcgacgtcatcggtaaataccacccccacggcgagt; SEQ ID NO: 13, underlined and bolded base is a mismatch) along with the original forward primer that would produce the T to C change. Amplification with the intermediate primer produces an intermediate sequence that is not recognized by the restriction enzyme and thus allows for amplification to ramp up. The other forward primer hybridizes both to the original sequence and to the intermediate sequence and produces the restriction site. However, because so much more template is now present, the immediate cleavage should still produce a strong signal.

[0224] In order to ensure that large amounts of the final product are made, it was decided that the final forward primer would be present in greater amounts than the intermediate forward primer. Initially, a ratio of 40:1, 40 final primer copies to 1 intermediate primer copy, was selected for all-in-one amplification. However, at this ratio no improvement in signal was observed (Fig. 14B). It was hypothesized that even at this low ratio the intermediate primer may compete with the final primer and thus result in poor production of the final product. As such, two much lower concentrations of intermediate primer were tested. The ratios of 160: 1 and 640:1 were found to greatly improve the final signal detected(Fig. 14C-14D) Indeed, quite surprisingly the very low ratio of 1 intermediate forward primer copy to 640 final forward primer copies was found to produce the strongest signal. Reducing the ratio even lower to 1256:1 abrogated the improvement produced by the intermediate forward primer. Thus, the use of intermediate primers at very low ratio as compared to the final forward primer greatly enhance the signal produced in an all-in-one assay.

[0225] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

Claims

CLAIMS:

1. A method of detecting a target DNA molecule in a sample, the method comprising:a. receiving a sample comprising nucleic acid molecules;b. amplifying a double stranded amplicon from said target DNA molecule with a pair of primers, wherein said amplicon comprises a restriction enzyme recognition sequence and a primer of said pair of primers comprises a first tag;c. contacting said amplicon with said restriction enzyme to produce a cleavage product comprising said first tag and a single stranded DNA (ssDNA) overhang;d. providing a DNA adapter comprising, a second tag and a ssDNA region, wherein said overhang of said cleavage product and said ssDNA region of said adapter are complementary;e. incubating said cleavage product, said DNA adapter and a ligase for a time sufficient to ligate said DNA adapter to said cleavage product thereby producing a ligation product; andf. detecting said first tag and said second tag in said ligation product;thereby detecting a target DNA molecule in a sample.

2. The method of claim 1, wherein said target DNA molecule comprises only 1 occurrence of said restriction enzyme recognition sequence.

3. The method of claim 1 or 2, wherein said target DNA molecule is a double stranded DNA (dsDNA) molecule.

4. The method of any one of claims 1 to 3, wherein said ssDNA overhang of said cleavage product and said ssDNA region of said adapter are equal in length and perfectly reverse complementary.

5. The method of any one of claims 1 to 4, wherein said DNA adapter further comprises a double stranded region, optionally wherein said second tag is attached to said double stranded region.

6. The method of claim 5, wherein said double stranded region of said DNA adapter is between 4 and 50 bases long.

7. The method of any one of claims 1 to 6, wherein said first tag or said second tag is a capture moiety, and wherein said detecting comprising applying said ligation product to a capturing moiety, wherein said capturing moiety specifically binds to said capture moiety to produce a capturing moiety -ligation product complex and detecting the other tag in said capturing moiety -ligation product.

8. The method of claim 7, wherein said capturing moiety is immobilized on a solid support and said ligation product becomes immobilized to said solid support upon binding said capturing moiety.

9. The method of any one of claims 1 to 8, wherein said detecting comprises contacting said ligation product with a labeled antibody specific to said first tag, a labeled antibody specific to said second tag or both, wherein said labeled antibody comprises or is conjugated to a fluorescent or visible label.

10. The method of any one of claims 7 to 9, wherein said detecting comprises contacting said capturing moiety-ligation product complex with a labeled antibody specific to said other tag, wherein said labeled antibody comprises or is conjugated to a fluorescent or visible label.

11. The method of claim 9 or 10, wherein said labeled antibody is conjugated to a gold nanoparticle.

12. The method of any one of claims 1 to 11, wherein said double stranded region of said DNA adapter comprises a sequence adjacent to said single stranded overhang that when ligated to said cleavage product does not recreate said restriction enzyme recognition sequence.

13. The method of any one of claims 1 to 12, wherein step (f) comprises applying said ligation product to a lateral flow device, wherein said lateral flow device comprises a test line comprising an immobilized agent that binds either said first or second tag and said detecting comprises applying a labeled antibody specific to the other tag to said lateral flow device, wherein said antibody comprises or is conjugated to a fluorescent or visible label.

14. The method of claim 13, wherein steps (c) to (f) comprise applying said amplicon to a lateral flow device, wherein said lateral flow device comprises: a loading area comprising said restriction enzyme, said adapter and said ligase, and a test line comprising an immobilized agent that binds either said first or second tag and said detecting comprises applying a labeled antibody specific to said other tag to said lateral flow device, wherein said antibody comprises or is conjugated to a fluorescent or visible label.

15. The method of claim 13 or 14, wherein said immobilized agent is immobilized capturing moieties, said first tag or said second tag is a capture moiety, and wherein said capturing moiety specifically binds to said capture moiety.

16. The method of any one of claims 13 to 15, wherein said lateral flow device further comprises a control line comprising immobilized antibody that binds to said labeled antibody or to a control DNA molecule.

17. The method of any one of claims 7 to 16, wherein said capture moiety is biotin and said capturing moiety is streptavidin.

18. The method of any one of claims 1 to 17, wherein:i. a first primer of said pair of primers is reverse complementary to a first sequence 3’ to said target base and wherein said first sequence is not more than 7 bases 3’ to a target base;ii. a second primer of said pair of primers is at least 85% identical to a second sequence 5’ to said target base; andiii. said first primer is less than 100% reverse complementary to said first sequence and produces an artificial restriction enzyme recognition sequence in said amplicon, wherein at least one base reverse complementary to a base in said first primer mismatched with said first sequence.

19. The method of claim 18, wherein said second primer is less than 100% identical to said second sequence and wherein said artificial restriction enzyme recognition sequence comprises at least one base reverse complementary to a base in said firstprimer mismatched with said first sequence and at least one base in said second primer mismatched with said second sequence.

20. The method of any one of claims 1 to 19, wherein said amplification is isothermal amplification.

21. The method of any one of claims 1 to 20, being a method of detecting a SNP of a target base in a sample.

22. The method of claim 21, wherein said first primer produces said artificial restriction enzyme recognition site in said amplicon when said SNP is present, said artificial restriction enzyme recognition site comprises said SNP, and a restriction enzyme recognition sequence is not present in said amplicon when said target base is present.

23. The method of any one of claims 12 to 22, wherein said amplification, said contacting and said incubating are all done in a single solution and / or in a single container and wherein said restriction enzyme produces a single stranded 3’ overhang.

24. The method of claim 23, wherein said method does not comprise denaturing enzymes within said single solution and / or single container.

25. The method of any one of claims 18 to 24, wherein said SNP is indicative of the presence of a pathology, said sample is from a subject and said method is a method of diagnosing said pathology in said subject.

26. The method of any one of claims 18 to 25, wherein said SNP is in nucleic acid molecule of a pathogen, said sample is from a subject, said SNP is indicative of said pathogen being resistant to a treatment and said method is a method of diagnosing a subject suffering from said pathogen as being resistant to treatment.

27. The method of any one of claims 1 to 26, wherein said sample comprises a target RNA molecule, said method further comprising before said amplifying reverse transcribing said target RNA molecule into said target DNA molecule and wherein detecting said target DNA molecule is indicative or detection of said target RNA molecule.

28. The method of any one of claims 1 to 27, being a method of simultaneously detecting a plurality of target nucleic acid molecules in a sample, whereina. an amplicon is amplified from each target nucleic acid molecule of said plurality with a pair of primers specific to said each target nucleic acid molecule to produce a plurality of amplicons;b. each amplicon of said plurality of amplicons comprises a restriction enzyme recognition sequence of a unique restriction enzyme such that each amplicon of said plurality of amplicons comprises a target sequence of a different enzyme;c. said contacting comprises contacting said plurality of amplicons with a plurality of restriction enzymes that cleave said unique restriction enzyme recognition sequences to produce a plurality of cleavage products wherein said cleavage product of said plurality comprises a unique single stranded overhang;d. said providing comprises providing a plurality of adapters, wherein each adapter of said plurality comprises a unique single stranded overhang complementary to said unique ssDNA overhangs and a unique second tag of a plurality of second tags such that each adapter comprises a different second tag of said plurality;e. said contacting produces a plurality of ligation products; andf. said detecting is simultaneously detecting said first tag and each of said plurality of second tags.

29. A method of detecting a single nucleotide polymorphism (SNP) of a target base in a sample comprising nucleic acid molecules, the method comprising:a. amplifying from said sample with a pair of primers an amplicon comprising said target base or a SNP of said target base, wherein:i. a first primer of said pair of primers is reverse complementary to a first sequence 3’ to said target base and wherein said first sequence is not more than 7 bases 3 ’ to said target base;ii. a second primer of said pair of primers is at least 85% identical to a second sequence 5’ to said target base; andiii. said first primer is less than 100% reverse complementary to said first sequence and produces an artificial restriction enzyme recognition site in said amplicon when said SNP is present, wherein said artificial restriction enzyme recognition site comprises said SNP and at least one base reverse complementary to a base in said first primer mismatched with said first sequence and wherein a restriction enzyme recognition site of said restriction enzyme is not present in said amplicon when said target base is present;b. contacting said amplicon with said restriction enzyme under conditions sufficient to produce cleavage by said restriction enzyme at restriction enzyme recognition sites; andc. detecting cleavage of said amplicon, wherein cleavage of said amplicon indicates the presence of said SNP and lack of cleavage of said amplicon indicates absence of said SNP;wherein steps (a) and (b) are performed simultaneously in a single container and wherein said amplifying is additionally with a third primer, wherein said third primer is an intermediate first primer comprising at least one fewer mismatch with said first sequence than said first primer, and wherein amplification with said intermediate first primer and said second primer does not produce said restriction enzyme recognition site.thereby detecting a SNP in a sample.

30. The method of claim 29, wherein said second primer is less than 100% identical to said second sequence and wherein said artificial restriction enzyme recognition site comprises said SNP, at least one base reverse complementary to a base in said first primer mismatched with said first sequence and at least one base in said second primer mismatched with said second sequence.

31. The method of claim 29 or 30, wherein said first primer comprises a first portion of said restriction enzyme recognition site; a second sequence directly 5’ to said first sequence comprises said SNP and consists of a second portion of said restriction enzyme recognition site; and wherein said first portion and said second portion together produce said restriction enzyme recognition site.

32. The method of any one of claims 29 to 31, wherein said first primer comprises two mismatches with said first sequence and said third primer comprises only one of said two mismatches with said first sequence.

33. The method of any one of claims 29 to 32, wherein a ratio of said first primer to said first intermediate primer is at least 10:1.

34. The method of claim 33, wherein said ratio is between 100:1 and 1000:1.

35. The method of any one of claims 29 to 34, further comprising performing the method of any one of claims 1 to 28, wherein said detecting a DNA molecule in a sample is detecting a DNA molecule comprising said SNP of a target base in said sample.

36. A method of detecting a single nucleotide polymorphism (SNP) of a target base in a sample comprising nucleic acid molecules, the method comprising:a. amplifying from said sample with a pair of primers an amplicon comprising said target base or a SNP of said target base, wherein:i. a first primer of said primer pair is reverse complementary to a first sequence 3’ to said target base and wherein said first sequence is not more than 25 bases 3 ’ to said target base; andii. said first primer is less than 100% reverse complementary to said first sequence and produces an artificial non-canonical TRTV PAM sequence in said amplicon not more than 25 bases 5’ to the complementary base to said target base or SNP of said target base;b. contacting said amplicon with a CAS 12 enzyme and a guide RNA (gRNA) under conditions sufficient to produce cleavage by said CAS 12 enzyme, wherein said gRNA is 100% identical to a second sequence directly 3’ to said TRTV sequence and comprising said complementary base to said target base or said SNP; andc. detecting cleavage of said amplicon;thereby detecting a SNP in a sample.

37. The method of claim 36, wherein said TRTV is TGTV.

38. The method of claim 36 or 37, wherein said second sequence comprises said complementary base to said SNP and cleavage of said amplicon indicates presence of said SNP and absence of cleavage of said amplicon indicates absence of said SNP or said second sequence comprises said complementary base to said target base and cleavage of said amplicon indicates absence of said SNP and lack of cleavage of said amplicon indicates presence of said SNP.

39. The method of any one of claims 36 to 38, wherein a 3’ end of said first sequence is not more than 20 bases 3’ to said target base.

40. The method of any one of claims 36 to 39, wherein said artificial TRTV sequence is not more than 8 bases 5’ to said complementary base.

41. The method of claim 40, wherein said artificial TRTV sequence is adjacent to said complementary base.

42. The method of any one of claims 36 to 41, wherein said first primer comprises said TRTV sequence and said TRTV sequence comprises one or two mismatches with said first sequence.

43. The method of any one of claims 36 to 42, wherein said first primer comprises 16-45 bases.

44. The method of any one of claims 36 to 43, wherein said CAS12 is CAS12a.

45. The method of any one of claims 36 to 44, wherein said gRNA comprises at least a mismatch at said target base.

46. The method of any one of claims 29 to 45, wherein said first sequence is adjacent to said target base.

47. The method of any one of claims 29 to 46, wherein said sample is a biological sample obtained from a subject and said method is a method of detecting said SNP in said subject.

48. The method of any one of claims 29 to 47, wherein said amplicon consists of not more than 3000 bases.

49. The method of any one of claims 29 to 48, wherein said detecting cleavage comprises determining the length of nucleic acid molecules produced after said contacting.

50. The method of any one of claims 36 to 49, wherein said first primer comprises a detectable moiety and said second primer comprises a capture moiety or said second primer comprises said detectable moiety and said first primer comprises said capture moiety and wherein said detecting comprises:a. contacting a solution comprising said amplicon with a capturing moiety configured to bind said capture moiety;b. isolating from said solution said capturing moiety and amplicon or fragments thereof bound to said capturing moiety to produce a depleted solution; andc. detecting said detectable moiety is said depleted solution, wherein the presence of said detectable moiety in said depleted solution is indicative of cleavage of said amplicon.

51. The method of claim 50, wherein said capturing moiety is conjugated to a surface of a lateral flow device, said contacting comprises loading said solution to said lateral flow device and wherein said detecting occurs at a test region downstream of said capturing moiety in said lateral flow device.

52. The method of claim 51, wherein said capturing moiety is conjugated to a support, wherein said support comprises a diameter larger than a pore of a membrane and said detectable moiety comprises a diameter smaller than said pore, wherein said isolating comprises passing said solution through said membrane such that said capturing moiety stays on a first side of said membrane and said detectable moiety after cleavage passes to a second side of said membrane and wherein said detecting said detectable moiety occurs on said second side of said membrane.

53. The method of claim 52, wherein said support is a bead.

54. The method of any one of claims 50 to 53, wherein said detectable moiety is a fluorescent molecule.

55. The method of any one of claims 50 to 54, wherein said detecting said detectable moiety comprises binding said detectable moiety with a labeled antibody specific to said detectable moiety and detecting said label.

56. The method of any one of claims 29 to 55, wherein said amplifying is isothermal amplification, optionally wherein said amplification is recombinase polymerase amplification (RPA).

57. The method of any one of claims 29 to 56, wherein said SNP is indicative of the presence of a pathology, said sample is from a subject and said method is a method of diagnosing said pathology in said subject.

58. The method of any one of claims 29 to 57, wherein said SNP is in nucleic acid molecule of a pathogen, said sample is a from a subject, said SNP is indicative of said pathogen being resistant to a treatment and said method is a method of diagnosing a subject suffering from said pathogen as being resistant to treatment.

59. A method of designing a primer pair, the method comprising:a. identifying a target base in a region of a target nucleic acid molecule, wherein a single nucleotide polymorphism (SNP) of said target base is known;b. selecting a first sequence 3’ to said target base in said target nucleic acid molecule, wherein said first sequence is not more than 25 bases 3’ to said target base;c. producing a sequence of a first primer that hybridizes to said first sequence and is less than 100% reverse complementary to said first sequence, comprises a TRTV sequence that comprises one or two mismatches with said first sequence or a first portion of a TRTV sequence comprising one or two mismatches with said first sequence wherein a second portion of said TRTV is a reverse complement of a sequence directly 5’ to said first sequence and a full TRTV sequence is produced by said first portion and said second portion when said primer hybridizes and amplifies, and wherein said TRTV sequence is not more than 25 bases 5’ to the complementary base to said target base when hybridized to said first sequence; andd. producing a sequence of a second primer capable of amplifying with said first primer said region of said target nucleic acid molecule, wherein said first primer and said second primer are said primer pair;thereby producing a primer pair.

60. A method of designing a primer pair, the method comprising:a. identifying a target base in a region of a target nucleic acid molecule, wherein a single nucleotide polymorphism (SNP) of said target base is known;b. determining a restriction enzyme recognition site that is not present in said region and wherein said restriction enzyme recognition site comprises a first portion that includes said SNP and a second portion that includes at least 1 mismatch to said region;c. selecting a first sequence 3’ to said target base in said target nucleic acid molecule, wherein said first sequence is not more than 7 bases 3’ to said target base;d. producing a sequence of a first primer that hybridizes to said first sequence and is less than 100% reverse complementary to said first sequence, comprises said second portion of said restriction enzyme recognition site that comprises at least one mismatch with said first sequence, and wherein when said first primer is hybridized to said first sequence, said first portion is adjacent to said second portion to produce said restriction enzyme recognition site; ande. producing a sequence of a second primer capable of amplifying with said first primer said region of said target nucleic acid molecule, wherein said first primer and said second primer are said primer pair;thereby producing a primer pair.

61. The method of claim 60, further comprising producing an intermediate first primer, wherein said intermediate first primer hybridizes to said first sequence and is identical to said first primer except that is comprises at least 1 few mismatch to said first sequence, and wherein when said intermediate first primer is hybridized to said first sequence said restriction enzyme recognition site is not produced.

62. The method of claim 60 or 61, wherein said restriction enzyme recognition site comprises 1 or 2 mismatches with said region comprising said SNP and comprises 2 or 3 mismatches with said region comprising said target base.

63. The method of any one of claims 60 to 62, wherein step (b) comprises determining a restriction enzyme recognition site that can be produced by mutating bases 5’, 3’ or both to said SNP, but which will not be produced when said target base is present and said mutating is performed.

64. The method of any one of claims 60 to 63, wherein step (d) comprises producing a sequence of said first primer that when used to amplify an amplicon of said region comprising said SNP mutates said bases 5’ or 3’ to said SNP to produce said restriction enzyme recognition site in said amplicon.

65. The method of any one of claims 60 to 64, wherein said primer pair is for use in performing a method of any one of claims 1 to 59.