Sirna molecule for regulating PCSK9 gene activity

Abstract

Provided are a small interfering RNA (siRNA) used to inhibit the expression of proprotein convertase subtilisin / kexin type 9 (PCSK9) in a cell, a vector comprising nucleotides encoding same, and a cell, as well as a method using the siRNA, the vector or the cell for the treatment of diseases or symptoms associated with the expression of PCSK9 in a subject.

Description

FIELD OF TECHNOLOGY The present invention relates to the field of RNA interference. BACKGROUND Proprotein convertase subtilisin / kexin type 9 (PCSK9) is a serine protease, which is mainly expressed in livers, small intestines and kidneys, is a regulatory targeting substance for a low density lipoprotein, and mainly plays a role by regulating expression and secretion activity of a low density lipoprotein receptor on the livers. Cholesterol in the blood is mainly synthesized in the livers, and decomposition of excess cholesterol is also mainly carried out in the livers. The low density lipoprotein receptor (LDLR) that exists on surfaces of the livers can bind to the cholesterol circulating back to the livers and decompose the cholesterol into bile acid which is then excreted out of the body through intestines. As the protease synthesized in the livers, the PCSK9 can bind to the LDLR and promote the LDLR to enter a hepatocyte lysosome for decomposition, thereby decreasing the amount of the LDLR. On the contrary, inhibition of PSCK9 enzyme activity can increase the amount of the LDLR, thereby enhancing the abilities to uptake and decompose the cholesterol, and ultimately reducing the content of the cholesterol. The PCSK9 can bind to the low density lipoprotein receptor through an extracellular pathway and an intracellular pathway and promote degradation of the LDLR. In the extracellular pathway, the PCSK9 secreted into an extracellular cell binds to the LDLR on a cell membrane, such that the LDLR is endocytosed to form an endosome and finally enters a lysosome for degradation. In the intracellular pathway, the PCSK9 secreted from a Golgi apparatus enters cytoplasm and directly binds to the LDLR, such that the LDLR directly enters a lysosomal degradation pathway in a cell. Therefore, the PCSK9 is an effective target for treatment of hyperlipidemia and atherosclerosis. Although hypercholesterolemia itself is asymptomatic, long-term elevated serum cholesterol can lead to atherosclerosis. After decades, chronically elevated cholesterol leads to the formation of atherosclerotic plaques in arteries, and the atherosclerosis can lead to progressive stenosis or even complete occlusion of the arteries involved. In addition, smaller plaques may rupture and cause clot formation and vascular occlusion, leading to, for example, myocardial infarction and / or stroke. When 2023295621   17 Jun 2026 the stenosis or the occlusion is gradually formed, blood supply to tissues and organs is slowly reduced until organ functions are impaired. In recent years, inhibitors with the protease PCSK9 as a target have become novel therapeutic drugs for these diseases. As a new treatment method, an siRNA has great 5 development potential. The siRNA acts on an mRNA in a cell and can directly silence a target gene compared with traditional small molecule drugs, and thus can fundamentally prevent occurrence and development of diseases more efficiently. However, due to poor stability, easy degradation by a nuclease in vivo, difficult absorption by tissues, difficult uptake by cells, easy generation of an off-target effect 10 and other defects, the siRNA is limited in clinical application. At present, an siRNA capable of effectively inhibiting expression of a PCSK9 gene in a cell is required urgently. SUMMARY 15 The present invention provides a novel small interfering RNA (siRNA) for inhibiting expression of proprotein convertase subtilisin / kexin type 9 (PCSK9) in a cell, a vector, a kit and a pharmaceutical composition thereof, as well as a method for inhibiting or reducing expression of a PCSK9 gene or treating diseases or symptoms associated with the expression of PCSK9 by using the siRNA, the vector, the kit or the 20 pharmaceutical composition. According to a first aspect, the present invention provides a small interfering RNA (siRNA) for inhibiting expression of proprotein convertase subtilisin / kexin type 9 (PCSK9) in a cell, the siRNA comprising a sense strand and an antisense strand that form a double-stranded region, wherein lengths of the sense strand and the antisense 25 strand are each independently 15-30 nucleotides, wherein the sense strand comprises GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmUmsAm, and the antisense strand comprises UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm. 2023295621   17 Jun 2026 According to a second aspect, the present invention provides a cell, comprising the siRNA according to the invention. According to a third aspect, the present invention provides a pharmaceutical composition, comprising the siRNA according to the invention or the cell according to the invention and a pharmaceutically acceptable carrier or excipient. According to a fourth aspect, the present invention provides a kit, comprising the siRNA according to the invention or the cell according to the invention. According to a fifth aspect, the present invention provides a method for treating diseases or symptoms associated with expression of PCSK9 in a subject, wherein the method comprises a step of administering the siRNA according to the invention, the cell according to the invention or the pharmaceutical composition according to the invention to the subject. According to a sixth aspect, the present invention provides use of the siRNA according to the invention the cell according to the invention or the pharmaceutical composition according to the invention for the manufacture of a medicament for treating diseases or symptoms associated with expression of PCSK9. In a further aspect, the present invention provides a small interfering RNA (siRNA) for inhibiting expression of proprotein convertase subtilisin / kexin type 9 (PCSK9) in a cell. The siRNA includes a sense strand and an antisense strand that form a doublestranded region, where lengths of the sense strand and the antisense strand are each independently 15-30 nucleotides, and the antisense strand includes a nucleotide sequence of at least 15 consecutive nucleotides of a nucleotide sequence shown in any one of SEQ ID NO: 105-208. In some specific embodiments, the sense strand includes a nucleotide sequence of at least 15 consecutive nucleotides of a nucleotide sequence shown in any one of SEQ ID NO: 1-104. In some embodiments, the lengths of the sense strand and the antisense strand are each independently 17-27 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides. In some embodiments, a length of the double-stranded region is 15-25 base pairs, 2a preferably 17-21 base pairs, more preferably 19-21 base pairs. In some embodiments, one or two of the sense strand and the antisense strand include a 3’ overhang and / or a 5’ overhang having at least 1 nucleotide, for example, one or two of the sense strand and the antisense strand include a 3’ overhang and / or a 5’ overhang having at least 1 nucleotide. In some preferred embodiments, the antisense strand includes a 3’ overhang and / or a 5’ overhang having at least 2 nucleotides, and preferably, the antisense strand includes a 3’ overhang and / or a 5’ overhang having 2 nucleotides. In some embodiments, the antisense strand includes a nucleotide sequence of at least 16 consecutive nucleotides, a nucleotide sequence of at least 17 consecutive nucleotides, a nucleotide sequence of at least 18 consecutive nucleotides, a nucleotide sequence of at least 19 consecutive nucleotides, or a nucleotide sequence of at least 20 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 105-208, and preferably, the antisense strand includes the nucleotide sequence shown in any one of SEQ ID NO: 105-208. In some embodiments, the sense strand includes a nucleotide sequence of at least 16 consecutive nucleotides, a nucleotide sequence of at least 17 consecutive nucleotides, a nucleotide sequence of at least 18 consecutive nucleotides, a nucleotide sequence of at least 19 consecutive nucleotides, or a nucleotide sequence of at least 20 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 1-104, and preferably, the sense strand includes the nucleotide sequence shown in any one of SEQ ID NO: 1-104. In some embodiments, the siRNA includes a sense strand sequence and an antisense strand sequence that are paired as shown in Table 3. In some embodiments, the antisense strand includes a nucleotide sequence of at least 15 consecutive nucleotides, a nucleotide sequence of at least 16 consecutive nucleotides, a nucleotide sequence of at least 17 consecutive nucleotides, a nucleotide sequence of at least 18 consecutive nucleotides, a nucleotide sequence of at least 19 consecutive nucleotides, or a nucleotide sequence of at least 20 consecutive nucleotides of a nucleotide sequence shown in any one of SEQ ID NO: 195, 203, 204, 142, 207, 143, 197, 205, 206, 144, 147, 148, 149, and 150, and preferably, the antisense strand includes the nucleotide sequence shown in any one of SEQ ID NO: 195, 203, 204, 142, 207, 143, 197, 205, 206, 144, 147, 148, 149, and 150. In some embodiments, the sense strand includes a nucleotide sequence of at least 15 consecutive nucleotides, a nucleotide sequence of at least 16 consecutive nucleotides, a nucleotide sequence of at least 17 consecutive nucleotides, a nucleotide sequence of at least 18 consecutive nucleotides, a nucleotide sequence of at least 19 consecutive nucleotides, or a nucleotide sequence of at least 20 consecutive nucleotides of a nucleotide sequence shown in any one of SEQ ID NO: 91, 99, 100, 38, 103, 39, 93, 101, 102, 40, 43, 44, 45, and 46, and preferably, the sense strand includes the nucleotide sequence shown in any one of SEQ ID NO: 91, 99, 100, 38, 103, 39, 93, 101, 102, 40, 43, 44, 45, and 46. In some embodiments, (a) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 195, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 91; (b) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 203, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 99; (c) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 204, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 100; (d) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 142, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 38; (e) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 207, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 103; (f) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 143, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 39; (g) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 197, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 93; (h) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 205, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 101; (i) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 206, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 102; (j) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 144, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 40; or (k) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 147, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 43; (l) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 148, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 44; (m) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 149, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 45; or (n) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 150, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 46. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand are modified nucleotides, or all the nucleotides of the sense strand and all the nucleotides of the antisense strand are modified nucleotides. In some specific embodiments, the sense strand and the antisense strand each independently include one or more nucleotide modifications selected from the following group: 2’-O-methyl modified nucleotides, 2’-fluoro modified nucleotides, 2’-deoxy- modified nucleotides, inosine ribonucleotides, abasic nucleotides, reverse abasic deoxyribonucleotides, nucleotides containing a thiophosphate group, vinyl phosphate modified nucleotides, locked nucleotides, 2’-amino- modified nucleotides, 2’-alkyl- modified nucleotides, morpholino nucleotides, aminophosphates, unnatural bases containing nucleotides, and terminal nucleotides or deoxyribonucleotides linked to cholesterol-based derivatives or a sebacamide dodecanoate group. In some preferred embodiments, the sense strand and the antisense strand each independently include one or more nucleotide modifications selected from the following group: 2’-O-methyl modified nucleotides, 2’-fluoro modified nucleotides, abasic nucleotides, or nucleotides containing a thiophosphate group. In some preferred embodiments, the sense strand and / or the antisense strand includes at least 2 2’-fluoro modified nucleotides. In some preferred embodiments, the sense strand and / or the antisense strand includes at least 8 2’-O-methyl modified nucleotides. In some preferred embodiments, a 3’ end and / or a 5’ end of the sense strand and / or the antisense strand includes 1-5 thiophosphate groups, preferably 2-3 thiophosphate groups. In some preferred embodiments, the antisense strand includes a modified nucleotide sequence shown in Table 5, and / or the sense strand includes a modified nucleotide sequence shown in Table 4. In some preferred embodiments, the siRNA includes a modified sense strand sequence and a modified antisense strand sequence that are paired as shown in Table 6. In some specific embodiments, (a) the sense strand includes CmsUmsAmGmAmCmCfUmGfUmdTUmUmGmCmUmUmUmUmGmUm, and the antisense                               strand                               includes AmsCfsAmAfAfAfGmCfAmAfAmAfCmAfGmGfUmCfUmAmGmsAmsAm; (b)             the              sense              strand             includes CmsUmsAmGmAmCmCfUmGfUmdTUmUmGmCmUmUmUmUmGmsUm, and the antisense                               strand                               includes AmsCfsAmAfAfAfGmCfAmAfAmAfCmAfGmGfUmCfUmAmGmsAmsAm; (c)              the              sense              strand             includes UmsGmsUmUmUmUmGfCfUfUmUmUmGmUmAmAmCmsUmsUm, and the antisense                               strand                               includes AmsAfsGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmCfAmsGfsGm; (d)             the              sense              strand             includes UmsGmsUmUmUmUmGfCfUfUmUmUmGmUmAmAmCmUmsUm, and the antisense                               strand                               includes AmsAfsGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmCfAmsGfsGm; (e)              the              sense              strand             includes GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmsUmsAm, and the antisense                               strand                               includes UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm; (f)              the              sense              strand              includes GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmsUmsAm, and the antisense                               strand                               includes UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm; (g)             the              sense              strand             includes GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmUmsAm, and the antisense                               strand                               includes UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm; (h)             the              sense              strand             includes GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmUmAm, and the antisense                               strand                               includes UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm; (i)              the              sense              strand              includes UmsUmsUmUmGmCmUfUfUfUmGmUmAmAmCmUmUmsGmsAm, and the antisense                               strand                               includes UmsCfsAmAfGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmsCfsAm; (j)              the              sense              strand              includes UmsUmsUmUmGmCmUfUfUfUmGmUmAmAmCmUmUmsGmsAm, and the antisense                               strand                               includes UmsCfsAmAfGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmsCfsAm; (k)             the              sense              strand             includes UmsGmsCmUmUmUmUfGfUfAmAmCmUmUmGmAmAmsGmsAm, and the antisense                               strand                               includes UmsCfsUmUfCmAfAmGfUmUfAmCfAmAfAmAfGmCfAmsAfsAm; (l)              the              sense              strand              includes GmsCmsUmUmUmUmGfUfAfAmCmUmUmGmAmAmGmsAmsUm, and the antisense                               strand                               includes AmsUfsCmUfUmCfAmAfGmUfUmAfCmAfAmAfAmGfCmsAfsAm; (m)             the             sense             strand             includes CmsUmsUmUmUmGmUfAfAfCmUmUmGmAmAmGmAmsUmsAm, and the antisense                               strand                               includes UmsAfsUmCfUmUfCmAfAmGfUmUfAmCfAmAfAmAfGmsCfsAm; or (n)             the              sense              strand             includes UmsUmsUmUmGmUmAfAfCfUmUmGmAmAmGmAmUmsAmsUm, and the antisense                               strand                               includes AmsUfsAmUfCmUfUmCfAmAfGmUfUmAfCmAfAmAfAmsGfsCm. In some embodiments, the siRNA is further conjugated with a ligand moiety containing N-acetylgalactosamine through a phosphate group or a thiophosphate group, and preferably, the sense strand of the siRNA is conjugated with the ligand moiety through the phosphate group or the thiophosphate group. In some preferred embodiments, a 3’ end of the sense strand is conjugated with the ligand moiety through the phosphate group or the thiophosphate group. In other preferred embodiments, a 5’ end of the sense strand is conjugated with the ligand moiety through the phosphate group or the thiophosphate group. In some embodiments, the ligand moiety includes a conjugated group shown in Formula (X’): R3       (X’) where, represents a position connected with a biomolecule; 10 Q     is     independently     H, or where L1 is a bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O))a-; L2 is a bond or -CH2CH2C(O)-; L3 is a bond, -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-; L4   is   -(OCH2CH2)c-,   -(OCH2CH2CH2)c-,   -(OCH2CH2CH2CH2)c-,   - (OCH2CH2CH2CH2CH2)c-, or -NHC(O)-(CH2)d-; where a is 0, 1, 2, or 3; b is 1, 2, 3, 4, or 5; c is 1, 2, 3, 4, or 5; d is 1, 2, 3, 4, 5, 6, 7, or 8; L is a bond, -CH2O-, or -NHC(O)-; L’ is a bond, -C(O)NH-, -NHC(O)-, or -O(CH2CH2O)e-; where e is 1, 2, 3, 4, or 5; T is a bond, -CH2-, -C(O)-, -M-, -CH2-M-, or -C(O)-M-; where M is      , hV^, HD^,or HCH R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H; or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H; where R is -OR’, -CH2OR’, or -CH2CH2OR’, where R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the conjugated ligand targets an asialoglycoprotein receptor (ASGPR). In some preferred embodiments, the conjugated group is selected from Table 1: Table 1. Structures of the conjugated group Nu mbe r Structure 1 HO .OH                     o \S n            H Y “YJaY'Y / HO / OH                 0     \Q              / / \< n            H II / / A          It \YY\ / 0 / / - /     / N"^^"0- / -x n ^x / N. J \ “YJaY0^   YY ^Y ^^4 Y           o HO / OH \< n              H / yXa / 0 / Y\      Y HqA / ^V Y 0      0 NHAc 2 HO .OH P'S-0.0.  - .o. l.-'0'0 "“^yYY^^ ^sy HO .OH                             ( \Y0           5 Y     Y? OJ     I H HO .OH                                /             V V^Y, / ° / Y\ Y / 0\Y-mY^ "‘Y^Y0^  HY 3 HO .OH             0               Q unN      N -X "Y^     B H / HO / OH           0           0    V             / x \XLo YY / -Y / K / x / ^ A / /          P? HO-XV0 NHAc                                                    H         X 1 n               ?          0       °! HO .OH              Q                 J v^Q n / °-YY\ -y / y / HqA^-^V                 N 4s NHAc             HO 4 HO / OH VX-0            H zP xX / °\Y y\ / n \ H0^NHAc   0      }.....NH HO / OH              \ X° \X-0           H__ / \                0 HqAX^V Y^q / Y / { o 0           / NxXx X ' / xzyNH     o^ Y    or H0 .OH                       P Vy.0              H / /   < \YY\ / O /       / N—X \=o hqY^a / x / Yr "y \ / =° NHAc                / ...... / H HO .OH                   \ YY / x . / JY H0ANHAc   °      0 5 HO .OH HO     NHAc °          y.....NH ho^oh             \                   WH ho-^A / °x^^  —^N / P  o            A° NHAc                       0   /      II HO .OH                         0 ho^Oi / Ox / Xq / x^M HO .OH                    ( x, o^, ,.___h_j n’^XX  1 6 HO XH VXz°\ / \ / \A xxW ho^^a / x / x      X NHAc                   H \....... HO .OH                      \ )=°                      / 0H WWx / x A / -nJ \         1 y n X / xxxU , / 0y <H            J 7 HQ .OH                              0 Wo            0 / \A\A^^A / xwJ \ HO^^ax x / x     -A NX >=0 NHAc    U         H \.....N^U HO >0H                           / H 7 HO / -OH rWx / x ho     nhac    0        2 NH HO / OH               \ X°                          .OH Wy-°W »-xo o     A / H                              II                  / \                       o HO / OH            n 0^^0 H0AW^Ac^°^ 2.....rf ° HO .OH                   \ 'rW / zx x^m H0AW^Ac^0^ 0 10 12 13 14 In some preferred embodiments, the conjugated group is selected from Table 2: Table 2. Structures of the conjugated group Nu mbe Structure r 17 19 20 21 22 HQ / OH O                H / P H0^^NHAc   0      ) NH ho zOH            \ V°    V? o \X / > -         H / \ hoAASa^°^ o /  1 ? H...... HO                    0 P / JH >o ho n1ac    °     V [f HO JDH                   \ X^S / O^  J-7 H°^NHAc   °      0 23-1 HQ / OH H°     NHAc    °         / .....NH HQ >0H                \ d \ QO \ o / > ) ) \^_ . / MU     NHAc    U         0 HO ^H               Q [ XXo^ -XH Vo ).....H HO JDH                   \ rX / x / \ J— / H0  ^       o 23-2 HQ / OH \\ O             H / ° V2XS / 0. / \     ,R— H0     NHAc    0        y.....NH HO >3H                  \ o \ xN-^ HO^H             0  | / JM Vo H0 ^    V.....jC HO JDH                   \ rX / x J— / H0   ™c °      o Q 25 26 28 29 In some embodiments, the ligand contained in the siRNA has the following structure: where       represents a position connected with the sense strand of the siRNA through the phosphate group or the thiophosphate group. In some embodiments, the ligand contained in the siRNA has the following 5 structure: where ' represents a position connected with the sense strand of the siRNA through the phosphate group or the thiophosphate group. In some embodiments, the ligand contained in the siRNA of the present invention 10 has the following structure: where        represents a position connected with the siRNA through the phosphate group or the thiophosphate group. In a second aspect, the present invention provides a vector, which includes a nucleotide sequence encoding the siRNA of the present invention. In a third aspect, the present invention provides a cell, which includes the siRNA or the vector of the present invention. In a fourth aspect, the present invention provides a pharmaceutical composition, which includes the siRNA, the vector or the cell of the present invention, and an optional pharmaceutically acceptable carrier or excipient. In a fifth aspect, the present invention provides a kit, which includes the siRNA, the vector or the cell of the present invention. In a sixth aspect, the present invention provides a method for treating diseases or symptoms associated with expression of PCSK9 in a subject, and the method includes a step of administering the siRNA, the vector, the cell or the pharmaceutical composition of the present invention to the subject. In some embodiments, the diseases associated with expression of PCSK9 are cardiovascular diseases. In some preferred embodiments, the cardiovascular diseases are selected from hyperlipidemia, hypercholesterolemia, nonfamilial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous     familial     hypercholesterolemia,     heterozygous     familial hypercholesterolemia, coronary heart disease, myocardial infarction, stroke, or atherosclerosis. In some embodiments, the diseases associated with expression of PCSK9 are neoplastic diseases. In some preferred embodiments, the neoplastic diseases are selected from melanoma, hepatocellular carcinoma, or metastatic hepatic cancer. In some embodiments, the diseases associated with expression of PCSK9 are T cell-mediated inflammatory immune diseases. In some preferred embodiments, the T cell-mediated inflammatory immune diseases are selected from psoriasis, psoriatic arthritis, eczema or atopic dermatitis, urticaria, hormone-dependent dermatitis, rheumatoid arthritis, scleroderma or diabetes mellitus, chronic liver diseases, or lymphoma. In some embodiments, the method for treating diseases or symptoms associated with expression of PCSK9 in a subject in the present invention includes administering the siRNA, the vector, the cell or the pharmaceutical composition to the subject, including subcutaneous administration, topical administration, or intravenous administration. In some embodiments, the subject is a human patient. DETAILED DESCRIPTION OF THE INVENTION The embodiments of the present invention are described below through particular specific examples, and other advantages and effects of the present invention can be easily understood by persons skilled in the art based on the contents disclosed in the specification. The present invention may also be implemented or applied in other different specific embodiments, and various modifications or changes of various details in the specification may also be made without departing from the spirit of the present invention based on different viewpoints and applications. It should be understood that the scope of protection of the present invention is not limited to the following specific embodiments. It should also be understood that terms used in the examples of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention. In the specification and claims of the present invention, unless otherwise explicitly stated herein, the singular forms “a”, “one” and “the” include plural forms. When numerical ranges are given in the examples, it should be understood that, unless otherwise stated in the present invention, two endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, meanings of all technical terms and scientific terms used in the present invention are the same as those usually understood by persons skilled in the technical field. In addition to specific methods, apparatuses and materials used in the examples, any methods, apparatuses and materials in the prior art similar to or equivalent to the methods, the apparatuses and the materials in the examples of the present invention may also be used to realize the present invention according to understanding of the prior art by persons skilled in the technical field and documentation of the present invention, which shall fall within the scope of protection of the present invention. The embodiments of the present invention are described in more specific detail below. Definition The term “siRNA” herein is a double-stranded RNA molecule that can mediate silencing of a complementary target RNA (such as an mRNA, such as a transcript of a gene that encodes a protein). The siRNA is usually double-stranded and includes an antisense strand complementary to the target RNA and a sense strand complementary 2023295621   16 Dec 2024 to the antisense strand. For convenience, such mRNA is also called an mRNA to be silenced herein. Such gene is also called a target gene. Usually, an RNA to be silenced is an endogenous gene or a pathogen gene. In addition, an RNA except for the mRNA (such as a tRNA) and a viral RNA can also be targeted. 5        Throughout the specification and claims, unless the context requires otherwise, the word “comprise” or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. As used herein, the term “antisense strand” refers to such a strand of the siRNA that includes a 0 region that is completely or substantially complementary to a target sequence. As used herein, the term “complementary region” refers to a region, on the antisense strand, that is completely or substantially complementary to a target mRNA sequence. In the case that the complementary region is not completely complementary to the target sequence, mispairing can exist in an internal or terminal region of a molecule. Usually, mispairing with highest tolerance exists in the 5 terminal region, for example, within 5, 4, 3, 2, or 1 nucleotide at a 5’ and / or 3’ end. A part, most sensitive to mispairing, of the antisense strand is called a “seed region”. For example, in an siRNA including a 19nt strand, some mispairings can be tolerated at position 19 (counting from 5’ to 3’). As used herein, the term “complementary” refers to the ability of a first polynucleotide to hybridize with a second polynucleotide under certain conditions such as strict conditions. For !0   example, the strict conditions may include 400 mM NaCl, 40 mM PIPES with a pH value of 6.4, and 1 mM EDTA that are lasted at 50°C or 70°C for 12-16 hours. As used herein, in order to meet the above requirements with respect to the hybridize ability, a “complementary” sequence may further include or completely form base pairs that are formed from non-Watson-Crick base pairs and / or from unnatural and modified nucleotides. Such non-Watson-25 Crick base pairs include, but are not limited to, G:U Wobble base pairs or Hoogstein base pairs. As used herein, a polynucleotide that is “at least partially complementary” or “substantially complementary” to a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a continuous part of an mRNA of interest (such as, an mRNA encoding PCSK9). For example, when a sequence is substantially complementary to a non-interrupted part of an mRNA 30 encoding PCSK9, a polynucleotide is at least partially complementary to the PCSK9 mRNA. Herein, the terms “complementary”, “completely complementary” and “substantially complementary” may be used relative to base pairs between the sense strand and the antisense strand of the siRNA, or between an antisense strand of an siRNA reagent and a target sequence. As used herein, the term “sense strand” refers to such a strand of the siRNA that includes a region that is substantially complementary to the region of the term antisense strand defined herein. A “nucleoside” is a compound composed of two components including a purine base or a pyrimidine base, and ribose or deoxyribose. A “nucleotide” is a compound composed of three components including a purine base or a pyrimidine base, ribose or deoxyribose, and phosphoric acid. An “oligonucleotide” refers to, for example, a nucleic acid molecule (RNA or DNA) that has a length of less than 100, 200, 300, or 400 nucleotides. The “base” is a basic composition unit for synthesis of nucleosides, nucleotides, and nucleic acids, and due to nitrogen in composition elements, is also called “nitrogenous base”. Herein, unless otherwise specified, capital letters A, U, T, G and C represent base composition of nucleotides, which are adenine, uracil, thymine, guanine, and cytosine, respectively. As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from a double-stranded structure of an siRNA (such as, an siRNA). For example, when a 3’-end of one strand of the siRNA extends a 5’-end of another strand or vice versa, a nucleotide overhang exists. The siRNA may include a overhang having at least one nucleotide; and alternatively, the overhang may include at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides, or more. The nucleotide overhang may include or be composed of nucleotides / nucleoside analogs (including deoxynucleotides / nucleosides). One or more overhangs may be located at the sense strand, the antisense strand, or any combination thereof. In addition, one or more nucleotides at the overhang may exist at the 5’-end, the 3’-end, or the two ends of the antisense strand or the sense strand of the siRNA. A “flat end” or “flat terminal end” means that no unpaired nucleotides exist at the end of the double-stranded siRNA, namely, no nucleotide overhang. A “flat end” siRNA refers to an siRNA that is double-stranded throughout a length, namely, no nucleotide overhang at any end of a molecule. The siRNA of the present invention includes an siRNA having a nucleotide overhang at one end (namely, a reagent having one overhang and one flat end) or having nucleotide overhangs at two ends. Substantially all nucleotides of the siRNA of the present invention are modified. For example, substantially all nucleotides of the sense strand are modified nucleotides, and / or substantially all nucleotides of the antisense strand are modified nucleotides, and / or substantially all the nucleotides of the sense strand and the antisense strand are modified nucleotides. In other embodiments of the present invention, all the nucleotides of the siRNA of the present invention are modified nucleotides. For example, all the nucleotides of the sense strand are modified nucleotides, and / or all the nucleotides of the antisense strand are modified nucleotides, and / or all the nucleotides of the sense strand and the antisense strand are modified nucleotides. The “substantially all nucleotides are modified” means that the siRNA of the present invention is mostly but not completely modified and may include no more than 5, 4, 3, 2, or 1 unmodified nucleotide. Herein, the “modified nucleotides” include, but are not limited to, 2’-O-methyl modified nucleotides, 2’-fluoro modified nucleotides, 2’-deoxy- modified nucleotides, inosine ribonucleotides, abasic nucleotides, reverse abasic deoxyribonucleotides, nucleotides containing a thiophosphate group, vinyl phosphate modified nucleotides, locked nucleotides, 2’-amino- modified nucleotides, 2’-alkyl- modified nucleotides, morpholino nucleotides, aminophosphates, unnatural bases containing nucleotides, and terminal nucleotides, deoxyribonucleotides or conventional protective groups linked to cholesterol-based derivatives or a sebacamide dodecanoate group, etc. For example, the 2’-fluoro modified nucleotides refer to nucleotides formed by substitution of hydroxyl at site 2’ of ribosyl of nucleotides with fluorine. The 2’-deoxy- modified nucleotides refer to nucleotides formed by substitution of 2’-hydroxyl of ribosyl with methoxyl. As used herein, the “ligand moiety” refers to a chemical portion that is conjugated with the siRNA and can change the distribution, targeting or life of the siRNA. In preferred embodiments, compared with, for example, an siRNA without the ligand, the ligand provides enhanced affinity for a selected target (such as a molecule, a cell or cell type, a compartment (such as a cell or organ compartment, a tissue, an organ, or a region of the body). As used herein, the terms “inhibit”, “reduce”, “silence’, “down-regulate” and other similar terms can be used interchangeably and include inhibition at any level. The phrase “inhibit expression of PCSK9” is intended to inhibit expression of any PCSK9 gene as well as variants or mutants of the PCSK9 gene. Thus, the PCSK9 gene may be a wild type PCSK9 gene, a mutant PCSK9 gene, or a transgenic PCSK9 gene in the case of genetically manipulated cells, cell population s, or organisms. “Inhibition of PCSK9 gene expression” includes inhibition of the PCSK9 gene at any level, such as at least partial inhibition of the PCSK9 gene expression. The PCSK9 gene expression can be evaluated based on levels or changes in levels of any variables associated with the PCSK9 gene expression, such as a PCSK9 mRNA level, a PCSK9 protein level, or a lipid level. The levels can be evaluated in individual cells or in a group of cells (including, for example, a sample derived from a subject). The inhibition can be evaluated through a decrease of an absolute or relative level of one or more variables associated with the PCSK9 expression compared with a control level. The control level may be any type of control level utilized in the field, such as a baseline level before administration or a level determined from a similarly untreated or treated subject, cell, or sample with a control (such as, an only buffer control or an inert agent control). The “hydroxyl protective group” refers to a group that can prevent hydroxyl from a chemical reaction and can also be removed under certain conditions to restore the hydroxyl. The hydroxyl protective group mainly includes a silane protective group, an acyl protective group, or am ether protective group, preferably including the following: trimethylsilyl (TMS), triethylsilyl (TES), dimethylisopropylsilyl (DMIPS), diethylisopropylsilyl (DEIPS), tert-butyldimethylsilyl (TBDMS), tertbutyldiphenylsilyl (TBDPS), triisopropylsilyl (TIPS), acetyl (Ac), chloroacetyl, dichloroacetyl, trichloroacetyl, trifluoroacetyl (TFA), benzoyl, p-methoxybenzoyl, 9-fluorenylmethoxycarbonyl     (Fmoc),     allyloxycarbonyl     (Alloc),     2,2,2- trichloroethoxycarbonyl (Troc), carbobenzoxy (Cbz), tert-butoxycarbonyl (Boc), phenylmethyl (Bn), p-methoxybenzyl (PMB), allyl, triphenylmethyl (Tr), di-p-methoxytriphenylmethyl (DMTr), methoxymethyl (MOM), phenoxymethyl (BOM), 2,2,2-trichloroethoxymethyl, 2-methoxyethoxymethyl (MEM), methylthiomethyl (MTM), or p-methoxybenzyloxymethyl (PMBM). The term “halo” or “halogen” refers to fluorine (F), chlorine (Cl), bromine (Br), and iodine (I). “C1-6 haloalkyl” refers to the “C1-6 alkyl” that is substituted with one or more halogen groups. In some embodiments, C1-4 haloalkyl is particularly preferred, and C1- 2 haloalkyl is more preferred. Exemplary haloalkyl includes, but is not limited to: -CF3, -CH2F, -CHF2, -CHFCH2F, -CH2CHF2, -CF2CF3, -CCl3, -CH2Cl, -CHCl2, 2,2,2-trifluoro-1,1-dimethyl-ethyl, etc. A haloalkyl group can be substituted at any available connection point with, for example, 1 to 5 substituents, 1 to 3 substituents, or 1 substituent. “C1-6 alkylene” refers to a divalent group formed by removing another hydrogen of C1-6 alkyl, and can be substituted or unsubstituted. In some embodiments, C1-4 alkylene, C2-4 alkylene, and C1-2 alkylene are preferred. Unsubstituted alkylene includes, but is not limited to: methylene (-CH2-), ethylidene (-CH2CH2-), propylidene (-CH2CH2CH2-), butylidene (-CH2CH2CH2CH2-), pentylidene (-CH2CH2CH2CH2CH2-), hexylidene (-CH2CH2CH2CH2CH2CH2-), etc. Exemplary substituted alkylene, such as, alkylene substituted with one or more alkyls (methyl), includes, but is not limited to: substituted methylene (-CH(CH3)-, -C(CH3)2-), substituted ethylidene (-CH(CH3)CH2-,  - CH2CH(CH3)-,   -C(CH3)2CH2-,   -CH2C(CH3)2-),   substituted propylidene (- CH(CH3)CH2CH2-, -CH2CH(CH3)CH2-, -CH2CH2CH(CH3)-, -C(CH3)2CH2CH2-, - CH2C(CH3)2CH2-, -CH2CH2C(CH3)2-), etc. As used herein, the term “vector” refers to such a nucleic acid molecule that can amplify or express another nucleic acid connected thereto. I.     siRNA The present invention provides a small interfering RNA (siRNA) for inhibiting expression of proprotein convertase subtilisin / kexin type 9 (PCSK9) in a cell. The siRNA includes a sense strand and an antisense strand that form a double-stranded region, where lengths of the sense strand and the antisense strand are each independently 15-30 nucleotides, and the antisense strand includes a nucleotide sequence of at least 15 consecutive nucleotides of a nucleotide sequence shown in any one of SEQ ID NO: 105-208. In some embodiments, the double-stranded region formed by the sense strand and the antisense strand is completely complementary. In other embodiments, the doublestranded region formed by the sense strand and the antisense strand is substantially complementary, which may include 1, 2, 3, 4, or 5 non-complementary sites. In some specific embodiments, the sense strand includes a nucleotide sequence of at least 15 consecutive nucleotides of a nucleotide sequence shown in any one of SEQ ID NO: 1-104. In some embodiments, the lengths of the sense strand and the antisense strand are each independently 17-27 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides. In some embodiments, a length of the double-stranded region is 15-25 base pairs, preferably 17-21 base pairs, more preferably 19-21 base pairs. One or two of the sense strand and the antisense strand include a 3’ overhang and / or a 5’ overhang having at least 1 nucleotide, for example, one or two of the sense strand and the antisense strand include a 3’ overhang and / or a 5’ overhang having at least 1 nucleotide. In some preferred embodiments, the antisense strand includes a 3’ overhang and / or a 5’ overhang having at least 2 nucleotides, and preferably, the antisense strand includes a 3’ overhang and / or a 5’ overhang having 2 nucleotides. In some embodiments, the lengths of the sense strand and the antisense strand are the same. In some embodiments, the full length of the sense strand and the full length of the antisense strand are complementary to form a double strand, namely, having a flat terminal end. In other embodiments, the lengths of the sense strand and the antisense strand are the same, and a part of the sense strand is complementary to a part of the antisense strand, namely, both the sense strand and the antisense strand have a 5’ overhang. In some embodiments, the lengths of the sense strand and the antisense strand are different. In preferred embodiments, a 5’ end of the antisense strand is a overhang having at least 1 nucleotide, more preferably a overhang having 2 or 3 nucleotides. In some embodiments, the antisense strand includes a nucleotide sequence of at least 16 consecutive nucleotides, a nucleotide sequence of at least 17 consecutive nucleotides, a nucleotide sequence of at least 18 consecutive nucleotides, a nucleotide sequence of at least 19 consecutive nucleotides, or a nucleotide sequence of at least 20 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 105-208, and preferably, the antisense strand includes the nucleotide sequence shown in any one of SEQ ID NO: 105-208. In some embodiments, the sense strand includes a nucleotide sequence of at least 16 consecutive nucleotides, a nucleotide sequence of at least 17 consecutive nucleotides, a nucleotide sequence of at least 18 consecutive nucleotides, a nucleotide sequence of at least 19 consecutive nucleotides, or a nucleotide sequence of at least 20 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 1-104, and preferably, the sense strand includes the nucleotide sequence shown in any one of SEQ ID NO: 1-104. In some embodiments, the siRNA includes a sense strand sequence and an antisense strand sequence that are paired as shown in Table 3. In some embodiments, the antisense strand includes a nucleotide sequence of at least 15 consecutive nucleotides, a nucleotide sequence of at least 16 consecutive nucleotides, a nucleotide sequence of at least 17 consecutive nucleotides, a nucleotide sequence of at least 18 consecutive nucleotides, a nucleotide sequence of at least 19 consecutive nucleotides, or a nucleotide sequence of at least 20 consecutive nucleotides of a nucleotide sequence shown in any one of SEQ ID NO: 195 / 203 / 204, 142 / 207, 143 / 197 / 205 / 206, 144, 147, 148, 149, and 150, and preferably, the antisense strand includes the nucleotide sequence shown in any one of SEQ ID NO: 195 / 203 / 204, 142 / 207, 143 / 197 / 205 / 206, 144, 147, 148, 149, and 150. In some embodiments, the sense strand includes a nucleotide sequence of at least 15 consecutive nucleotides, a nucleotide sequence of at least 16 consecutive nucleotides, a nucleotide sequence of at least 17 consecutive nucleotides, a nucleotide sequence of at least 18 consecutive nucleotides, a nucleotide sequence of at least 19 consecutive nucleotides, or a nucleotide sequence of at least 20 consecutive nucleotides of a nucleotide sequence shown in any one of SEQ ID NO: 91 / 99 / 100, 38 / 103, 39 / 93 / 101 / 102, 40, 43, 44, 45, and 46, and preferably, the sense strand includes the nucleotide sequence shown in any one of SEQ ID NO: 91 / 99 / 100, 38 / 92, 39 / 93 / 101 / 102, 40, 43, 44, 45, and 46. In some embodiments, (a) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 195, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 91; (b) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 203, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 99; (c) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 204, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 100; (d) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 142, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 38; (e) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 207, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 103; (f) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 143, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 39; (g) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 197, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 93; (h) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 205, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 101; (i) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 206, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 102; (j) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 144, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 40; or (k) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 147, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 43; (l) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 148, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 44; (m) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 149, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 45; or (n) the antisense strand includes a nucleotide sequence shown in SEQ ID NO: 150, and the sense strand includes a nucleotide sequence shown in SEQ ID NO: 46. II. Modifications of nucleotides In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least 80% of the nucleotides of the sense strand are modified nucleotides, and / or at least 80% of the nucleotides of the antisense strand are modified nucleotides. In some embodiments, all the nucleotides of the sense strand and / or all the nucleotides of the antisense strand are modified nucleotides. Modifications of the nucleotides in the present invention may be modifications on phosphate groups, ribose groups and / or base groups of nucleotides. In some specific embodiments, the sense strand and the antisense strand each independently include one or more nucleotide modifications selected from the following group: 2’-O-methyl modified nucleotides, 2’-fluoro modified nucleotides, 2’-deoxy- modified nucleotides, inosine ribonucleotides, abasic nucleotides, reverse abasic deoxyribonucleotides, nucleotides containing a thiophosphate group, vinyl phosphate modified nucleotides, locked nucleotides, 2’-amino- modified nucleotides, 2’-alkyl- modified nucleotides, morpholino nucleotides, aminophosphates, unnatural bases containing nucleotides, and terminal nucleotides or deoxyribonucleotides linked to cholesterol-based derivatives or a sebacamide dodecanoate group. In some preferred embodiments, the sense strand and the antisense strand each independently include one or more nucleotide modifications selected from the following group: 2’-O-methyl modified nucleotides, 2’-fluoro modified nucleotides, deoxyribonucleotides, or nucleotides containing a thiophosphate group. In some preferred embodiments, the sense strand and / or the antisense strand includes at least 2 2’-fluoro modified nucleotides. In some preferred embodiments, the sense strand and / or the antisense strand includes at least 8 2’-O-methyl modified nucleotides. In some preferred embodiments, a 3’ end and / or a 5’ end of the sense strand and / or the antisense strand includes 1-5 thiophosphate groups, preferably 2-3 thiophosphate groups. In some preferred embodiments, the sense strand and / or the antisense strand includes an adenine deoxyribonucleotide, a thymine deoxyribonucleotide, a guanine deoxyribonucleotide, and / or a cytosine deoxyribonucleotide. In more preferred embodiments, the sense strand and / or the antisense strand includes a thymine deoxyribonucleotide. In most preferred embodiments, the sense strand includes a thymine deoxyribonucleotide. In some preferred embodiments, the antisense strand includes a modified nucleotide sequence shown in Table 5 of the specification, and / or the sense strand includes a modified nucleotide sequence shown in Table 4 of the specification. In some preferred embodiments, the siRNA includes a modified sense strand sequence and a modified antisense strand sequence that are paired as shown in Table 6 of the specification. In some specific embodiments, (a) the sense strand includes CmsUmsAmGmAmCmCfUmGfUmdTUmUmGmCmUmUmUmUmGmUm, and the antisense                               strand                               includes AmsCfsAmAfAfAfGmCfAmAfAmAfCmAfGmGfUmCfUmAmGmsAmsAm; (b)             the              sense              strand             includes CmsUmsAmGmAmCmCfUmGfUmdTUmUmGmCmUmUmUmUmGmsUm, and the antisense                               strand                               includes AmsCfsAmAfAfAfGmCfAmAfAmAfCmAfGmGfUmCfUmAmGmsAmsAm; (c)              the              sense              strand             includes UmsGmsUmUmUmUmGfCfUfUmUmUmGmUmAmAmCmsUmsUm, and the antisense                               strand                               includes AmsAfsGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmCfAmsGfsGm; (d)             the              sense              strand             includes UmsGmsUmUmUmUmGfCfUfUmUmUmGmUmAmAmCmUmsUm, and the antisense                               strand                               includes AmsAfsGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmCfAmsGfsGm; (e)              the              sense              strand             includes GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmsUmsAm, and the antisense                               strand                               includes UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm; (f)              the              sense              strand              includes GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmsUmsAm, and the antisense                               strand                               includes UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm; (g)             the              sense              strand             includes GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmUmsAm, and the antisense                               strand                               includes UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm; (h)             the              sense              strand             includes GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmUmAm, and the antisense                               strand                               includes UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm; (i)              the              sense              strand              includes UmsUmsUmUmGmCmUfUfUfUmGmUmAmAmCmUmUmsGmsAm, and the antisense                               strand                               includes UmsCfsAmAfGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmsCfsAm; (j)              the              sense              strand              includes UmsUmsUmUmGmCmUfUfUfUmGmUmAmAmCmUmUmsGmsAm, and the antisense                               strand                               includes UmsCfsAmAfGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmsCfsAm; (k)             the              sense              strand             includes UmsGmsCmUmUmUmUfGfUfAmAmCmUmUmGmAmAmsGmsAm, and the antisense                               strand                               includes UmsCfsUmUfCmAfAmGfUmUfAmCfAmAfAmAfGmCfAmsAfsAm; (l)              the              sense              strand              includes GmsCmsUmUmUmUmGfUfAfAmCmUmUmGmAmAmGmsAmsUm, and the antisense                               strand                               includes AmsUfsCmUfUmCfAmAfGmUfUmAfCmAfAmAfAmGfCmsAfsAm; (m)             the             sense             strand             includes CmsUmsUmUmUmGmUfAfAfCmUmUmGmAmAmGmAmsUmsAm, and the antisense                               strand                               includes UmsAfsUmCfUmUfCmAfAmGfUmUfAmCfAmAfAmAfGmsCfsAm; or (n)             the              sense              strand             includes UmsUmsUmUmGmUmAfAfCfUmUmGmAmAmGmAmUmsAmsUm, and the antisense                               strand                               includes AmsUfsAmUfCmUfUmCfAmAfGmUfUmAfCmAfAmAfAmsGfsCm. III. Ligand The siRNA of the present invention is further conjugated with a ligand moiety containing N-acetylgalactosamine through a phosphate group or a thiophosphate group. In preferred embodiments, the sense strand of the siRNA is conjugated with the ligand moiety through the phosphate group or the thiophosphate group. In some preferred embodiments, a 3’ end of the sense strand is conjugated with the ligand moiety through the phosphate group or the thiophosphate group. In other preferred embodiments, a 5’ end of the sense strand is conjugated with the ligand moiety through the phosphate group or the thiophosphate group. In some embodiments, the ligand moiety includes a conjugated group shown in Formula (X’): where, (X’) represents a position connected with a biomolecule; 10 is      independently H, Li L3 O 2 L4AcHN HO OH OH HN HN O O O L4—O l4—o AcHN HO L3 l4—o OH OH HO O AcHN OH OH HO O AcHN OH OH HN..... L3 l4—o HO O AcHN OH O HN" O l4—o L3 l4—o AcHN HO OH L3 l4—o OH HO O AcHN OH OH , HO O AcHN l4—0 AcHN OH OH HO OH OH , OH , HN HN or where L1 is a bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O))a-; L2 is a bond or -CH2CH2C(O)-; L3 is a bond, -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-; L4  is  -(OCH2CH2)c-,  -(OCH2CH2CH2)c-,  -(OCH2CH2CH2CH2)c-,  - (OCH2CH2CH2CH2CH2)c-, or -NHC(O)-(CH2)d-; where a is 0, 1, 2, or 3; b is 1, 2, 3, 4, or 5; c is 1, 2, 3, 4, or 5; d is 1, 2, 3, 4, 5, 6, 7, or 8; L is a bond, -CH2O-, or -NHC(O)-; L’ is a bond, -C(O)NH-, -NHC(O)-, or -O(CH2CH2O)e-; where e is 1, 2, 3, 4, or 5; T is a bond, -CH2-, -C(O)-, -M-, -CH2-M-, or -C(O)-M-; where M is        HCH HO"!, or R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H; or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H; where R is -OR’, -CH2OR’, or -CH2CH2OR’, where R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the conjugated group is shown in Formula (I’): Q                   R-i R2 0           r3 (I’) where, represents a position connected with a biomolecule; Q      is      independently 0 H, 0H -OH OH OH ,                         or > 0H -OH OH -OH ; where L1 is a bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O))a-; L2 is a bond or -CH2CH2C(O)-; L3 is a bond, -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-; L4 is -(OCH2CH2)c-, -(OCH2CH2CH2)c-, -(OCH2CH2CH2CH2)c-,  - (OCH2CH2CH2CH2CH2)c-, or -NHC(O)-(CH2)d-; where a is 0, 1, 2, or 3; b is 1, 2, 3, 4, or 5; c is 1, 2, 3, 4, or 5; d is 1, 2, 3, 4, 5, 6, 7, or 8; L is -CH2O- or -NHC(O)-; L’ is a bond, -C(O)NH-, or -NHC(O)-; R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H; or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H; where R is -OR’, -CH2OR’, or -CH2CH2OR’, where R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some specific embodiments, where, the Q is independently H or where the L1 is -CH2O- or -NHC(O)-(CH2NHC(O))a-; the L2 is -CH2CH2C(O)-; the L3 is -(NHCH2CH2)b- or -(NHCH2CH2CH2)b-; the L4 is -(OCH2CH2)c- or -NHC(O)-(CH2)d-; where the a is 0, 1, 2, or 3; the b is 1, 2, 3, 4, or 5; the c is 1, 2, 3, 4, or 5; the d is 1, 2, 3, 4, 5, 6, 7, or 8; the L is -CH2O-; the L’ is a bond; the R1 and the R2 together form -CH2CH2O- or -CH2CH(R)-O-, and the R3 is H; or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H; where the R is -OR’, -CH2OR’, or -CH2CH2OR’, where the R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; the m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and the n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the conjugated group is shown in Formula (I’-1), Formula (I’-2), or Formula (I’-3): 0                      (I’-1),               0                      (I’-2), or where, (I’-3) represents a position connected with a biomolecule; Q is where L1 is -CH2O- or -NHC(O)-; L2 is -CH2CH2C(O)-; L3 is -(NHCH2CH2)b- or -(NHCH2CH2CH2)b-; L4 is -(OCH2CH2)c- or -NHC(O)-(CH2)d-; where b is 1, 2, 3, 4, or 5; c is 1, 2, 3, 4, or 5; 5                  d is 1, 2, 3, 4, 5, 6, 7, or 8; L is -CH2O-; R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; and n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. 10 In some specific embodiments, where, 15 the Q is independently or where the L1 is -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O))a-; the L2 is -CH2CH2C(O)-; the L3 is -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-; the L4 is -(OCH2CH2)c- or -NHC(O)-(CH2)d-; where the a is 0, 1, 2, or 3; the b is 1, 2, 3, 4, or 5; the c is 1, 2, 3, 4, or 5; the d is 1, 2, 3, 4, 5, 6, 7, or 8; the L is -CH2O- or -NHC(O)-; the L’ is a bond or -C(O)NH-; the R1 and the R2 together form -CH2CH2O- or -CH2CH(R)-O-, and the R3 is H; or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H; where the R is -OR’, -CH2OR’, or -CH2CH2OR’, where the R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; the m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and the n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the conjugated group is shown in Formula (II’-1) or Formula (II’-2): where, (II’-1) or (II’-2) represents a position connected with a biomolecule; Q     is     independently where L1 is -CH2O- or -CH2O-CH2CH2O-; L3 is -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-; L4 is -(OCH2CH2)c- or -NHC(O)-(CH2)d-; 5                where b is 1, 2, 3, 4, or 5; c is 1, 2, 3, 4, or 5; d is 1, 2, 3, 4, 5, 6, 7, or 8; L is -NHC(O)-; L’ is a bond or -C(O)NH-; 10        R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. 15 In some specific embodiments, where, the Q is independently 0 or where the L1 is -CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O))a-; the L2 is a bond; the L3 is -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-; the L4 is -(OCH2CH2)c- or -NHC(O)-(CH2)d-; where the a is 0, 1, 2, or 3; the b is 1, 2, 3, 4, or 5; the c is 1, 2, 3, 4, or 5; the d is 1, 2, 3, 4, 5, 6, 7, or 8; the L is -CH2O- or -NHC(O)-; the L’ is a bond or -C(O)NH-; the R1 and the R2 together form -CH2CH2O- or -CH2CH(R)-O-, and the R3 is H; or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H; where the R is -OR’, -CH2OR’, or -CH2CH2OR’, where the R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; the m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and the n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the conjugated group is shown in Formula (II’-2): o                   (ir-2) where, represents a position connected with a biomolecule; Q is 0 independently where L1 is -CH2- or -C(O)-; L3 is -(NHCH2CH2)b-; L4 is -(OCH2CH2)c-; where b is 1, 2, 3, 4, or 5; c is 1, 2, 3, 4, or 5; L is -CH2O- or -NHC(O)-; R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective 10 group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; and n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. 15 In some specific embodiments, where, or where the L1 is a bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O))a-; the L2 is a bond or -CH2CH2C(O)-; the L3 is a bond, -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-; the L4 is -(OCH2CH2)c-, -(OCH2CH2CH2)c-, -(OCH2CH2CH2CH2)c-, - (OCH2CH2CH2CH2CH2)c-, or -NHC(O)-(CH2)d-; where the a is 0, 1, 2, or 3; the b is 1, 2, 3, 4, or 5; the c is 1, 2, 3, 4, or 5; the d is 1, 2, 3, 4, 5, 6, 7, or 8; the L is a bond, -CH2O-, or -NHC(O)-; the L’ is a bond, -C(O)NH-, -NHC(O)-, or -O(CH2CH2O)e-; where the e is 1, 2, 3, 4, or 5; the T is a bond, -CH2-, -M-, -CH2-M-, or -C(O)-M-; where the M is                 ,                 ,                 , or hO^ ; the R1 and the R2 together form -CH2CH2O- or -CH2CH(R)-O-, and the R3 is H; or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H; where the R is -OR’, -CH2OR’, or -CH2CH2OR’, where the R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; the m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and the n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some specific embodiments, where, the T is -M-, -CH2-M-, or -C(O)-M-, where the M is    \'   ,     \— /    , or ,. In some specific embodiments, where, HO OH % / U / L3 the Q is independently H or       2 4AcHN         ; where the L1 is -CH2O- or -NHC(O)-(CH2NHC(O))a-; the L2 is -CH2CH2C(O)-; the L3 is -(NHCH2CH2)b- or -(NHCH2CH2CH2)b-; the L4 is -(OCH2CH2)c- or -NHC(O)-(CH2)d-; where the a is 0, 1, 2, or 3; the b is 1, 2, 3, 4, or 5; the c is 1, 2, 3, 4, or 5; the d is 1, 2, 3, 4, 5, 6, 7, or 8; the L is a bond or -CH2O-; the L’ is a bond or -O(CH2CH2O)e-; where the e is 1, 2, 3, 4, or 5; the R1 and the R2 together form -CH2CH2O- or -CH2CH(R)-O-, and the R3 is H; or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H; where the R is -OR’, -CH2OR’, or -CH2CH2OR’, where the R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; the m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; the n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and the T is as defined according to the foregoing embodiments. In some embodiments, the conjugated group is shown in Formula (III’-1), Formula (III’-2), or Formula (III’-3): (III’-1), (III’-2), where L1 is -CH2O- or -NHC(O)-; L2 is -CH2CH2C(O)-; L3 is -(NHCH2CH2)b- or -(NHCH2CH2CH2)b-; L4 is -(OCH2CH2)c- or -NHC(O)-(CH2)d-; where b is 1, 2, 3, 4, or 5; c is 1, 2, 3, 4, or 5; d is 1, 2, 3, 4, 5, 6, 7, or 8; L is a bond or -CH2O-; where R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably    -C(O)CH2CH2C(O)OH    or 4,4’- dimethoxytriphenylmethyl; n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and T is as defined according to the foregoing embodiments. In some specific embodiments, where, the Q is independently H, , , or 10 15 ; where the L1 is -CH2-, -CH2O-, or -C(O)-; the L2 is a bond; the L3 is -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-; the L4 is -(OCH2CH2)c- or -NHC(O)-(CH2)d-; where the b is 1, 2, 3, 4, or 5; the c is 1, 2, 3, 4, or 5; the d is 1, 2, 3, 4, 5, 6, 7, or 8; the L is a bond or -NHC(O)-; the L’ is a bond; the R1 and the R2 together form -CH2CH2O- or -CH2CH(R)-O-, and the R3 is H; or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H; where the R is -OR’, -CH2OR’, or -CH2CH2OR’, where the R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; the m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; the n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and the T is as defined according to the foregoing embodiments. In some embodiments, the conjugated group is shown in Formula (IV-1) or Formula (IV-2): 10 where, ....... ....... 15 °x / ' (IV-1) or OR' (IV-2) is O O O O , , or ; where L1 is -CH2-, -CH2O-, or -C(O)-; L3 is -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-; L4 is -(OCH2CH2)c- or -NHC(O)-(CH2)d-; where b is 1, 2, 3, 4, or 5; c is 1, 2, 3, 4, or 5; d is 1, 2, 3, 4, 5, 6, 7, or 8; 10 L is a bond or -NHC(O)-; L’ is a bond; where R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably    -C(O)CH2CH2C(O)OH    or 4,4’- dimethoxytriphenylmethyl; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and T is as defined according to the foregoing embodiments. In some specific embodiments, where, 15 the Q is independently 0 or where the L1 is a bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O))a-; the L2 is a bond or -CH2CH2C(O)-; the L3 is a bond, -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-; the L4 is -(OCH2CH2)c-, -(OCH2CH2CH2)c-, -(OCH2CH2CH2CH2)c-, - (OCH2CH2CH2CH2CH2)c-, or -NHC(O)-(CH2)d-; where the a is 0, 1, 2, or 3; the b is 1, 2, 3, 4, or 5; the c is 1, 2, 3, 4, or 5; the d is 1, 2, 3, 4, 5, 6, 7, or 8; the L is a bond, -CH2O-, or -NHC(O)-; the L’ is -O(CH2CH2O)e-; where the e is 1, 2, 3, 4, or 5; the T is a bond, -CH2-, -C(O)-, -M-, -CH2-M-, or -C(O)-M-; where the M is                 ,                 ,                 , or fO ; the R1 and the R2 together form -CH2CH2O- or -CH2CH(R)-O-, and the R3 is H; or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H; where the R is -OR’, -CH2OR’, or -CH2CH2OR’, where the R’ is H, a hydroxyl protective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl; the m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and the n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some preferred embodiments, the conjugated group is selected from the following: Nu mbe Structure 11 12 14 15 16 In some preferred embodiments, the conjugated group is selected from the following: Nu mbe r Structure 17 HO / OH H°     NHAc    °        ).....NH HO .OH               \ X°                    / 0H 0 / \    N— / 0 n                / Xn hOx-x x / \<x /  >, /  9             r 9 NHAc 0 ( r HO / OH                   9 nxJH L hoA^a^°^ ).....x0 HO / OH                \ JU 18 HO .OH tU / A / U- / H°     NHAc °        2.....NH HV°H              ) / °                     / OH h0XX0XH 0 0     of NHAC       ( A, / / - xAG p   0 Xjv«y HO / OH                    0 , uj L H0^«Ae   0     ).....fl HO / OH                 \ Xa / xA 19 HO .OH                     o Hx - / H      / . HO ,0H           J   \Q          / ^N^^ / Oy VXS / °\ / X / \ / H^^O. / X CL / \ / N / J Ho-x^ / x / ^q / X /      x / X^x / X / x / NHAc                                                  II o           0 HO / OH \< n              H / \"°\ / °\ / X / X / ^'x ho-^xa / x / ^q / X / o NHAc 20 HO / OH V\ 0                       ,o hqA^0-^ NHAc                H j                    A^O x,J. /   ry-^.' X xAxy J HO ,0H                           f           ° XX / °\ / x / \ / 0 / ^., J* H°    NHAc °         H^b 22 23-1 24 25 27 28 In some embodiments, the ligand targets an asialoglycoprotein receptor (ASGPR). In one preferred embodiment, the ligand has the following structure: where        represents a position connected with the siRNA through the phosphate group or the thiophosphate group. In one preferred embodiment, the ligand has the following structure: where represents a position connected with the sense strand of the siRNA through the phosphate group or the thiophosphate group. In one preferred embodiment, the ligand has the following structure: represents a position connected with the sense strand of the siRNA where through the phosphate group or the thiophosphate group. IV. Inhibition of PCSK9 gene expression The siRNA of the present invention can inhibit PCSK9 gene expression by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. Inhibition of PCSK9 gene expression may be demonstrated by a decrease in an amount of an mRNA expressed by a first cell or cell population (such cell may present in, for example, a sample derived from a subject), where the PCSK9 gene is transcribed and the cell or these cells have been treated (for example, by making the cell or these cells contact with the siRNA of the present invention, or by giving the siRNA of the present invention to a subject in which the cells are present or previously present), such that the PCSK9 gene expression is inhibited compared with a second cell or cell population (one or more control cells) that is substantially identical to the first cell or cell population but has not been treated in this way. In preferred embodiments, the inhibition is evaluated by expressing a level of an mRNA in the treated cell as a percentage of a level of an mRNA in a control cell using a formula below. In some specific embodiments, a 2- Ct value is calculated to compare differences between an experimental group and a control group, where △△Ct=[(Ct value of a target gene in the experimental group-Ct value of an internal reference in the experimental group)-(Ct value of a target gene in the control group-Ct value of an internal reference in the control group)]. Alternatively, the PCSK9 gene expression, such as the inhibition of PCSK9 gene expression, can be evaluated based on a decrease of parameters (such as a lipid level, or a cholesterol level, such as an LDLc level) associated with functions of the PCSK9 gene expression. PCSK9 gene silencing can be determined in any cell that expresses PCSK9 through constitutive or genomic engineering and through any known assay in the field. A liver is a main site for PCSK9 expression. Other important expression sites include a pancreas, a kidney and intestines. Inhibition of PCSK9 protein expression can be demonstrated by a decrease in a PCSK9 protein level (such as a protein level expressed in a sample derived from a subject) expressed by a cell or cell population. As explained above in evaluation of mRNA inhibition, the inhibition of a protein expression level in a treated cell or cell population can be similarly expressed as a percentage of a protein level in a control cell or cell population. The control cell or cell population that can be used for evaluating the inhibition of PCSK9 gene expression include cells or cell populations that have not yet been getting in contact with the siRNA of the present invention. For example, the control cell or cell population can be derived from individual subjects (such as human beings or animal subjects) before the subjects are treated with the siRNA. V. Vector The present invention provides a vector, which includes a nucleotide sequence encoding the siRNA of the present invention. The vector of the present invention can amplify or express nucleotides that are connected thereto and encode the siRNA of the present invention. The siRNA targeting the PCSK9 gene can be expressed from a transcription unit inserted into a DNA or RNA vector. Expression can be transient (within several hours to several weeks) or sustained (several weeks to several months or longer), depending on a specific construct used and a target tissue or cell type. Nucleotides encoding the siRNA targeting the PCSK9 gene can be introduced into a linear construct, a circular plastid, or a viral vector. The nucleotides encoding the siRNA targeting the PCSK gene can be incorporated into a cell genome for stable expression, or be stably inherited and expressed outside chromosomes. In general, siRNA expression vectors are usually DNA plasmids or viral vectors. A viral vector system containing an encoding sequence of the siRNA targeting the PCSK9 gene includes, but is not limited to: (a) adenovirus vectors; (b) retroviral vectors; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) picornavirus vectors; (i) poxvirus vectors; and (j) helper virus-dependent adenoviruses or gutless adenoviruses. VI. Cell The present invention provides a cell, which includes the siRNA or the vector of the present invention, where the siRNA or the vector of the present invention can be transcribed in the cell. VII. Pharmaceutical composition The present invention provides a pharmaceutical composition, which includes the siRNA, the vector or the cell of the present invention, and an optional pharmaceutically acceptable carrier or excipient. The “pharmaceutically acceptable” used herein refers such compounds, materials, compositions and / or dosage forms that are suitable for use in contact with tissues of human subjects and animal subjects without causing excessive toxicity, irritation, anaphylaxis or other problems or complications within a correct medical judgment range, commensurate with a reasonable benefit / risk ratio. Herein, the pharmaceutically acceptable carrier refers to a drug carrier that facilitates administration of the siRNA or the vector containing the encoding sequence or the cell to the human body and / or facilitates absorption or exertion of functions, for example, a diluent; an excipient, such as water; a filler, such as starch, sucrose, etc.; an adhesive, such as a cellulose derivative, alginate, gelatin, and polyvinylpyrrolidone; a wetting agent, such as glycerol; a disintegrating agent, such as agar, calcium carbonate, and sodium bicarbonate; an absorption enhancer, such as a quaternary ammonium compound; a surfactant, such as cetanol; an adsorption carrier, such as kaolin and bentonite; a lubricant, such as talc powder, calcium / magnesium stearate, polyethylene glycol, etc.. In addition, other adjuvants, such as a flavoring agent, a sweetener, etc., can also be added to the composition. For example, the pharmaceutical composition including the siRNA, the vector or the cell of the present invention may include a pharmaceutically acceptable diluent or slow-release matrix, and the siRNA or the vector of the present invention is embedded into the slow-release matrix. VIII. Kit The present invention provides a kit, which includes the siRNA, the vector or the cell of the present invention. The present invention further provides a kit for using the siRNA of the present invention and / or implementing a method of the present invention. Such a kit includes one or more of the siRNA, the vector or the cell of the present invention and may further include an operation instruction. The operation instruction may record an instruction for inhibiting PCSK9 expression in the cell by making the cell contact with the siRNA or the vector of the present invention at an amount that effectively inhibits the PCSK9 expression. In the case that the siRNA or the vector of the present invention is in contact with the cell in vitro, optionally, the kit of the present invention may also include a tool for making the cell contact with the siRNA or the vector of the present invention (such as, an injection device) or a tool for measuring an inhibitory effect of PCSK9 (such as, a device for measuring the inhibition of a PCSK9 mRNA or protein). Such device for measuring the inhibition of PCSK9 may include a device for obtaining a sample (such as, a plasma sample) from a subject. In the case that the siRNA or the vector of the present invention or the cell into which the siRNA or the vector has been introduced in vitro is administered to the body, the kit of the present invention may also optionally include a device for administering the siRNA, the vector or the cell of the present invention to a subject or a device for determining an effective therapeutic dose or an effective preventive dose. IX. Therapeutic method and pharmaceutical use The present invention provides a method for treating diseases or symptoms associated with expression of PCSK9 in a subject, and the method includes a step of administering the siRNA, the vector, the cell or the pharmaceutical composition of the present invention to the subject. In some embodiments, the diseases associated with expression of PCSK9 are cardiovascular diseases. In some preferred embodiments, the cardiovascular diseases are selected from hyperlipidemia, hypercholesterolemia, nonfamilial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous     familial     hypercholesterolemia,     heterozygous     familial hypercholesterolemia, coronary heart disease, myocardial infarction, stroke, or atherosclerosis. In some embodiments, the diseases associated with expression of PCSK9 are neoplastic diseases. In some preferred embodiments, the neoplastic diseases are selected from melanoma, hepatocellular carcinoma, or metastatic hepatic cancer. In some embodiments, the diseases associated with expression of PCSK9 are T cell-mediated inflammatory immune diseases. In some preferred embodiments, the T cell-mediated inflammatory immune diseases are selected from psoriasis, psoriatic arthritis, eczema, atopic dermatitis, urticaria, hormone-dependent dermatitis, rheumatoid arthritis, scleroderma, diabetes mellitus, chronic liver diseases, or lymphoma. In some embodiments, the method for treating diseases or symptoms associated with expression of PCSK9 in a subject in the present invention includes administering the siRNA or the pharmaceutical composition to the subject, including subcutaneous administration or intravenous administration. In some embodiments, the subject is a human patient. The present invention also relates to the siRNA, the vector, the cell or the pharmaceutical composition of the present invention that are used for treating diseases or symptoms associated with expression of PCSK9 in a subject. The present invention also relates to use of the siRNA, the vector, the cell or the pharmaceutical composition of the present invention in preparation of drugs for treatment of diseases or symptoms associated with expression of PCSK9 in a subject. The drugs of the present invention can be prepared into emulsions, micro-emulsions, and micro-particles. Sequence An RNA sequence provided by the present invention targets a human PCSK9 gene 5 (or a target gene, a target mRNA sequence, or a target sequence). Table 3. Nucleotide sequences of the sense strand and the antisense strand that target PCSK9 gene as used in the present invention SEQ   ID NO: Sense strand sequence (5’^ 3’) SE Q ID NO: Antisense strand sequence (5’^ 3’) 1 CCUACGUGGUGGUGCUGAA 105 UUCAGCACCACCACGUAGGUG 2 GGUGGAGGUGUAUCUCCUA 106 UAGGAGAUACACCUCCACCAG 3 GGGUCAUGGUCACCGACUU 107 AAGUCGGUGACCAUGACCCUG 4 CCUGGAGUUUAUUCGGAAA 108 UUUCCGAAUAAACUCCAGGCC 5 GCACCUGCUUUGUGUCACA 109 UGUGACACAAAGCAGGUGCUG 6 CCAAAGAUGUCAUCAAUGA 110 UCAUUGAUGACAUCUUUGGCA 7 GCUGUUUUGCAGGACUGUA 111 UACAGUCCUGCAAAACAGCUG 8 GGUCUGGAAUGCAAAGUCA 112 UGACUUUGCAUUCCAGACCUG 9 GGCUGGGGCUGAGCUUUAA 113 UUAAAGCUCAGCCCCAGCCCU 10 GCAGGAACUGAGCCAGAAA 114 UUUCUGGCUCAGUUCCUGCUG 11 CCAAGCAAGCAGACAUUUA 115 UAAAUGUCUGCUUGCUUGGGU 12 CUGUCCUCUCUGUUGCCUU 116 AAGGCAACAGAGAGGACAGAC 13 UGUCCUCUCUGUUGCCUUU 117 AAAGGCAACAGAGAGGACAGA 14 GUCCUCUCUGUUGCCUUUU 118 AAAAGGCAACAGAGAGGACAG 15 UCCUCUCUGUUGCCUUUUU 119 AAAAAGGCAACAGAGAGGACA 16 CCUCUCUGUUGCCUUUUUA 120 UAAAAAGGCAACAGAGAGGAC 17 CUCUCUGUUGCCUUUUUAU 121 AUAAAAAGGCAACAGAGAGGA 18 UCUCUGUUGCCUUUUUACA 122 UGUAAAAAGGCAACAGAGAGG 19 CUCUGUUGCCUUUUUACAA 123 UUGUAAAAAGGCAACAGAGAG 20 UCUGUUGCCUUUUUACAGA 124 UCUGUAAAAAGGCAACAGAGA 21 CUGUUGCCUUUUUACAGCA 125 UGCUGUAAAAAGGCAACAGAG 22 UGUUGCCUUUUUACAGCCA 126 UGGCUGUAAAAAGGCAACAGA 23 GUUGCCUUUUUACAGCCAA 127 UUGGCUGUAAAAAGGCAACAG 24 UUGCCUUUUUACAGCCAAA 128 UUUGGCUGUAAAAAGGCAACA 25 ACUUUUCUAGACCUGUUUU 129 AAAACAGGUCUAGAAAAGUUG 26 CUUUUCUAGACCUGUUUUA 130 UAAAACAGGUCUAGAAAAGUU 27 UUUUCUAGACCUGUUUUGA 131 UCAAAACAGGUCUAGAAAAGU 28 UUUCUAGACCUGUUUUGCU 132 AGCAAAACAGGUCUAGAAAAG 29 UUCUAGACCUGUUUUGCUU 133 AAGCAAAACAGGUCUAGAAAA 30 UCUAGACCUGUUUUGCUUU 134 AAAGCAAAACAGGUCUAGAAA 31 CUAGACCUGUUUUGCUUUU 135 AAAAGCAAAACAGGUCUAGAA 32 UAGACCUGUUUUGCUUUUA 136 UAAAAGCAAAACAGGUCUAGA 33 AGACCUGUUUUGCUUUUGU 137 ACAAAAGCAAAACAGGUCUAG 34 GACCUGUUUUGCUUUUGUA 138 UACAAAAGCAAAACAGGUCUA 35 ACCUGUUUUGCUUUUGUAA 139 UUACAAAAGCAAAACAGGUCU 36 CCUGUUUUGCUUUUGUAAA 140 UUUACAAAAGCAAAACAGGUC 37 CUGUUUUGCUUUUGUAACU 141 AGUUACAAAAGCAAAACAGGU 38 UGUUUUGCUUUUGUAACUU 142 AAGUUACAAAAGCAAAACAGG 39 GUUUUGCUUUUGUAACUUA 143 UAAGUUACAAAAGCAAAACAG 40 UUUUGCUUUUGUAACUUGA 144 UCAAGUUACAAAAGCAAAACA 41 UUUGCUUUUGUAACUUGAA 145 UUCAAGUUACAAAAGCAAAAC 42 UUGCUUUUGUAACUUGAAA 146 UUUCAAGUUACAAAAGCAAAA 43 UGCUUUUGUAACUUGAAGA 147 UCUUCAAGUUACAAAAGCAAA 44 GCUUUUGUAACUUGAAGAU 148 AUCUUCAAGUUACAAAAGCAA 45 CUUUUGUAACUUGAAGAUA 149 UAUCUUCAAGUUACAAAAGCA 46 UUUUGUAACUUGAAGAUAU 150 AUAUCUUCAAGUUACAAAAGC 47 UUUGUAACUUGAAGAUAUU 151 AAUAUCUUCAAGUUACAAAAG 48 UUGUAACUUGAAGAUAUUU 152 AAAUAUCUUCAAGUUACAAAA 49 UGUAACUUGAAGAUAUUUA 153 UAAAUAUCUUCAAGUUACAAA 50 GUAACUUGAAGAUAUUUAU 154 AUAAAUAUCUUCAAGUUACAA 51 UAACUUGAAGAUAUUUAUU 155 AAUAAAUAUCUUCAAGUUACA 52 AACUUGAAGAUAUUUAUUA 156 UAAUAAAUAUCUUCAAGUUAC 53 ACUUGAAGAUAUUUAUUCU 157 AGAAUAAAUAUCUUCAAGUUA 54 CUUGAAGAUAUUUAUUCUA 158 UAGAAUAAAUAUCUUCAAGUU 55 UUGAAGAUAUUUAUUCUGA 159 UCAGAAUAAAUAUCUUCAAGU 56 UGAAGAUAUUUAUUCUGGA 160 UCCAGAAUAAAUAUCUUCAAG 57 GAAGAUAUUUAUUCUGGGU 161 ACCCAGAAUAAAUAUCUUCAA 58 AAGAUAUUUAUUCUGGGUU 162 AACCCAGAAUAAAUAUCUUCA 59 AGAUAUUUAUUCUGGGUUU 163 AAACCCAGAAUAAAUAUCUUC 60 GAUAUUUAUUCUGGGUUUU 164 AAAACCCAGAAUAAAUAUCUU 61 AUAUUUAUUCUGGGUUUUA 165 UAAAACCCAGAAUAAAUAUCU 62 UAUUUAUUCUGGGUUUUGU 166 ACAAAACCCAGAAUAAAUAUC 63 AUUUAUUCUGGGUUUUGUA 167 UACAAAACCCAGAAUAAAUAU 64 UUUAUUCUGGGUUUUGUAA 168 UUACAAAACCCAGAAUAAAUA 65 UUAUUCUGGGUUUUGUAGA 169 UCUACAAAACCCAGAAUAAAU 66 UAUUCUGGGUUUUGUAGCA 170 UGCUACAAAACCCAGAAUAAA 67 AUUCUGGGUUUUGUAGCAU 171 AUGCUACAAAACCCAGAAUAA 68 UUCUGGGUUUUGUAGCAUU 172 AAUGCUACAAAACCCAGAAUA 69 UCUGGGUUUUGUAGCAUUU 173 AAAUGCUACAAAACCCAGAAU 70 CUGGGUUUUGUAGCAUUUU 174 AAAAUGCUACAAAACCCAGAA 71 UGGGUUUUGUAGCAUUUUU 175 AAAAAUGCUACAAAACCCAGA 72 GGGUUUUGUAGCAUUUUUA 176 UAAAAAUGCUACAAAACCCAG 73 GGUUUUGUAGCAUUUUUAU 177 AUAAAAAUGCUACAAAACCCA 74 GUUUUGUAGCAUUUUUAUU 178 AAUAAAAAUGCUACAAAACCC 75 UUUUGUAGCAUUUUUAUUA 179 UAAUAAAAAUGCUACAAAACC 76 UUUGUAGCAUUUUUAUUAA 180 UUAAUAAAAAUGCUACAAAAC 77 UUGUAGCAUUUUUAUUAAU 181 AUUAAUAAAAAUGCUACAAAA 78 UGUAGCAUUUUUAUUAAUA 182 UAUUAAUAAAAAUGCUACAAA 79 GUAGCAUUUUUAUUAAUAU 183 AUAUUAAUAAAAAUGCUACAA 80 UAGCAUUUUUAUUAAUAUA 184 UAUAUUAAUAAAAAUGCUACA 81 AGCAUUUUUAUUAAUAUGA 185 UCAUAUUAAUAAAAAUGCUAC 82 GGUGACUUUUUAAAAUAAA 186 UUUAUUUUAAAAAGUCACCAU 83 GUGACUUUUUAAAAUAAAA 187 UUUUAUUUUAAAAAGUCACCA 84 UGACUUUUUAAAAUAAAAA 188 UUUUUAUUUUAAAAAGUCACC 85 GACUUUUUAAAAUAAAAAU 189 AUUUUUAUUUUAAAAAGUCAC 86 ACUUUUUAAAAUAAAAACA 190 UGUUUUUAUUUUAAAAAGUCA 87 CUUUUUAAAAUAAAAACAA 191 UUGUUUUUAUUUUAAAAAGUC 88 UUUUUAAAAUAAAAACAAA 192 UUUGUUUUUAUUUUAAAAAGU 89 UUUUAAAAUAAAAACAAAU 193 AUUUGUUUUUAUUUUAAAAAG 90 UUUAAAAUAAAAACAAACA 194 UGUUUGUUUUUAUUUUAAAAA 91 CUAGACCUGUdTUUGCUUUUG U 195 ACAAAAGCAAAACAGGUCUAGA A 92 UGUUUUGCUUUUGUAACUU 196 AAGUUACAAAAGCAAAACAGG 93 GUUUUGCUUUUGUAACUUA 197 UAAGUUACAAAAGCAAAACAG 94 UUUUGCUUUUGUAACUUGA 198 UCAAGUUACAAAAGCAAAACA 95 UGCUUUUGUAACUUGAAGA 199 UCUUCAAGUUACAAAAGCAAA 96 GCUUUUGUAACUUGAAGAU 200 AUCUUCAAGUUACAAAAGCAA 97 CUUUUGUAACUUGAAGAUA 201 UAUCUUCAAGUUACAAAAGCA 98 UUUUGUAACUUGAAGAUAU 202 AUAUCUUCAAGUUACAAAAGC 99 CUAGACCUGUdTUUGCUUUUG U 203 ACAAAAGCAAAACAGGUCUAGA A 100 CUAGACCUGUdTUUGCUUUUG U 204 ACAAAAGCAAAACAGGUCUAGA A 101 GUUUUGCUUUUGUAACUUA 205 UAAGUUACAAAAGCAAAACAG 102 GUUUUGCUUUUGUAACUUA 206 UAAGUUACAAAAGCAAAACAG 103 UGUUUUGCUUUUGUAACUU 207 AAGUUACAAAAGCAAAACAGG 104 UGCUUUUGUAACUUGAAGA 208 UCUUCAAGUUACAAAAGCAAA Table 4 shows modified RNA sequences used in the present invention. Herein, meanings of abbreviation are as follows: A, U, G and C represents a natural adenine ribonucleotide, a uracil ribonucleotide, a guanine ribonucleotide, and a cytosine ribonucleotide, respectively. d represents that the right side nucleotide is a deoxyribonucleotide. For example, dA, dT, dG and dC represent an adenine deoxyribonucleotide, a thymine deoxyribonucleotide, a guanine deoxyribonucleotide, and a cytosine deoxyribonucleotide, respectively. i represents an inosine ribonucleotide. m represents that the left side nucleotide is a 2’-OCH3 modified nucleotide. For example, Am, Um, Gm and Cm represent 2’-OCH3 modified A, U, G, and C. f represents that the left side nucleotide is a 2’-F modified nucleotide. For example, Af, Uf, Gf and Cf represent 2’-F modified A, U, G, and C, respectively. “s” or “s-” represents that the flanking two nucleotides and / or delivery vectors are connected by thiophosphate. VP represents that the right side nucleotide is a vinyl phosphonate modified nucleotide, which is well known in the field, with reference to, for example, PCT publication No. WO2011139702, No. WO2013033230, and No. WO2019105419. IB represents a reverse abasic deoxyribonucleotide, which can include the following three structures according to its position / connection mode in the siRNA. IB is well known in the field, with reference to, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16 and PCT publication No. WO2016011123 and No. WO2019051402, L96 represents a GalNAc delivery moiety having the following structure well known in the field, where represents a position connected to the siRNA through 5 a phosphate group or a thiophosphate group, with reference to, for example, PCT publication No. WO2009073809 and No. WO2009082607, NAG37 represents a GalNAc delivery moiety having the following structure well known in the field, where ' represents a position connected to the siRNA through 10 a phosphate group or a thiophosphate group, with reference to, for example, PCT publication No. WO2018044350, GL6 represents a GalNAc delivery moiety having the following structure, where represents a position connected to the siRNA through a phosphate group or a thiophosphate group, GL12 represents a GalNAc delivery moiety having the following structure, where ' represents a position connected to the siRNA through a phosphate group or a thiophosphate group, Table 4 Modified RNA sequences of the sense strand of the siRNA targeting PCSK9 gene as used in the present invention Single strand number Sequence (5’^ 3') SEQ ID NO: SR004482S CmsCmsUmAmCmGmUfGfGfUmGmGmUmGmCmUmGmsAmsAm 209 SR004483S GmsGmsUmGmGmAmGfGfUfGmUmAmUmCmUmCmCmsUmsAm 210 SR004484S GmsGmsGmUmCmAmUfGfGfUmCmAmCmCmGmAmCmsUmsUm 211 SR004485S CmsCmsUmGmGmAmGfUfUfUmAmUmUmCmGmGmAmsAmsAm 212 SR004486S GmsCmsAmCmCmUmGfCfUfUmUmGmUmGmUmCmAmsCmsAm 213 SR004487S CmsCmsAmAmAmGmAfUfGfUmCmAmUmCmAmAmUmsGmsAm 214 SR004488S GmsCmsUmGmUmUmUfUfGfCmAmGmGmAmCmUmGmsUmsAm 215 SR004489S GmsGmsUmCmUmGmGfAfAfUmGmCmAmAmAmGmUmsCmsAm 216 SR004490S GmsGmsCmUmGmGmGfGfCfUmGmAmGmCmUmUmUmsAmsAm 217 SR004491S GmsCmsAmGmGmAmAfCfUfGmAmGmCmCmAmGmAmsAmsAm 218 SR004492S CmsCmsAmAmGmCmAfAfGfCmAmGmAmCmAmUmUmsUmsAm 219 SR004493S CmsUmsGmUmCmCmUfCfUfCmUmGmUmUmGmCmCmsUmsUm 220 SR004494S UmsGmsUmCmCmUmCfUfCfUmGmUmUmGmCmCmUmsUmsUm 221 SR004495S GmsUmsCmCmUmCmUfCfUfGmUmUmGmCmCmUmUmsUmsUm 222 SR004496S UmsCmsCmUmCmUmCfUfGfUmUmGmCmCmUmUmUmsUmsUm 223 SR004497S CmsCmsUmCmUmCmUfGfUfUmGmCmCmUmUmUmUmsUmsAm 224 SR004498S CmsUmsCmUmCmUmGfUfUfGmCmCmUmUmUmUmUmsAmsUm 225 SR004499S UmsCmsUmCmUmGmUfUfGfCmCmUmUmUmUmUmAmsCmsAm 226 SR004500S CmsUmsCmUmGmUmUfGfCfCmUmUmUmUmUmAmCmsAmsAm 227 SR004501S UmsCmsUmGmUmUmGfCfCfUmUmUmUmUmAmCmAmsGmsAm 228 SR004502S CmsUmsGmUmUmGmC fCfUfUmUmUmUmAmCmAmGmsCmsAm 229 SR004503S UmsGmsUmUmGmCmCfUfUfUmUmUmAmCmAmGmCmsCmsAm 230 SR004504S GmsUmsUmGmCmCmUfUfUfUmUmAmCmAmGmCmCmsAmsAm 231 SR004505S UmsUmsGmCmCmUmUfUfUfUmAmCmAmGmCmCmAmsAmsAm 232 SR004506S AmsCmsUmUmUmUmCfUfAfGmAmCmCmUmGmUmUmsUmsUm 233 SR004507S CmsUmsUmUmUmCmUfAfGfAmCmCmUmGmUmUmUmsUmsAm 234 SR004508S UmsUmsUmUmCmUmAfGfAfCmCmUmGmUmUmUmUmsGmsAm 235 SR004509S UmsUmsUmCmUmAmGfAfCfCmUmGmUmUmUmUmGmsCmsUm 236 SR004510S UmsUmsCmUmAmGmAfC fC fUmGmUmUmUmUmGmCmsUmsUm 237 SR004511S UmsCmsUmAmGmAmCfCfUfGmUmUmUmUmGmCmUmsUmsUm 238 SR004512S CmsUmsAmGmAmCmCfUfGfUmUmUmUmGmCmUmUmsUmsUm 239 SR004513S UmsAmsGmAmCmCmUfGfUfUmUmUmGmCmUmUmUmsUmsAm 240 SR004514S AmsGmsAmCmCmUmGfUfUfUmUmGmCmUmUmUmUmsGmsUm 241 SR004515S GmsAmsCmCmUmGmUfUfUfUmGmCmUmUmUmUmGmsUmsAm 242 SR004516S AmsCmsCmUmGmUmUfUfUfGmCmUmUmUmUmGmUmsAmsAm 243 SR004517S CmsCmsUmGmUmUmUfUfGfCmUmUmUmUmGmUmAmsAmsAm 244 SR004518S CmsUmsGmUmUmUmUfGfC fUmUmUmUmGmUmAmAmsCmsUm 245 SR004519S UmsGmsUmUmUmUmGfCfUfUmUmUmGmUmAmAmCmsUmsUm 246 SR004520S GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmsUmsAm 247 SR004521S UmsUmsUmUmGmCmUfUfUfUmGmUmAmAmCmUmUmsGmsAm 248 SR004522S UmsUmsUmGmCmUmUfUfUfGmUmAmAmCmUmUmGmsAmsAm 249 SR004523S UmsUmsGmCmUmUmUfUfGfUmAmAmCmUmUmGmAmsAmsAm 250 SR004524S UmsGmsCmUmUmUmUfGfUfAmAmCmUmUmGmAmAmsGmsAm 251 SR004525S GmsCmsUmUmUmUmGfUfAfAmCmUmUmGmAmAmGmsAmsUm 252 SR004526S CmsUmsUmUmUmGmUfAfAfCmUmUmGmAmAmGmAmsUmsAm 253 SR004527S UmsUmsUmUmGmUmAfAfCfUmUmGmAmAmGmAmUmsAmsUm 254 SR004528S UmsUmsUmGmUmAmAfCfUfUmGmAmAmGmAmUmAmsUmsUm 255 SR004529S UmsUmsGmUmAmAmCfUfUfGmAmAmGmAmUmAmUmsUmsUm 256 SR004530S UmsGmsUmAmAmCmUfUfGfAmAmGmAmUmAmUmUmsUmsAm 257 SR004531S GmsUmsAmAmCmUmUfGfAfAmGmAmUmAmUmUmUmsAmsUm 258 SR004532S UmsAmsAmCmUmUmGfAfAfGmAmUmAmUmUmUmAmsUmsUm 259 SR004533S AmsAmsCmUmUmGmAfAfGfAmUmAmUmUmUmAmUmsUmsAm 260 SR004534S AmsCmsUmUmGmAmAfGfAfUmAmUmUmUmAmUmUmsCmsUm 261 SR004535S CmsUmsUmGmAmAmGfAfUfAmUmUmUmAmUmUmCmsUmsAm 262 SR004536S UmsUmsGmAmAmGmAfUfAfUmUmUmAmUmUmCmUmsGmsAm 263 SR004537S UmsGmsAmAmGmAmUfAfUfUmUmAmUmUmCmUmGmsGmsAm 264 SR004538S GmsAmsAmGmAmUmAfUfUfUmAmUmUmCmUmGmGmsGmsUm 265 SR004539S AmsAmsGmAmUmAmUfUfUfAmUmUmCmUmGmGmGmsUmsUm 266 SR004540S AmsGmsAmUmAmUmUfUfAfUmUmCmUmGmGmGmUmsUmsUm 267 SR004541S GmsAmsUmAmUmUmUfAfUfUmCmUmGmGmGmUmUmsUmsUm 268 SR004542S AmsUmsAmUmUmUmAfUfUfCmUmGmGmGmUmUmUmsUmsAm 269 SR004543S UmsAmsUmUmUmAmUfUfCfUmGmGmGmUmUmUmUmsGmsUm 270 SR004544S AmsUmsUmUmAmUmUfCfUfGmGmGmUmUmUmUmGmsUmsAm 271 SR004545S UmsUmsUmAmUmUmCfUfGfGmGmUmUmUmUmGmUmsAmsAm 272 SR004546S UmsUmsAmUmUmCmUfGfGfGmUmUmUmUmGmUmAmsGmsAm 273 SR004547S UmsAmsUmUmCmUmGfGfGfUmUmUmUmGmUmAmGmsCmsAm 274 SR004548S AmsUmsUmCmUmGmGfGfUfUmUmUmGmUmAmGmCmsAmsUm 275 SR004549S UmsUmsCmUmGmGmGfUfUfUmUmGmUmAmGmCmAmsUmsUm 276 SR004550S UmsCmsUmGmGmGmUfUfUfUmGmUmAmGmCmAmUmsUmsUm 277 SR004551S CmsUmsGmGmGmUmUfUfUfGmUmAmGmCmAmUmUmsUmsUm 278 SR004552S UmsGmsGmGmUmUmUfUfGfUmAmGmCmAmUmUmUmsUmsUm 279 SR004553S GmsGmsGmUmUmUmUfGfUfAmGmCmAmUmUmUmUmsUmsAm 280 SR004554S GmsGmsUmUmUmUmGfUfAfGmCmAmUmUmUmUmUmsAmsUm 281 SR004555S GmsUmsUmUmUmGmUfAfGfCmAmUmUmUmUmUmAmsUmsUm 282 SR004556S UmsUmsUmUmGmUmAfGfCfAmUmUmUmUmUmAmUmsUmsAm 283 SR004557S UmsUmsUmGmUmAmGfCfAfUmUmUmUmUmAmUmUmsAmsAm 284 SR004558S UmsUmsGmUmAmGmCfAfUfUmUmUmUmAmUmUmAmsAmsUm 285 SR004559S UmsGmsUmAmGmCmAfUfUfUmUmUmAmUmUmAmAmsUmsAm 286 SR004560S GmsUmsAmGmCmAmUfUfUfUmUmAmUmUmAmAmUmsAmsUm 287 SR004561S UmsAmsGmCmAmUmUfUfUfUmAmUmUmAmAmUmAmsUmsAm 288 SR004562S AmsGmsCmAmUmUmUfUfUfAmUmUmAmAmUmAmUmsGmsAm 289 SR004563S GmsGmsUmGmAmCmUfUfUfUmUmAmAmAmAmUmAmsAmsAm 290 SR004564S GmsUmsGmAmCmUmUfUfUfUmAmAmAmAmUmAmAmsAmsAm 291 SR004565S UmsGmsAmCmUmUmUfUfUfAmAmAmAmUmAmAmAmsAmsAm 292 SR004566S GmsAmsCmUmUmUmUfUfAfAmAmAmUmAmAmAmAmsAmsUm 293 SR004567S AmsCmsUmUmUmUmUfAfAfAmAmUmAmAmAmAmAmsCmsAm 294 SR004568S CmsUmsUmUmUmUmAfAfAfAmUmAmAmAmAmAmCmsAmsAm 295 SR004569S UmsUmsUmUmUmAmAfAfAfUmAmAmAmAmAmCmAmsAmsAm 296 SR004570S UmsUmsUmUmAmAmAfAfUfAmAmAmAmAmCmAmAmsAmsUm 297 SR004571S UmsUmsUmAmAmAmAfUfAfAmAmAmAmCmAmAmAmsCmsAm 298 SR004440S CmsUmsAmGmAmCmCfUmGfUmdTUmUmGmCmUmUmUmUmGmUm -L96 299 SR004676S UmsGmsUmUmUmUmGfCfUfUmUmUmGmUmAmAmCmsUmsUm-L96 300 SR004677S GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmsUmsAm-L96 301 SR004678S UmsUmsUmUmGmCmUfUfUfUmGmUmAmAmCmUmUmsGmsAm-L96 302 SR004679S UmsGmsCmUmUmUmUfGfUfAmAmCmUmUmGmAmAmsGmsAm-L96 303 SR004680S GmsCmsUmUmUmUmGfUfAfAmCmUmUmGmAmAmGmsAmsUm-L96 304 SR004681S CmsUmsUmUmUmGmUfAfAfCmUmUmGmAmAmGmAmsUmsAm-L96 305 SR004682S UmsUmsUmUmGmUmAfAfCfUmUmGmAmAmGmAmUmsAmsUm-L96 306 SR011225S CmsUmsAmGmAmCmCfUmGfUmdTUmUmGmCmUmUmUmUmGmsU ms-GL12 307 SR011239S CmsUmsAmGmAmCmCfUmGfUmdTUmUmGmCmUmUmUmUmGmsU ms-GL6 308 SR011269S GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmUmsAms-GL6 309 SR011272S GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmUmAm-GL6 310 SR011271S UmsGmsUmUmUmUmGfCfUfUmUmUmGmUmAmAmCmUmsUms-GL6 311 SR011273S UmsGmsCmUmUmUmUfGfUfAmAmCmUmUmGmAmAmsGmsAm-GL6 312 Table 5 Modified RNA sequences of the antisense strand of the siRNA targeting PCSK9 gene as used in the present invention Single   strand number Sequence (5‘^ 3') SEQ ID NO: SR004572A UmsUfsCmAfGmCfAmCfCmAfCmCfAmCfGmUfAmGfGmsUfsGm 313 SR004573A UmsAfsGmGfAmGfAmUfAmCfAmCfCmUfCmCfAmCfCmsAfsGm 314 SR004574A AmsAfsGmUfCmGfGmUfGmAfCmCfAmUfGmAfCmCfCmsUfsGm 315 SR004575A UmsUfsUmCfCmGfAmAfUmAfAmAfCmUfCmCfAmGfGmsCfsCm 316 SR004576A UmsGfsUmGfAmCfAmCfAmAfAmGfCmAfGmGfUmGfCmsUfsGm 317 SR004577A UmsCfsAmUfUmGfAmUfGmAfCmAfUmCfUmUfUmGfGmsCfsAm 318 SR004578A UmsAfsCmAfGmUfCmCfUmGfCmAfAmAfAmCfAmGfCmsUfsGm 319 SR004579A UmsGfsAmCfUmUfUmGfCmAfUmUfCmCfAmGfAmCfCmsUfsGm 320 SR004580A UmsUfsAmAfAmGfCmUfCmAfGmCfCmCfCmAfGmCfCmsCfsUm 321 SR004581A UmsUfsUmCfUmGfGmCfUmCfAmGfUmUfCmCfUmGfCmsUfsGm 322 SR004582A UmsAfsAmAfUmGfUmCfUmGfCmUfUmGfCmUfUmGfGmsGfsUm 323 SR004583A AmsAfsGmGfCmAfAmCfAmGfAmGfAmGfGmAfCmAfGmsAfsCm 324 SR004584A AmsAfsAmGfGmCfAmAfCmAfGmAfGmAfGmGfAmCfAmsGfsAm 325 SR004585A AmsAfsAmAfGmGfCmAfAmCfAmGfAmGfAmGfGmAfCmsAfsGm 326 SR004586A AmsAfsAmAfAmGfGmCfAmAfCmAfGmAfGmAfGmGfAmsCfsAm 327 SR004587A UmsAfsAmAfAmAfGmGfCmAfAmCfAmGfAmGfAmGfGmsAfsCm 328 SR004588A AmsUfsAmAfAmAfAmGfGmCfAmAfCmAfGmAfGmAfGmsGfsAm 329 SR004589A UmsGfsUmAfAmAfAmAfGmGfCmAfAmCfAmGfAmGfAmsGfsGm 330 SR004590A UmsUfsGmUfAmAfAmAfAmGfGmCfAmAfCmAfGmAfGmsAfsGm 331 SR004591A UmsCfsUmGfUmAfAmAfAmAfGmGfCmAfAmCfAmGfAmsGfsAm 332 SR004592A UmsGfsCmUfGmUfAmAfAmAfAmGfGmCfAmAfCmAfGmsAfsGm 333 SR004593A UmsGfsGmCfUmGfUmAfAmAfAmAfGmGfCmAfAmCfAmsGfsAm 334 SR004594A UmsUfsGmGfCmUfGmUfAmAfAmAfAmGfGmCfAmAfCmsAfsGm 335 SR004595A UmsUfsUmGfGmCfUmGfUmAfAmAfAmAfGmGfCmAfAmsCfsAm 336 SR004596A AmsAfsAmAfCmAfGmGfUmCfUmAfGmAfAmAfAmGfUmsUfsGm 337 SR004597A UmsAfsAmAfAmCfAmGfGmUfCmUfAmGfAmAfAmAfGmsUfsUm 338 SR004598A UmsCfsAmAfAmAfCmAfGmGfUmCfUmAfGmAfAmAfAmsGfsUm 339 SR004599A AmsGfsCmAfAmAfAmCfAmGfGmUfCmUfAmGfAmAfAmsAfsGm 340 SR004600A AmsAfsGmCfAmAfAmAfCmAfGmGfUmCfUmAfGmAfAmsAfsAm 341 SR004601A AmsAfsAmGfCmAfAmAfAmCfAmGfGmUfCmUfAmGfAmsAfsAm 342 SR004602A AmsAfsAmAfGmCfAmAfAmAfCmAfGmGfUmCfUmAfGmsAfsAm 343 SR004603A UmsAfsAmAfAmGfCmAfAmAfAmCfAmGfGmUfCmUfAmsGfsAm 344 SR004604A AmsCfsAmAfAmAfGmCfAmAfAmAfCmAfGmGfUmCfUmsAfsGm 345 SR004605A UmsAfsCmAfAmAfAmGfCmAfAmAfAmCfAmGfGmUfCmsUfsAm 346 SR004606A UmsUfsAmCfAmAfAmAfGmCfAmAfAmAfCmAfGmGfUmsCfsUm 347 SR004607A UmsUfsUmAfCmAfAmAfAmGfCmAfAmAfAmCfAmGfGmsUfsCm 348 SR004608A AmsGfsUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmAfGmsGfsUm 349 SR004609A AmsAfsGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmCfAmsGfsGm 350 SR004610A UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm 351 SR004611A UmsCfsAmAfGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmsCfsAm 352 SR004612A UmsUfsCmAfAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmsAfsCm 353 SR004613A UmsUfsUmCfAmAfGmUfUmAfCmAfAmAfAmGfCmAfAmsAfsAm 354 SR004614A UmsCfsUmUfCmAfAmGfUmUfAmCfAmAfAmAfGmCfAmsAfsAm 355 SR004615A AmsUfsCmUfUmCfAmAfGmUfUmAfCmAfAmAfAmGfCmsAfsAm 356 SR004616A UmsAfsUmCfUmUfCmAfAmGfUmUfAmCfAmAfAmAfGmsCfsAm 357 SR004617A AmsUfsAmUfCmUfUmCfAmAfGmUfUmAfCmAfAmAfAmsGfsCm 358 SR004618A AmsAfsUmAfUmCfUmUfCmAfAmGfUmUfAmCfAmAfAmsAfsGm 359 SR004619A AmsAfsAmUfAmUfCmUfUmCfAmAfGmUfUmAfCmAfAmsAfsAm 360 SR004620A UmsAfsAmAfUmAfUmCfUmUfCmAfAmGfUmUfAmCfAmsAfsAm 361 SR004621A AmsUfsAmAfAmUfAmUfCmUfUmCfAmAfGmUfUmAfCmsAfsAm 362 SR004622A AmsAfsUmAfAmAfUmAfUmCfUmUfCmAfAmGfUmUfAmsCfsAm 363 SR004623A UmsAfsAmUfAmAfAmUfAmUfCmUfUmCfAmAfGmUfUmsAfsCm 364 SR004624A AmsGfsAmAfUmAfAmAfUmAfUmCfUmUfCmAfAmGfUmsUfsAm 365 SR004625A UmsAfsGmAfAmUfAmAfAmUfAmUfCmUfUmCfAmAfGmsUfsUm 366 SR004626A UmsCfsAmGfAmAfUmAfAmAfUmAfUmCfUmUfCmAfAmsGfsUm 367 SR004627A UmsCfsCmAfGmAfAmUfAmAfAmUfAmUfCmUfUmCfAmsAfsGm 368 SR004628A AmsCfsCmCfAmGfAmAfUmAfAmAfUmAfUmCfUmUfCmsAfsAm 369 SR004629A AmsAfsCmCfCmAfGmAfAmUfAmAfAmUfAmUfCmUfUmsCfsAm 370 SR004630A AmsAfsAmCfCmCfAmGfAmAfUmAfAmAfUmAfUmCfUmsUfsCm 371 SR004631A AmsAfsAmAfCmCfCmAfGmAfAmUfAmAfAmUfAmUfCmsUfsUm 372 SR004632A UmsAfsAmAfAmCfCmCfAmGfAmAfUmAfAmAfUmAfUmsCfsUm 373 SR004633A AmsCfsAmAfAmAfCmCfCmAfGmAfAmUfAmAfAmUfAmsUfsCm 374 SR004634A UmsAfsCmAfAmAfAmCfCmCfAmGfAmAfUmAfAmAfUmsAfsUm 375 SR004635A UmsUfsAmCfAmAfAmAfCmCfCmAfGmAfAmUfAmAfAmsUfsAm 376 SR004636A UmsCfsUmAfCmAfAmAfAmCfCmCfAmGfAmAfUmAfAmsAfsUm 377 SR004637A UmsGfsCmUfAmCfAmAfAmAfCmCfCmAfGmAfAmUfAmsAfsAm 378 SR004638A AmsUfsGmCfUmAfCmAfAmAfAmCfCmCfAmGfAmAfUmsAfsAm 379 SR004639A AmsAfsUmGfCmUfAmCfAmAfAmAfCmCfCmAfGmAfAmsUfsAm 380 SR004640A AmsAfsAmUfGmCfUmAfCmAfAmAfAmCfCmCfAmGfAmsAfsUm 381 SR004641A AmsAfsAmAfUmGfCmUfAmCfAmAfAmAfCmCfCmAfGmsAfsAm 382 SR004642A AmsAfsAmAfAmUfGmCfUmAfCmAfAmAfAmCfCmCfAmsGfsAm 383 SR004643A UmsAfsAmAfAmAfUmGfCmUfAmCfAmAfAmAfCmCfCmsAfsGm 384 SR004644A AmsUfsAmAfAmAfAmUfGmCfUmAfCmAfAmAfAmCfCmsCfsAm 385 SR004645A AmsAfsUmAfAmAfAmAfUmGfCmUfAmCfAmAfAmAfCmsCfsCm 386 SR004646A UmsAfsAmUfAmAfAmAfAmUfGmCfUmAfCmAfAmAfAmsCfsCm 387 SR004647A UmsUfsAmAfUmAfAmAfAmAfUmGfCmUfAmCfAmAfAmsAfsCm 388 SR004648A AmsUfsUmAfAmUfAmAfAmAfAmUfGmCfUmAfCmAfAmsAfsAm 389 SR004649A UmsAfsUmUfAmAfUmAfAmAfAmAfUmGfCmUfAmCfAmsAfsAm 390 SR004650A AmsUfsAmUfUmAfAmUfAmAfAmAfAmUfGmCfUmAfCmsAfsAm 391 SR004651A UmsAfsUmAfUmUfAmAfUmAfAmAfAmAfUmGfCmUfAmsCfsAm 392 SR004652A UmsCfsAmUfAmUfUmAfAmUfAmAfAmAfAmUfGmCfUmsAfsCm 393 SR004653A UmsUfsUmAfUmUfUmUfAmAfAmAfAmGfUmCfAmCfCmsAfsUm 394 SR004654A UmsUfsUmUfAmUfUmUfUmAfAmAfAmAfGmUfCmAfCmsCfsAm 395 SR004655A UmsUfsUmUfUmAfUmUfUmUfAmAfAmAfAmGfUmCfAmsCfsCm 396 SR004656A AmsUfsUmUfUmUfAmUfUmUfUmAfAmAfAmAfGmUfCmsAfsCm 397 SR004657A UmsGfsUmUfUmUfUmAfUmUfUmUfAmAfAmAfAmGfUmsCfsAm 398 SR004658A UmsUfsGmUfUmUfUmUfAmUfUmUfUmAfAmAfAmAfGmsUfsCm 399 SR004659A UmsUfsUmGfUmUfUmUfUmAfUmUfUmUfAmAfAmAfAmsGfsUm 400 SR004660A AmsUfsUmUfGmUfUmUfUmUfAmUfUmUfUmAfAmAfAmsAfsGm 401 SR004661A UmsGfsUmUfUmGfUmUfUmUfUmAfUmUfUmUfAmAfAmsAfsAm 402 SR004442A AmsCfsAmAfAfAfGmCfAmAfAmAfCmAfGmGfUmCfUmAmGmsAm sAm 403 SR004609A AmsAfsGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmCfAmsGfsGm 404 SR004610A UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm 405 SR004611A UmsCfsAmAfGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmsCfsAm 406 SR004614A UmsCfsUmUfCmAfAmGfUmUfAmCfAmAfAmAfGmCfAmsAfsAm 407 SR004615A AmsUfsCmUfUmCfAmAfGmUfUmAfCmAfAmAfAmGfCmsAfsAm 408 SR004616A UmsAfsUmCfUmUfCmAfAmGfUmUfAmCfAmAfAmAfGmsCfsAm 409 SR004617A AmsUfsAmUfCmUfUmCfAmAfGmUfUmAfCmAfAmAfAmsGfsCm 410 SR004442A AmsCfsAmAfAfAfGmCfAmAfAmAfCmAfGmGfUmCfUmAmGmsAm sAm 411 SR004442A AmsCfsAmAfAfAfGmCfAmAfAmAfCmAfGmGfUmCfUmAmGmsAm sAm 412 SR004610A UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm 413 SR004610A UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm 414 SR004609A AmsAfsGmUfUmAfCmAfAmAfAmGfCmAfAmAfAmCfAmsGfsGm 415 SR004614A UmsCfsUmUfCmAfAmGfUmUfAmCfAmAfAmAfGmCfAmsAfsAm 416 Table 6 Paired modified sense strands and modified antisense strands of the siRNA targeting PCSK9 gene as used in the present invention Double strand number Sense strand number Antisense strand number DR002254 SR004482S SR004572A DR002255 SR004483S SR004573A DR002256 SR004484S SR004574A DR002257 SR004485S SR004575A DR002258 SR004486S SR004576A DR002259 SR004487S SR004577A DR002260 SR004488S SR004578A DR002261 SR004489S SR004579A DR002262 SR004490S SR004580A DR002263 SR004491S SR004581A DR002264 SR004492S SR004582A DR002265 SR004493S SR004583A DR002266 SR004494S SR004584A DR002267 SR004495S SR004585A DR002268 SR004496S SR004586A DR002269 SR004497S SR004587A DR002270 SR004498S SR004588A DR002271 SR004499S SR004589A DR002272 SR004500S SR004590A DR002273 SR004501S SR004591A DR002274 SR004502S SR004592A DR002275 SR004503S SR004593A DR002276 SR004504S SR004594A DR002277 SR004505S SR004595A DR002278 SR004506S SR004596A DR002279 SR004507S SR004597A DR002280 SR004508S SR004598A DR002281 SR004509S SR004599A DR002282 SR004510S SR004600A DR002283 SR004511S SR004601A DR002284 SR004512S SR004602A DR002285 SR004513S SR004603A DR002286 SR004514S SR004604A DR002287 SR004515S SR004605A DR002288 SR004516S SR004606A DR002289 SR004517S SR004607A DR002290 SR004518S SR004608A DR002291 SR004519S SR004609A DR002292 SR004520S SR004610A DR002293 SR004521S SR004611A DR002294 SR004522S SR004612A DR002295 SR004523S SR004613A DR002296 SR004524S SR004614A DR002297 SR004525S SR004615A DR002298 SR004526S SR004616A DR002299 SR004527S SR004617A DR002300 SR004528S SR004618A DR002301 SR004529S SR004619A DR002302 SR004530S SR004620A DR002303 SR004531S SR004621A DR002304 SR004532S SR004622A DR002305 SR004533S SR004623A DR002306 SR004534S SR004624A DR002307 SR004535S SR004625A DR002308 SR004536S SR004626A DR002309 SR004537S SR004627A DR002310 SR004538S SR004628A DR002311 SR004539S SR004629A DR002312 SR004540S SR004630A DR002313 SR004541S SR004631A DR002314 SR004542S SR004632A DR002315 SR004543S SR004633A DR002316 SR004544S SR004634A DR002317 SR004545S SR004635A DR002318 SR004546S SR004636A DR002319 SR004547S SR004637A DR002320 SR004548S SR004638A DR002321 SR004549S SR004639A DR002322 SR004550S SR004640A DR002323 SR004551S SR004641A DR002324 SR004552S SR004642A DR002325 SR004553S SR004643A DR002326 SR004554S SR004644A DR002327 SR004555S SR004645A DR002328 SR004556S SR004646A DR002329 SR004557S SR004647A DR002330 SR004558S SR004648A DR002331 SR004559S SR004649A DR002332 SR004560S SR004650A DR002333 SR004561S SR004651A DR002334 SR004562S SR004652A DR002335 SR004563S SR004653A DR002336 SR004564S SR004654A DR002337 SR004565S SR004655A DR002338 SR004566S SR004656A DR002339 SR004567S SR004657A DR002340 SR004568S SR004658A DR002341 SR004569S SR004659A DR002342 SR004570S SR004660A DR002343 SR004571S SR004661A DR002221 SR004440S SR004442A DR002358 SR004676S SR004609A DR002359 SR004677S SR004610A DR002360 SR004678S SR004611A DR002361 SR004679S SR004614A DR002362 SR004680S SR004615A DR002363 SR004681S SR004616A DR002364 SR004682S SR004617A DR005642 SR011225S SR004442A DR005656 SR011239S SR004442A DR005672 SR011269S SR004610A DR005675 SR011272S SR004610A DR005674 SR011271S SR004609A DR005676 SR011273S SR004614A DESCRIPTION OF THE EMBODIMENTS Unless otherwise specified, sources of raw materials used in the examples are as 5 follows: Huh7 cell line was purchased from Nanjing Cobioer, with an article No. CBP60202; Hep3B cell line was purchased from Nanjing Cobioer, with an article No. CBP60197; PHH cells were purchased from Shanghai Xuanyi, with an article No. QYLF-10 HPMC; HEK293A cell line was purchased from Nanjing Cobioer, with an article No. CBP60436; and Balb / c mice were purchased from Zhejiang Charles River, with an article No. Balb / c. Example 1 Preparation of a compound E7 1. 1. Preparation of an intermediate 3-4 1.1 1.1 Preparation of a compound 2 Cbz-OSu TEA 20 °C, 16 hrs 1                                                           2 Benzyl(2,5-dioxopyrrolidine-1-yl)carbonate (600 g, 2.40 mol) was slowly added to DCM (1.80 L) of a compound 1 (300 g, 2.01 mol) at 15°C, and TEA (203 g, 2.01 mol, 280 mL) was added dropwise. After the addition, a mixture was stirred at 25°C for 16 h. TLC (dichloromethane:methanol=10:1) showed that the reactant 1 (Rf=0.32) was retained and an important new point (Rf=0.52) was detected. The reaction mixture was washed with a saturated sodium bicarbonate solution (1.00 Lx2), and an organic phase was washed with a salt solution (1.00 L), dried with anhydrous Na2SO4 and concentrated under vacuum. A yellow oily compound 2 (about 385 g) was obtained without purification. 1.2 1.2 Preparation of a compound 2A 4 AC2O TEA DMAP 2A pyridine 0-25 °C, 16 hrs DMAP (19.8 g, 162 mmol) was added at one time to a pyridine solution (1.75 L) of a compound 4 (350 g, 1.62 mol, HCl) and Ac2O (994 g, 9.74 mol, 912 mL) at 0-15°C, and TEA (164 g, 1.62 mol, 226 mL) was added dropwise. A mixture was stirred at 25°C for 16 h. LCMS (product: RT=0.687 min) showed that initial reactants were completely consumed. EtOAc (1.40 L) was added to the mixture at 25°C and stirred for 30 min, then the mixture was filtered, and a filter cake was cleaned with EtOAc (300 mL). The filter cake was ground with water (1.45 L) at 25°C for 30 min. A mixture was filtered, and a filter cake was cleaned with water (175 mL*3) and then collected to obtain a white solid compound 2A (about 580 g). 1.3 Preparation of a compound 2B AcHN TMSOTf -------► DCM 10-25 °C, 12 hrs 2A                                  2B Three reactions were carried out in parallel. TMSOTf (137 g, 616 mmol, 111 mL) was added dropwise to a DCM solution (800 mL) of the compound 2A (200 g, 514 mmol) at 10-15°C for 0.5 h. Then, a mixture was stirred at 25°C for 3 h. TLC (dichloromethane:methanol=20:1) showed that the compound 2A (Rf=0.54) was completely consumed and a new point (Rf=0.24) was formed. The three reactions were combined. The mixture was cooled to 0-15°C and slowly poured to a NaHCO3 solution (300 g dissolved in 3.00 L of water) at 0-5°C. An organic phase was separated, and an aqueous phase was extracted with DCM (1.00 L*3). Organic layers were combined, dried with Na2SO4, filtered and concentrated under vacuum. A yellow oily compound 2B (about 507 g) was obtained and directly used in a next step without purification. 1.4 1.4 Preparation of a compound 3 NHCbz 2B TMSOTf DCM 0-20 °C, 12 hrs 3 TMSOTf (84.4 g, 380 mmol, 69.0 mL) was added dropwise to a mixture of the compound 2B (250 g, 759 mmol) and the compound 2 (151 g, 531 mmol) in DCM (1.00 L) at 0-10°C, and the mixture was stirred at 20°C for 12 h. TLC (dichloromethane:methanol=20:1) showed that the compound 2 (Rf=0.33) was completely consumed and an new point (Rf=0.03) was formed. Combined reactants were cooled to 0-5°C, and then the reactants were poured to NaHCO3 (aqueous solution, 100 g dissolved in 1 L of water) and stirred at 5-10°C for 10 min to separate phases. An aqueous phase was extracted with DCM (500 mL*2), combined organic phases were dried with Na2SO4 and filtered, and a filtrate was concentrated under vacuum. A yellow oily compound 3 (about 360 g) was obtained without purification. 1H NMR: (400 MHz, DMSO). 5=7.79-7.37 (m, 1H), 7.35-7.26 (m, 5H), 5.21-5.20 (m, 1H), 5.00-4.95 (m, 3H), 4.55-4.53 (m, 1H), 4.03-3.86 (m, 3H), 3.61-3.59 (m, 1H), 3.59-3.57 (m, 1H), 3.48-3.40 (m, 6H), 3.39-3.31 (m, 2H), 3.14-3.13 (m, 2H), 2.09 (s, 3H), 1.99 (s, 3H), 1.88 (s, 3H), 1.76-1.74 (m, 3H). 1.5 1.5 Preparation of an intermediate 3-4 (TFA salt) 3                                                          ¢10)^3-4 (TFA salt) Three reactions were carried out in parallel. The compound 3 (180 g, 293 mmol) and TFA (33.5 g, 293 mmol, 21.8 mL) were added to a mixture of Pd / C (18.0 g, 16.3 mmol, content: 10%) in THF (1.80 L) in an argon atmosphere. A suspension was subjected to degasification and hydrogen ventilation for three times. The mixture was stirred in H2 (50 Psi) at 30°C for 2 h. LCMS (product: RT=0.697 min) showed that the compound 3 was consumed and a product peak was detected. The three reactions were combined. The mixture was filtered with celite, and a filtrate was concentrated under reduced pressure to remove a solvent. A yellow solid intermediate 3-4 (TFA salt) (393 g, 660 mmol, yield: 74.8%, purity: 99.6%, TFA) was obtained without purification. 1H NMR: (400 MHz, DMSO-d6) 5=7.92 (d, J = 9.1 Hz, 4H), 5.27-5.17 (m, 1H), 5.03-4.91 (m, 1H), 4.60-4.50 (m, 1H), 4.09-3.97 (m, 4H), 3.85 (s, 2H), 3.65-3.46 (m, 10H), 3.04-2.92 (m, 2H), 2.10 (s, 3H), 2.00 (s, 3H), 1.94-1.86 (m, 3H), 1.82-1.71 (m, 4H). 2. 2. Preparation of an intermediate 3-3 2.1 2.1 Preparation of a compound 5 0    0 NHCbz 4B DIEA, HBTU, DCM 25 °C, 16.5 h 3-4                                                                                                   5 DIEA (30.3 g, 234 mmol, 40.8 mL, 6.60 eq) was added at one time to a DCM solution (1.00 L) of a compound 4B (10.0 g, 35.5 mmol, 1.00 eq) and the compound 34 prepared above (46.3 g, 78.2 mmol, 2.20 eq, TFA) at 25°C. Stirring was carried out at 25°C for half an hour. HBTU (30.3 g, 234 mmol, 40.8 mL, 6.60 eq) was added to a mixture. Stirring was carried out at 25°C for 16 h. LCMS (product: RT=0.681 mins) showed that a reaction was completed. The mixture was concentrated under vacuum. 0.50 N HCl (200 mL*2) was added to the mixture at 20°C, and the mixture was extracted with DCM (3*500 mL). Organic layers were combined, cleaned with saturated NaHCOs (3*800 mL) until a pH value was 8, cleaned with a salt solution (3*500 mL), dried with Na2SO4, concentrated under vacuum and purified. A residue was purified by column chromatography (SiO2, DCM: MeOH=50:1 to 15:1). The residue was concentrated under vacuum at 40°C and purified by preparative-MPLC (column: 800 g Agela C18; mobile phase: [water-ACN]; 15-45%, 25 min; 45%, 10 min). Vacuum drying was carried out to obtain a yellow solid compound 5 (about 180 g+75.0 g+87.0 g+40.0 g+38.0 g). 417.0 g of the compound 3-4 was converted into the compound 5 in 9 batches. 2.2 Preparation of an intermediate 3-3 AcO OAc AcO OAc 5                                                                                               3-3 The compound 5 (73.0 g, 61.7 mmol, 1.00 eq) and TFA (7.04 g, 61.7 mmol, 4.57 mL, 1.00 eq) were added to THF (300 mL) of Pd / C (3.00 g, content: 10%) in an argon atmosphere. A suspension was subjected to degasification and hydrogen ventilation for three times. Stirring was carried out in H2 (20 Psi) at 20°C for 16 h. TLC (dichloromethane:methanol=8: 1, Rf=0.0) showed that a reaction was completed. A mixture was filtered with celite, and a filtrate was concentrated under increased pressure to remove a solvent so as to obtain a white solid compound 3-3 (about 33.4 g+129 g+75.0 g). 1H NMR: (400 MHz, DMSO) 3=8.53 (t, J = 5.2 Hz, 1H), 8.18 (d, J = 2.4 Hz, 3H), 8.03 (t, J = 5.2 Hz, 1H), 7.84 (dd, J = 3.6 Hz, 2H), 5.22 (d, J = 3.2 Hz, 2H), 4.96 (dd, J = 3.2 Hz, 2H), 4.55 (d, J =8.4 Hz, 2H), 4.02 (t, J =8.8 Hz, 6H), 3.77-3.59 (m, 5H), 3.58-3.45 (m, 21H), 3.40-3.20 (m, 4H), 2.18 (t, J = 7.6 Hz, 2H), 2.17 (d, J =8.0 Hz, 6H), 2.10 (s, 6H), 1.99 (s, 6H), 1.901.80 (m, 8H), 1.77 (s, 6H). 3. 3. Preparation of a compound E7 3.1 Preparation of a compound 3 A compound 1 (2.00 g, 1.87 mmol, prepared by a method of the intermediate 3-3) was dissolved in DCM (20.0 mL) at room temperature, DIEA (0.135 mL, 0.814 mmol) and a compound 2 (0.550 g, 0.814 mmol) were sequentially added to a resulting solution, and nitrogen replacement was carried out for 3 times. A reaction mixture was stirred at 25°C for 16 h. Liquid chromatography-mass spectrometry detected an MS response of a product. Thin layer chromatography (dichloromethane / methanol=5 / 1) showed that raw materials disappeared and a new point was generated. A reaction solution was concentrated under reduced pressure, and a resulting crude product was purified by column chromatography (dichloromethane / methanol=5 / 1) to obtain a white solid compound 3 (about 780 mg). 1H NMR (400 MHz, CD3OD) 3=7.28-7.42 (m, 5H), 5.30-5.34 (m, 4H), 5.04-5.14 (m, 6H), 4.63-4.67 (m, 4H), 4.36-4.44 (m, 2H), 4.00-4.20 (m, 23H), 3.91-3.95 (m, 4H), 3.69-3.77 (m, 9H), 3.523.67 (m, 32H), 3.34-3.43 (m, 9H), 2.29-2.31 (m, 4H), 2.14 (s, 12H), 2.03 (s, 12H), 1.921.96 (m, 24H). LCMS: m / z=1221.6 (M / 2+H)+. 3.2 3.2 Preparation of a compound 4 The compound 3 (1.10 g, 0.451 mmol) was dissolved in MeOH (10.0 mL) at room temperature, wet Pd / C (0.050 g, 0.451 mmol) with a mass fraction of 10% was added to a resulting solution, hydrogen replacement was carried out for 3 times, and a reaction mixture was stirred in a hydrogen atmosphere (14.696 psi) at 25°C for 18 h. Liquid chromatography-mass spectrometry detected an MS response of a product. Thin layer chromatography (dichloromethane / methanol=10 / 1, with phosphomolybdic acid as a color developing agent) showed that raw materials were completely consumed and a new point was generated. A reaction solution was filtered, and a filtrate was concentrated under reduced pressure to obtain a white solid compound 4 (about 840 mg). 1H NMR (400 MHz, CD3OD) S=5.32-5.34 (m 4H), 5.06-5.10 (m, 4H), 4.63-4.65 (m, 4H), 4.38-4.40 (m, 2H), 3.99-4.20 (m, 20H), 3.90-3.97 (m, 4H), 3.69-3.76 (m, 6H), 3.50-3.68 (m, 36H), 3.353.44 (m, 11H), 2.28-2.38 (m, 4H), 2.15 (s, 12H), 2.03 (s, 12H), 1.90-1.94 (m, 24H). LCMS: m / z=1154.7 (M / 2+H)+. 3.3 3.3 Preparation of a compound 6 The compound 5 (232 mg, 0.364 mmol) was dissolved in DCM (10.0 mL) at room temperature, HBTU (207 mg, 0.546 mmol), DIEA (0.181 mL, 1.09 mmol) and the compound 4 (840 mg, 0.364 mmol) were sequentially added to a resulting solution, and nitrogen replacement was carried out for 3 times. A reaction mixture was stirred at 25°C for 1 h. Liquid chromatography-mass spectrometry detected that raw materials disappeared. Thin layer chromatography (dichloromethane / methanol=5 / 1) showed that the raw materials disappeared and a new point was generated. A reaction solution was concentrated under reduced pressure, and a resulting crude product was purified by column chromatography (dichloromethane / methanol= 8 / 1 to 5 / 1) to obtain a white solid compound 6 (about 620 mg). 1H NMR (400 MHz, CD3OD) 3=7.41-7.43 (m, 2H), 7.23-7.34 (m, 7H), 6.83-6.90 (m, 4H), 5.31-5.35 (m, 4H), 5.01-5.12 (m, 4H), 4.63-4.65 (m, 4H), 4.41-4.45 (m, 2H), 4.31-4.33 (m, 1H), 3.99-4.22 (m, 22H), 3.87-3.97 (m, 6H), 3.58-3.81 (m, 45H), 3.34-3.43 (m, 10H), 2.19-2.40 (m, 10H), 2.14 (s, 12H), 2.02 (s, 12H), 1.92-1.96 (mz, 24H), 1.48-1.63 (m, 4H), 1.28-1.38 (m, 8H). LCMS: m / z=1460.0 (M / 2+H)+. 4. 4. Preparation of a compound E7 E7 The compound 6 (300 mg, 0.103 mmol) was dissolved in DCM (10.0 mL) at room temperature, DIEA (0.102 mL, 0.618 mmol), a compound 7 (10.3 mg, 0.103 mmol) and DMAP (12.6 mg, 0.103 mmol) were sequentially added to a resulting solution, and nitrogen replacement was carried out for 3 times. A reaction mixture was stirred at 25°C for 2 h. Liquid chromatography-mass spectrometry detected that raw materials disappeared. A reaction solution was concentrated under reduced pressure, and a resulting crude product was subjected to preparative separation by preparative high performance liquid chromatography (preparative-HPLC, column: Waters Xbridge BEH C18 100*30mm*10um; mobile phase: water-ACN; B%: 17%-57%, 5 min) to obtain a white solid compound E7 (53.0 mg, yield: 17.08%, purity: 78.94%). 1H NMR (400 MHz, CD3OD) 3=7.41-7.45 (m, 2H), 7.17-7.34 (m, 7H), 6.85-6.89 (m, 4H), 5.32-5.36 (m, 4H), 5.03-5.13 (m, 4H), 4.63-4.67 (m, 4H), 4.38-4.47 (m, 2H), 4.32-4.34 (m, 1H), 4.01-4.26 (m, 22H), 3.88-4.00 (m, 6H), 3.77-3.81 (m, 7H), 3.49-3.76 (m, 45H), 3.33-3.47 (m, 86 10H), 2.56-2.62 (m, 2H), 2.45-2.55 (m, 3H), 2.21-2.38 (m, 7H), 2.14 (s, 12H), 2.05 2.11 (m, 2H), 2.02 (s, 12H), 1.92-1.96 (m, 24H), 1.47-1.68 (m, 4H), 1.28-1.34 (m, 8H). MS: m / z=3022.36 (M+H)+. Example 2 Preparation of a compound E13 1. Preparation of an intermediate 2-2 1.1. Preparation of a compound 3 10                        1                             2                                         3 4 reactions were carried out in parallel. 4-methylmorpholine (434 g, 4.30 mol, 472 mL) was added to a THF solution (1.75 L) of a compound 1 (250 g, 741 mmol) and then cooled to 0°C. Isobutyl chloroformate (243 g, 1.78 mol, 233 mL) was added to a reaction mixture within 10 min to maintain 15 a reaction temperature less than 4.0°C. After the addition, the mixture was stirred for 40 min or above, and a compound 2 (526 g, 1.78 mol) was added to the reaction mixture successively within 10 min to maintain a reaction temperature less than 4.0°C. After the addition, an ice bath was removed, and then reactants were allowed to be heated to 87 room temperature continuously for 2 h. TLC (petroleum ether / ethyl acetate=1 / 1, compound 1 Rf=0.43) showed that the compound 1 was completely consumed and a new point was formed. The 4 reactions were combined. A reaction solution was poured to a stirred cold (0°C) 0.50 M HCl (aq.) (12.0 L) solution and stirred for about 10 min. Then, EtOAc (4.00 L*3) was added and stirred for a period of time, liquid separation was carried out, and an organic phase was washed with a salt solution (10.0 L), dried with Na2SO4 and concentrated under vacuum to produce a thick colorless oily compound. Hexane (1.20 L) was added to the stirred oily compound. White smoke appeared in a solution and then disappeared after further stirring. A seed crystal (1.20 g, 0.10 wt %) was added, and a white crystal was formed slowly at this time. Within 20 min, a suspension was thick enough to hinder stirring. At this time, additional hexane (6.00 L) was added and stirred for 12 h. The suspension was filtered, cleaned with hexane (1.20 L) and dried to obtain a white solid compound 3 (about 1.20 kg). 1H NMR: (400 MHz DMSO) J=8.10-8.08 (m, 1H), 7.62-7.60 (m, 1H), 7.38-7.31 (m, 5H), 5.11-4.94 (m, 2H), 4.12-4.09 (m, 1H), 3.92-3.87 (m, 1H), 2.25-2.19 (m, 4H), 1.90-1.88 (m, 2H), 1.73-1.67 (m, 2H), 1.40-1.39 (m, 27H). 1.2 Preparation of a compound 4 3                                                   4 5 reactions were carried out in parallel. An HCOOH solution (2.40 L) of the compound 3 (240 g, 415 mmol) was stirred at 45°C for 2 h. LCMS (compound 4=0.570 min) showed that the compound 3 was completely consumed and a main peak having a required m / z value appeared. The 5 reactions were combined. Toluene and ACN (each 1.50 L) were used for dilution and concentration. Azeotropic treatment was carried out with ACN and toluene (500 mL) at 1:1 and ACN for three times (500 mL each time) to remove formic acid. A compound 4 was subjected to high vacuum drying. Then, a residue was stirred with DCM (500 mL), and an organic layer was poured off. Then, azeotropic drying was carried out for two times with ACN (400 mL), vacuum drying was carried out, and then azeotropic 88 treatment was carried out with toluene (400 mL) for 9 times to obtain a white solid compound 4 (about 800 g). 1H NMR: (400 MHz DMSO) 3 =12.4-12.2 (m, 2H), 8.12-8.10 (m, 1H), 7.62-7.60 (m, 1H), 7.38-7.34 (m, 5H), 5.07-5.02 (m, 2H), 4.22-4.17 (m, 1H), 3.99-3.96 (m, 1H), 2.31-2.21 (m, 4H), 2.00-1.93 (m, 2H), 1.76-1.75 (m, 2H). 1.3. Preparation of a compound 6 4                                                                                     6 HOBT (103 g, 760 mmol), EDCI (146 g, 760 mmol) and DIEA (113 g, 877 mmol, 153 mL) were sequentially added to a stirred DMF solution (2.00 L) of the compound 4 (80.0 g, 194 mmol) and a compound 2-3 (384 g, 700 mmol, TFA). Reactants were stirred at 20°C for 2 h. TLC (dichloromethane / methanol=5 / 1, compound 6 Rf=0.43) showed that the compound 4 was completely consumed and a new point was formed. A reaction mixture was slowly poured to a stirred cold 0.5 M HCl aqueous solution (230 mL), stirred for 10 min to form a white solid and then filtered, and an aqueous phase was extracted with DCM (1.50 L) for two times. Combined organic phases were cleaned with 5% NaHCO3 (aq.) (200 mL), then dried (Na2SO4) and evaporated and concentrated under increased pressure. A residue was purified by column chromatography (SiO2, dichloromethane / methanol=5 / 1, compound 6 Rf=0.43) to obtain a yellow solid compound 6 (about 180 g). 1H NMR: (400 MHz DMSO) 3 7.95-7.91 (m, 3H), 7.82-7.80 (m, 4H), 7.39-7.31 (m, 6H), 5.21-5.01 (m, 3H), 5.00-4.96 (m, 5H), 4.56-4.53 (m, 3H), 4.02 (s, 1H), 3.88 (s, 9H), 3.85 (s, 4H), 3.76 (s, 3H), 3.50-349 (m, 9H), 3.39-3.36 (m, 6H), 3.19-3.15 (m, 6H), 2.15-2.05 (m, 12H), 1.99 (s, 9H), 1.89-1.77 (m, 21H). 1.4. Preparation of an intermediate 2-2 2-2 Pd(OH)2 / C (4.94 g, 3.52 mmol, content: 10%) was added to a dry hydrogenation flask in an argon atmosphere, MeOH (350 mL) was added, and the compound 6 (47.4 g, 28.5 mmol) and TFA (3.26 g, 28.5 mmol, 2.11 mL) were sequentially added and 5 stirred in H2 (50 psi) at 20°C for 3 h. TLC (dichloromethane / methanol=5 / 1, intermediate 2-2 Rf=0.25) monitored a reaction and showed that the compound 6 was consumed. A reaction mixture was filtered, and a filtrate was concentrated under vacuum to obtain a white solid intermediate 2-2 (TFA salt) (46.3 g, yield: 94.6%, purity: 95.7%, TFA). 10      1H NMR: (400 MHz DMSO) 5=8.56-8.50 (m, 1H), 8.14-8.05 (m, 4H), 7.99 (s, 1H), 7.88-7.82 (m, 4H), 5.225.21 (m, 3H), 4.99-4.96 (m, 3H), 4.55-4.53 (m, 3H), 4.09 (s, 1H), 4.03 (s, 9H), 3.873.79 (m, 6H), 3.59-3.52 (m, 1H), 3.51-347 (m, 9H), 3.39-3.37 (m, 5H), 3.17-3.16 (m, 6H), 2.22-2.10 (m, 12H), 1.99 (s, 9H), 1.93-1.73 (m, 21H). 15 2. 2. Preparation of a compound E13 lnt-1 : (rA^0                OH                                OMs [>O TsNHBoc              < S BnO-^ 1-3              A. .OBn MsCI                    A. .OBn K2CO3 BnO—K2CO3, TEBA BnO^y ' / qboc K2CO3, TEBA, BnO. ,               TEA DOM BnO,                    MeOH 'OBoc                                      'OBoc 1-1                                          1-2                                             1-4                                                   1-5 Mg MeOH HCI E13 2.1 Preparation of a compound Int1 2.1.1 Preparation of a compound 1-2 TsNHBoc K2CO3, TEBA BnO NHTs OBoc 5                    1-1                                        1-2 At room temperature, a compound 1-1 (38.0 g, 231 mmol), TsNHBoc (75.4 g, 278 mmol), K2CO3 (6.40 g, 46.3 mmol) and TEBA (5.27 g, 23.1 mmol) were added to a three-necked flask. A reaction was carried out at 95°C for 2 h, and then cooling was carried out to 25°C. TLC (PE / EA=2 / 1, UV 254 nm) showed that the reaction was 10 completed. A reaction solution was diluted with water (500 mL) and then extracted with dichloromethane (200 mL*3). An organic phase was concentrated under reduced pressure, and a crude product was purified by column separation (PE / EA=10 / 1 to 3 / 1) to obtain a colorless oily compound 1-2 (about 40.0 g). 1H NMR (400 MHz, CDCl3) 15        8 7.72 (d, J = 8.4 Hz, 2 H), 7.28 - 7.39 (m, 7 H), 4.72 - 4.86 (m, 2 H), 4.42 - 4.56 (m, 2 H), 3.52 - 3.61 m, 2 H), 3.14 - 3.39 (m, 2 H), 2.43 (s, 3 H), 1.47 (s, 9 H). 2.1.2 Preparation of a compound 1-4 1-2                                           1-4 The compound 1-2 (79.0 g, 181 mmol), a compound 1-3 (4.21 g, 30.5 mmol) and TEBA (3.47 g, 15.2 mmol) were enabled to undergo a reaction at 95°C for 3 h. TLC (PE / EA=2 / 1, UV 254 nm) showed that the reaction was completed. A reaction solution was diluted with water (500 mL) and then extracted with dichloromethane (200 mL*3). An organic phase was concentrated under reduced pressure, and a crude product was purified by column separation (PE / EA=10 / 1 to 3 / 1) to obtain a colorless oily compound 1-4 (about 40.0 g). 1H NMR (400 MHz, CDCl3) 5=7.64 - 7.77 (m, 2 H), 7.27 - 7.38 (m, 13 H), 5.05 - 5.16 (m, 1 H), 4.50 - 4.59 (m, 4 H), 4.03 - 4.11 (m, 1 H), 3.62 - 3.76 (m, 2 H), 3.44 - 3.58 (m, 3 H), 3.25 - 3.33 (m, 2 H), 3.15 - 3.20 (m, 1 H), 2.42 (s, 3 H), 1.46 (s, 9 H). 2.1.3 Preparation of a compound 1-5 OH                               OMs 1-4                                                1-5 In an ice bath, the compound 1-4 (77.0 g, 128 mmol) and Et3N (28.6 mL, 205 mmol) were sequentially added to dichloromethane (800 mL), and methanesulfonyl chloride (24.2 g, 212 mmol) was slowly added dropwise. A reaction was carried out at 25°C for 2 h. LCMS showed that the reaction was completed. Water (800 mL) was added to a reaction solution for washing, and an organic phase was concentrated under reduced pressure to obtain a colorless oily compound 1-5 (about 90.0 g). LCMS (ESI): m / z=700.1 (M+Na)+; 1H NMR (400 MHz, CDCl3) 57.68 (d, J = 8.4 Hz, 2 H), 7.28 - 7.39 (m, 12 H), 5.10 - 5.20 (m, 1 H), 4.93 - 5.02 (m, 1 H), 4.52 - 4.61 (m, 4 H), 3.72 - 3.88 (m, 2 H), 3.52 - 3.67 (m, 4 H), 3.27 - 3.36 (m, 1 H), 3.15 - 3.22 (m, 1 H), 3.04 (s, 3 H), 2.43 (s, 3 H), 1.43 (s, 9 H). LCMS: m / z=700.1 (M+Na)+. 2.1.4 Preparation of a compound 1-6 1-5 K2CO3 MeOH 1-6 At room temperature, the compound 1-5 ( 90.0 g, 133 mmol) and potassium carbonate (91.8 g, 664 mmol) were added to MeOH (900 mL). A reaction was carried out at 66°C for 2 h. TLC (PE / EA=2 / 1, UV 254 nm) showed that a new point was generated. An organic phase was concentrated under reduced pressure, water (200 mL) was added to a reaction solution for dilution, and extraction was carried out with dichloromethane (200 mL*3). An organic phase was concentrated under reduced pressure, and a crude product was purified by column separation (PE / EA=30 / 1 to 2 / 1) to obtain a white solid compound 1-6 (about 64.0 g). 1H NMR (400 MHz, CDCI3) 3 7.62 (d, J = 8.4 Hz, 2 H), 7.27 - 7.39 (m, 12 H), 4.48 - 4.62 (m, 4 H), 3.93 - 4.08 (m, 2 H), 3.55 - 3.69 (m, 4 H), 2.84 - 3.10 (m, 4 H), 2.44 (s, 3 H). 1.1.5 Preparation of a compound 1-7 1-6 Mg MeOH H 1-7 At room temperature, the compound 1-6 ( 69.0 g, 143 mmol) and magnesium chips (54.7 g, 2.28 mol) were added to MeOH (400 mL) to carry out a reaction at 66°C for 1 h. TLC (DCM / MeOH= 10 / 1, UV 254 nm) showed that raw materials were completely reacted and a new point was generated. A reaction solution was diluted with water (3,000 mL) and a saturated ammonium chloride aqueous solution (3,000 mL), and then extracted with dichloromethane (1,000*3). An organic phase was washed with saturated sodium bicarbonate (300 mL*3), and the organic phase was concentrated under reduced pressure to obtain a colorless oily compound 1-7 (about 32.0 g). 1H NMR (400 MHz, CDCl3) 37.27 - 7.40 (m, 10 H), 4.57 (s, 4 H), 3.90 - 4.00 (m, 2 H), 3.59 - 3.69 (m, 4 H), 2.77 - 3.04 (m, 4 H). 1.1.6 Preparation of a compound 1-8 H 1-7 HCI H 1-8 At room temperature, the compound 1-7 (8.00 g, 24.4 mmol) was added to HCl (100 mL, 12 M) to carry out a reaction at 50°C for 2 h. A reaction solution was concentrated under reduced pressure to obtain a colorless oily compound 1-8 (about 3.60 g, HCl salt), 1H NMR (400 MHz, CDCI3) 5 4.12 - 4.22 (m, 2 H), 3.78 (d, J = 4.4 Hz, 4 H), 3.17 - 3.30 (m, 4 H). 1.1.7 Preparation of a compound Int-1 At room temperature, the compound 1-8 (8.29 g, 24.5 mmol) was added to pyridine (50 mL, 618 mmol), and then DMTrCl (4.77 g, 12.3 mmol) was added. The reaction system was enabled to undergo a reaction at 25°C for 18 h. TLC (DCM / MeOH=10 / 1, UV 254 nm) showed that a product was generated. A reaction solution was concentrated under reduced pressure, diluted with saturated ammonium chloride (200 mL) and extracted with DCM (100 mL*3). An organic phase was concentrated under reduced pressure. A crude product was separated by column chromatography (DCM / MeOH=99 / 1 to 10 / 1) to obtain a yellow solid Int-1 (about 2.6 g, 5.78 mmol, 23.6%). 1H NMR (400 MHz, CDCl3) 5 7.38 - 7.50 (m, 2 H), 7.25 - 7.36 (m, 6 H), 7.18 -7.25 (m, 1 H), 6.87 (d, J = 8.8 Hz, 4 H), 4.26 - 4.40 (m, 1 H), 3.94 - 4.05 (m, 1 H), 3.85 (d, J = 4.4 Hz, 2 H) 3.73 - 3.82 (m, 6 H), 3.34 - 3.41 (m, 1 H), 3.23 - 3.30 (m, 3 H), 3.05 - 3.23 (m, 2 H). 2.2 2.2 Preparation of a compound Int6 2.2.1 Preparation of a compound 3 A compound 1 (1.00 g, 3.05 mmol) was dissolved in anhydrous N,N- dimethylformamide (10.0 mL) at 25°C, HOBt (0.54 g, 3.97 mmol), EDCI (0.76 g, 3.97 mmol) and DIEA (1.51 mL, 9.16 mmol) were sequentially added, and then a compound 2 (0.79 g, 3.66 mmol) was added. A mixed solution was stirred at 25°C for 2 h. Liquid chromatography-mass spectrometry showed that raw materials were completely reacted and a product was generated. Thin layer chromatography (dichloromethane:methanol=10:1) showed that the raw materials were completely reacted and a product was generated. Dichloromethane (200 ml) was added to the mixed solution, and the mixed solution was washed with a saturated citric acid solution (20 ml*3), a saturated sodium bicarbonate solution (20 ml*3) and a saturated salt solution (20 ml*3) for three times, respectively. An organic phase was dried with anhydrous sodium sulfate and then concentrated under reduced pressure to obtain a crude product. The crude product was purified by column chromatography (dichloromethane: methanol=10:1) to obtain a yellow oily compound 3 (about 1.00 g). 1H NMR (400 MHz, CD3OD) 8 7.21-7.41 (m, 10H), 4.47-4.60 (m, 4H), 3.88-4.01 (m, 2H), 3.75 (dd, J = 3.2, 13.2 Hz, 1H), 3.63-3.65 (m, 3H), 3.40-3.63 (m, 7H), 2.272.34 (m, 4H), 1.50-1.60 (m, 4H), 1.28-1.34 (m, 8H). LCMS: m / z=526.8 (M+H)+. 2.2.2  2.2.2 Preparation of a compound 4 The compound 3 (380 mg, 0.20 mmol) was dissolved in anhydrous methanol (10.0 mL) at 25°C, and wet Pd / C (500 mg, 4.70 mmol) with a mass fraction of 10% was added. A reaction solution was stirred at 50°C for 12 h. Liquid chromatography-mass spectrometry showed that a product was generated. The reaction solution was filtered with diatomite, and a filtrate was concentrated under reduced pressure to obtain a yellow oily compound 4 (about 600 mg). 1H NMR (400 MHz, CD3OD) 5 3.79-3.89 (m, 2H), 3.73 (dd, J = 3.6, 13.2 Hz, 1H), 3.64-3.68 (m, 5H), 3.57-3.62 (m, 2H), 3.48-3.56 (m, 2H), 3.38-3.47 (m, 1H), 1.58-1.62 (m, 5H), 1.34 (d, J = 2.8 Hz, 11H), 1.30-1.37 (m, 1H). LCMS: m / z=346.5 (M+H)+. 2.2.3  2.2.3 Preparation of a compound 5 The compound 4 (600 mg, 1.74 mmol) was dissolved in pyridine (3.00 mL) at 25°C, and DMTrCl (883 mg, 2.61 mmol) was added. A reaction solution was stirred at 25°C for 1 h. Liquid chromatography-mass spectrometry showed that a product was generated. Thin layer chromatography (dichloromethane:methanol=10:1) showed that raw materials were completely reacted and a product was generated. Dichloromethane (200 ml) was added to a mixed solution, and the mixed solution was washed with a saturated sodium bicarbonate solution (20 mlx3) and a salt solution (20 mlx3) for three times, respectively. An organic phase was dried with anhydrous sodium sulfate and then concentrated under reduced pressure to obtain a crude product. The crude product was purified by column chromatography (petroleum ether: ethyl acetate=3:1) to obtain a colorless liquid compound 5 (about 475 mg). 1H NMR (400 MHz, CD3OD) 5 7.41-7.43 (m, 2H), 7.16-7.34 (m, 7H), 6.83-6.87 (m, 4H), 3.88-4.04 (m, 2H), 3.77-4.09 (m, 7H), 3.61-3.68 (m, 4H), 3.43-3.58 (m, 3H), 3.33-3.38 (m, 1H), 3.14-3.20 (m, 1H), 3.05 (dd, J = 8.4, 13.2 Hz, 1H), 2.20-2.42 (m, 4H), 1.51-1.60 (m, 4H), 1.25-1.39 (m, 8H). LCMS: m / z=648.3 (M+H)+. 2.2.4  2.2.4 Preparation of a compound Int-6 lnt-6 5 The compound 5 (475 mg, 0.73 mmol) was dissolved in tetrahydrofuran (8.00 mL) and H2O (2.00 mL) at 25°C, and lithium hydroxide monohydrate (36.9 mg, 0.89 mmol) 96 was added. A reaction solution was stirred at 25°C for 12 h. Thin layer chromatography (dichloromethane:methanol=10:1) showed that raw materials were completely reacted and a product was generated. The reaction solution was concentrated under reduced pressure and then directly freeze-dried on a freeze dryer to obtain a white solid product compound 6 (about 430 mg). 2.3 2.3 Preparation of a compound E13 2.3.1 Preparation of a compound 7 Intermediate C The compound Int-6 (100 mg, 0.156 mmol) was dissolved in anhydrous N,N-dimethylformamide (3.00 mL) at 25°C, and an HBTU reagent (89.0 mg, 0.234 mmol), DIEA (0.078 mL, 0.47 mmol) and an intermediate C (254 mg, 0.156 mmol, prepared by a method of the intermediate 2-2 in Example 2) were sequentially added. A reaction solution was stirred at 25°C for 12 h. Thin layer chromatography (dichloromethane:methanol=10:1) showed that a new point was generated. Dichloromethane (200 ml) was added to a mixed solution, and the mixed solution was washed with a saturated sodium bicarbonate solution (20 mlx3) for three times and washed with a salt solution (20 mlx3) for three times. An organic phase was dried with anhydrous sodium sulfate and then concentrated under reduced pressure to obtain a crude product. The crude product was purified by column chromatography (dichloromethane: methanol=10:1) to obtain a yellow oily product compound 7 (about 140 mg). 1H NMR (400 MHz, CD3OD) 8 7.43 (d, J = 8.4 Hz, 2H), 7.18-7.34 (m, 7H), 6.816.91 (m, 4H), 5.34 (d, J = 2.8 Hz, 3H), 5.09-5.11 (m, 3H), 4.62-4.66 (m, 3H), 4.27-4.35 (m, 2H), 4.07-4.17 (m, 9H), 4.00-4.07 (m, 4H), 3.89-3.98 (m, 5H), 3.79 (d, J = 2.4 Hz, 6H), 3.69-3.75 (m, 5H), 3.60-3.64 (m, 9H), 3.52-3.56 (m, 10H), 3.43-3.50 (m, 4H), 3.39-3.40 (m, 1H), 2.25-2.40 (m, 8H), 2.13-2.15 (m, 9H), 2.02 (s, 9H), 1.94-1.96 (m, 18H), 1.48-1.66 (m, 4H), 1.21-1.36 (m, 11H). 2.3.2 Preparation of E13 E13 The compound 7 (400 mg, 0.187 mmol) was dissolved in anhydrous dichloromethane (5.00 mL), DIEA (0.18 mL, 1.12 mmol) and DMAP (5.71 mg, 0.047 mmol) were sequentially added, and a compound 8 (112 mg, 1.12 mmol) was added at last. A mixed solution was stirred at 25°C for 3 h. Thin layer chromatography (dichloromethane:methanol=10:1) showed that a new point was generated. Dichloromethane (200 ml) was added to the mixed solution, the mixed solution was washed with a saturated salt solution (15.0 mlx3) for three times, and an organic phase was dried with anhydrous sodium sulfate and then concentrated under reduced pressure to obtain a crude product. The crude product was separated by high performance liquid chromatography (chromatographic column: Welch Xtimate C18 150*25mm*5um; mobile phase: water-ACN; gradient: 27%-57% / 11 min; flow rate: 25 ml / min) to obtain a white solid compound E13 (74.8 mg, 0.033 mmol, yield: 17.9%). LCMS (ESI): m / z=1149.5 (M / 2+H)+ ; 1H NMR (400 MHz, CD3OD) 8 7.42-7.44 (m, 2H), 7.18-7.34 (m, 7H), 6.83-6.90 (m, 4H), 5.33-5.34 (m, 3H), 5.08-5.11 (m, 3H), 4.61-4.68 (m, 3H), 4.27-4.36 (m, 2H), 4.19-4.27 (m, 1H), 4.10-4.19 (m, 7H), 4.08 (s, 2H), 4.00-4.07 (m, 4H), 3.90-3.94 (m, 4H), 3.83-3.89 (m, 1H), 3.79 (d, J=2.4 Hz, 6H), 3.70-3.72 (m, 4H), 3.53-3.54 (m, 15H), 3.44-3.48 (m, 3H), 3.35-3.40 (m, 4H), 3.103.23 (m, 2H), 2.53-2.63 (m, 4H), 2.22-2.40 (m, 8H), 2.11-2.16 (m, 9H), 2.05-2.10 (m, 2H), 2.02 (s, 9H), 1.90-1.97 (m, 19H), 1.48-1.65 (m, 4H), 1.29-1.32 (m, 8H). Example 3 Preparation of an siRNA The siRNA of the present invention is prepared by a solid-phase phosphoramidite method well known in the field. The method can specifically refer to, for example, PCT publication No. WO2016081444 and No. WO2019105419, and is briefly described below. 1. Preparation of an siRNA without connection of a ligand 1.1 Synthesis of a sense strand (SS strand) Through the solid-phase phosphoramidite synthesis method, with a blank CPG solid support as an initial cycle, nucleoside monomers were connected one by one in a 98 direction from 3’ to 5’ according to a nucleotide arrangement sequence of a sense strand. Connection of each of the nucleoside monomers includes reactions in four steps including deprotection, coupling, capping, and oxidation or thiolation. Synthesis conditions of an oligonucleotide with a synthesis scale of 5 umol are as follows: the nucleoside monomers were provided by a 0.05 mol / L acetonitrile solution, and the reaction in each step was carried out under a same condition, namely at a temperature of 25°C; the deprotection was carried out with a 3% trichloroacetic acid-dichloromethane solution, and the deprotection was carried out for 3 times; the coupling reaction was carried out with a 0.25 mol / L ETT-acetonitrile solution as an activator, and the coupling was carried out for 2 times; the capping was carried out with 10% acetic anhydride-acetonitrile and pyridine / N-methylimidazole / acetonitrile (10:14:76, v / v / v), and the capping was carried out for 2 times; the oxidation was carried out with 0.05 mol / L iodine / tetrahydrofuran / pyridine / water (70 / 20 / 10, v / v / v), and the oxidation was carried out for 2 times; and the thiolation was carried out with 0.2 mol / L acetonitrile / 3-methylpyridine (1 / 1, v / v) of PADS, and the thiolation was carried out for 2 times. 1.2 Synthesis of an antisense strand (AS strand) Through the solid-phase phosphoramidite synthesis method, with a blank CPG solid support as an initial cycle, nucleoside monomers were connected one by one in a direction from 3’ to 5’ according to a nucleotide arrangement sequence of an antisense strand. Connection of each of the nucleoside monomers includes reactions in four steps including deprotection, coupling, capping, and oxidation or thiolation. Synthesis conditions of a 5 umol oligonucleotide of the antisense strand are the same as those of the sense strand. 1.3 Purification and annealing of an oligonucleotide 1.3.1 Ammonolysis A synthesized solid support (sense strand or antisense strand) was added to a 5 mL centrifuge tube, 3% diethylamine / ammonia water (v / v) was added, and a reaction was carried out in a constant-temperature water bath at 35°C (or 55°C) for 16 h (or 8 h). Filtration was carried out, the solid support was washed with ethanol / water for three times with 1 mL each time, a filtrate was centrifuged and concentrated, and a crude product was purified. 1.3.2 Purification Methods for purification and desalination are well known to persons in the field. For example, a strong anion filler column can be used, a sodium chloride-sodium hydroxide system was used for elution and purification, a product was collected in a tube, a gel filler purification column can be used for desalination, and an elution system was pure water. 1.3.3 Annealing According to Table 6, the sense strand (SS strand) and the antisense strand (AS strand) were mixed at a molar ratio (SS strand / AS strand=1 / 1.05), heated to 70-95°C in a water bath pot, maintained for 3-5 min, and then naturally cooled to room temperature, and the system was freeze-dried to obtain a product. Finally, double-stranded DR002254 to DR002343 were obtained. 2. Preparation of an siRNA connected by a sense strand and a ligand 2.1 Connection of a ligand and a CPG carrier 2.1.2 Connection of the compound E7 and the CPG carrier After the compound E7 (53 mg, 0.018 mmol) and HBTU (13.3 mg, 0.035 mmol) were mixed, acetonitrile (5 mL) was added for dissolution by oscillation, and then DIEA (9.0 mg, 0.07 mmol) and DMAP (2.1 mg, 0.018 mmol) were added for dissolution by oscillation until a solution was clear. A blank carrier Resin (550 mg, CPG pore size 1,000 A) was weighed and added to the reaction solution, the temperature was controlled at 20°C, and shaking was conducted to carry out a reaction overnight. A sample was taken and monitored, TLC was carried out, and results showed that a reaction was completed, where DCM / methanol=4 / 1 was used as a developing agent, and phosphomolybdic acid was used as a color developing agent. Filtration was carried out by a sand core funnel, a filter cake was washed with anhydrous acetonitrile (20 mL*5), and the filter cake was taken and subjected to suction filtration under reduced pressure by an oil pump for 6 h to obtain 530 mg of a white-like solid. 530 mg of the condensed product was placed in a 50 mL round-bottomed flask, CapC (DMAP / acetonitrile), CapB (N-methylimidazole / pyridine / acetonitrile) and CapA (acetic anhydride / acetonitrile) were sequentially added, and shaking was carried out overnight at room temperature. Filtration was carried out, a filter cake was washed with acetonitrile (20 mL*4), and the filter cake was taken and subjected to suction filtration under reduced pressure by an oil pump for 8 h to obtain 200 mg of a white-like solid for solid-phase synthesis. 2.1.2 Connection of the compound E13 and the CPG carrier The compound E13 and the CPG carrier were connected by a method similar to a connection method of the compound E7 and the CPG carrier. 2.2 Synthesis of a sense strand (SS strand) Through the solid-phase phosphoramidite synthesis method, with a GL6 solid support prepared above as an initial cycle, nucleoside monomers were connected one by one in a direction from 3’ to 5’ according to a nucleotide arrangement sequence of a sense strand. Connection of each of the nucleoside monomers includes reactions in four steps including deprotection, coupling, capping, and oxidation or thiolation. Synthesis conditions of an oligonucleotide with a synthesis scale of 5 umol are as follows: the nucleoside monomers were provided by a 0.05 mol / L acetonitrile solution, and the reaction in each step was carried out under a same condition, namely at a temperature of 25^C; the deprotection was carried out with a 3% trichloroacetic acid-dichloromethane solution, and the deprotection was carried out for 3 times; the coupling reaction was carried out with a 0.25 mol / L ETT-acetonitrile solution as an activator, and the coupling was carried out for 2 times; the capping was carried out with 10% acetic anhydride-acetonitrile and pyridine / N-methylimidazole / acetonitrile (10:14:76, v / v / v), and the capping was carried out for 2 times; the oxidation was carried out with 0.05 mol / L iodine / tetrahydrofuran / pyridine / water (70 / 20 / 10, v / v / v), and the oxidation was carried out for 2 times; and the thiolation was carried out with 0.2 mol / L acetonitrile / 3-methylpyridine (1 / 1, v / v) of PADS, and the thiolation was carried out for 2 times. 2.3 Synthesis of an antisense strand (AS strand) Through the solid-phase phosphoramidite synthesis method, with a blank CPG solid support as an initial cycle, nucleoside monomers were connected one by one in a direction from 3’ to 5’ according to a nucleotide arrangement sequence of an antisense strand. Connection of each of the nucleoside monomers includes reactions in four steps including deprotection, coupling, capping, and oxidation or thiolation. Synthesis conditions of a 5 umol oligonucleotide of the antisense strand are the same as those of the sense strand. 2.4 Purification and annealing of an oligonucleotide 2.4.1 Ammonolysis A synthesized solid support (sense strand or antisense strand) was added to a 5 mL centrifuge tube, 3% diethylamine / ammonia water (v / v) was added, and a reaction was carried out in a constant-temperature water bath at 35°C (or 55°C) for 16 h (or 8 h). Filtration was carried out, the solid support was washed with ethanol / water for three times with 1 mL each time, a filtrate was centrifuged and concentrated, and a crude product was purified. 2.4.2 Purification Methods for purification and desalination are well known to persons in the field. For example, a strong anion filler column can be used, a sodium chloride-sodium hydroxide system was used for elution and purification, a product was collected in a tube, a gel filler purification column can be used for desalination, and an elution system was pure water. 2.4.3 Annealing According to Table 6, the sense strand (SS strand) and the antisense strand (AS strand) were mixed at a molar ratio (SS strand / AS strand=1 / 1.05), heated to 70-95°C in a water bath pot, maintained for 3-5 min, and then naturally cooled to room temperature, and the system was freeze-dried to obtain a product. An siRNA conjugated with L96 was obtained by a similar method. Finally, the following siRNA(s) were obtained: DR002221, DR002358 to DR002364, DR005642, DR005656, DR005672, DR005674, DR005675, and DR005676. Example 4 Activity screening in a cell line 1. Activity screening in an HepG2 cell line Cell transfection On the first day, an HepG2 (Nanjing Cobioer, article No. CBP60199) cell line was digested, resuspended, counted and spread on a 96-well plate at 100 pL / well and 1*104 cells / well, and transfection was performed 18 h later. On the second day, the siRNA prepared in Example 3 (DR002221 or DR002254 to DR002343) was diluted with Opti-MEM. 198 pL of Opti-MEM was taken, added to 2 pL of a compound mother solution and evenly mixed by blowing and sucking for later use. During each experiment, corresponding dilution operation was carried out according to different experimental demands. On the second day, 0.9 pL of RNAiMAX (Thermo, 13778150) was diluted with 14.1 pL of Opti-MEM and evenly mixed by gentle blowing and sucking, followed by standing at room temperature for 5 min. Then, 15 pL of a prepared RNAi-MAX mixture and 15 pL of the diluted siRNA (with a final concentration of 10 nM) were evenly mixed by gentle blowing and sucking, subjected to standing at room temperature for 10 min, and then added to a 96-well plate at 10 pL / well. An RNA was extracted after culture was performed in an incubator containing 5% of CO2 at 37°C for 24 h. RNA extraction According to an operation protocol of a high-throughput cell RNA extraction kit (FireGen, FG0412), cell RNA extraction was performed by a nucleic acid extraction apparatus (Hangzhou Allsheng, Auto-pure96). RNA reverse transcription A denaturation reaction mixture was prepared with reference to a PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara, 6210B). Each well contained 1 pL of an Oligo dT Primer, 1 pL of a dNTP Mixture, and 12.5 pL of a template RNA. Incubation was performed to carry out a denaturation reaction in a conventional PCR apparatus at 65°C for 5 min. The mixture was placed on ice and rapidly cooled for 2 min. A reverse transcription reaction solution was prepared with reference to a PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara, 6210B). Each well contained 4 pL of a 5xPrime Script II Buffer, 0.5 pL of an RNase Inhibitor, and 1 pL of PrimeScript II RTase. 14.5 pL of a denatured reaction solution and the reverse transcription reaction solution were slowly mixed evenly, incubated in a conventional PCR apparatus for reverse transcription at 42°C for 45 min, and incubated for inactivation at 95°C for 5 min. A reverse transcription product (cDNA) was cooled at 4°C. After the reverse transcription was completed, 30 pL of distilled water without a DNA enzyme and an RNA enzyme was added to a cDNA sample in each well. Fluorescent quantitative PCR With reference to an operation process of a TaqMan™ Fast Advanced Master Mix (ABI, 4444965), 20 uL of a system was subjected to a fluorescent quantitative PCR reaction (ABI, QuantStudio3). A reaction procedure was as follows: (50°C, 2 min)x1 Cycle; (95°C, 20 s)x1 Cycle; (95°C, 1 s; 60°C, 24 s)x40 Cycles. Table 7 Primer information Primer name Sequence information (5’-3’) Fluorescent group hACTB-Primer- Forward ACGTGGACATCCGCAAAGAC (SEQ ID NO: 417) / hACTB-Primer- Reverse TCTTCATTGTGCTGGGTGCC (SEQ ID NO: 418) / hACTB-Probe AACACAGTGCTGTCTGGCGGCACCA (SEQ ID NO: 419) 5'TET, 3'BHQ2 hPCSK9- Primer-Forward AGAAACGCAGATTGGGCTGG (SEQ ID NO: 420) / hPCSK9-Probe- Reverse GCCATCACTCACCGAGCTTC (SEQ ID NO: 421) / hPCSK9-Probe TGAGGCTGGGAAGGGGAACACAGACCA (SEQ ID NO: 422) 5'6-FAM, 3'BHQ1 Data statistics A 2-  Ct value was calculated and converted into a percentage to obtain a residual inhibitory rate. △△Ct=[(Ct value of a target gene in an experimental group-Ct value of an internal reference in the experimental group)-(Ct value of a target gene in a control group-Ct value of an internal reference in the control group)]. The target gene is hPCSK9, and the internal reference is hACTB.. 2. Activity screening for an Huh7 cell line Similar to the activity screening in the HepG2 cell line, an Huh7 (Nanjing Cobioer, article No. CBP60202) cell line was used for activity screening. With a final concentration of the siRNA as 10 nM and 0.1 nM, activity screening of the siRNA compound was performed. Results of the activity screening in the HepG2 cell line and the activity screening in the Huh7 cell line are shown in Table 8. Table 8 Experimental results of high-throughput activity screening in HepG2 and Huh7 cell lines HepG2-10nM Huh7-10nM Huh7-0.1nM siRNA number Residual inhibitory rate SD Residual inhibitory rate SD Residual inhibitory rate SD Mock 100.6% 15.5% 100.05% 4.41% 100.04% 3.92% DR002221 48.7% 12.9% 14.10% 0.42% 69.60% 7.44% DR002291 39.7% 1.0% 22.68% 2.44% 74.45% 11.99% DR002292 25.3% 4.2% 18.01% 1.41% 64.06% 5.33% DR002293 46.3% 4.9% 24.37% 2.27% 68.66% 5.71% DR002296 53.1% 6.0% 25.26% 0.00% 64.42% 11.00% DR002297 50.7% 17.9% 29.32% 0.14% 64.72% 5.07% DR002298 53.3% 13.9% 31.55% 1.24% 78.87% 6.56% DR002299 26.5% 2.0% 17.76% 1.22% 65.78% 2.90% Example 5 Activity screening (transfection) in primary mouse hepatocytes (PMH) of Tg mice Cell transfection Primary mouse hepatocytes of Tg mice were isolated (Tg mice were derived from Gem Pharmatech, T053388), counted and spread on a 24-well plate at 900 gL / well and 8*104 cells / well. Transfection 10 gL of the diluted siRNA (DR002221 or DR002254 to DR002343) prepared in Example 3 (with a final concentration of 10 nM) was added to 40 gL of Opti-MEM for even mixing. 3 gL of RNAiMAX was added to 47 gL of Opti-MEM for even mixing, incubated for 5 min, evenly mixed with the diluted siRNA, subjected to standing at room temperature for 10 min, and then added to corresponding wells. Culture was carried out in an incubator containing 5% of CO2 at 37°C for 24 h. Fluorescent quantitative PCR With reference to an operation process of a TaqMan™ Fast Advanced Master Mix (ABI, 4444965), 20 pL of a system was subjected to a fluorescent quantitative PCR reaction (ABI, QuantStudio3). A reaction procedure was as follows: (50°C, 2 min)*1 Cycle; (95°C, 20 s)*1 Cycle; (95°C, 1 s; 60°C, 24 s)*40 Cycles. RNA extraction A total RNA was extracted by a magnetic bead method using a high-throughput nucleic acid extraction apparatus, and then fluorescent quantitative PCR detection was performed after reverse transcription. Table 9 Primer information Primer name Sequence information (5’-3’) Fluorescent group mGAPDH-Primer- Forward2 CGGCAAATTCAACGGCACAG (SEQ ID NO: 423) / mGAPDH-primer- Reverse2 CCACGACATACTCAGCACCG (SEQ ID NO: 424) / mGAPDH-Probe2 ACCATCTTCCAGGAGCGAGACCCCACT 5'TET, 3'BHQ2 hPCSK9-Primer- Forward AGAAACGCAGATTGGGCTGG (SEQ ID NO: 425) / hPCSK9-Primer- Reverse GCCATCACTCACCGAGCTTC (SEQ ID NO: 426) / hPCSK9-Primer TGAGGCTGGGAAGGGGAACACAGACCA (SEQ ID NO: 427) 5'6-FAM, 3'BHQ1 Data statistics A 2- Ct value was calculated and converted into a percentage to obtain a residual inhibitory rate. △△ Ct=[(Ct value of a target gene in an experimental group-Ct value of an internal reference in the experimental group)-(Ct value of a target gene in a control group-Ct value of an internal reference in the control group)]. Experimental results of activity screening of the siRNA in PMH are shown in Table 10. Table 10 Experimental results (transfection) of activity screening in primary mouse hepatocytes of Tg mice siRNA Residual STD inhibitory rate DR002291 2.0% 0.2% DR002292 1.4% 0.0% DR002293 2.2% 0.0% DR002296 1.7% 0.2% DR002297 2.0% 0.4% DR002299 1.9% 0.2% DR002221 2.9% 0.6% Example 6 IC50 activity screening in primary human hepatocytes (PHH) using an siRNA at multiple concentrations A. Activity screening in primary human hepatocytes (PHH cells) Cell transfection 1.4 mL of a rat tail collagen solution (Sigma, C3867) was added to 40.6 mL of distilled water without a DNA enzyme and an RNA enzyme for even mixing. 40 uL of a mixture was added to each well of a 96-well culture plate and coated overnight at 4°C, and a coating solution was removed on the second day. On the second day, before use, the coated cell plate was moistened with DPBS, and then the DPBS was sucked away. PHH cells were added to resuscitation culture medium for resuscitation at 37°C, then centrifuged, suspended and counted. The PHH cells were spread on a 96-well plate at 90 uL / well and 2*104 cells / well. A complete culture medium was replaced 4 h later, and transfection was performed 18 h later. On the third day, 198 uL of Opti-MEM was added to 2 uL of a 20 uM siRNA (DR002221 or DR002254 to DR002343), evenly mixed by blowing and sucking, and as a first concentration point, diluted at a corresponding gradient according to actual experimental needs. On the third day, 0.9 uL of RNAiMAX (Thermo, 13778150) was diluted with 14.1 uL of Opti-MEM and evenly mixed by gentle blowing and sucking, followed by standing at room temperature for 5 min. Then, 15 uL of a prepared RNAi-MAX mixture and 15 uL of a diluted compound were evenly mixed by gentle blowing and sucking. A final concentration of the siRNA was 10 nM, 1 nM, 0.1 nM, 0.01 nM, or 0.001 nM. Standing was performed at room temperature for 10 min, and the mixture was added to a 96-well plate at 10 uLwell. An RNA was extracted after culture was performed in an incubator containing 5% of CO2 at 37°C for 24 h. RNA extraction Similar to Example 4, according to an operation protocol of a high-throughput cell RNA extraction kit (FireGen, FG0412), cell RNA extraction was performed by a nucleic acid extraction apparatus (Hangzhou Allsheng, Auto-pure96). RNA reverse transcription A denaturation reaction mixture was prepared with reference to a PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara 6210B). Each well contained 1 pL of an Oligo dT Primer, 1 pL of a dNTP Mixture, and 12.5 liL of a template RNA. Incubation was performed to carry out a denaturation reaction in a conventional PCR apparatus at 65°C for 5 min. The mixture was placed on ice and rapidly cooled for 2 min. A reverse transcription reaction solution was prepared with reference to a PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara, 6210B). Each well contained 4 pL of a 5*Prime Script II Buffer, 0.5 pL of an RNase Inhibitor, and 1 pL of PrimeScript II RTase. 14.5 pL of a denatured reaction solution and 5.5 pL of the reverse transcription reaction solution were slowly mixed evenly. Incubation was performed in a conventional PCR apparatus for reverse transcription at 42°C for 45 min, and incubatioin was performed for inactivation at 95°C for 5 min. A reverse transcription product (cDNA) was cooled at 4°C. After the reverse transcription was completed, 30 pL of distilled water without a DNA enzyme and an RNA enzyme was added to a cDNA sample in each well. Fluorescent quantitative PCR With reference to an operation process of a TaqMan™ Fast Advanced Master Mix (ABI, 4444965), 20 pL of a system was subjected to a fluorescent quantitative PCR reaction (ABI, QuantStudio3). A reaction procedure was as follows: (50°C, 2 min)x1 Cycle; (95°C, 20 s)x1 Cycle; (95°C, 1 s; 60°C, 24 s)x40 Cycles. Table 11 Primer information Primer name Sequence information (5’-3’) Fluorescent group hACTB-Primer- ACGTGGACATCCGCAAAGAC / Forward (SEQ ID NO: 428) hACTB-Primer- Reverse TCTTCATTGTGCTGGGTGCC (SEQ ID NO: 429) / hACTB-Probe AACACAGTGCTGTCTGGCGGCACCA (SEQ ID NO: 430) 5'TET, 3'BHQ2 hPCSK9- Primer-Forward AGAAACGCAGATTGGGCTGG (SEQ ID NO: 431) / hPCSK9- Primer-Reverse GCCATCACTCACCGAGCTTC (SEQ ID NO: 432) / hPCSK9-Probe TGAGGCTGGGAAGGGGAACACAGACCA (SEQ ID NO: 433) 5'6-FAM, 3'BHQ1 Data statistics A 2-AAct value was calculated and converted into a percentage to obtain a residual inhibitory rate. △△ct=[(ct value of a target gene in an experimental group-ct value of an 5 internal reference in the experimental group)-(ct value of a target gene in a control group-ct value of an internal reference in the control group)]. Experimental results are shown in Table 12. Table 12 Experimental results of Ic50 activity screening using a PHH cell line siRNA number 10nM 1nM 0.1nM 0.01nM 0.001nM IC50 (nM) DR002221- 30.6% 45.1% 71.1% 98.5% 93.3% 0.5291 DR002291 27.3% 34.8% 53.9% 80.7% 103.5% 0.1416 DR002292 33.8% 36.6% 54.9% 77.8% 100.6% 0.1501 DR002293 36.5% 42.7% 56.8% 87.8% 96.3% 0.2943 DR002296 22.8% 43.5% 52.9% 86.3% 102.8% 0.2422 DR002297 31.5% 39.0% 62.4% 81.1% 95.1% 0.2996 DR002298 32.1% 47.3% 61.1% 82.8% 85.7% 0.5343 DR002299 31.8% 41.5% 60.9% 69.2% 74.5% 0.3567 10 Example 7 Detection of off-target activity of psi-CHECK2 Preparation of a plasmid A corresponding off-target plasmid of an antisense strand was designed according to an siRNA sequence, a psicHEcK2 GSSM-5Hits recombinant plasmid was prepared 109 by Sangon Biotech (Shanghai) Co., Ltd., and the recombinant plasmid was diluted to 1,000 ng / pL for later use. Cell transfection 100 pL of an HEK293A cell re-suspending solution was spread to each well of a 96-well plate at 8*103 cells / well. On the second day, a complete culture medium in wells was first sucked away and then changed into an Opti-MEM culture medium at 80 pL / well, and starvation treatment was performed for about 1.5 h. siRNA preparation: An siRNA (DR002221 or DR002254 to DR002343) was diluted for 3 times from a final concentration of 40 nM in a total of 11 concentration points. Plasmid mixture: A plasmid mixture in each well contained 0.01 pL of a plasmid and 8.99 pL of Opti-MEM. Lipo mixture: Lipo 2000 (Lipofectamine™ 2000 transfection reagent, Thermo, 11668019) was diluted with Opti-MEM and then subjected to standing at room temperature for 5 min. A LIpo mixture in each well contained 0.2 pL of Lipo and 9.8 pL of Opti-MEM. 22 pL of the prepared Lipo mixture, 22 pL of the siRNA and 19.8 pL of the plasmid mixture were separately loaded to a same corresponding well, named Well A, evenly mixed by blowing and beating, incubated at room temperature for 20 min and then subjected to co-transfection. Finally, a Well A mixture was added to cells in each well at 20 pL / well. A final volume of each well was 100 pL, including 80 pL of the original Opti-MEM and 20 pL of the well A mixture. A final concentration of the siRNA was 10 nM, 3.33 nM, 1.11 nM, 0.37 nM, 0.12 nM, 0.041 nM, 0.013 nM, 0.0045 nM, 0.0015 nM, 0.0005 nM, or 0.00016 nM. After culture was performed in an incubator containing 5% of CO2 at 37°C for 4 h, 100 pL of a DMEM culture medium containing 20% of fetal bovine serum was added to each well. After culture was carried out in the incubator containing 5% of CO2 at 37°C for 24 h, detection was carried out. Detection of results Before an experiment, well mixed Dual-Glo®Luciferase (Dual-Glo®Luciferase Assay System, Promega, E2940) was remelted, equalized to room temperature and then added with DMEM at a ratio of 1:1 in each tube to prepare a substrate I, which was prepared for immediate use. Dual-Glo® Stop & Glo® Buffer was remelted, equalized to room temperature and then mixed with Dual-Glo® Stop & Glo®Substrate at a ratio of 100:1 to prepare a substrate II, which was prepared for immediate use. An original culture medium in a 96-well culture plate was sucked away by a vacuum pump. 150 uL of the substrate I was added to each well and incubated on a shaker at room temperature for 10 min. 120 gL of the substrate I was transferred to a 96-well ELISA plate, and a Firefly (firefly luciferase) chemiluminescence value on a microplate reader (Tecan, Infinite 200) was read. Then, 60 gL of the substrate II was added to each well and incubated on a shaker at room temperature for 10 min. A Renilla (renilla luciferase) chemiluminescence value on the microplate reader was read. Analysis and processing of data The fluorescence activity is determined by the microplate reader, and collected Renilla signals are normalized in accordance with a Firefly signal standard. An inhibitory effect of the siRNA is obtained by comparing unprocessed results (residual inhibitory activity), and a calculation process is shown as follows: normalized Ren / Fir ratio: Ratio=Renilla / Firefly. Residual inhibitory rate=(RatiosiRNA / Ratiocontrol)*100%, taking an average value of results of two wells, where Ratiocontrol is a Ratio value of a control well (without the siRNA) (taking an average value of results of two wells). Mapping: Mapping is carried out by using Graphpad Prism. Half maximal inhibitory concentration (IC50): In this experiment, mapping is carried out based on Top and Bottom, and an IC50 value is obtained according to a formula Y=Bottom+(Top-Bottom) / (1+10A((LogIC50-X)*HillSlope)), where Y=50, and X=log (concentration). Experimental results are shown in Table 13. Table 13 Experimental results of detection of off-target activity of psi-CHECK2 Compound number 10nM 3.33n M 1.11n M 0.37n M 0.12n M 0.041n M 0.013n M 0.0045n M 0.0015n M 0.0005n M 0.00016n M GSSM -5Hits fit IC50 (nM) DR002221 106.1% 103.7 % 94.9% 101.0 % 96.9% 93.4% 96.2% 96.0% 106.2% 90.2% 86.6% > 10 DR002291 43.7% 54.0% 72.2% 104.9 % 101.3 % 100.6% 101.8% 102.3% 112.6% 108.2% 94.8% 2.8961 DR002292 97.3% 89.8% 105.9 % 120.4 % 93.6% 85.6% 99.8% 99.4% 172.9% 90.5% 96.0% > 10 DR002293 53.4% 69.4% 90.3% 89.8% 89.7% 101.0% 90.6% 102.5% 95.5% 97.9% 93.9% > 10 DR002296 74.4% 90.5% 109.8 % 112.4 % 103.1 % 113.9% 109.7% 106.5% 100.0% 103.9% 89.7% > 10 DR002297 14.3% 18.7% 39.9% 76.3% 99.1% 103.4% 107.0% 102.4% 104.9% 104.0% 87.6% 0.8063 DR002298 7.0% 7.3% 11.4% 34.8% 82.9% 98.9% 112.6% 107.5% 110.0% 104.6% 99.9% 0.2604 DR002299 43.0% 43.8% 72.3% 102.6 % 100.2 % 101.7% 116.4% 100.9% 96.4% 96.3% 86.6% 1.2817 Example 8 IC50 activity screening (free uptake) using primary mouse hepatocytes (PMH) of Tg mice Cell transfection 5       Primary mouse hepatocytes of Tg mice were isolated (Tg mice were derived from Gem Pharmatech, T053388), counted and spread on a 24-well plate at 900 pL / well and 8^104 cells / well. 10 pL of a diluted siRNA (DR002221 or DR002358 to DR002364) was added to 90 pL of Opti-MEM for even mixing, added to corresponding wells, and cultured in an 10 incubator containing 5% of CO2 at 37°C for 24 h to carry out free uptake activity screening. The siRNA with an initial concentration of 20 nM was diluted for 5 times to obtain 5 concentration points (20 nM, 4 nM, 0.8 nM, 0.16 nM, or 0.032 nM). Fluorescent quantitative PCR A total RNA was extracted by a magnetic bead method using a high-throughput 15 nucleic acid extraction apparatus, and then fluorescent quantitative PCR detection was performed after reverse transcription. Table 14 Primer information Primer name Sequence information (5’-3’) Fluorescent group mGAPDH-Primer- Forward2 CGGCAAATTCAACGGCACAG (SEQ ID NO: 434) / mGAPDH-Primer- Reverse2 CCACGACATACTCAGCACCG (SEQ ID NO: 435) / mGAPDH-Probe2 ACCATCTTCCAGGAGCGAGACCCCACT (SEQ ID NO: 436) 5'TET, 3'BHQ2 hPCSK9-Primer- Forward AGAAACGCAGATTGGGCTGG (SEQ ID NO: 437) / hPCSK9-Primer- Reverse GCCATCACTCACCGAGCTTC (SEQ ID NO: 438) / hPCSK9-Probe TGAGGCTGGGAAGGGGAACACAGACCA (SEQ ID NO: 439) 5'6-FAM, 3'BHQ1 Data statistics A 2-AAct value was calculated and converted into a percentage to obtain a residual inhibitory rate. △△ct=[(ct value of a target gene in an experimental group-ct value of an 5 internal reference in the experimental group)-(ct value of a target gene in a control group-ct value of an internal reference in the control group)]. Experimental results are shown in Table 15. Table 15 Experimental results (free uptake) of Ic50 activity screening in primary mouse hepatocytes of Tg mice using an siRNA at 5 concentrations Compound 20nM 4nM 0.8nM 0.16nM 0.032nM IC50 (nM) DR002358 3.4% 9.2% 31.2% 74.6% 98.5% 0.3240 DR002359 3.9% 7.4% 22.6% 46.9% 67.5% 0.2943 DR002360 19.6% 38.4% 80.0% 118.3% 109.2% 1.7500 DR002361 6.0% 11.9% 35.3% 56.9% 80.0% 0.7026 DR002362 11.6% 19.0% 48.5% 71.2% 82.1% 0.6556 DR002363 10.4% 13.9% 34.8% 44.1% 70.3% 0.8480 DR002364 6.0% 13.3% 39.7% 75.1% 81.9% 0.6101 DR002221 11.8% 24.4% 42.9% 55.0% 62.5% 1.2410 10 Example 9 In vivo activity screening Experimental animals: 40 humanized PcSK9 Tg mice that were male and 11- to 12-week-old were selected. A baseline level of a PcSK9 protein was determined by ELISA on D-12 (namely, 15 day 12 before administration, same below) and D-5 before administration of the animals, and the baseline level was defined as 100%. On D0, a test compound was administered subcutaneously at 3 mg / kg by single administration, as shown in Table 16 for detail. Table 16 Administration details for in vivo activity screening Group information siRNA Animal number Administration dose Administration volume Administration route       and frequency Vehicle PBS 5 3 mg / kg 5 mL / kg Subcutaneous, single time TA01 DR002221 5 3 mg / kg 5 mL / kg Subcutaneous, single time TA02 DR005642 5 3 mg / kg 5 mL / kg Subcutaneous, single time TA03 DR005656 5 3 mg / kg 5 mL / kg Subcutaneous, single time TA04 DR002359 5 3 mg / kg 5 mL / kg Subcutaneous, single time TA05 DR005672 5 3 mg / kg 5 mL / kg Subcutaneous, single time TA06 DR005675 5 3 mg / kg 5 mL / kg Subcutaneous, single time TA07 DR005674 5 3 mg / kg 5 mL / kg Subcutaneous, single time On D7, D14, D21 and D28 after the administration, whole blood was taken, respectively. After standing was carried out at room temperature, serum was obtained by centrifugation, and a PCSK9 protein level was determined by ELISA. Results are shown in Table 17. 5        Table 17 In vivo activity screening results Compound D7 D14 D21 D28 Average SD Average SD Average SD Average SD PBS 122.0% 39.4% 110.5% 36.8% 126.5% 31.5% 120.4% 36.1% DR002221 13.3% 2.9% 12.9% 2.1% 21.7% 3.0% 29.6% 4.0% DR005642 13.8% 2.2% 13.5% 3.5% 19.9% 5.8% 22.4% 5.5% DR005656 15.8% 4.4% 15.0% 5.8% 26.3% 12.3% 27.6% 11.9% DR002359 11.6% 3.3% 17.7% 7.0% 24.4% 20.7% 39.7% 5.1% DR005672 11.3% 2.3% 9.2% 2.0% 16.1% 3.7% 25.9% 8.3% DR005675 12.4% 1.4% 16.2% 4.0% 25.4% 4.8% 49.0% 13.5% DR005674 7.2% 1.9% 8.4% 1.8% 8.5% 3.3% 11.1% 3.2%

Claims

1. A small interfering RNA (siRNA) for inhibiting expression of proprotein convertase subtilisin / kexin type 9 (PCSK9) in a cell, the siRNA comprising a sense5 strand and an antisense strand that form a double-stranded region, wherein lengths of the sense strand and the antisense strand are each independently 15-30 nucleotides, wherein the sense strand comprises GmsUmsUmUmUmGmCfUfUfUmUmGmUmAmAmCmUmUmsAm, and the antisense strand comprises10 UmsAfsAmGfUmUfAmCfAmAfAmAfGmCfAmAfAmAfCmsAfsGm.

2. The siRNA according to claim 1, wherein the lengths of the sense strand and the antisense strand are each independently 19-23 nucleotides.15        3. The siRNA according to claim 1 or claim 2, wherein the length of the sensestrand is 19 nucleotides, and the length of the antisense strand is 21 nucleotides.

4. The siRNA according to any one of claims 1-4, wherein a length of the doublestranded region is 19-21 base pairs.

205. The siRNA according to any one of claims 1-4, wherein all the nucleotides of the sense strand and all the nucleotides of the antisense strand are modified nucleotides, preferably, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the following group: 2’-O-methyl25 modified nucleotides, 2’-fluoro modified nucleotides, 2’-deoxy- modified nucleotides, inosine ribonucleotides, abasic nucleotides, reverse abasic deoxyribonucleotides, nucleotides containing a thiophosphate group, vinyl phosphate modified nucleotides, locked nucleotides, 2’-amino- modified nucleotides, 2’-alkyl- modified nucleotides, morpholino nucleotides, aminophosphates, unnatural bases containing nucleotides, and30 terminal nucleotides or deoxyribonucleotides linked to cholesterol-based derivatives or a sebacamide dodecanoate group, preferably selected from2’-O-methyl modified nucleotides, 2’-fluoro modified nucleotides, deoxyribonucleotides, and nucleotides containing a thiophosphate group.2023295621   17 Jun 20266. The siRNA according to any one of claims 1-5, wherein the siRNA is further conjugated with a ligand moiety containing N-acetylgalactosamine through a phosphate group or a thiophosphate group,and preferably, the sense strand of the siRNA is conjugated with the ligand moiety 5 through the phosphate group or the thiophosphate group,and more preferably, a 3’ end of the sense strand is conjugated with the ligand moiety through the phosphate group or the thiophosphate group.

107. The siRNA according to claim 6, wherein the ligand moiety comprises a conjugated group shown in Formula (X’):Q(X’)wherein,represents a position connected with the siRNA;H,Q15is independentlyHNi,OHL3OL1 HN"HO OL4—OAcHNOHHO OL3'L4—OAcHNOHOH,or2023295621   17 Jun 2026wherein L1 is a bond, -CH2-, -CH2CH2-, -C(O)-, -CH2O-, -CH2O-CH2CH2O-, or -NHC(O)-(CH2NHC(O))a-;L2 is a bond or -CH2CH2C(O)-;5          L3 is a bond, -(NHCH2CH2)b-, -(NHCH2CH2CH2)b-, or -C(O)CH2-;L4 is -(OCH2CH2)c-, -(OCH2CH2CH2)c-, -(OCH2CH2CH2CH2)c-,  -(OCH2CH2CH2CH2CH2)c-, or -NHC(O)-(CH2)d-;wherein a is 0, 1, 2, or 3;b is 1, 2, 3, 4, or 5;10                  c is 1, 2, 3, 4, or 5;d is 1, 2, 3, 4, 5, 6, 7, or 8;L is a bond, -CH2O-, or -NHC(O)-;L’ is a bond, -C(O)NH-, -NHC(O)-, or -O(CH2CH2O)e-;wherein e is 1, 2, 3, 4, or 5;15 T is a bond, -CH2-, -C(O)-, -M-, -CH2-M-, or -C(O)-M-;h ■ m ■wherein M is      '—'     ,      '—'     ,      '—'     , orK}d ;R1 and R2 together form -CH2CH2O- or -CH2CH(R)-O-, and R3 is H;or the R1 and the R3 together form -C1-2 alkylene-, and the R2 is H;20          wherein R is -OR’, -CH2OR’, or -CH2CH2OR’, wherein R’ is H, a hydroxylprotective group, or a solid support, and the hydroxyl protective group is preferably -C(O)CH2CH2C(O)OH or 4,4’-dimethoxytriphenylmethyl;m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; andn is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

258. The siRNA according to claim 7, wherein the conjugated group is selected from the following:2023295621   17 Jun 2026Number Structure 1 HO / OH                  o \^O\ / O. / \ / x / 'N'^ NHAc                   / HO / OH               0    \ HO^Y^a   0 NHAc                   QJ HO / OH \< n              H / V^°\ ,0. / x / x. / '^''x HO-^^X'^ \Z\fXZ   o NHAc x / O^^nCXa 1 n         o-^ 0                 1 2 HO .OH h^X^X-x / NHAc                    H ) HO / OH                      _ \V,0                  II     % 0-^ HO .OH                                / Jbx / 0\Z'- / \z°\^-n-4 H     NHAc °          h"\) xOxXyNCX n        oz 0             1 3 HO OH            0             q NHAc                              / HO ,0H            0            0     \q^ ho^A;0 NHAc 0' HO xOH             J                J \Vo x-X / X^X / x xx / H0^NHAc            H^b "X / 0. / \ ,N. J-x -          I o-J 0              f2023295621   17 Jun 20262023295621   17 Jun 20267 HO .OH H°     NHAc    0        }.....NH HO .OH                \ A0                          .OH °^O o         An H° NHAc 0        0        / V                   ( 0 HO / OH H°     NHAc °         .....N HO .OH                  \ 8 HO .OH “Co          3 7        roH / H                            11                 / \                      o HO .OH                                 Q ,° .....>° HO / OH                         \ W.0                 H / vA\ .0^ / x / .0 / x ^ N-- / NHAc                           0 9 OH HO / H°   NHAc^      ^H '^0                     .OH OH                         \                      1 H0\T                            0         0 ||                       [ 0 0H NH"              H                              J To        ?    / vA\ .

0. / '. / .O / J / --0 HO^^AA  0   ^N" NHAc                  H2023295621   17 Jun 202611122023295621   17 Jun 2026141516alternatively, the conjugated group is selected from the following:Nu mberStructure2023295621   17 Jun 20261819202023295621   17 Jun 20262223-12023295621   17 Jun 202624252023295621   17 Jun 2026282023295621   17 Jun 20269. The siRNA according to any one of claims 6-8, wherein the ligand targets an asialoglycoprotein receptor (ASGPR).5        10. The siRNA according to claim 6, wherein the ligand is selected from a groupconsisting of (a), (b), and (c), wherein:(a) the ligand has the following structure:wherein represents a position connected with the siRNA through the10 phosphate group or the thiophosphate group,(b) the ligand has the following structure:2023295621   17 Jun 2026wherein represents a position connected with the sense strand of the siRNAthrough the phosphate group or the thiophosphate group,(c) the ligand has the following structure:wherein represents a position connected with the sense strand of the siRNAthrough the phosphate group or the thiophosphate group.1011. The siRNA according to any one of claims 1-10, wherein the 3’ end of the sense strand is conjugated with a ligand moiety through a thiophosphate group, wherein the ligand moiety has the following structure:2023295621   17 Jun 2026wherein * represents a position connected with the sense strand of the siRNA.

12. A cell, comprising the siRNA according to any one of claims 1-11.

513. A pharmaceutical composition, comprising the siRNA according to any one of claims 1-11or the cell according to claim 12 and a pharmaceutically acceptable carrier or excipient.10   14. A kit, comprising the siRNA according to any one of claims 1-11 or the cellaccording to claim 12.

15. The siRNA according to any one of claims 1-11, the cell according to claim 12 or the pharmaceutical composition according to claim 13 for use in treating diseases or15 symptoms associated with expression of PCSK9 in a subject.

16. The siRNA, the cell, or the pharmaceutical composition for ues according to claim 15, wherein the diseases or symptoms associated with expression of PCSK9 are cardiovascular diseases or hypercholesterolemia,20 preferably, the cardiovascular diseases are selected from hyperlipidemia, hypercholesterolemia, coronary heart disease, myocardial infarction, stroke, and atherosclerosis, the hypercholesterolemia is selected from nonfamilial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, and heterozygous familial25 hypercholesterolemia.2023295621   17 Jun 202617. A method for treating diseases or symptoms associated with expression of PCSK9 in a subject, wherein the method comprises a step of administering the siRNA according to any one of claims 1-11, the cell according to claim 12 or the pharmaceutical 5 composition according to claim 13 to the subject.

18. The method according to claim 17, wherein the diseases or symptoms associated with expression of PCSK9 are cardiovascular diseases or hypercholesterolemia, preferably, the cardiovascular diseases are selected from hyperlipidemia, 10 hypercholesterolemia, coronary heart disease, myocardial infarction, stroke, and atherosclerosis, the hypercholesterolemia is selected from nonfamilial hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, and heterozygous familial hypercholesterolemia.1519. Use of the siRNA according to any one of claims 1-11, the cell according to claim 12 or the pharmaceutical composition according to claim 13 for the manufacture of a medicament for treating diseases or symptoms associated with expression of PCSK9.20   20. The use according to claim 19, wherein the diseases or symptoms associated withexpression of PCSK9 are cardiovascular diseases or hypercholesterolemia, preferably, the cardiovascular diseases are selected from hyperlipidemia, hypercholesterolemia, coronary heart disease, myocardial infarction, stroke, and atherosclerosis, the hypercholesterolemia is selected from nonfamilial25 hypercholesterolemia, polygenic hypercholesterolemia, familial hypercholesterolemia, homozygous familial hypercholesterolemia, and heterozygous familial hypercholesterolemia.