Lipid nanoparticles conjugated with specific HSC antibodies and their uses.

Abstract

Provided are ionizable cationic lipids and lipid nanoparticles for the delivery of nucleic acids to cells (e.g., HSC), and methods of making and using such lipids and targeted lipid. nanoparticles.

Description

Lipid nanoparticles conjugated with specific HSC antibodies and their uses. CROSS-REFERENCE TO RELATED REQUESTS

[0001] This application claims the benefit of priority of U.S. Provisional Application No. 63 / 443,223, filed February 3, 2023, U.S. Provisional Application No. 63 / 463,252, filed May 1, 2023, and U.S. Provisional Application No. 63 / 467,282, filed May 17, 2023, each of which is incorporated by reference herein in its entirety. REFERENCE TO A LISTING OF ELECTRONIC SEQUENCES

[0002] The contents of the electronic sequence listing (183952035040SEQLIST.xml; Size: 57069 bytes; and Creation Date: January 30, 2024) are incorporated herein by reference in their entirety. FIELD OF THE INVENTION

[0003] The invention provides lipid nanoparticles for the delivery of nucleic acids to hematopoietic stem cells, methods of manufacture and use. BACKGROUND

[0004] There is a need for safe and effective in vivo methods for targeted gene editing in hematopoietic stem cells (HSCs). SUMMARY

[0005] A lipid nanoparticle (LNP) for targeted delivery of a nucleic acid into a hematopoietic stem cell (HSC) is provided in this document, the LNP comprising a lipid-antibody conjugate comprising the compound of Formula (I): [Lipid] - [optional ligand] - [antibody], wherein the antibody binds to CD105 and / or CD117; an ionizable cationic lipid comprising: (i) a compound of Formula (II'): Petition 870250067839, dated 01 / 08 / 2025, page 134 / 474 2 / 300 (II'), or a salt thereof, wherein: R1, R2 and R3 are each independently a C1-3 alkylene bond; R1A, R2A and R3A are each independently a C1-10 alkylene bond; R1A1, R1A2, R1A3, R2A1, R2A2, R2A3, R3A1, R3A2 and R3A3 are each independently H, C1-20 alkyl, C1-20 alkenyl, -(CH2)o-1oC(O)ORa1 or -(CH2)o-1oOC(O)Ra2; Ra1e Ra2são, each one, independently C1-20 alkyl or C1-20 alkenyl; p3B2 R3B1 R3B is r3B3; r3bi is C1-6 alkylene; and R3B2 and R3B3 are each independently H or C1-6 alkyl optionally substituted by one or more substituents, each independently selected from the group consisting of -OH and -O-(C1-6 alkyl); or (ii) a compound having the following structure: or a salt of them; and one or more nucleic acids arranged in the LNP.

[0006] In some forms, the compound of Formula (II') is a compound of Formula (II): Petition 870250067839, dated 01 / 08 / 2025, p. 135 / 474 3 / 300 (II), or a salt thereof, wherein: R1, R2 and R3 are each independently a C1-3 alkylene bond; R1A, R2A and R3A are each independently a C1-10 alkylene bond; R1A1, R1A2, R1A3, R2A1, R2A2, R2A3, R3A1, R3A2 and R3A3 are each independently H, C1-20 alkyl, C1-20 alkenyl, -(CH2)o-1oC(O)ORa1or -(CH2)o-1oOC(O)Ra2; Ra1e Ra2são, each one, independently C1-20 alkyl or C1-20 alkenyl; p3B2 R3B1 R3Bé r3B3 ; R3B1^ Ci—6 a|qUj|eno- θ R3B2 θ R3B3 are, each independently, H or C1-6 alkyl.

[0007] In some embodiments, the LNP comprises two lipid-antibody conjugates comprising the compound of Formula (I), wherein the first lipid-antibody conjugate and the second lipid-antibody conjugate are the same or different.

[0008] In some embodiments, the LNP antibody that binds to CD105 and / or CD117 comprise a variable antibody heavy chain (VH) region and a variable antibody light chain (VL) region. In some embodiments, the antibody binds to CD117, wherein VH comprises a CDR-H1 comprising the amino acid sequence of FTFSNYAMS (SEQ ID NO: 1), and a CDR-H2 comprising the amino acid sequence of AISGSGGSTYYADSVKG. Petition 870250067839, dated 01 / 08 / 2025, p. 136 / 474 4 / 300 (SEQ ID NO: 2) and a CDR-H3 comprising the amino acid sequence of AKGPPTYHTNYYYMDV (SEQ ID NO: 3), and VL comprises a CDR-L1 comprising the amino acid sequence of RASQGISSWLA (SEQ ID NO: 4), a CDR-L2 comprising the amino acid sequence of AASSLQS (SEQ ID NO: 5) and a CDR-L3 comprising the amino acid sequence of QQTNSFPYT (SEQ ID NO: 6). In some embodiments, the antibody binds to CD117, wherein VH comprises a CDR-H1 comprising the amino acid sequence of FTFSDADMD (SEQ ID NO: 10), a CDR-H2 comprising the amino acid sequence of RTRNKAGSYTTEYAASVKG (SEQ ID NO: 11) and a CDR-H3 comprising the amino acid sequence of AREPKYWIDFDL (SEQ ID NO: 12), and VL comprises a CDR-L1 comprising the amino acid sequence of RASQSISSYLN (SEQ ID NO: 13), a CDR-L2 comprising the amino acid sequence of AASSLQS (SEQ ID NO: 14) and a CDR-L3 comprising the amino acid sequence of QQSYIAPYT (SEQ ID NO: 15).In some embodiments, the antibody binds to CD105, wherein VH comprises a CDR-H1 comprising the amino acid sequence of DAWMD (SEQ ID NO: 19), a CDR-H2 comprising the amino acid sequence of EIRSKASNHATYYAESVKG (SEQ ID NO: 20) and a CDR-H3 comprising the amino acid sequence of WRRFFDS (SEQ ID NO: 21), and VL comprises a CDR-L1 amino acid sequence comprising the amino acid sequence of RASSSVSYMH (SEQ ID NO: 22), a CDR-L2 comprising the amino acid sequence of ATSNLAS (SEQ ID NO: 23) and a CDR-L3 comprising the amino acid sequence of QQWSSNPLT (SEQ ID NO: 24).

[0009] In some embodiments, the LNP antibody binds to CD117 comprises a variable antibody heavy chain (VH) region and a variable antibody light chain (VL) region, wherein VH comprises a CDR-H1 comprising the sequence of Petition 870250067839, dated 01 / 08 / 2025, p. 137 / 474 5 / 300 amino acids of FTFSNYAMS (SEQ ID NO: 1), a CDR-H2 comprising the amino acid sequence of AISGSGGSTYYADSVKG (SEQ ID NO: 2) and a CDR-H3 comprising the amino acid sequence of AKGPPTYHTNYYYMDV (SEQ ID NO: 3), and VL comprises a CDR-L1 comprising the amino acid sequence of RASQGISSWLA (SEQ ID NO: 4), a CDR-L2 comprising the amino acid sequence of AASSLQS (SEQ ID NO: 5) and a CDR-L3 comprising the amino acid sequence of QQTNSFPYT (SEQ ID NO: 6).

[0010] In some forms, the LNP antibody binds to CD117 comprises a variable antibody heavy chain (VH) region and a variable antibody light chain (VL) region, wherein VH comprises a CDR-H1 comprising the amino acid sequence of FTFSDADMD (SEQ ID NO: 10), a CDR-H2 comprising the amino acid sequence of RTRNKAGSYTTEYAASVKG (SEQ ID NO: 11), and a CDR-H3 comprising the amino acid sequence of AREPKYWIDFDL (SEQ ID NO: 12), and VL comprises a CDR-L1 comprising the amino acid sequence of RASQSISSYLN (SEQ ID NO: 13), a CDR-L2 comprising the amino acid sequence of AASSLQS (SEQ ID NO: 14), and a CDR-L3 comprising the amino acid sequence of QQSYIAPYT (SEQ ID NO: 15).

[0011] In some embodiments, the LNP antibody binds to CD105 comprises a variable antibody heavy chain (VH) region and a variable antibody light chain (VL) region, wherein VH comprises a CDR-H1 comprising the amino acid sequence of DAWMD (SEQ ID NO: 19), a CDR-H2 comprising the amino acid sequence of EIRSKASNHATYYAESVKG (SEQ ID NO: 20), and a CDR-H3 comprising the amino acid sequence of WRRFFDS (SEQ ID NO: 21), and VL comprises a CDR-L1 Petition 870250067839, dated 01 / 08 / 2025, p. 138 / 474 6 / 300 comprising the amino acid sequence of RASSSVSYMH (SEQ ID NO: 22), a CDR-L2 comprising the amino acid sequence of ATSNLAS (SEQ ID NO: 23) and a CDR-L3 comprising the amino acid sequence of QQWSSNPLT (SEQ ID NO: 24).

[0012] In some embodiments, the LNP antibody comprises a variable antibody heavy chain (VH) region and a variable antibody light chain (VL) region, wherein the antibody binds to CD117, and wherein the VH comprises the amino acid sequence of SEQ ID NO: 7 and the VL comprises the amino acid sequence of SEQ ID NO: 8. In some embodiments, the antibody comprises a variable antibody heavy chain (VH) region and a variable antibody light chain (VL) region, wherein the antibody binds to CD117, and wherein the VH comprises the amino acid sequence of SEQ ID NO: 16 and the VL comprises the amino acid sequence of SEQ ID NO: 17. In some embodiments, the antibody comprises a variable antibody heavy chain (VH) region and a variable antibody light chain (VL) region, wherein the antibody binds to CD105, and wherein the VH comprises the amino acid sequence of SEQ ID NO: 25 and the VL comprises the amino acid sequence of SEQ ID NO: 26.

[0013] In some forms, the LNP antibody binds to CD117 comprises a variable antibody heavy chain (VH) region and a variable antibody light chain (VL) region, wherein VH comprises the amino acid sequence of SEQ ID NO: 7 and VL comprises the amino acid sequence of SEQ ID NO: 8.

[0014] In some forms, the LNP antibody binds to CD117 comprises a variable antibody heavy chain (VH) region and a variable antibody light chain (VL) region, wherein VH comprises the amino acid sequence of SEQ ID NO: 16 and VL comprises the amino acid sequence of SEQ ID NO: 17.

[0015] In some forms, the LNP antibody binds to Petition 870250067839, dated 01 / 08 / 2025, p. 139 / 474 7 / 300 CD105 comprises a variable antibody heavy chain (VH) region and a variable antibody light chain (VL) region, wherein the VH comprises the amino acid sequence of SEQ ID NO: 25 and the VL comprises the amino acid sequence of SEQ ID NO: 26.

[0016] In some embodiments, the LNP antibody that binds to CD105 and / or CD117 comprise a Fab fragment, F(ab')2, Fab'-SH, Fv, scFv, or single variable immunoglobulin domain. In some embodiments, the antibody comprises a Fab. In some embodiments, the antibody comprises an Fc domain.

[0017] In some embodiments, the antibody comprises a Fab comprising a heavy chain domain and a light chain domain. In some embodiments, the heavy chain and light chain domains of the Fab comprise the amino acid sequences presented in SEQ ID NOs: 9 and 38, or have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 9 and 38. In some embodiments, the heavy chain and light chain domains of the Fab comprise the amino acid sequences presented in SEQ ID NOs: 18 and 39, or have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 18 and 39.In some embodiments, the heavy chain and light chain domains of Fab comprise the amino acid sequences shown in SEQ ID NOs: 27 and 40, or have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences shown in SEQ ID NOs: 27 and 40.

[0018] In some embodiments, the Fab lacks the native interchain disulfide bond at the C-terminus. In some embodiments, the Fab is designed to replace one or both of the cysteines in the native constant light chain and the native constant heavy chain that form the native interchain disulfide bond with a non-cysteine ​​amino acid, thus removing the Petition 870250067839, dated 01 / 08 / 2025, p. 140 / 474 8 / 300 native interchain disulfide linkage in the Fab. In some embodiments, the Fab comprises a heavy chain fragment comprising C233S substitution and a light chain fragment comprising C214S substitution, numbered according to Kabat.

[0019] In some embodiments, the Fab has an unnatural interchain disulfide bond. In some embodiments, the Fab has an engineered and buried interchain disulfide bond.

[0020] In some embodiments, the Fab comprises an F174C substitution in the heavy chain fragment and an S176C substitution in the light chain fragment, numbered according to Kabat. In some embodiments, the Fab comprises a cysteine ​​at the C-terminal of the heavy or light chain fragment. In some embodiments, the Fab additionally comprises one or more amino acids between the Fab heavy chain fragment and the cysteine ​​at the C-terminal.

[0021] In some embodiments, the antibody comprises a single immunoglobulin variable domain (ISV). In some embodiments, the ISV domain is a Nanobody® ISV domain. In some embodiments, the single immunoglobulin variable domain comprises a cysteine ​​at the C-terminus.

[0022] In some embodiments, the antibody comprises two or more VHH domains.

[0023] In some embodiments, the single variable immunoglobulin domain comprises a VHH domain and further comprises a spacer comprising one or more amino acids between the VHH domain and the cysteine ​​at the C-terminus. In some embodiments, the two or more VHH domains are linked by an amino acid spacer. In some embodiments, the antibody comprises a first VHH domain linked to an antibody CH1 domain and a second VHH domain linked to an antibody light chain constant domain.

[0024] In some embodiments, the antibody CH1 domain and the Petition 870250067839, dated 01 / 08 / 2025, p. 141 / 474 9 / 300 antibody light chain constant domains are linked by one or more disulfide bonds. In some embodiments, the CH1 domain comprises F174C and C233S substitutions, and the constant light chain domain comprises S176C and C214S substitutions, with numbering according to Kabat.

[0025] In some embodiments, the antibody comprises an amino acid spacer or ligand with the amino acid sequence AAA or with an amino acid sequence presented in any of the SEQ ID NOs: 45-60.

[0026] In some embodiments, the antibody comprises a bispecific antibody. In some embodiments, the LNP antibody that binds to CD105 and / or CD117 comprises a bispecific antibody.

[0027] In some embodiments, an LNP is provided in this document, in which one or more nucleic acids are DNA or RNA. In some embodiments, the RNA is mRNA.

[0028] In some forms, one or more nucleic acids of LNPs comprise an mRNA encoding a site-directed nuclease, a chemical base editor, a master editor, or an epigenome editor. In some embodiments, one or more nucleic acids comprise an mRNA encoding a site-directed nuclease. In some embodiments, the site-directed nuclease is a CRISPR-associated nuclease (Cas), a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a megaTAL. In some embodiments, the site-directed nuclease is a Cas, ZFN, TALEN, or megaTAL nuclease comprising an amino acid sequence that confers binding to a target nucleotide sequence.

[0029] In some forms, one or more nucleic acids of LNPs comprise an mRNA encoding a CRISPR-associated nuclease (Cas) or a chemical base editor; and a guide RNA (gRNA) comprising a nucleotide sequence that confers binding to Petition 870250067839, dated 01 / 08 / 2025, p. 142 / 474 10 / 300 a target nucleotide sequence.

[0030] In some forms, one or more nucleic acids of LNPs comprise an mRNA encoding a master editor; and a master editor guide RNA (pegRNA) comprising a nucleotide sequence that confers binding to a target nucleotide sequence.

[0031] In some embodiments, Cas nuclease is an enzyme Cas Type II or Type V or a variant thereof. In some embodiments, the Cas nuclease is a Cas9 enzyme, a Cas12 enzyme, a CasX enzyme, a Cas14 enzyme, or a variant thereof.

[0032] In some embodiments, the LNP gRNA or pegRNA comprises a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence. In some embodiments, one or more LNP nucleic acids additionally comprise a donor template nucleic acid that comprises a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence.

[0033] In some embodiments, the target nucleotide sequence comprises at least 15 consecutive nucleotides and is located within a coding region of a gene, an intronic region associated with a gene, an exonic region associated with a gene, a 5' untranslated region associated with a gene, or a 3' untranslated region associated with a gene, wherein the gene is selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, IVAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, Petition 870250067839, dated 01 / 08 / 2025, page 143 / 474 11 / 300 FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III and protein C.

[0034] In some embodiments, the target nucleotide sequence is within a regulatory region, optionally an enhancer region or a repressor region, of a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, IVAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III, and protein C. In some embodiments, the target nucleotide sequence is within the BCL11A erythroid enhancer. In some embodiments, the target nucleotide sequence comprises the GTGATAAAAGCAACTGTTAG polynucleotide sequence (SEQ ID NO: 62), or a variant thereof comprising up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide substitutions.

[0035] In some embodiments, the ionizable cationic lipid of LNP comprises a compound of Formula (II'). In some embodiments, the ionizable cationic lipid of LNP comprises a compound of Formula (II). In some embodiments, R3B2 and R3B3 are each independently H or C1-6 alkyl optionally substituted by one or more substituents, each independently selected from the group consisting of -OH and -O-(C1-6 alkyl). In some embodiments, R3B2 and R3B3 are each independently methyl or ethyl, each optionally substituted by one or more -OH. In some embodiments, R3B2 and R3B3 are each unsubstituted methyl. Petition 870250067839, dated 01 / 08 / 2025, p. 144 / 474 12 / 300 r3B3é

[0037] In some modalities, In some embodiments, R1, R2, and R3 are each independently a linkage or methylene. In some embodiments, R1 and R2 are each methylene and R3 is a linkage.

[0038] In some embodiments, the ionizable cationic lipid of LNP is a compound of Formula (IIa): r3A1(IIa). where R1A, R2A, R3A, R1A1, R1A2, R1A3, R2A1, R2A2, R2A3, R3A1, R3A2, R3A3, R3B1, R3B2 and R3B3 are as defined for Formula (II'), Formula Petition 870250067839, dated 01 / 08 / 2025, p. 145 / 474 13 / 300 (II), or any variation or modality thereof.

[0039] In some embodiments, the ionizable cationic lipid of LNP is a compound of Formula (IIb): (IIb).

[0040] In some embodiments, R1A, R2A and R3A are, each independently, a linkage or -(CH2)i-io-. In some embodiments, R1A and R2A are each independently a -CH2-, (CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, -(CH2)6-, -(CH2)6-, or -(CH2)7- linkage. In some embodiments, R1A and R2A are each independently a -(CH2)2-, -(CH2)4-, -(CH2)6-, -(CH2)7-, or -(CH2)7- linkage. In some embodiments, R3A is a -CH2-, -(CH2)2-, or -(CH2)7- linkage. In some embodiments, R1A1, R1A2, R1A3, R2A1, R2A2, and R2A3 are each independently H, C1-15 alkyl, -CH=CH-(C1-15 alkyl), -CH=CH- -(CH2)o-40C(0)CH2(Ci-i5 alkyl).In some embodiments, R1A1 and R2A1 are each independently -CH=CH-(C1-15 alkyl), CH=CH-CH2-CH=CH-(C1-15 alkyl), -(CH2)o-4C(O)OCH(C1-15 alkyl)(C1-15 alkyl) or -(CH2)o-4OC(O)CH(C1-15 alkyl)(C1-15 alkyl); and R1A2, R1A3, R2A2 and R2A3 are each H. In some embodiments, R1A1 and R2A1 are... each, Petition 870250067839, dated 01 / 08 / 2025, pp. 146 / 474 14 / 300 or

[0041] In some modes, R1A1 and R2A1 are each,

[0042] In some embodiments, R3A1, R3A2 and R3A3 are each independently H, C1-15 alkyl, -(CH2)o-4C(O)OCH(C1-5 alkyl)(C110 alkyl), -(CH2)o-4OC(O)CH(C1-5 alkyl)(C1-W alkyl), -(CH2)o4C(O)OCH2(C1-10 alkyl) or -(CH2)o-4OC(O)CH2(C1-10 alkyl).

[0043] In some embodiments, R3A1 and R3A2 are each independently C1-15 alkyl; and R3A3 is H.

[0044] In some embodiments, R3A1 and R3A2 are each independently ethyl, propyl,

[0045] In some embodiments, R3A1 is propyl and R3A2 is

[0046] In some embodiments, the ionizable cationic lipid of LNP is Petition 870250067839, dated 01 / 08 / 2025, page 147 / 474 15 / 300

[0047] In some embodiments, the ionizable cationic lipid of LNP is

[0048] In some embodiments, the ionizable cationic lipid of LNP is

[0049] Ionizable cationic lipid comprises the compound that has the structure

[0050] In some respects, it is provided in this document Petition 870250067839, dated 01 / 08 / 2025, page 148 / 474 16 / 300 a LNP in which the antibody is covalently coupled to a lipid in the LNP via a polyethylene glycol (PEG)-containing ligand. In some embodiments, the antibody that binds to CD105 and / or CD117 is covalently coupled to a lipid in the LNP via a polyethylene glycol (PEG)-containing ligand. In some embodiments, the lipid covalently coupled to the antibody via a PEG-containing ligand is distearoylglycerol (DSG), distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), distearoylglycerophosphoglycerol (DSPG), dimyristoylglycerol (DMG), dipalmitoylphosphatidylethanolamine (DPPE), dipalmitoylglycerol (DPG), or ceramide. In some embodiments, the PEG is PEG 2000 or PEG 3400.

[0051] In some embodiments, the lipid-antibody conjugate is present in LNP in a range of 0.001 to 0.5 mol%. In some embodiments, the lipid-antibody conjugate is present in LNP in a range of 0.002 to 0.2 mol.

[0052] In some embodiments, ionizable cationic lipid is present in LNP in a range of 30 to 70 mol%. In some embodiments, ionizable cationic lipid is present in LNP in a range of 40 to 60 mol%.

[0053] In some embodiments, LNP additionally comprises one or more of a structural lipid, a neutral phospholipid, and a free PEG-lipid. In some embodiments, the structural lipid is a sterol. In some embodiments, the sterol is cholesterol. In some embodiments, the sterol is present in LNP in a range of 20 to 70 mol%. In some embodiments, the sterol is present in LNP in a range of 30 to 50 mol%. In some embodiments, the sterol comprises cholesterol and is present in LNP at a concentration of about 40 mol%.

[0054] In some embodiments, the neutral phospholipid is selected from the group consisting of phosphatidylcholine, phosphatidylethane Petition 870250067839, dated 01 / 08 / 2025, page 149 / 474 17 / 300 lamina, distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoylsn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and sphingomyelin. In some embodiments, the neutral phospholipid is present in the LNP in a range of 5 to 15 mol%. In some embodiments, the concentration of neutral phospholipid in the LNP is about 10 mol. In some embodiments, the neutral phospholipid is DSPC and the concentration of DSPC in the LNP is about 10 mol.

[0055] In some embodiments, the free PEG-lipid is selected from the group consisting of PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified diacylglycerols and PEG-modified dialkylglycerols. In some embodiments, the free PEG-lipid comprises PEG-dioleoylglycerol (PEG-DOG), PEG-dimyristoylglycerol (PEG-DMG), PEG-dipalmitoylglycerol (PEG-DPG), PEG-dilinoleoylglycerophosphatidylethanolamine (PEG-DLPE), PEG-dimyristoylphosphatidylethanolamine (PEG-DMPE), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), PEG-distearoylglycerol (PEG-DSG), N-palmitoylsphingosine-1{succinyl[methoxy(polyethylene glycol)] (PEG-ceramide), PEG-distearoylglycerophosphoglycerol (PEG-DSPG), PEG-dioleoylglycerophosphoethanolamine (PEG-DOPE), 2-[(polyethylene glycol)-2000]-N,Nditetradecylacetamide, PEG-distearoyl-phosphatidylethanolamine (PEG-DSPE) or a derivative thereof. In some embodiments, the free PEG-lipid comprises a diacylphosphatidylethanolamine comprising a dipalmitoyl (C16) chain or a distearoyl (C18) chain, and optionally, the free PEG-lipid comprises PEG-DPG and PEG-DMG. In some embodiments, the free PEG-lipid is present in the LNP in a range of 1 to 4 mol%. In some embodiments, the PEG-lipid is DPG-PEG comprising PEG having a molecular weight of 2000 daltons, and the DPG lipid. Petition 870250067839, dated 01 / 08 / 2025, page 150 / 474 18 / 300 PEG is present in LNP at a concentration of approximately 1.5 mol%.

[0056] In some embodiments, the free PEG-lipid comprises the same lipid or a different lipid from the lipid in the lipid-antibody conjugate.

[0057] In some embodiments, the free PEG-lipid comprises a PEG that has a molecular weight of at least 2,000 daltons. In some embodiments, the PEG has a molecular weight of about 3,000 to 5,000 daltons.

[0058] In some embodiments, the LNP has an average diameter in the range of 50 to 200 nm. In some embodiments, the LNP has an average diameter of about 100 nm. In some embodiments, the LNP has a polydispersity index in the range of 0.05 to 1. In some embodiments, the LNP has a zeta potential of about 10 mV to about 30 mV at pH 5. In some embodiments, the LNP has a zeta potential of about -30 mV to about 5 mV at pH 7.4.

[0059] In some embodiments, the LNP comprises the ionizable cationic lipid, the lipid-antibody conjugate comprising the compound of the following formula: [Lipid] - [optional ligand] - [antibody], wherein the antibody binds to CD105 and / or CD117, a sterol or other structural lipid, a neutral phospholipid, a free polyethylene glycol (PEG) lipid and the nucleic acid.

[0060] Also provided in this document is a method for directing the delivery of a nucleic acid to a hematopoietic stem cell (HSC), optionally ex vivo or in vivo in a subject, wherein the method comprises administering to the subject the LNP of any of the aforementioned embodiments, wherein the LNP comprises the nucleic acid. In some embodiments, the subject is a human being.

[0061] In some modalities, the method additionally involves administering an HSC mobilization agent to the subject, and in Petition 870250067839, dated 01 / 08 / 2025, p. 151 / 474 19 / 300 that LNP is administered to the subject intravenously. In some embodiments, the HSC mobilization agent is administered to the subject before, during, or before and during LNP administration. In some embodiments, the HSC mobilization agent comprises plerixafor, granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage colony-stimulating factor (GM-CSF), or any combination thereof. In some embodiments, the HSC mobilization agent comprises plerixafor and G-CSF.

[0062] Also provided here is a method for genetically modifying a hematopoietic stem cell (HSC), optionally ex vivo or in vivo in a subject, wherein the method comprises administering to the subject the LNP of any of the preceding embodiments, wherein the one or more nucleic acids disposed in the LNP comprise an mRNA encoding a site-directed nuclease, a chemical base editor, a master editor or an epigenome editor.

[0063] Also provided in this document is a method for treating a disease in a subject in need thereof, wherein the method comprises administering to the subject LNP of any of the aforementioned modalities, wherein one or more nucleic acids disposed in the LNP comprise a sequence, optionally an mRNA, that encodes a site-directed nuclease, a chemical base editor, a master editor or an epigenome editor.

[0064] In some embodiments, the method further comprises administering an HSC-mobilizing agent to the subject, and in which LNP is administered to the subject intravenously. In some embodiments, the HSC-mobilizing agent is administered to the subject before, during, or before and during the administration of LNP. In some embodiments, the HSC-mobilizing agent comprises plerixafor, granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage colony-stimulating factor (GM-CSF), or any other such agent. Petition 870250067839, dated 01 / 08 / 2025, p. 152 / 474 20 / 300 combination of them. In some modalities, the HSC mobilization agent comprises plerixafor and G-CSF.

[0065] In some modalities, the disease is a blood disorder. In some modalities, the disease is a hemoglobinopathy, a primary immunodeficiency (PID), a congenital cytopenia, a hemophilia, a thrombophilia, an inborn error of metabolism, a neuropathy, or a viral disease. In some modalities, the disease is an α-hemoglobinopathy or a β-hemoglobinopathy. In some modalities, the β-hemoglobinopathy is β-thalassemia or sickle cell disease.

[0066] In some embodiments, the administration of LNPs results in one or more of the following: (i) an insertion of an HBB transgene or a fragment thereof into at least one HSC of the subject; (ii) increased β-globin expression in the subject; (iii) an increased amount of adult α2β2 hemoglobin (HbA) in the subject; (iv) insertion of an HBG1 transgene or a fragment thereof into at least one HSC of the subject; (v) insertion of an HBG2 transgene or a fragment thereof into at least one HSC of the subject; (vi) increased γ-globin expression in the subject; (vii) an increased amount of fetal α2γ2 hemoglobin (HbF) in the subject; (viii) disruption of the HBA1 gene, the HBA2 gene, or a combination thereof in at least one HSC of the subject; (ix) decreased α-globin expression in the subject; and (x) a decreased amount of α-globin α4 heterotetramers from the subject.

[0067] In some forms, the disease is a PID. In some forms, the PID is a severe combined immunodeficiency (SCID), Wiskott-Aldrich syndrome, chronic granulomatous disease, immune dysregulation, X-linked polyendocrinopathy and enteropathy (IPEX), a hyper IgM syndrome, or X-linked agammaglobulinemia.

[0068] In some modalities, the PID is a SCID. In some Petition 870250067839, dated 01 / 08 / 2025, p. 153 / 474 In 21 / 300 modalities, SCID is Artemis-SCID (ART-SCID), recombination activator gene SCID (RAG-SCID), X-linked SCID (X-SCID), adenosine deaminase-deficient SCID, interleukin 7 receptor-deficient SCID, or JAK3 SCID. In some modalities, SCID is ART-SCID, where LNP administration results in the insertion of a DCLREIC transgene or a fragment thereof into at least one HSC of the subject; increased expression of functional Artemis protein in the subject; or a combination thereof. In some modalities, SCID is RAG-SCID, where LNP administration results in the insertion of an RAG1 transgene or an RAG2 transgene or a fragment thereof into at least one HSC of the subject; increased expression of functional RAG1 protein or RAG2 protein in the subject; or a combination thereof.In some forms, SCID is X-SCID, where LNP administration results in the insertion of an IL2RG transgene or a fragment thereof into at least one HSC of the subject; increased expression of functional IL2RG protein in the subject; or a combination thereof.

[0069] In some forms, PID is Wiskott-Aldrich syndrome. In some forms, PID is Wiskott-Aldrich syndrome, and in which the administration of LNP results in the insertion of a MAS transgene, or a fragment thereof, into at least one HSC of the subject; increased expression of the functional expression of the WASP protein in the subject; or a combination thereof.

[0070] In some forms, chronic.

[0071] In some modalities, chronicle linked to X.

[0072] In some embodiments, PID is chronic granulomatous disease, and in which LNP administration results in one or more of (i) insertion of a CYBA transgene, a CYBB transgene, a Petition 870250067839, dated 01 / 08 / 2025, p. 154 / 474 22 / 300 transgene NCF1, a transgene NCF2 or a transgene NCF4 or a fragment thereof in at least one HSC of the subject; (II) introduction of a point mutation at point 676C>T in the CYBB gene of at least one HSC in the subject; (iii) increased expression of functional CYBA protein, CYBB protein, NCF1 protein, NCF2 protein or NCF4 protein in the subject; and (v) an increased amount of functional NADPH oxidase enzyme complex in the subject.

[0073] In some modalities, the PID is IPEX. In some modalities, the PID is IPEX, and in which the administration of LNP results in the insertion of a FOXP3 transgene or a fragment thereof into at least one HSC of the subject; increased expression of functional FOXP3 protein in the subject; or a combination thereof.

[0074] In some modalities, PID is hyperIgM syndrome. In some forms, PID is hyperIgM syndrome, in which LNP administration results in one or more of the following: (i) insertion of an AICDA transgene, a UNG transgene, a CD40 transgene, or a CD40LG transgene, or a fragment thereof, into at least one HSC of the subject; (ii) increased expression of functional AICDA protein, UNG protein, CD40 protein, or CD40LG protein in the subject; (iii) a reduced amount of IgM antibodies in the subject; and (iv) an increased amount of IgG, IgA, or IgE antibodies in the subject.

[0075] In some modalities, the disease is a congenital cytopenia. In some modalities, the congenital cytopenia is Fanconia anemia, Shwachman-Diamond syndrome, Blackfan-Diamond anemia, dyskeratosis congenita, congenital amegakaryocytic thrombocytopenia, or reticular dysgenesis. In some modalities, the congenital cytopenia is Fanconia anemia, and in which the administration of LNP results in the insertion of one or more FANC genes or a fragment thereof into at least one HSC in the subject; increased expression of one or more functional FANC proteins in the subject; or a combination Petition 870250067839, dated 01 / 08 / 2025, page 155 / 474 23 / 300 of the same. In some forms, congenital cytopenia is Fanconia anemia, and in which the administration of LNP insertion of a FANCA transgene or a fragment thereof into at least one HSC of the subject; increased expression of functional FANCA in the subject; or a combination thereof.

[0076] In some forms, the disease is hemophilia. In some forms, hemophilia is Hemophilia A, Hemophilia B, or Hemophilia C.

[0077] In some embodiments, the disease is a hemophilia, and in which the administration of LNP results in (i) insertion of an F8 transgene, an F9 transgene or an F11 transgene or a fragment thereof into at least one HSC of the subject; (ii) increased expression of functional factor VIII protein, factor IX protein or factor XI protein in the subject; and (iii) increased blood coagulation in the subject.

[0078] In some forms, the disease is a thrombophilia. In some forms, the thrombophilia is amegakaryocytic thrombocytopenia or factor X deficiency.

[0079] In some forms, the disease is a thrombophilia, and in which the administration of LNP results in one or more of the following: (i) insertion of an F5 transgene, an F2 transgene, an antithrombin III-encoding transgene, a protein C-encoding transgene, or a protein S-encoding transgene or a fragment thereof into at least one HSC of the subject; (ii) increased expression of functional factor V protein, factor II protein, antithrombin III protein, protein C, or protein S in the subject; and (iii) reduced blood coagulation in the subject.

[0080] In some forms, the disease is an inborn error of metabolism. In some forms, the inborn error of metabolism is phenylketonuria, medium-chain acyl-CoA dehydrogenase (MCAD) deficiency, a lysosomal storage disease, a glycogen storage disorder, a peroxisomal disorder, a disease of Petition 870250067839, dated 01 / 08 / 2025, page 156 / 474 24 / 300 Fabry disease, Gaucher disease, Hurler syndrome, Hunter syndrome, Wolman disease, or pyruvate kinase deficiency. In some forms, the peroxisomal disorder is X-linked adrenoleukodystrophy. In some forms, the lysosomal storage disease is metachromatic leukodystrophy, mucopolysaccharidosis I, or mucopolysaccharidosis II.

[0081] In some forms, the disease is a neuropathy. In some forms, the neuropathy is Friedreich's ataxia.

[0082] In some modalities, the disease is a viral disease. In some modalities, the viral disease is HIV / AIDS. In some modalities, the viral disease is HIV / AIDS, and in which LNP administration prevents HIV infection, HIV / AIDS progression, or a combination thereof.

[0083] In some embodiments, one or more nucleic acids of the treatment method disposed in the LNP comprise an mRNA encoding a site-directed nuclease. In some embodiments, the site-directed nuclease is a CRISPR-associated nuclease (Cas), a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a megaTAL. In some embodiments, the site-directed nuclease is a Cas, ZFN, TALEN, or megaTAL nuclease comprising an amino acid sequence that confers binding to a target nucleotide sequence.

[0084] In some embodiments, one or more nucleic acids of the treatment method disposed in the LNP comprise (i) an mRNA encoding a CRISPR-associated nuclease (Cas) or a chemical base editor; and (ii) a guide RNA (gRNA) comprising a nucleotide sequence that confers binding to a target nucleotide sequence. In some embodiments, one or more nucleic acids disposed in the LNP comprise (i) an mRNA encoding a master editor; and (ii) a master editing guide RNA (pegRNA) that Petition 870250067839, dated 01 / 08 / 2025, p. 157 / 474 25 / 300 comprises a nucleotide sequence that confers binding to a target nucleotide sequence. In some embodiments, the Cas nuclease is a Cas Type II or Type V enzyme or a variant thereof. In some embodiments, the Cas nuclease is a Cas9 enzyme, a Cas12 enzyme, a CasX enzyme, or a Cas 14 enzyme or a variant thereof. In some embodiments, the gRNA or pegRNA comprises a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence.

[0085] In some embodiments, one or more nucleic acids of the treatment method disposed in the LNP additionally comprise a donor template nucleic acid comprising a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence.

[0086] In some embodiments, the target nucleotide sequence of the treatment method comprises at least 15 consecutive nucleotides and is located within a coding region of a gene, an intronic region associated with a gene, an exonic region associated with a gene, a 5' untranslated region associated with a gene, or a 3' untranslated region associated with a gene, wherein the gene is selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, IVAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III and protein C.

[0087] In some embodiments, the target nucleotide sequence is within a regulatory region, optionally a region Petition 870250067839, dated 01 / 08 / 2025, page 158 / 474 26 / 300 enhancer or repressor region of a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, IVAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III and protein C.

[0088] In some embodiments, the target nucleotide sequence is within the BCL11A erythroid enhancer. In some embodiments, the target nucleotide sequence comprises the polynucleotide sequence GTGATAAAAGCAACTGTTAG (SEQ ID NO: 62), or a variant thereof comprising up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide substitutions. In some embodiments, the subject of the methods provided in this document is a human being. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] This application can be understood by reference to the following description, taken in conjunction with the attached Figures.

[0090] Figure 1 represents an exemplary therapeutic strategy for in vivo CRISPR editing of hematopoietic stem cells (HSCs) with targeted lipid nanoparticles (LNPs).

[0091] Figure 2 represents the proton NMR spectrum of intermediate 13-11.

[0092] Figure 3A represents the proton NMR spectrum of intermediate 13-11a; Figure 3B represents the proton NMR spectrum of intermediate 13-11b; and Figure 3C represents the LC-ELSD spectrum of intermediate 13-11b.

[0093] Figure 4A represents the proton NMR spectrum of intermediate 13-10; Figure 4B represents the LC-CAD chromatogram. Petition 870250067839, dated 01 / 08 / 2025, p. 159 / 474 27 / 300 of the intermediate 13-10.

[0094] Figure 5A-1 represents the proton NMR spectrum for lipid 1; Figure 5A-2 represents the LC-CAD chromatogram of lipid 1.

[0095] Figure 5B-1 represents the proton NMR spectrum of lipid 3; Figure 5B-2 represents the LC-CAD chromatogram of lipid 3.

[0096] Figure 5C-1 represents the proton NMR spectrum of lipid 4; Figure 5C-2 represents the LC-CAD L chromatogram of lipid 4.

[0097] Figure 5D-1 represents the proton NMR spectrum of lipid 5; Figure 5D-2 represents the LC-CAD chromatogram of lipid 5.

[0098] Figure 5E-1 represents the proton NMR spectrum of lipid 6; Figure 5E-2 represents the LC-CAD chromatogram of lipid 6.

[0099] Figure 5F-1 represents the proton NMR spectrum of lipid 7; Figure 5F-2 represents the LC-CAD chromatogram of lipid 7.

[0100] Figure 5G-1 represents the proton NMR spectrum of lipid 2; Figure 5G-2 represents the LC-CAD chromatogram of lipid 2.

[0101] Figure 5H-1 represents the proton NMR spectrum of lipid 8; Figure 5H-2 represents the LC-CAD chromatogram of lipid 8.

[0102] Figure 5I-1 represents the proton NMR spectrum of lipid 9; Figure 5I-2 represents the LC-CAD chromatogram of lipid 9.

[0103] Figure 5J-1 represents the proton NMR spectrum of lipid 10; Figure 5J-2 represents the LC-CAD chromatogram of lipid 10. Petition 870250067839, dated 01 / 08 / 2025, p. 160 / 474 28 / 300

[0104] Figure 5K-1 represents the proton NMR spectrum of lipid 11; Figure 5K-2 represents the LC-CAD chromatogram of lipid 11.

[0105] Figure 5L-1 represents the proton NMR spectrum of lipid 12; Figure 5L-2 represents the LC-CAD chromatogram of lipid 12.

[0106] Figure 5M-1 represents the proton NMR spectrum of lipid 13; Figure 5M-2 represents the LC-CAD chromatogram of lipid 13.

[0107] Figure 5N-1 represents the proton NMR spectrum of lipid 15; Figure 5N-2 represents the LC-CAD chromatogram of lipid 15.

[0108] Figure 5O-1 represents the proton NMR spectrum of lipid 16; Figure 5O-2 represents the LC-DAC of lipid 16.

[0109] Figure 5P-1 represents the proton NMR spectrum of lipid 19; Figure 5P-2 represents the LC-CAD chromatogram of lipid 19.

[0110] Figure 5Q-1 represents the proton NMR spectrum of lipid 20; Figure 5Q-2 represents the LC-CAD chromatogram of lipid 20.

[0111] Figure 5R-1 represents the proton NMR spectrum of lipid 31; Figure 5R-2 represents the LC-CAD chromatogram of lipid 31.

[0112] Figure 5S-1 represents the proton NMR spectrum of lipid 32; Figure 5S-2 represents the LC-CAD chromatogram of lipid 32.

[0113] Figure 5T-1 represents the proton NMR spectrum of lipid 33; Figure 5T-2 represents the LC-CAD chromatogram of lipid 33.

[0114] Figure 5U-1 represents the proton NMR spectrum of Petition 870250067839, dated 01 / 08 / 2025, page 161 / 474 29 / 300 lipid 34; Figure 5U-2 represents the LC-CAD chromatogram of lipid 34.

[0115] Figures 6A-6D represent the results of the experiment to screen full-length LNP-Fab and LNP-antibody conjugates for binding to HSCs. The LNP-Fab and LNP-antibody conjugates were formulated with 1,1'-octadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate (DiI) and used to treat HSCs in vitro. DiI fluorescence is shown as a measure of LNP targeting, since binding of the LNP-Fab conjugate to HSCs results in HSCs that have DiI fluorescence. The specific Fab or antibody of each LNP-Fab or LNP-antibody conjugate is shown at the top of each panel. Each column displays DiI fluorescence from HSCs treated with the indicated LNP-Fab or LNP-antibody conjugate prepared at various Fab / antibody densities, as indicated in the detailed layout legend.Unconjugated LNPs and LNPs conjugated with the mutOKT8 anti-CD8 antibody were used as negative controls for HSC targeting, since CD8 is not expressed by HSCs. Hanks' balanced saline (HBS) was also used as a non-LNP buffer control. Figure 6A depicts a first experiment to screen for HSC targeting of a first set of LNP-Fab conjugates. Figure 6B depicts a second experiment to screen for HSC targeting of the first set of LNP-Fab conjugates. Figure 6C depicts a first experiment to screen for HSC targeting of a second set of LNP-antibody conjugates. Figure 6D depicts a second experiment to screen for HSC targeting of the second set of LNP-antibody conjugates.

[0116] Figures 7A-7D represent the results of the experiment to screen full-length LNP-Fab and LNP-antibody conjugates for HSC transfection. The LNP-Fab and conjugates Petition 870250067839, dated 01 / 08 / 2025, p. 162 / 474 30 / 300 LNP-antibody conjugates were formulated with DiI and an mRNA encoding green fluorescent protein (GFP) and used to treat HSCs in vitro. A combination of DiI fluorescence and GFP fluorescence is shown as a measure of LNP transfection, since binding of the LNP-Fab or LNP-antibody conjugate to HSCs results in HSCs that have DiI fluorescence, and since transcription of mRNA into GFP requires the mRNA to enter the cell and escape the endosome. The specific Fab or antibody of each LNP-Fab or LNP-antibody conjugate is shown at the top of each panel. Each column shows dual fluorescence of DiI and GFP from HSCs treated with the indicated LNP-Fab conjugate or LNP-antibody conjugate prepared at various Fab / antibody densities, as indicated in the detailed layout legend. Unconjugated LNPs and LNPs conjugated with anti-CD8 mutOKT8 antibody were used as negative controls for HSC targeting, since CD8 is not expressed by HSCs.Hanks' balanced saline (HBS) solution was also used as a non-LNP buffer control. Figure 7A depicts a first experiment to screen for HSC transfection of a first set of LNP-Fab conjugates. Figure 7B depicts a second experiment to screen for HSC transfection of the first set of LNP-Fab conjugates. Figure 7C depicts a first experiment to screen for HSC transfection of a second set of LNP-antibody conjugates. Figure 7D depicts a second experiment to screen for HSC transfection of the second set of LNP-antibody conjugates.

[0117] Figure 8 depicts the transfection of HSCs by LNPs conjugated with Fab Ab1 anti-CD117. DiI fluorescence indicates the binding of the (Ab1)-LNP conjugate to HSCs, and GFP fluorescence indicates the successful transfection of HSCs with GFP mRNA.

[0118] Figures 9A-9B depict the in vitro editing of HSCs by Petition 870250067839, dated 01 / 08 / 2025, page 163 / 474 31 / 300 treatment with KC3 LNPs conjugated with the Fab Ab1 anti-CD117. KC3 LNP formulations conjugated with or without Ab1 were used to encapsulate chemically modified N1-methyl-pseudo-uridine Cas9 mRNA with a CD45-specific gRNA. Primary human HSCs were treated with these LNPs in a dose range of 100 to 800 ng of total RNA for 7 days, after which the HSCs were stained with fluorescent antibodies against CD34 and CD117 to define HSC cell populations and a fluorescent antibody against CD45 to detect CD45 knockout. Figure 9A depicts the fluorescence of CD34 and CD45 from HSCs treated with Ab1-conjugated KC3 LNPs and illustrates a reduction in HSCs expressing CD45 with increasing amounts of RNA loading. Figure 9B represents the percentage of CD45 knockout in HSCs treated with Ab1-conjugated (KC3-Ab1) and non-conjugated (KC3) LNPs.

[0119] Figures 10A-10B depict in vitro editing of HSCs by treatment with lipid 15 LNPs conjugated with the Fab Ab1 antiCD117. Lipid 15 LNP formulations conjugated with or without Ab1 were used to encapsulate chemically modified N1-methyl-pseudo-uridine Cas9 mRNA with a CD45-specific gRNA. Primary human HSCs were treated with these LNPs in a dose range of 100 to 800 ng of total RNA for 7 days, after which the HSCs were stained with fluorescent antibodies against CD34 and CD117 to define HSC cell populations and a fluorescent antibody against CD45 to detect CD45 knockout. Figure 10A depicts the fluorescence of CD34 and CD45 from HSCs treated with Ab1-conjugated lipid 15 LNPs and illustrates a reduction in HSCs expressing CD45 with increasing amounts of RNA loading.Figure 10B represents the percentage of CD45 knockout in HSCs treated with Ab1-conjugated (lipid 15 Ab1) and non-conjugated (lipid 15) LNPs. Petition 870250067839, dated 01 / 08 / 2025, page 164 / 474 32 / 300

[0120] Figure 11 represents a percentage of CD45 knockout in LNP-treated HSCs, as measured by phenotype (CD45 expression) and genotype (indels detected through sequencing analysis). Each individual point represents a single replication technique (i.e., a single well of HSCs). The phenotype KO percentage is the frequency of cells lacking the CD45 protein. The genotype KO percentage is the percentage of reads containing out-of-frame indels at the target cleavage site.

[0121] Figure 12 represents structures of various Fab hybrids, VHH (NB), ScFv, Fab-ScFv and Fab-VHH.

[0122] Figure 13 depicts the in vitro transfection of HSCs with LNPs conjugated with Ab1 that encapsulate mCherry mRNA at varying Fab densities.

[0123] Figures 14A-14C depict in vitro gene editing of HSCs using Ab1-conjugated LNPs that carry RNAs for gene editing machinery. Primary HSCs were cultured in vitro and treated with LNPs encapsulating CRISPR and beta-2-microglobulin (B2M) mRNA guides. The gene editing effect was measured by flow cytometry targeting the B2M cell surface marker. Figure 14A shows exemplary flow cytometry results of Ab1-conjugated LNPs (binding Ab) recognizing long-term hematopoietic stem cells (LT-HSCs). Figure 14B shows exemplary flow cytometry results of mutant Ab1-conjugated LNPs (mutAb1, non-binding Abm). Figure 14C shows the mean percentage of cells that exhibited a knockout of B2M protein expression in samples treated with Ab1-conjugated LNPs and non-binding mutAb1.

[0124] Figures 15A-15F represent in vivo transfection of Long-term human HSCs (LT-HSCs) grafted into NSG™ mice. Figure 15A depicts exemplary results of Petition 870250067839, dated 01 / 08 / 2025, pp. 165 / 474 33 / 300 flow cytometry illustrating the flow cytometry gating strategy to identify LT-HSCs using the CD34 and CD117 markers (CD34 is a ubiquitous HSC marker and CD117 is a long-term HSC marker). Transfection efficiency was assessed by measuring the percentage of mCherry-positive cells. Cells were initially screened using antibodies against human and mouse CD45+ cells in order to differentiate human HSCs from the mixture with mouse HSCs. Figure 15B represents an additional exemplary flow cytometry result showing mCherry expression in a screened cell using the gating strategy illustrated in Figure 15A. Figure 15C shows the mean percentage of mCherry-positive LT-HSCs from mice treated with lipid 15 LNPs coated with Fab Ab1, untargeted Fab mutAb1, or uncoated (naked) LNPs encapsulating mCherry mRNA.Figure 15D shows the mean percentage of mCherry-positive LTHSCs from mice treated with KC3 LNPs coated with Fab Ab1 or Fab mutAb1 encapsulating mCherry mRNA. Figure 15E shows the amount of mCherry protein normalized by total protein detected in liver tissues of mice treated with lipid 15 LNPs coated with Fab Ab1, untargeted Fab mutAb1, or uncoated (naked) LNPs encapsulating mCherry mRNA. Figure 15F shows the amount of mCherry protein normalized by total protein detected in liver tissues of mice treated with KC3 LNPs coated with Fab Ab1, untargeted Fab mutAb1, or uncoated (naked) LNPs encapsulating mCherry mRNA. In Figures 15B-E, the sample size was 2 to 9 mice for each treatment condition. Bar charts show data as mean values ​​± SD; **** indicates P 0.0001; * indicates P < 0.05; “ns” indicates not significant.

[0125] Figure 16 depicts the in vivo transfection of LT-HSCs Petition 870250067839, dated 01 / 08 / 2025, pp. 166 / 474 34 / 300 human cells grafted into NSG™ mice, showing the average percentage of mCherry-positive LT-HSCs from mice treated with Fab Ab1-coated lipid 15 LNPs encapsulating mCherry mRNA and from untreated mice.

[0126] Figure 17 depicts the in vitro transfection of cynomolgus monkey HSCs with Fab Ab1-coated LNPs. LT-HSCs were isolated from cynomolgus monkey bone marrow and identified using the markers CD34 and CD117. The mean percentage of LTHSCs that were mCherry positive is shown for samples treated with lipid LNPs 15 that were Fab Ab1-coated, untargeted Fab mutAb1-coated, or uncoated.

[0127] Figure 18 represents exemplary flow cytometry results illustrating the flow cytometry gating strategy to identify cynomolgus monkey LT-HSCs using cynomolgus monkey CD34 and CD117 markers (CD34 is a ubiquitous HSC marker and CD117 is a long-term HSC marker). Transfection efficiency was assessed by measuring the percentage of mCherry-positive cells.

[0128] Figures 19A-19B represent in vivo transfection of LT-HSCs in cynomolgus monkeys. Cynomolgus monkeys were first treated intramuscularly with diphenhydramine at a dose of 2 mg / kg, and 30 minutes later were treated intravenously with HSC-targeted LNPs at various doses, as shown on the X-axis. Whole bone marrow samples were collected 24 hours after treatment by iliac crest aspiration and analyzed by flow cytometry using mCherry reporter. Figure 19A shows the mean percentage of mCherry-positive LT-HSCs from cynomolgus monkeys treated with Fab Ab1-coated lipid 15 LNPs encapsulating mCherry mRNA. Figure 19B shows the mean percentage of mCherry-positive LT-HSCs from Petition 870250067839, dated 01 / 08 / 2025, page 167 / 474 35 / 300 cynomolgus monkeys were treated with Fab Ab1-coated KC3 LNPs encapsulating mCherry mRNA. The LNPs were administered intravenously at various doses, as shown on the horizontal geometric axes. Each marked data point represents a single cynomolgus monkey, with one or two cynomolgus monkeys tested per LNP and dose combination. DETAILED DESCRIPTION

[0129] The invention provides lipid nanoparticles (LNPs) that specifically target hematopoietic stem cells (HSCs) and deliver nucleic acids encapsulated in the LNP to HSCs. In some aspects, the LNP for targeted delivery comprises (a) a lipid-antibody conjugate comprising the compound of formula (I): [Lipid]-[optional ligand]-[antibody] (I); and (b) an ionizable cationic lipid; and (c) one or more nucleic acids arranged in the LNP. In some embodiments, the antibody specifically binds to CD105 and / or CD117. In some embodiments, the one or more nucleic acids comprise an mRNA encoding a nuclease and an associated guide RNA. Also provided herein are compositions comprising the LNP and methods for manufacturing and using the LNP for gene editing in HSCs.

[0130] Unless otherwise indicated, the practice of the present invention employs conventional techniques of organic chemistry, pharmacology, cell biology and biochemistry.These techniques are explained in the literature, such as in “Comprehensive Organic Synthesis” (BM Trost & I. Fleming, eds., 1991-1992); “Current Protocols in Molecular Biology” (FM Ausubel et al., eds., 1987, and periodic updates); and “Current Protocols in Immunology” (JE Coligan et al., eds., 1991), each of which is incorporated herein by reference in its entirety. Various aspects of the invention are presented below in sections; however, the aspects of the invention described in a specific section should not be limited to any particular section. Petition 870250067839, dated 01 / 08 / 2025, pp. 168 / 474 36 / 300 I. Definitions

[0131] To facilitate understanding of the present invention, several terms and phrases are defined below.

[0132] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art to which the present invention pertains. Abbreviations used herein have their conventional meanings within chemical and biological techniques. The chemical structures and formulas presented herein are to be interpreted in accordance with the standard rules of chemical valence known in chemical techniques. Furthermore, when a chemical group is a diradical, for example, it is understood that chemical groups can be bonded to their adjacent atoms in the rest of the structure in one or both orientations, for example, -OC(O)- is interchangeable with -C(O)O- or OC(S)- is interchangeable with -C(S)O-.

[0133] The terms “one” and “an”, as used in this document, mean “one or more” and include the plural unless the context is inappropriate. In some modalities, “one or more” is 1 or 2. In some modalities, “one or more” is 1, 2 or 3. In some modalities, “one or more” is 1, 2, 3 or 4. In some modalities, “one or more” is 1, 2, 3, 4 or 5. In some modalities, “one or more” is 1, 2, 3, 4, 5 or more.

[0134] The term “alkyl” as used herein refers to a linear or branched saturated hydrocarbon, such as a linear or branched group of 1-12, 1-10 or 1-6 carbon atoms, referred to herein as C1-C12alkyl, C1-Cwalkyl or C1-Cealkyl, respectively. In some embodiments, alkyl is optionally substituted. Exemplary alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, 2-methyl-1-propyl, 2-methyl-2-propyl, 2-methyl-1 Petition 870250067839, dated 01 / 08 / 2025, p. 169 / 474 37 / 300 butyl, 3-methyl-1-butyl, 2-methyl-3-butyl, 2,2-dimethyl-1-propyl, 2-methyl-1pentyl, 3-methyl-1-pentyl, 4-methyl-1-pentyl, 2-methyl-2-pentyl, 3-methyl-2pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-1-butyl, 3,3-dimethyl-1-butyl, 2-ethyl1-butyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, heptyl, octyl, etc.

[0135] The term “alkylene” refers to a diradical of an alkyl group. In some embodiments, alkylene is optionally substituted. An example alkylene group is -CH2CH2-.

[0136] The term “haloalkyl” refers to an alkyl group that is substituted by at least one halogen. For example, -CH2F, -CHF2, -CF3, -CH2CF3, -CF2CF3 and the like.

[0137] The term “oxo” is recognized in the art and refers to a substituent “=O”. For example, a cyclopentane substituted with an oxo group is cyclopentanone.

[0138] The term “morpholinyl” refers to a substituent that has the structure of: Γ0v, which is optionally replaced.

[0139] The term “piperidinyl” refers to a substituent that has a structure of: , which is optionally replaced.

[0140] In general, the term “substituted”, preceded by the term “optionally” or not, means that one or more hydrogens of the designated chemical moiety are replaced by a suitable substituent. Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent at each replaceable position of the group, and when more than one position in any given structure may be replaced by more than one substituent selected from a specified group, the substituent may be the same or different at each position. Petition 870250067839, dated 01 / 08 / 2025, p. 170 / 474 38 / 300 The combinations of substituents envisioned under this invention are preferably those that result in the formation of stable or chemically viable compounds. In some embodiments, "optionally substituted" is equivalent to "unsubstituted or substituted." In some embodiments, "optionally substituted" indicates that the designated atom or group is optionally substituted by one or more substituents independently selected from optional substituents provided herein. In some embodiments, the optional substituent may be selected from the group consisting of: C^alkyl, cyano, halogen, -O-C1-6 alkyl, C1-6 haloalkyl, C3-7 cycloalkyl, 3- to 7-membered heterocyclyl, 5- to 6-membered heteroaryl, and phenyl. In some embodiments, the optional substituent is alkyl, cyano, halogen, halo, azide, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido, carboxylic acid. -C(O)alkyl, -CO2alkyl, carbonyl, carboxyl, alkylthio, sulfonyl, sulfonamide, sulfonamide, ketone, aldehyde, ester, heterocyclyl, aryl or heteroaryl. In some embodiments, the optional substituent is -ORs1, -NRs2Rs3, -C(O)Rs4, -C(O)ORs5, -C(O)NRs6Rs7, -OC(O)Rs8, -OC(O)ORs9, -OC(O)NRs10R11, -NRs12C(O)Rs13 or -NRs14C(O)ORs15, where Rs1, Rs2, Rs3, Rs4, Rs5, Rs6, Rs7, Rs8, Rs9, Rs10, Rs11, Rs12, Rs13, Rs14 and Rs15 are each independently H, C1-6 alkyl, C3-10 cycloalkyl, C6-14 aryl, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl, each of which is optionally substituted.

[0141] The term “haloalkyl” refers to an alkyl group that is substituted by at least one halogen. For example, -CH2F, -CHF2, -CF3, -CH2CF3, -CF2CF3 and the like.

[0142] The term “cycloalkyl” refers to a group of cyclic, bicyclic, monovalent saturated bridged cyclic (e.g., adamantyl) or spirocyclic hydrocarbons of 3-12, 3-10, 3-8, 4-8 or 4-6 carbons, referred to herein, for example, as “C4-8cycloalkyl”. Petition 870250067839, dated 01 / 08 / 2025, page 171 / 474 39 / 300 derived from a cycloalkane. In some embodiments, cycloalkyl is optionally substituted. Exemplary cycloalkyl groups include, but are not limited to, cyclohexanes, cyclopentanes, cyclobutanes, and cyclopropanes. Unless otherwise specified, the cycloalkyl groups are optionally substituted at one or more ring positions by, for example, alkanoyl, alkoxy, alkyl, haloalkyl, alkenyl, alkynyl, amido, amidino, amino, aryl, arylalkyl, azido, carbamate, carbonate, carboxy, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclyl, hydroxyl, imino, ketone, nitro, phosphate, phosphonate, phosphinate, sulfate, sulfide, sulfonamido, sulfonyl, or thiocarbonyl. In certain embodiments, the cycloalkyl group is unsubstituted, i.e., it is not substituted.

[0143] The terms “heterocyclyl” and “heterocyclic group” are recognized in the art and refer to saturated, partially unsaturated, or aromatic ring structures of 3 to 10 members, alternatively rings of 3 to 7 members, whose ring structures include one to four heteroatoms, such as nitrogen, oxygen, and sulfur. In some embodiments, heterocyclyl is optionally substituted. The number of ring atoms in the heterocyclyl group can be specified using the Cx-Cx nomenclature, where x is an integer specifying the number of ring atoms. For example, a Ca-Cyheterocyclyl group refers to a saturated or partially unsaturated ring structure of 3 to 7 members containing one to four heteroatoms, such as nitrogen, oxygen, and sulfur. The designation “C3-C7” indicates that the heterocyclic ring contains a total of 3 to 7 ring atoms, including any heteroatoms that occupy a ring atom position. An example of a C3 heterocycline is aziridinyl.Heterocycles can be, for example, mono-, bi-, or other multicyclic ring systems (e.g., fused, spiro, bridging bicyclics). A heterocycle can be fused to one or more aryl rings, partially unsaturated or... Petition 870250067839, dated 01 / 08 / 2025, page 172 / 474 40 / 300 saturated. Heterocyclyl groups include, for example, biotinyl, chromenyl, dihydrofuryl, dihydroindolyl, dihydropyranyl, dihydrothienyl, dithiazolyl, homopiperidinyl, imidazolidinyl, isoquinolyl, isothiazolidinyl, iso-oxazolidinyl, morpholinyl, oxolanyl, oxazolidinyl, phenoxanthenyl, piperazinyl, piperidinyl, pyranyl, pyrazolidinyl, pyrazolinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrrolidin-2-onyl, pyrrolinyl, tetrahydrofuryl, tetrahydroisoquinolyl, tetrahydropyranyl, tetrahydroquinolyl, thiazolidinyl, thiolanyl, thiomorpholinyl, thiopyranyl, xanthenyl, lactones, lactams, such as azetidinones and pyrrolidinones, sultams, sultones and the like.Unless otherwise specified, the heterocyclic ring is optionally substituted in one or more positions by substituents such as alkanoyl, alkoxy, alkyl, alkenyl, alkynyl, amido, amidino, amino, aryl, arylalkyl, azido, carbamate, carbonate, carboxy, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclyl, hydroxyl, imino, ketone, nitro, oxo, phosphate, phosphonate, phosphinate, sulfate, sulfide, sulfonamido, sulfonyl, and thiocarbonyl. In certain embodiments, the heterocyclyl group is unsubstituted, i.e., it is not substituted.

[0144] The term “aryl” is recognized in the art and refers to a carbocyclic aromatic group. In some embodiments, aryl is optionally substituted. Representative aryl groups include phenyl, naphthyl, anthracenyl and the like. The term “aryl” includes polycyclic ring systems having two or more carbocyclic rings in which two or more carbons are common to two adjacent rings (the rings are “fused rings”) where at least one of the rings is aromatic and, for example, the other ring (or rings) may be cycloalkyls, cycloalkenyls, cycloalkynyls and / or aryls. Unless otherwise indicated, the aromatic ring may be substituted in one or more ring positions by, for example, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido, carboxylic acid, C(O)alkyl, CO2alkyl, carbonyl, carboxyl, alkylthio, sulfonyl, sulfo Petition 870250067839, dated 01 / 08 / 2025, pp. 173 / 474 41 / 300 amide, sulfonamide, ketone, aldehyde, ester, heterocyclyl, aryl or heteroaryl moieties, -CF3, -CN or the like. In certain embodiments, the aromatic ring is substituted in one or more ring positions by halogen, alkyl, hydroxyl or alkoxyl. In certain other embodiments, the aromatic ring is unsubstituted, i.e., it is not substituted. In certain embodiments, the aryl group is a 6- to 10-membered ring structure. In some embodiments, the aryl group is a C6-C14 aryl.

[0145] The term “heteroaryl” is recognized in the art and refers to aromatic groups that include at least one ring heteroatom. In some embodiments, heteroaryl is optionally substituted. In certain cases, a heteroaryl group contains 1, 2, 3, or 4 ring heteroatoms. Representative examples of heteroaryl groups include pyrrolyl, furanyl, thiophenyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, pyrazolyl, pyridinyl, pyrazinyl, pyridazinyl, and pyrimidinyl, and the like. Unless otherwise indicated, the heteroaryl ring may be substituted in one or more ring positions by, for example, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido, carboxylic acid, C(O)alkyl, -CO2alkyl, carbonyl, carboxyl, alkylthio, sulfonyl, sulfonamido, sulfonamide, ketone, aldehyde, ester, heterocyclyl, aryl or heteroaryl moieties, -CF3, -CN or the like.The term “heteroaryl” also includes polycyclic ring systems having two or more rings in which two or more carbons are common to two adjacent rings (the rings are “fused rings”) where at least one of the rings is heteroaromatic, for example, the other cyclic rings may be cycloalkyls, cycloalkenyls, cycloalkynyls and / or aryls. In certain embodiments, the heteroaryl ring is substituted at one or more ring positions by halogen, alkyl, hydroxyl or alkoxyl. In certain other embodiments, the heteroaryl ring is unsubstituted, i.e., it is not substituted. In certain embodiments, the heteroaryl group is a 5- to 10-membered ring structure, alternatively a Petition 870250067839, dated 01 / 08 / 2025, pp. 174 / 474 42 / 300 ring structure with 5 to 6 members, whose ring structure includes 1, 2, 3 or 4 heteroatoms, such as nitrogen, oxygen and sulfur.

[0146] The terms “amine” and “amino” are recognized in the art and refer to unsubstituted and substituted amines, for example, a chemical moiety represented by the general formula -N(R10)(R11), wherein R10 and R11 each independently represent hydrogen, alkyl, cycloalkyl, heterocyclyl, alkenyl, aryl, aralkyl or (CH2)m-R12; or R10 and R11, taken together with the N atom to which they are attached, complete a heterocycle having from 4 to 8 atoms in the ring structure; R12 represents an aryl, a cycloalkyl, a cycloalkenyl, a heterocycle or a polycycle; in is zero or an integer in the range of 1 to 8. In certain embodiments, R10 and R11 each independently represent hydrogen, alkyl, alkenyl or -(CH2)m-R12.

[0147] The terms “alkoxy” or “alkoxy” are recognized in the art and refer to an alkyl group, as defined above, having an oxygen radical attached to it. In some embodiments, alkoxy is optionally substituted. Representative alkoxy groups include methoxy, ethoxy, propyloxy, tert-butoxy and the like. An “ether” is two hydrocarbons covalently linked by an oxygen. Consequently, the substituent of an alkyl that makes that alkyl an ether is or resembles an alkoxy, such as may be represented by one of -O-alkyl, -O-alkenyl, O-alkynyl, -O-(CH2)m-R12, wherein m and R12 are described above. The term “haloalkoxy” refers to an alkoxy group that is substituted by at least one halogen. For example, O-CH2F, -O-CHF2, -O-CF3, and the like. In certain embodiments, the haloalkoxyl is an alkoxyl group that is replaced by at least one fluorine group.In certain embodiments, the haloalkoxyl is an alkoxyl group that is replaced by 1-6, 1-5, 1-4, 2-4, or 3 fluorine groups.

[0148] The symbol “—” indicates a point of attachment.

[0149] The developing compounds may contain one or more Petition 870250067839, dated 01 / 08 / 2025, pp. 175 / 474 43 / 300 chiral centers and / or double bonds and therefore exist as stereoisomers, such as geometric isomers, enantiomers, or diastereomers. The term “stereoisomers” when used in this document consists of all geometric isomers, enantiomers, or diastereomers. These compounds may be designated by the symbols “R” or “S”, depending on the configuration of substituents around the stereogenic carbon atom. The present invention encompasses various stereoisomers of these compounds and mixtures thereof. Stereoisomers include enantiomers and diastereomers. Mixtures of enantiomers or diastereomers may be designated “(±)” in the nomenclature, but those skilled in the art will recognize that a structure may implicitly denote a chiral center. It is understood that graphical representations of chemical structures, for example, generic chemical structures, encompass all stereoisomeric forms of the specified compounds, unless otherwise indicated.

[0150] Individual stereoisomers of compounds of the present invention can be prepared synthetically from commercially available starting materials containing asymmetric or stereogenic centers, or by preparing racemic mixtures followed by resolution methods well known to those of ordinary skill in the art. Such resolution methods are exemplified by (1) fixing a mixture of enantiomers to a chiral auxiliary, separating the resulting mixture of diastereomers by recrystallization or chromatography and releasing the optically pure product from the auxiliary, (2) salt formation using an optically active resolving agent, or (3) direct separation of the mixture of optical enantiomers on chiral chromatographic columns.Stereoisomeric mixtures can also be resolved into their component stereoisomers by well-known methods such as chiral phase chromatography, high-performance liquid chromatography in the chiral phase, and compound crystallization. Petition 870250067839, dated 01 / 08 / 2025, page 176 / 474 44 / 300 as a chiral salt complex or crystallization of the compound in a chiral solvent. Furthermore, enantiomers can be separated using supercritical fluid chromatography (SFC) techniques described in the literature. Still beyond that, stereoisomers can be obtained from stereomerically pure intermediates, reagents, and catalysts by well-known asymmetric synthetic methods.

[0151] Geometric isomers may also exist in the compounds of the present invention. The symbol “............” denotes a bond which may be a single, double or triple bond, as described in this document. The present invention encompasses the various geometric isomers and mixtures thereof resulting from the arrangement of substituents around a carbon-carbon double bond or arrangement of substituents around a carbocyclic ring. The substituents around a carbon-carbon double bond are designated as being in the “Z” or “E” configuration wherein the terms “Z” and “E” are used in accordance with IUPAC standards. Unless otherwise specified, structures representing double bonds encompass both “E” and “Z” isomers.

[0152] Substituents around a carbon-carbon double bond can alternatively be called “cis” or “trans”, where “cis” represents substituents on the same side of the double bond and “trans” represents substituents on opposite sides of the double bond. The arrangement of substituents around a carbocyclic ring is designated as “cis” or “trans”. The term “cis” represents substituents on the same side of the ring plane and the term “trans” represents substituents on opposite sides of the ring plane. Mixtures of compounds in which the substituents are arranged both on the same and on opposite sides of the ring plane are designated “cis / trans”.

[0153] The invention also encompasses isotopically labeled compounds of the invention that are identical to those cited herein, except that Petition 870250067839, dated 01 / 08 / 2025, page 177 / 474 45 / 300 One or more atoms are replaced by an atom that has an atomic mass or mass number different from the atomic mass or mass number normally found in nature. Examples of isotopes that can be incorporated into compounds of the Invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, such as 2H, 3H, 13C, 14C, 15N, 18O, 17O, 31P, 32P, 35S, 18F, and 36Cl, respectively.

[0154] Certain disclosed isotopically labeled compounds (e.g., those labeled with 3H and 14C) are useful in compound and / or substrate tissue distribution assays. Tritiated (i.e., 3H) and carbon-14 (i.e., 14C) isotopes are particularly preferred for their ease of preparation and detectability. Furthermore, substitution with heavier isotopes, such as deuterium (i.e., 2H), can provide certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and may therefore be preferable in some circumstances. The isotopically labeled compounds of the invention can generally be prepared following procedures analogous to those disclosed, for example, in the examples in this document, by replacing an isotopically labeled reagent with an un-isotopically labeled reagent.

[0155] As used in this document, the terms “subject” and “patient” refer to organisms to be treated by the methods of the present invention. Such organisms are preferably mammals (e.g., murine, simian, equine, bovine, porcine, canine, feline and the like), and more preferably humans.

[0156] As used in this document, the term “pharmaceutical composition” refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vivo or ex vivo. Petition 870250067839, dated 01 / 08 / 2025, page 178 / 474 46 / 300

[0157] As used herein, the term “pharmaceutically acceptable excipient” refers to any of the standard pharmaceutical vehicles, such as phosphate-buffered saline, water, emulsions (e.g., oil-in-water or water-in-oil emulsions), and various types of wetting agents. Compositions may also include stabilizers and preservatives. For examples of carriers, stabilizers, and adjuvants, see Remington's The Science and Practice of Pharmacy, 21st edition, A.R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, MD, 2006.

[0158] As is known to those skilled in the art, “salts” of the compounds of the present invention may be derived from inorganic or organic acids and bases. Examples of acids include, but are not limited to, hydrochloric, hydrobromic, sulfuric, nitric, perchloric, fumaric, maleic, phosphoric, glycolic, lactic, salicylic, succinic, toluenesulfonic, tartaric, acetic, citric, methanesulfonic, ethanesulfonic, formic, benzoic, malonic, naphthalene-2-sulfonic, benzenesulfonic and the like. Other acids, such as oxalic, although not pharmaceutically acceptable in themselves, may be employed in the preparation of salts useful as intermediates in obtaining the compounds of the invention and their pharmaceutically acceptable acid addition salts.

[0159] Examples of bases include, but are not limited to, alkali metal hydroxides (e.g., sodium), alkaline earth metal hydroxides (e.g., magnesium), ammonia, and compounds of the formula NW4+, wherein W is C1-4 alkyl and the like.

[0160] Examples of salts include, but are not limited to: acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphosulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, flucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate, maleate, meta Petition 870250067839, dated 01 / 08 / 2025, page 179 / 474 47 / 300 nonsulfonate, 2-naphthalenesulfonate, nicotinate, oxalate, palmoate, pectinate, persulfate, phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, tosylate, undecanoate and the like. Other examples of salts include anions of the compounds of the present invention compounded with a suitable cation, such as Na+, NHZ and NWZ (wherein W is a C1-4 alkyl group) and the like.

[0161] Abbreviations used in this document include diisopropylethylamine (DIPEA); 4-dimethylaminopyridine (DMAP); tetrabutylammonium iodide (TBAI); 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC); benzotriazol-1-yl-oxyphosphate (BOP), 9-fluorenylmethoxycarbonyl (Fmoc), tetrabutyldimethylsilyl chloride (TBDMSCl), hydrogen fluoride (HF), phenyl (pH), bis(trimethylsilyl)amine (HMDS), dimethylformamide (DMF); methylene chloride (DCM); tetrahydrofuran (THF); high-performance liquid chromatography (HPLC); mass spectrometry (MS), evaporative light scattering detector (ELSD), electroscattering (ES)); nuclear magnetic resonance spectroscopy (NMR).

[0162] As used in this document, the term “effective amount” refers to an amount (e.g., of a nucleic acid or a composition) sufficient to achieve beneficial or desired results. An effective amount may be administered in one or more administrations, applications, or dosages and is not intended to be limited to a specific formulation or route of administration. The term effective amount may be considered to include therapeutically and / or prophylactically effective amounts of a compound.

[0163] The phrase “therapeutically effective amount”, as used herein, means the amount of a compound (e.g., a nucleic acid, e.g., an mRNA), material or composition comprising a compound (e.g., a nucleic acid, e.g., an mRNA) that is effective in producing some desired therapeutic effect in at least one subpopulation of cells in a mammal, Petition 870250067839, dated 01 / 08 / 2025, page 180 / 474 48 / 300 for example, a human being, or a subject (for example, a human subject) to a reasonable benefit / risk ratio applicable to any medical treatment.

[0164] The phrase “prophylactically effective amount”, as used herein, means the amount of a compound (e.g., a nucleic acid, e.g., an mRNA), material or composition comprising a compound (e.g., a nucleic acid, e.g., an mRNA) that is effective in producing some desired prophylactic effect in at least one subpopulation of cells in a mammal, e.g., a human being, or a subject (e.g., a human subject) by reducing, minimizing or eliminating the risk of developing a condition or reducing or minimizing the severity of a condition to a reasonable benefit / risk ratio applicable to any medical treatment.

[0165] As used herein, the terms “treat”, “treating” and “treatment” include any effect, for example, diminishing, reducing, modulating, improving or eliminating, that results in the improvement of the condition, disease, disorder and the like, or in the improvement of a symptom thereof.

[0166] The phrase “pharmaceutically acceptable” is used here to refer to compounds, materials, compositions and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic response or other problem or complication, consistent with a reasonable benefit / risk ratio.

[0167] In the request, where it is stated that an element or component is included and / or selected from a list of recited elements or components, it should be understood that the element or component may be any of the recited elements or components, or the element or component may be selected from a group consisting of two or more of the recited elements or components. Petition 870250067839, dated 01 / 08 / 2025, p. 181 / 474 49 / 300

[0168] Furthermore, it should be understood that the elements and / or characteristics of a composition or method described herein may be combined in various ways without departing from the spirit and scope of the present invention, whether explicitly or implicitly stated herein. For example, when reference is made to a particular compound, that compound may be used in various embodiments of compositions of the present invention and / or in methods of the present invention, unless otherwise understood from the context. In other words, within this application, the embodiments have been described and represented in a way that allows a clear and concise application to be written and drawn, but it is intended and will be appreciated that the embodiments may be combined or separated in a variable manner without departing from the present teaching and invention(s).For example, it will be appreciated that all the features described and outlined in this document may be applicable to all aspects of the invention(s) described in this document(s).

[0169] It should be understood that the expression “at least one of” includes individually each of the objects recited after the expression and the various combinations of two or more of the objects recited, unless otherwise understood from the context and usage. The expression “and / or” in connection with three or more objects recited should be understood as having the same meaning, unless otherwise understood from the context.

[0170] The use of the term “include”, “includes”, “including”, “have”, “has”, “having”, “contain” or “contains”, including grammatical equivalents thereof, should generally be understood as open-ended and non-limiting, i.e., not excluding additional unspoken elements or steps, unless otherwise expressly stated or understood from the context.

[0171] When the use of the term “about” precedes a value Petition 870250067839, dated 01 / 08 / 2025, page 182 / 474 50 / 300 quantitative, the present invention also includes the specific quantitative value itself, unless specifically indicated otherwise. As used herein, the term “approximately” refers to a variation of ±10% from the nominal value, unless otherwise indicated or inferred.

[0172] As used in this document, unless otherwise indicated, the term “antibody” means any antigen-binding molecule or molecular complex comprising at least one complementarity-determining region (CDR) that binds specifically to a particular antigen. The term is understood to encompass an intact antibody (e.g., an intact monoclonal antibody) or a fragment thereof, such as an Fc fragment of an antibody (e.g., an Fc fragment of a monoclonal antibody) or an antigen-binding fragment of an antibody (e.g., an antigen-binding fragment of a monoclonal antibody), including an intact antibody, antigen-binding fragment thereof, or Fc fragment that has been modified or altered or engineered. Examples of antigen-binding fragments include Fab, Fab', (Fab')2, Fv, single-chain antibodies (e.g., scFv), minibodies, and diabodies.Examples of antibodies that have been modified or engineered include chimeric antibodies, humanized antibodies, and multispecific antibodies (e.g., bispecific antibodies). The term also encompasses a single variable immunoglobulin domain, such as a Nanobody (e.g., a Vhh).

[0173] Natural antibodies generally comprise a tetramer. Each of these tetramers is typically composed of two identical pairs of polypeptide chains, each pair having a full-length “light” chain (typically having a molecular weight of about 25 kDa) and a full-length “heavy” chain (typically having a molecular weight of about 50–70 kDa). The terms “heavy chain” and Petition 870250067839, dated 01 / 08 / 2025, page 183 / 474 51 / 300 “light chain”, as used herein, refers to any immunoglobulin polypeptide with a variable domain sequence sufficient to confer specificity for a target antigen. The amino-terminal portion of each light and heavy chain typically includes a variable domain of about 100 to 110 or more amino acids that is typically responsible for antigen recognition. The carboxy-terminal portion of each chain typically defines a constant domain responsible for the effector function.Thus, in a naturally occurring antibody, a full-length heavy chain immunoglobulin polypeptide includes a variable domain (Vh) and three constant domains (Chi, Ch2, and Ch3), wherein the Vh domain is at the amino terminus of the polypeptide and the Ch3 domain is at the carboxyl terminus, and a full-length light chain immunoglobulin polypeptide includes a variable domain (Vl) and a constant domain (Cl), wherein the Vl domain is at the amino terminus of the polypeptide and the Cl domain is at the carboxyl terminus.

[0174] Human light chains are typically classified as kappa and lambda light chains, and human heavy chains are typically classified as mu, delta, gamma, alpha, or epsilon, and define the antibody isotype as IgM, IgD, IgG, IgA, and IgE, respectively. IgG has several subclasses, including but not limited to IgG1, IgG2, IgG3, and IgG4. IgM has subclasses including but not limited to IgM1 and IgM2. IgA is similarly subdivided into subclasses including but not limited to IgA1 and IgA2. In the complete light and heavy chains, the variable and constant domains are typically joined by a “J” region of about 12 or more amino acids, with the heavy chain also including a “D” region of about 10 more amino acids. See, for example, Fundamental Immunology (Paul, W., ed., Raven Press, 2nd ed., 1989), which is incorporated by reference in its entirety for all purposes.The variable regions of each light / heavy chain pair typically form a binding site. Petition 870250067839, dated 01 / 08 / 2025, page 184 / 474 52 / 300 antigen. The variable domains of naturally occurring antibodies typically exhibit the same general structure of relatively conserved framework regions (FR) linked by three hypervariable regions, also called complementarity-determining regions or CDRs. The CDRs of the two chains in each pair are typically aligned by the framework regions, which may allow binding to a specific epitope. From the amino terminus to the carboxyl terminus, both light and heavy chain variable domains typically comprise the FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4 domains.

[0175] The term “CDR set” refers to a group of three CDRs are single, variable regions capable of binding to antigen. The exact boundaries of these CDRs have been defined differently according to different systems. The system described by Kabat (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991)) not only provides an unambiguous residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries that define the three CDRs. These CDRs can be called Kabat CDRs. Chothia and colleagues (Chothia and Lesk, 1987, J. Mol. Biol. 196: 901-17; Chothia et al., 1989, Nature 342: 877-83) found that certain subportions within Kabat CDRs adopt nearly identical peptide backbone conformations, despite having great diversity at the amino acid sequence level.These subportions were designated as L1, L2, and L3 or H1, H2, and H3, where “L” and “H” designate the light chain and heavy chain regions, respectively. These regions can be called Chothia CDRs, which have boundaries that overlap with Kabat CDRs. Other boundaries defining CDRs that overlap with Kabat CDRs were described by Padlan, 1995, FASEB J. 9: 133-39; MacCallum, 1996, J. Mol. Biol. 262(5): 732-45; and Lefranc, 2003, Dev. Comp. Petition 870250067839, dated 01 / 08 / 2025, p. 185 / 474 53 / 300 Immunol. 27: 55-77. Still other definitions of CDR boundaries may not strictly follow one of the systems described here, but nevertheless overlap with Kabat CDRs, although they may be shortened or lengthened in light of predictions or experimental findings that particular residues or groups of residues, or even entire CDRs, do not significantly impact antigen binding. The methods used in this document may utilize CDRs defined according to any of these systems, although certain modalities use CDRs defined by Kabat or Chothia. The identification of predicted CDRs using amino acid sequence is well known in the field, as in Martin, AC “Protein sequence and structure analysis of antibody variable domains”, In Antibody Engineering, volume 2. Kontermann R., Dübel S., eds. Springer-Verlag, Berlin, pages 33-51 (2010).The amino acid sequence of the variable domain of the heavy and / or light chain can also be inspected to identify the CDR sequences by other conventional methods, for example, by comparison with known amino acid sequences from other variable regions of the heavy and light chain to determine the hypervariability regions of the sequence. The numbered sequences can be aligned by eye, or by employing an alignment program, such as one from the CLUSTAL suite of programs, as described in Thompson, 1994, Nucleic Acids Res. 22: 4673-80. Molecular models are conventionally used to correctly delineate the framework and CDR regions and thus correct sequence-based assignments.

[0176] The term “Fc”, as used herein, refers to a molecule comprising the sequence of an antigen-unbound fragment resulting from the digestion of an antibody or produced by other means, whether in monomeric or multimeric form, and may contain the hinge region. The original immunoglobulin source of native Fc is Petition 870250067839, dated 01 / 08 / 2025, p. 186 / 474 54 / 300 preferably of human origin and can be any of the immunoglobulins, although IgG1 and IgG2 are preferred. Fc molecules are composed of monomeric polypeptides that can be linked in dimeric or multimeric forms by covalent (i.e., disulfide bonds) and non-covalent association. The number of intermolecular disulfide bonds between monomeric subunits of native Fc molecules varies from 1 to 4, depending on the class (e.g., IgG, IgA, and IgE) or subclass (e.g., IgG1, IgG2, IgG3, IgA1, and IgGA2). An example of an Fc molecule is a disulfide-linked dimer resulting from the digestion of an IgG with papain. The term "native Fc," as used herein, is generic for monomeric, dimeric, and multimeric forms.

[0177] An F(ab) fragment typically includes a light chain and the Vh and Chi domains of a heavy chain, wherein the Vh-Chi heavy chain portion of the F(ab) fragment cannot form a disulfide bond with another heavy chain polypeptide. As used in the present document, an F(ab) fragment may also include a light chain containing two variable domains separated by an amino acid linker and a heavy chain containing two variable domains separated by an amino acid linker and a Chi domain.

[0178] An F(ab') fragment typically includes a light chain and a portion of a heavy chain that contains more of the constant region (between the Chi and Ch2 domains), so that an interchain disulfide bond can be formed between two heavy chains to form an F(ab')2 molecule.

[0179] As used herein, an “antibody that binds to X” (that is, X being a particular antigen), or “an anti-X antibody”, is an antibody that specifically recognizes antigen X.

[0180] As used in this document, a “buried interchain disulfide bond” or a “buried interchain disulfide bond” refers to a disulfide bond in a polypeptide that is not Petition 870250067839, dated 01 / 08 / 2025, page 187 / 474 55 / 300 is either easily accessible to water-soluble reducing agents, or is effectively “buried” in the hydrophobic regions of the polypeptide, so that it is not available to either reducing agents or conjugation to other hydrophilic pexos. Buried interchain disulfide bonds are further described in WO2017 096361A1, which is incorporated by reference in its entirety.

[0181] As used in this document, the specificity of LNP-targeted delivery is defined by the ratio of the percentage of hematopoietic stem cells (HSCs) that receive the administered nucleic acid (e.g., on-target delivery) to the percentage of an undesired or untargeted cell type that is not intended to be the delivery destination but receives the administered nucleic acid (e.g., off-target delivery). For example, specificity is higher when more HSCs receive the delivered nucleic acid and / or when fewer cells of other types receive the delivered nucleic acid. The specificity of LNP-targeted delivery can also be defined by the ratio of the amount of nucleic acid being delivered to HSCs (e.g., on-target delivery) to the amount of nucleic acid being delivered to cells of other types (e.g., off-target delivery).Delivery specificity can be determined using any suitable method. As a non-limiting example, the level of nucleic acid expression in HSCs can be measured and compared to that of another cell type that is not intended to be the delivery target.

[0182] As used in this document, a humanized antibody is an antibody that is wholly or partly of non-human origin and whose protein sequence has been modified to replace certain amino acids, for example, that occur at the corresponding position(s) in the framework regions of the VH and VL domains in a human antibody sequence, to increase its similarity to Petition 870250067839, dated 01 / 08 / 2025, page 188 / 474 56 / 300 antibodies are produced naturally in humans in order to prevent or minimize an immune response in humans. For example, using genetic engineering techniques, the variable domains of a non-human antibody of interest can be combined with the constant domains of human antibodies. The constant domains of a humanized antibody are most often human CH and CL domains.

[0183] As used herein, the term “spacer” or “linker” denotes a peptide that fuses two or more polypeptides or proteins into a single molecule. The use of spacers to connect two or more (poly)peptides is well known in the art. Additional exemplary peptide spacers are shown in Table C. A frequently used class of peptide spacer is known as “Gly-Ser” or “GS” spacers. These are spacers that consist essentially of glycine (G) and serine (S) residues and generally comprise one or more repetitions of a peptide motif, such as the GGGGS motif (SEQ ID NO: 45) (e.g., having the formula (GlyGly-Gly-Gly-Ser)n where n can be 1, 2, 3, 4, 5, 6, 7 or more). Some frequently used examples of such GS spacers are 9GS spacers (GGGGSGGGS, SEQ ID NO: 48), 15GS spacers (n=3) and 35GS spacers (n=7). Reference is made, for example, to Chen et al. 2013 (Adv. Drug Deliv. Rev. 65(10): 1357-1369) and Klein et al.2014 (Protein Eng. Des. Sel. 27 (10): 325-330).

[0184] As used in this document, the term “structural lipid” refers to sterols and also to lipids containing sterol moieties.

[0185] It should be understood that the order of steps or the order in which to perform certain actions is immaterial, as long as the present invention remains operable. Furthermore, two or more steps or actions can be conducted simultaneously.

[0186] In several places in this descriptive report, the substitutes Petition 870250067839, dated 01 / 08 / 2025, page 189 / 474 57 / 300 alkyl compounds are disclosed in groups or bands. The description is specifically intended to include each and every individual subcombination of the members of such groups and bands. For example, the term “C1-6 alkyl” is specifically intended to individually disclose C1, C2, C3, C4, C5, C6, C1-C6, C1-C5, C1-C4, C1-C3, C1-C2, C2-C6, C2-C5, C2-C4, C2-C3, C3-C6, C3-C5, C3-C4, C4-C6, C4-C5, and C5-C6 alkyl. By way of further examples, an integer in the range of 0 to 40 is specifically intended to individually reveal 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, and 40, and an integer in the range of 1 to 20 is specifically intended to individually reveal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20.

[0187] The use of any and all examples, or illustrative language in this document, for example, “such as” or “including,” is intended only to better illustrate the present invention and does not represent a limitation on the scope of the invention, unless claimed. No language in the descriptive report should be interpreted as indicating any unclaimed element as essential to the practice of this invention.

[0188] Throughout the description, in which compositions and kits are described as having, including, or comprising specific components, or in which processes and methods are described as having, including, or comprising specific steps, it is contemplated that, additionally, there are compositions and kits of the present invention that consist essentially of the aforementioned components, and that there are processes and methods according to the present invention that consist essentially of the aforementioned components, or consist of the aforementioned processing steps.

[0189] As a general rule, compositions that specify a percentage are by weight, unless otherwise indicated. In addition Petition 870250067839, dated 01 / 08 / 2025, page 190 / 474 58 / 300 of this, if a variable is not accompanied by a definition, the previous definition of the variable controls. II. Lipid nanoparticle compositions

[0190] The invention provides a lipid nanoparticle (LNP) composition comprising an ionizable cationic lipid described herein and / or a lipid-HSC target group conjugate (e.g., lipid-antibody conjugate) described herein. In certain embodiments, the LNP may comprise an ionizable cationic lipid described herein and one or more of a sterol, a neutral phospholipid, a PEG-lipid, and an immune cell targeting group-lipid conjugate. In some embodiments, the LNP comprises a lipid mixture comprising the ionizable cationic lipid and one or more of a sterol, a neutral phospholipid, a PEG-lipid, and a lipid-HSC target group conjugate (e.g., lipid-antibody conjugate). (a) Ionizable cationic lipids

[0191] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid. When used in a lipid nanoparticle composition, such ionizable cationic lipids can facilitate the delivery of a payload (e.g., a nucleic acid, such as DNA or RNA, such as mRNA) to cells, e.g., mammalian cells, e.g., hematopoietic stem cells (HSCs). Such ionizable cationic lipids are designed to enable the intracellular delivery of a nucleic acid, e.g., mRNA, to the cytosolic compartment of a target cell type and rapidly degrade into non-toxic components. The complex functionalities of ionizable cationic lipids are facilitated by the interaction between the chemistry and geometry of the ionizable lipid head group, the hydrophobic “acyl tail” groups, and the ligands that link the head group and Petition 870250067839, dated 01 / 08 / 2025, p. 191 / 474 59 / 300 acyl tail groups. Typically, the pKa of the ionizable amine head group is designed to be in the range of 6 to 8, such as between 6.2 and 7.4, or between 6.7 and 7.2, so that it remains strongly cationic under acidic formulation conditions (e.g., pH 4 - pH 5.5), neutral or slightly anionic at physiological pH (7.4), and cationic in the early and late endosomal compartments (e.g., pH 5.5 - pH 7). Acyl tail groups play a key role in fusion of the lipid nanoparticle with endosomal membranes and membrane destabilization through structural perturbation.The three-dimensional structure of the acyl tail (determined by its length, degree, and location of unsaturation) along with the relative sizes of the head and tail groups is believed to play a role in promoting membrane fusion and, therefore, endosomal escape of lipid nanoparticles (a fundamental requirement for cytosolic delivery of a nucleic acid payload). The ligand that links the head and tail acyl groups is designed to degrade by physiologically prevalent enzymes (e.g., proteases or proteases) or by acid-catalyzed hydrolysis.

[0192] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid represented by Formula (II'): (II'), or a salt thereof, wherein: R1, R2 and R3 are each independently a C1-3 alkylene bond; Petition 870250067839, dated 01 / 08 / 2025, p. 192 / 474 60 / 300 R1A, R2A and R3A are each independently a C1-10 alkylene bond; R1A1, R1A2, R1A3, R2A1, R2A2, R2A3, R3A1, R3A2, and R3A3 are each independently H, C1-20 alkyl, C1-20 alkenyl, -(CH2)o1oC(O)ORa1or -(CH2)o-1oOC(O)Ra2; Ra1 and Ra2sion, each independently C1-20 alkyl or C1-20 alkenyl; r3B2 R3B”^ I R3Bé R3B3; R3B1 is a C1-6 alkylene; and R3B2 and R3B3 are each independently H or C1-6 alkyl optionally substituted by one or more substituents, each independently selected from the group consisting of -OH and -O-(C1-6 alkyl).

[0193] Any of the variables or substituents provided in this document is either not substituted or substituted by one or more substituents. In some embodiments, any of the variables or substituents provided in this document is optionally substituted. In some embodiments, any of the variables or substituents provided in this document is optionally substituted by one or more substituents independently selected from the group consisting of -ORs1, -NRs2Rs3, -C(O)Rs4, -C(O)ORs5, C(O)NRs6 Rs7, -OC(O)Rs8, -OC(O)ORs9, -OC(O)NRs10R11, -NRs12C(O)Rs13e NRs14C(O)ORs15, where Rs1 Rs2 Rs3 Rs4 Rs5 Rs6 Rs7 Rs8 Rs9 Rs10 Rs11, Rs12, Rs13, Rs14 and Rs15 are each independently H, C1-6 alkyl, C3-10 cycloalkyl, C6-14 aryl, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl, each of which is optionally substituted.

[0194] In some modes, R1, R2 and R3 are each, Petition 870250067839, dated 01 / 08 / 2025, p. 193 / 474 61 / 300 independently a linkage or C1-3 alkylene. In some embodiments, R1, R2 and R3 are each independently a linkage or methylene. In some embodiments, R1 and R2 are each methylene and R3 is a linkage. In some embodiments, R1, R2 and R3 are each methylene. In some embodiments, R1, R2 and R3 are each independently unsubstituted or substituted.

[0195] In some embodiments, R1A, R2A and R3A are each independently a C1-10 alkylene linkage. In some embodiments, R1A, R2A and R3A are each independently a -(CH2)i-io- linkage. In some embodiments, R1A and R2A are each independently a -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, -(CH2)6-, -(CH2)7- or -(CH2)8- linkage. In some embodiments, R1A and R2A are each a bond, each -CH2-, each -(CH2)2-, each -(CH2)3-, each (CH2)4-, each -(CH2)6-, each -(CH2)7- or each -(CH2)8-. In some embodiments, R1A and R2A are each independently a bond, each -(CH2)2-, -(CH2)4-, -(CH2)6-, -(CH2)7- or -(CH2)8-. In some embodiments, R1A and R2A are each a bond, each -(CH2)2-, each -(CH2)4-, each -(CH2)6-, each -(CH2)7- or each -(CH2)8-. In some embodiments, R3A is a linkage, -CH2-, -(CH2)2-, or -(CH2)7-. In some embodiments, R1A, R2A, and R3A are each independently unsubstituted or substituted.

[0196] In some modes, R1A1, R1A2, R1A3, R2A1, R2A2, R2A3, R3A1, R3A2 and R3A3 are each independently H, C1-20 alkyl, C120 alkenyl, -(CH2)o-1oC(O)ORa1 or -(CH2)o-1oOC(O)Ra2. In some embodiments, R1A1, R1A2, R1A3, R2A1, R2A2, R2A3, R3A1, R3A2, and R3A3 are each independently H, C1-15 alkyl, -CH=CH-(C1-15 alkyl), CH=CH-CH2-CH=CH-(C1-15 alkyl), -(CH2)o-4C(0)OCH(Ci-io alkyl)(C115 alkyl), -(CH2)o-40C(0)CH(Ci-io alkyl)(C1-15 alkyl), -(CH2)o4C(O)OCH2(Ci-i5 alkyl) or -(CH2)o-40C(0)CH2(Ci-i5 alkyl). In some modes, R1A1, R1A2, R1A3, R2A1, R2A2, R2A3, R3A1, R3A2 and R3A3 Petition 870250067839, dated 01 / 08 / 2025, pp. 194 / 474 62 / 300 are, each independently, either not replaced or replaced.

[0197] In some embodiments, R1A1 and R2A1 are each independently -CH=CH-(C1-15 alkyl), -CH=CH-CH2-CH=CH-(C1-10 alkyl), -(CH2)o-4C(O)OCH(C1-10 alkyl)(C1-15 alkyl) or -(CH2)o4OC(O)CH(C1-10 alkyl)(C1-15 alkyl); and R1A2, R1A3, R2A2 and R2A3 are each H. In some embodiments, R1A1 and R2A1 are each or In some modes, R1A1 and R2A1 are each C1-15 alkyl; R1A2 and R2A2 are each C1-15 alkyl; and R1A3 and R2A3 are each H. In some embodiments, R1A1 and R2A1 are each, ; and R1A2 and R2A2 are, each one,

[0198] In some embodiments, R1A1 and R2A1 are each -(CH2)o4OC(O)CH2(C1-15 alkyl); R2A1 and R2A2 are each -(CH2)o-4C(O)OCH2(C1-15 alkyl); and R1A3 and R2A3 are each H. In some Petition 870250067839, dated 01 / 08 / 2025, p. 195 / 474 63 / 300 modalities riai and R2A1 are, Each One, ; and R2A1 and R2A2 are, each one, the

[0199] In some embodiments, R1A1 and R2A1 are each C(O)OCH2(C1-15 alkyl); R1A2 and R2A2 are each -(CH2)o4C(O)OCH2(C1-15 alkyl); and R1A3 and R2A3 are each H. In some In the modalities, R1A1 and R2A1 are, each one, the ; and R1A2 and R2A2 are, each one,

[0200] In some embodiments, R3A1, R3A2 and R3A3 are each independently H, C1-15 alkyl, -(CH2)o-4C(O)OCH(C1-5 alkyl)(C1-10 alkyl), -(CH2)o-4OC(O)CH(C1-5 alkyl)(C1-10 alkyl), -(CH2)o-4C(O)OCH2(C1-10 alkyl) or -(CH2)O-4OC(O)CH2(C1-10 alkyl).

[0201] In some embodiments, R3A1 and R3A2 are each independently C1-15 alkyl; and R3A3 is H. In some embodiments, R3A1 and R3A2 are each independently ethyl,

[0202] In some embodiments, R3A1 is C1-15 alkyl; and R3A2 and R3A3 are each H. In some embodiments, R3A1 is

[0203] In some embodiments, R3A1 is -C(O)OCH(C1-5 alkyl)(C110 alkyl); and R3A2 and R3A3 are each H. In some embodiments, Petition 870250067839, dated 01 / 08 / 2025, page 196 / 474 64 / 300 or

[0204] In some embodiments, R3A1 is -(CH2)o-4OC(O)CH2(C1-Io alkyl); R3A2 is -(CH2)o-4(O)OCH2(C1-Io alkyl); and R3A3 is H. In some embodiments, R3A1 is or and R3A2 and the

[0205] In some embodiments, R3A1 is -(CH2)o-4C(O)OCH2(C1-io alkyl); R3A2 is -(CH2)o-4C(O)OCH2(C1-io alkyl); and R3A3 is H. In some- but modalities, R3A1 is; and R3A2 is

[0206] In some modes, R3A1, R3A2 and R3A3 are each, H.

[0207] Ra1e Ra2são, each independently C1-20 alkyl or C1-20 alkenyl. In some embodiments, Ra1 and Ra2 are, each independently -(CH2)o-15CH3 or -CH(C1-10 alkyl)(C1-15 alkyl). In some embodiments, Ra1 and Ra2 are, each independently Petition 870250067839, dated 01 / 08 / 2025, p. 197 / 474 65 / 300 Each of which is optionally replaced. In some modalities, Ra1 and Ra2 are each independently either not replaced or replaced. r3B2

[0208] In some modalities, R3Bé R3B3. In some modalities, R3Bé H. In some modalities, R3Bé not replaced or replaced.

[0209] In some embodiments, R3B1 is C1-6 alkylene. In some embodiments, R3B1 is ethylene or propylene. In some embodiments, R3B1 is unsubstituted or substituted. In some embodiments, R3B1 is optionally substituted.

[0210] In some embodiments, R3B2 and R3B3 are each independently and optionally substituted. In some embodiments, R3B2 and R3B3 are each independently H or C1-6 alkyl optionally substituted by one or more substituents, each independently selected from the group consisting of -OH and -O(C1-6 alkyl). In some embodiments, R3B2 and R3B3 are each independently H or C1-6 alkyl groups optionally substituted by one or more substituents independently selected from the group consisting of -ORs1, -NRs2Rs3, -C(O)Rs4, -C(O)ORs5, C(O)NRs6Rs7, OC(O)Rs8, -OC(O)ORs9, -OC(O)NRs10R11, -NRs12C(O)Rs13 and NRs14C(O)ORs15, where Rs1 Rs2 Rs3 Rs4 Rs5 Rs6 Rs7 Rs8 Rs9 Rs10 Rs11, Rs12, Rs13, Rs14 and Rs15 are each independently H, C1-6 alkyl, C3-10 cycloalkyl, C6-14 aryl, 5- to 10-membered heteroaryl or 3- to 10-membered heterocyclyl, each of which is optionally substituted. In some embodiments, R3B2 and R3B3 are each Petition 870250067839, dated 01 / 08 / 2025, p. 198 / 474 66 / 300 independently H, methyl, ethyl, propyl, butyl, or pentyl, each of which is optionally substituted by one or more substituents, each independently selected from the group consisting of -OH and -O-(C1-6 alkyl). In some embodiments, R3B2 and R3B3 are each independently methyl or ethyl, each optionally substituted by one or more -OH. In some embodiments, R3B2 and R3B3 are each methyl or each ethyl, each optionally substituted by one or more -OH. In some embodiments, R3B2 and R3B3 are each unsubstituted methyl. r3B2 r3bi ' I

[0211] In some modalities, Ré or each of which is optionally replaced.

[0212] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid represented by Formula (IIa): R3A1(IIa), or a salt thereof, where R1A, R2A, R3A, R1A1, R1A2, R1A3, R2A1, R2A2, Petition 870250067839, dated 01 / 08 / 2025, p. 199 / 474 67 / 300 R2A3, R3A1, r3A2, R3A3, R3B1, R3B2 θ R3B3Sg0ΟΟΠίΟΓΓΠΘ deflDldOS ρθΓΘ 3 Formula (II'), Formula (II), or any variation or modality thereof.

[0213] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid represented by Formula (llb): r!a1_r1aou a salt of the same, where R1A, R2A, R3A, R1A1, R1A2, R1A3, R2A1, R2A2, R2A3, r3ai_ r3A2e R3A3δθ0 as defined for Formula (II'), Formula (II), or any variation or embodiment thereof.

[0214] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid of formula: or a salt of the same.

[0215] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid of formula: Petition 870250067839, dated 01 / 08 / 2025, page 200 / 474 68 / 300 or a salt of the same.

[0216] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid of formula: or a salt of the same.

[0217] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid represented by Formula 11Ia or Formula lllb: x1x2 (Formula llla) or a salt of the same, wherein: Petition 870250067839, dated 01 / 08 / 2025, page 201 / 474 69 / 300 R1' and R2' are independently C1-3 alkyl, or R1' and R2' are taken together with the nitrogen atom to form an optionally substituted piperidinyl or morpholinyl; Y is selected from the group consisting of -O-, -OC(O)-, -OC(S)- and -CH2-; X1, X2, X3 and X4 are hydrogen, or X1 and X2 or X3 and X4 are independently taken together to form an oxo; N is 0 or 3; oep are independently an integer selected from 2-6.

[0218] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid represented by Formula IIIa. In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid represented by Formula IIIb. In some embodiments, the compound of formula IIIa is not a compound selected from the group consisting of Petition 870250067839, dated 01 / 08 / 2025, p. 202 / 474 70 / 300 or one of their salty portions.

[0219] In certain modalities, oep may be 2. In certain modalities, oep may be 3. In other modalities, oep may be 4. In some modalities, oep may be 5. In other modalities, oep may be 6.

[0220] In certain embodiments, X1 and X2 can be taken together to form an oxo and X3 and X4 are taken together to form an oxo. In other embodiments, X1, X2, X3 and X4 can be hydrogen.

[0221] In certain embodiments, Y can be selected from the group consisting of -O-, -OC(O)-, OC(S)- and -CH2-. For example, in certain embodiments, Y can be -O-. In certain embodiments, Y can be -OC(O)-. In certain embodiments, Y can be -CH2-. In certain embodiments, Y can be -OC(S)-.

[0222] In certain embodiments, R1' and R2' may independently be C1-3 alkyl. In other embodiments, R1' and R2' may be -CH3. In certain embodiments, R1' and R2' are -CH2CH3. In certain embodiments, R1' and R2' are C3 alkyl.

[0223] In certain modes, n can be 0. In other modes, n can be 3.

[0224] This document also provides, in part, a Petition 870250067839, dated 01 / 08 / 2025, p. 203 / 474 71 / 300 compound represented by Formula IV: χ1 χ2h3C' / ^o R2'k(Px3x4(Formula IV), or a salt thereof, where: R1' and R2' are independently C1-3 alkyl, or R1' and R2' are taken together with the nitrogen atom to form an optionally substituted piperidinyl or morpholinyl; Y is selected from the group consisting of -O-, -OC(O)-, -OC(S)- and -CH2-; X1, X2, X3 and X4 are hydrogen, or X1 and X2 or X3 and X4 are taken together to form an oxo; n is 0-4; o is 1 er is an integer selected from 3 to 8 or o is 2 er is an integer selected from 1 to 8, p is 1 es is an integer selected from 3 to 8 or p is 2 es is an integer selected from 1 to 8, wherein, when oep are 1, res are independently 4, 5, 7 or 8, and when oep are 2, res are independently 1, 2, 4 or 5.

[0225] In certain embodiments, X1 and X2 can be taken together to form an oxo and X3 and X4 can be taken together to form an oxo. In other embodiments, X1, X2, X3 and X4 can be hydrogen.

[0226] In certain embodiments, Y can be selected from the group consisting of -O-, -OC(O)- and -CH2-. For example, in certain embodiments, Y can be -O-. In certain embodiments, Y can be OC(O)-. In certain embodiments, Y can be -CH2-. In certain embodiments, Y can be -OC(S)-. Petition 870250067839, dated 01 / 08 / 2025, pp. 204 / 474 72 / 300

[0227] In certain embodiments, R1' and R2' may independently be C1-3 alkyl. In other embodiments, R1' and R2' may be -CH3. In certain embodiments, R1' and R2' may be -CH2CH3. In some embodiments, R1' and R2' may be C3 alkyl. In certain embodiments, R1' and R2' are taken together with the nitrogen atom to form an optionally substituted piperidinyl.

[0228] In certain modes, n can be 0. In other modes, n can be 3.

[0229] In some embodiments, the lipid nanoparticle compositions provided in this document comprise an ionizable cationic lipid selected from the group consisting of: oe Petition 870250067839, dated 01 / 08 / 2025, page 205 / 474 73 / 300 or a salt of the same.

[0230] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid of formula: or a salt of the same.

[0231] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid of formula: or a salt of the same.

[0232] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid of formula: or a salt of the same.

[0233] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid of formula: Petition 870250067839, dated 01 / 08 / 2025, page 206 / 474 74 / 300 or a salt of the same.

[0234] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid of formula: or a salt of the same.

[0235] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid of formula: or a salt of the same.

[0236] In some embodiments, the lipid nanoparticle compositions provided herein comprise an ionizable cationic lipid of formula: or a salt of the same.

[0237] In some embodiments, the lipid nanoparticle compositions provided in this document comprise an ionizable cationic lipid of Formula V: Petition 870250067839, dated 01 / 08 / 2025, p. 207 / 474 75 / 300 (Formula V), or a salt thereof, where: R1' and R2' are independently C^alkyl, or R1' and R2' are taken together with the nitrogen atom to form an optionally substituted piperidinyl or morpholinnyl; Y is selected from the group consisting of -O-, -OC(O), -OC(S)- and -CH2-; X1, X2, X3, and X4 are hydrogen, or X1 and X2 or X3 and X4 are taken together to form an oxo; en is an integer selected from 0 to 4.

[0238] In certain embodiments, X1 and X2 can be taken together to form an oxo and X3 and X4 can be taken together to form an oxo. In other embodiments, X1, X2, X3 and X4 can be hydrogen.

[0239] In certain embodiments, Y can be selected from the group consisting of -O-, -OC(O)- and -CH2-. For example, in certain embodiments, Y can be -O-. In certain embodiments, Y can be OC(O)-. In certain embodiments, Y can be -CH2-. In certain embodiments, Y can be -OC(S)-.

[0240] In certain embodiments, R1' and R2' may independently be C1-3 alkyl. In other embodiments, R1' and R2' may be -CH3. In certain embodiments, R1' and R2' may be -CH2CH3. In some embodiments, R1' and R2' may be C3 alkyl. In certain embodiments, R1' and R2' are taken together with the nitrogen atom to form an optionally substituted piperidinyl.

[0241] In certain modes, n can be 0. In other modes, n can be 3.

[0242] In some embodiments, the lipid nanoparticle compositions provided in this document comprise a lipid Petition 870250067839, dated 01 / 08 / 2025, p. 208 / 474 76 / 300 ionizable cationic formula: or a salt of the same. Scheme S1 - Synthetic scheme to produce a lipid of the formula (Ilia)

[0243] A compound of Formula IIIa can be prepared, for example, according to scheme S1. A hydro-functional protected propane diol is converted to the corresponding dimethylamino functional ether (Y = oxo) or ester (Y = OC(O)). Ether linkage formation results from a reaction of the alkyl halide with alcohol in the presence of tertiary butylammonium iodide / NaOH in THF at 80 °C. Ester linkage formation utilizes treatment of an acidic dimethylamine functional with alcohol under carbodiimide activation (DCM, EDC, DIAPE, DMAP). Diol deprotection produces a vicinal diol intermediate which is subsequently converted into the corresponding ether- or ester-linked diacyl lipids by treatment with TBAI / NaOH and bromoacyl or by carbodiimide-mediated carboxylic acid activation to ester linkage formation, respectively. Petition 870250067839, dated 01 / 08 / 2025, p. 209 / 474 77 / 300 Scheme S2 - Synthetic scheme to produce a lipid composition of Formula (IV)

[0244] A compound of Formula IV can be prepared, for example, according to scheme S2. The synthetic procedure is as described above for scheme S1; however, in scheme S2, bis-unsaturated acyl groups or mono-unsaturated acyl groups can be employed to obtain a lipid of Formula IV.

[0245] In some embodiments, the ionizable cationic lipid used in the LNPs of the present disclosure is selected from the lipids in Table A or a combination thereof. In some embodiments, the ionizable cationic lipid is:

[0246] In some embodiments, the ionizable cationic lipid used Petition 870250067839, dated 01 / 08 / 2025, page 210 / 474 78 / 300 in the LNPs of the present disclosure is a compound of the formula (KC3): or a salt thereof. References to “KC3” or “lipid KC3” in this document refer to a compound of Formula (KC3) or a salt thereof. References to “KC3 LNPs” in this document refer to lipid nanoparticles comprising a compound of Formula (KC3) or a salt thereof. Table A: Exemplary ionizable cationic lipids. Petition 870250067839, dated 01 / 08 / 2025, p. 211 / 474 79 / 300 Petition 870250067839, dated 01 / 08 / 2025, p. 212 / 474 80 / 300 Petition 870250067839, dated 01 / 08 / 2025, p. 213 / 474 81 / 300 Petition 870250067839, dated 01 / 08 / 2025, p. 214 / 474 82 / 300 Petition 870250067839, dated 01 / 08 / 2025, p. 215 / 474 83 / 300 Petition 870250067839, dated 01 / 08 / 2025, p. 216 / 474 84 / 300 Petition 870250067839, dated 01 / 08 / 2025, p. 217 / 474 85 / 300 Petition 870250067839, dated 01 / 08 / 2025, p. 218 / 474 86 / 300 Petition 870250067839, dated 01 / 08 / 2025, p. 219 / 474 87 / 300 Petition 870250067839, dated 01 / 08 / 2025, p. 220 / 474 88 / 300 Petition 870250067839, dated 01 / 08 / 2025, p. 221 / 474 89 / 300

[0247] In some embodiments, the ionizable cationic lipid is not Dlin-MC3-DMA.

[0248] In certain embodiments, the ionizable cationic lipid described herein may be present in the LNP or lipid mixture in a range of 30-70 mol%, 30-60 mol%, 30-50 mol%, 40-70 mol%, 40-60 mol%, 40-50 mol%, 50-70 mol%, 50-60 mol%, or about 30 mol%, about 35 mol%, about 40 mol%, about 45 mol%, about 50 mol%, about 55 mol%, about 60 mol%, about 65 mol%, or about 70 mol%. Petition 870250067839, dated 01 / 08 / 2025, page 222 / 474 90 / 300 (b) Sterol

[0249] In certain embodiments, the LNP or lipid mixture may comprise a sterol component which may comprise, for example, cholesterol, fecosterol, β-sitosterol, ergosterol, campesterol, stigmasterol, stigmastanol or brassicasterol. In certain embodiments, the sterol is cholesterol.

[0250] Sterols (e.g., cholesterol) may be present in LNP or in the lipid mixture in a range of 20-70 mol%, 20-60 mol%, 20-50 mol%, 30-70 mol%, 30-60 mol%, 30-50 mol%, 40-70 mol%, 40-60 mol%, 40-50 mol%, 50-70 mol%, 50-60 mol%, or about 20 mol%, about 25 mol%, about 30 mol%, about 35 mol%, about 40 mol%, about 45 mol%, about 50 mol%, about 55 mol%, about 60 mol%, or about 65% by mole. (c) Neutral phospholipid

[0251] In some embodiments, the LNP or lipid mixture may comprise one or more neutral phospholipids described herein. In certain embodiments, the one or more neutral phospholipids may comprise, for example, phosphatidylcholine, phosphatidylethanolamine, distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoylsn-glycero-3-phosphocholine (DSPC), hydrogenated soy phosphatidylcholine (HSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) or 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), sphingomyelin (SM).

[0252] Neutral phospholipids include, for example, distearoyl-phosphatidylethanolamine (DSPE), dimyrstoyl-phosphatidylethanolamine (DMPE), distearoyl-glycero-phosphocholine (DSPC), phosphatidylcholine de soja hidrogenada (HSPC), dioleoyl-glycero-phosphoethanolamine (DOPE), dilinoleoyl-glycerophosphocholine (DLPC), dimyristoyl-glycero-phosphocholine (DMPC), dioleoyl-glycero-phosphocholine (DOPC), dipalmitoyl-glycero-phosphocholine (DPPC), diundecanoyl-glycero-phosphocholine (DUPC), palmitoyl-oleoyl-glycero-phosphocholine Petition 870250067839, 01 / 08 / 2025, pág. 223 / 474 91 / 300 (POPC), dictadecenyl-glycero-phosphocholine, oleoyl-cholesteryl-hemisuccinoylglycero-phosphocholine, hexadecyl-glycero-phosphocholine, dilinolenoyl-glycero-phosphocholine, diaraquidonoyl-glycero-3-phosphocholine, didocosa-hexaenoyl-glycero-phosphocholine or esphingomyelin.

[0253] Neutral phospholipid may be present in LNP or in the lipid mixture in a range of 1-10 mol%, 1-15 mol%, 1-12 mol%, 1-10 mol%, 3-15 mol%, 3-12 mol%, 3-10 mol%, 4-15 mol%, 4-12 mol%, 4-10 mol%, 4-8 mol%, 5-15 mol%, 5-12 mol%, 5-10 mol%, 6-15 mol%, 6-12 mol%, about 6-10 mol%, or about 1 mol%, about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol%, about 6 mol%, about 7 mol%, about 8 mol%, about 9 mol%, about 10 mol%, about 11 mol%, about 12 mol%, about 13 mol%, about 14 mol% or about 15 mol%. (d) PEG-lipid

[0254] The LNP or lipid mixture may include one or more lipids modified with polyethylene glycol (PEG) or PEG. Such species may be alternately referred to as pegylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. As noted above, free PEG lipids may be included in the LNP or lipid mixture to reduce or eliminate nonspecific binding through a target group when an HSC-lipid target group conjugate (e.g., antibody conjugate) is included in the LNP or lipid mixture.

[0255] One or more PEG lipids may comprise, for example, PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, and PEG-modified dialkylglycerols. For example, a PEG lipid may be PEG-dioleoylglycerol (PEG-DOG), PEG-dimyristoylglycerol (PEG-D10), or PEG-dimyristoylglycerol (PEG-D10). Petition 870250067839, dated 01 / 08 / 2025, pp. 224 / 474 92 / 300 DMG), PEG-dipalmitoylglycerol (PEG-DPG), PEG-dilinoleoylglycerophosphatidylethanolamine (PEG-DLPE), PEG-diesteylethanolamine (PEG-DMPE), PEG-diesteylleoyldiesteylethanolamine (PEG-DMPE), PEG-dipalmitoylphosphatidylethanolamine (PEG-DEPI), PEG-distearoylglycerol (PEG-DSG), PEG-diacylglycerol (PEG-DAG, for example, PEG-DMG, PEG-DPG and PEG-DSG), PEG-ceramide, PEG-distearoylglycerophosphoglycerol (PEG-DASP), PEG-dioleoylglycerophosphoethanolamine (PEG-DOPE), 2[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide or a lipid PEG-distearoylphosphatidylethanolamine (PEG-DSPE).

[0256] In certain embodiments, the LNP or lipid mixture may contain one or more free PEG-lipids which may comprise, for example, PEG-distearoylglycerol (PEG-DSG), PEG-diacylglycerol (PEGDAG, for example, PEG-DMG, PEG-DPG and PEG-DSG), PEG-dimyristoylglycerol (PEG-DMG), PEG-distearoylphosphatidylethanolamine (PEGDSPE) and PEG-dimyristoylphosphatidylethanolamine (PEG-DMPE). In some embodiments, the free PEG-lipid comprises a diacylphosphatidylcholine chain comprising a dipalmitoyl (C16) chain or a distearoyl (C18) chain.

[0257] PEG-lipid may be present in LNP or in the lipid mixture in a range of 1-10 mol percent, 1-8 mol percent, 1-7 mol percent, 1-6 mol percent, 1-5 mol percent, 1-4 mol percent, 1-3 mol percent, 2-8 mol percent, 2-7 mol percent, 2-6 mol percent, 2-5 mol percent, 2-4 mol percent, 2-3 mol percent or about 1 mol percent, about 2 mol percent, about 3 mol percent, about 4 mol percent or about 5 mol percent. In some embodiments, the PEG-lipid is a free PEG-lipid.

[0258] In some embodiments, PEG-lipid may be present in the LNP or in the lipid mixture in the range of 0.01-10 mol percent, 0.01-5 mol percent, 0.01-4 mol percent, 0.01-3 mol percent Petition 870250067839, dated 01 / 08 / 2025, page 225 / 474 93 / 300 mol, 0.01-2 mol percent, 0.01-1 mol percent, 0.1-10 mol percent, 0.1-5 mol percent, 0.1-4 mol percent, 0.1-3 mol percent, 0.1-2 mol percent, 0.1-1 mol percent, 0.5-10 mol percent, 0.5-5 mol percent, 0.5-4 mol percent, 0.5-3 mol percent, 0.5-2 mol percent, 0.5-1 mol percent, 1-2 mol percent, 3-4 mol percent, 4-5 mol percent, 5-6 mol percent or 1.25-1.75 mol percent. In some embodiments, the PET-lipid may be about 0.5 mol percent, about 1 mol percent, about 1.5 mol percent, about 2 mol percent, about 2.5 mol percent, about 3 mol percent, about 3.5 mol percent, about 4 mol percent, about 4.5 mol percent, about 5 mol percent, or about 5.5 mol percent of the lipid mixture. In some embodiments, the PEG-lipid is a free PEG-lipid.

[0259] In some embodiments, the PEG-lipid anchor length is C14 (as in PEG-DMG). In some embodiments, the PEG-lipid anchor length is C16 (as in DPG). In some embodiments, the PEG-lipid anchor length is C18 (as in PEG-DSG). In some embodiments, the main structure or head group of the PEG-lipid is glycerol diacyl or phosphoethanolamine. In some embodiments, the PEG-lipid is a free PEG-lipid.

[0260] An LNP of the present disclosure may comprise one or more free PEG-lipids that are not conjugated to an HSC target group (e.g., an antibody that binds to CD105 and / or CD117) and a PEG-lipid that is conjugated to an HSC target group (e.g., an antibody that binds to CD105 and / or CD117). In some embodiments, the free PEG-lipid comprises the same as or a different lipid from the lipid in the lipid-HSC target group conjugate (e.g., lipid-antibody conjugate). Petition 870250067839, dated 01 / 08 / 2025, p. 226 / 474 94 / 300 (e) HSC target group

[0261] As discussed in this document, LNPs can be targeted to a particular cell type, for example, a hematopoietic stem cell (HSC). This can be accomplished using one or more of the lipids described in this document. In addition, targeting can be enhanced by including an HSC target group on a solvent-accessible surface of an LNP particle. For example, HSC targeting groups may include a member of a specific binding pair, for example, an antibody-antigen pair, a ligand-receptor pair, etc. In some embodiments, the HSC target group is an antibody. In certain embodiments, the antibody binds to an HSC surface antigen, such as CD105 (also known as endoglin) and / or CD117 (also known as c-kit, KIT tyrosine-protein kinase, or mast cell / stem cell growth factor receptor (SCFR)).Targeting can be implemented, for example, using HSC lipid-target group conjugates (e.g., lipid-antibody conjugates) described in this document.

[0262] Optionally, the HSC target group is an antibody fragment (e.g., an antibody fragment that binds to CD105 and / or CD117) without an Fc component. scFv, Fab, or VHH fragments can also be directly conjugated to activated PEG-lipids to produce insertable conjugates. In some embodiments, the HSC target group is an antibody-lipid fragment conjugate comprising scFv, Fab, or VHH fragments. In some embodiments, the conjugated antibody fragment is directly conjugated to an activated PEG-lipid.

[0263] In some embodiments, PEG-(lipid) is equivalent to (lipid)-PEG.

[0264] In certain modalities, a target group for HSC may be a Petition 870250067839, dated 01 / 08 / 2025, p. 227 / 474 95 / 300 antibody bound to the surface or antigen-binding fragment bound to the surface of the same, which may allow adjustment of cell targeting specificity. This is especially useful since highly specific antibodies can be raised against an epitope of interest for the desired targeting site. In one embodiment, multiple different antibodies can be incorporated and presented on the surface of an LNP, where each antibody binds to different epitopes on the same antigen or different epitopes on different antigens. Such approaches can increase the avidity and specificity of targeting interactions to a particular target cell.

[0265] In some embodiments, targeting can be implemented, for example, using HSC lipid-target group conjugates (e.g., lipid-antibody conjugates) described in this document.Exemplary HSC lipid-target group conjugates (e.g., lipid-antibody conjugates) may include compounds of Formula (VI). [Lipid] - [optional ligand] - [HSC target group, e.g., antibody that binds an HSC surface antigen, e.g., an antibody that binds to CD105 and / or CD117] (Formula VI).

[0266] In certain embodiments, targeting can be implemented, for example, using HSC lipid-target group conjugates (e.g., lipid-antibody conjugates) described in this document. Exemplary HSC lipid-target group conjugates (e.g., lipid-antibody conjugates) may include compounds of Formula (I), [Lipid] - [optional ligand] - [antibody], (I), wherein the antibody binds to CD105 and / or CD117 (Formula I).

[0267] In some modalities, the target group of HSC includes Petition 870250067839, dated 01 / 08 / 2025, p. 228 / 474 96 / 300 involves a polypeptide, and the conjugate lipid (e.g., a lipid-antibody conjugate) is conjugated to the N-terminus, C-terminus, or anywhere in the middle of the polypeptide. In some embodiments, the HSC target group comprises a polypeptide, and the conjugate lipid is conjugated to the N-terminus of the polypeptide. In some embodiments, the lipid is conjugated to the N-terminus of the polypeptide. In some embodiments, the lipid is conjugated to the polypeptide at a position between the N-terminus and the C-terminus. In some embodiments, the HSC target group comprises an antibody or an antigen-binding fragment thereof, conjugated to the lipid at the N-terminus, C-terminus, or any position between the N-terminus and C-terminus of the antibody or antigen-binding fragment thereof.In some embodiments, the HSC target group comprises an antibody or an antigen-binding fragment thereof, conjugated to a lipid, wherein the antibody or an antigen-binding fragment thereof of the lipid-antibody conjugate binds to CD105 and / or CD117.

[0268] Exemplary anti-CD105 antibodies include, for example, TRC105 (US Patent No. US20180311359A1), muRH105 (PCT Application No. WO2012149412A3), 43A3 (Biolegend), 166707 (Novus Biologicals), MEM-229 (Abcam), MJ7 / 18 (Ge AZ et al., Cloning and expression of a cDNA-coding endoglin, a TGFβ endothelial cell ligand Gene 1994; 138 (1-2): 201-206), OTI8A1 (OriGene), EPR19911-220 (Sigma Aldrich), 3A9 (Abcam), MAB1320 (R&D Systems), GTX100508 (GeneTex), SN6 (https: / / doi.org / 10.1002 / ijc.11551), MEM-226 (Thermo Fisher), 10862-1-AP (Proteintech), JE60-59 (Thermo Fisher), 103 (Invitrogen), ARC0446 (Invitrogen), PA5-111623 (Invitrogen), PA5-29555 (Invitrogen), PA5-80582 (Invitrogen), PA5-27205 (Invitrogen), PA5-117933 (Invitrogen), PA5-29554 (Invitrogen), 2D5E8 (Proteintech), OTI3H5 (OriGene), OTI9E5 (OriGene), 4C11 (Thermo Fisher), 1E5 (Abnova), OTI6G8 (OriGene), QA19A14 (Biolegend), 43A4E1 Petição 870250067839, de 01 / 08 / 2025, pág. 229 / 474 97 / 300 (Miltenyi Biotec), REA794 (Miltenyi Biotec), D50G1 (Cell Signaling), AF1097 (Novus Biologicals), 001 (Novus Biologicals), EPR10145-12 (Abcam), EPR10145-10 (Abcam), EPR19911 (Abcam), ENG / 3269 (Abcam), P3D1 (Santa Cruz), P4A4 (Santa Cruz), 2Q1707 (Santa Cruz), RM0030-6J9 (Santa Cruz), A-8 (Santa Cruz), 8E11 (Santa Cruz), and antigen-binding fragment of the memos. In certain embodiments, the anti-CD105 antibody comprises a variable heavy chain (Vh) domain and a variable light chain (Vl) domain of an antibody selected from the group consisting of EPR19911-220, GTX100508, PA5-111623, PA5-29555, PA5-80582, PA5-27205, PA5117933, PA5-29554, AF1097, EPR10145-12, EPR10145-10, EPR19911 and 10862-1-AP. In certain embodiments, the anti-CD105 antibody comprises the heavy chain CDRi, CDR2 and CDR3 and the light chain CDR1, CDR2 and CDR3, determined by Kabat (see, Kabat et al., (1991) Sequences of Proteins of Immunological Interest, NIH publication no. 91-3242, Bethesda), Chothia (see, for example, Chothia, (1987), J. MOL. BIOL. 196: 901-917), MacCallum (see, MacCallum RM et al., (1996) J. MOL. BIOL. 262: ia C & Lesk A M732-745), or any other method of CDR determination known in the art, from the Vh and Vl sequences of an antibody selected from the group consisting of EPR19911-220, GTX100508, AF1097, PA5-111623, PA5-29555, PA5-80582, PA5-27205, PA5-117933, PA5-29554, EPR10145-12, EPR10145-10, EPR19911 and 10862-1-AP.In some embodiments, the anti-CD105 antibody comprises CDR1, CDR2, and CDR3 heavy chains and CDR1, CDR2, and CDR3 light chains of any of the anti-CD105 antibodies described in this document, or other anti-CD105 antibodies known in the art.

[0269] Example anti-CD117 antibodies include, for example, Ab58 (PCT Publication No. WO2019084067A1), Ab67 (PCT Publication No. WO2019084067A1), Ab55 (PCT Publication No. Petition 870250067839, dated 01 / 08 / 2025, p. 230 / 474 98 / 300 WO2019084067A1), CK6 (Patente US n° US8552157B2), hSR-1 (Patente US n° US7915391B2), 6LUN1, 104D2 (Biolegend), A3C6E2 (Patente europeia n° EP0787743), OTI3F9 (OriGene), BA7.3C.9 (ATCC), B-K15 (OriGene), 2B8 (Publicação de Patente US n° US20160324982A1), ACK2 (Invitrogen), K45 (Blechmen J. et al., J Biol Chem 25 de fevereiro de 1993; 268 (6): 4399-406), YB5.B8 (Ashman L.K. et al., Epitope mapping and functional studies with three monoclonal antibodies to the c-kit receptor tyrosine kinase, YB5.B8, 17F11, and SR-1 J Cell Physiol 1994; 158 (3): 545-554), 1C5 (Thermo Fisher), 348800 (Invitrogen), PA5-14694 (Invitrogen), PA5-16458 (Invitrogen), PA5-16770 (Invitrogen), 18696-1-AP (Proteintech), HC34LC14 (Thermo Fisher), ST04-99 (Invitrogen), MA5-44656 (Invitrogen), YR145 (Abcam), EPR25707-134 (Abcam), YR145 (Abcam), D13A2 (Cell Signaling), Ab81 (Cell Signaling), 2C11 (Sigmaaldrich), S18022G (Biolegend), QA18A19 (Biolegend), W18195C (Biolegend), A3C6E2 (Biolegend), AF1356 (R&D Systems), AF332 (R&D Systems), MAB332 (R&D Systems), AF3267 (R&D Systems), E-3 (Santa-Cruz), E-1 (Santa-Cruz), H10 (Santa-Cruz), 3C11 (Santa-Cruz), 3H1825 (Santa-Cruz), C-14 (Santa-Cruz), 47233 (Novus Biologicals), NBP2-45508 (Novus Biologicals), NBP2-52975 (Novus Biologicals), AF3267 (Novus Biologicals), NBP2-34487 (Novus Biologicals), NBP1-85593 (Novus Biologicals), e fragmento de ligação ao antígeno dos mesmos.In certain embodiments, the anti-CD117 antibody comprises a variable heavy chain (Vh) domain and a variable light chain (Vl) domain of an antibody selected from the group consisting of PA5-14694, PA5-16458, PA5-16770, 18696-1-AP, HC34LC14, ST04-99, MA5-44656. EPR25707-134, AF1356, AF332, MAB332, AF3267, NBP2-45508, NBP2-52975, AF3267, NBP2-34487, 34-8800 and NBP1-85593. In certain embodiments, the anti-C117 antibody comprises the heavy chain CDRi, CDR2 and CDR3 and the light chain CDR1, CDR2 and CDR3. Petition 870250067839, dated 01 / 08 / 2025, page 231 / 474 99 / 300 determined under Kabat (see, Kabat et al., (1991) Sequences of Proteins of Immunological Interest, NIH publication no. 91-3242, Bethesda), Chothia (see, for example, Choth, (1987), J. MOL. BIOL. 196: 901-917), MacCallum (see, MacCallum RM et al., (1996) J. MOL. BIOL. MA5-44656, EPR25707-134, AF1356, AF332, MAB332, AF3267, NBP2-45508, NBP2-52975, AF3267, NBP2-34487, 34-8800 and NBP185593). In some embodiments, the anti-CD117 antibody comprises CD117 antibodies: CDR1, CDR2, and CDR3 heavy chains, and CDR1, CDR2, and CDR3 light chains from any of the anti-CD117 antibodies described in this document, or other anti-CD117 antibodies known in the art.

[0270] In some embodiments, the HSC target group (e.g., antibody binding to CD105 and / or CD117) comprises an Fc fragment of antibody. The most common immunoglobulin isotype in humans is IgG, which is composed of two identical heavy chain polypeptides and two identical light chain polypeptides. Disulfide bonds link both heavy chain polypeptides to each other. In addition, a disulfide bond also links each light chain polypeptide to a heavy chain polypeptide. The heavy chain polypeptides contain four distinct domains, including variable heavy (VH), constant heavy 1 (CH1), constant heavy 2 (CH2), and constant heavy 3 (CH3) domains. Each light chain contains a variable light (VL) and variable heavy (VH) domain. The variable domains of the heavy and light chains provide the antibody with antigen-binding activity and are responsible for the diversity and specificity of immunoglobulins.It is important to emphasize that the domains... Petition 870250067839, dated 01 / 08 / 2025, page 232 / 474 100 / 300 heavy chain constants, primarily CH2 and CH3, are involved in non-antigen-binding functions of antibodies and constitute the Fc region. The Fc region is capable of binding to complement, which can trigger phagocytosis or complement-dependent cytotoxicity (CDC). Furthermore, the Fc region can also bind to Fc receptors, which can trigger phagocytosis or antibody-dependent cellular cytotoxicity (ADCC). Additionally, the Fc region is known to enhance antibody maintenance during circulation.

[0271] In some embodiments, the HSC target group (e.g., antibody binding to CD105 and / or CD117) comprises an antibody or antigen-binding fragment thereof selected from the group consisting of a Fab, F(ab')2, Fab'-SH, Fv, and scFv fragment. In some embodiments, the antibody is a human or humanized antibody. In some embodiments, the HSC target group comprises a single variable Fab or immunoglobulin domain, such as a Nanobody.

[0272] In some embodiments, the HSC target group comprises a Fab that does not comprise a natural interchain disulfide bond. For example, in some embodiments, the Fab comprises a heavy chain fragment comprising a C233S substitution and / or a light chain fragment comprising a C214S substitution, numbered according to Kabat. In some embodiments, the HSC target group comprises a Fab comprising one or more non-native interchain disulfide bonds. In some embodiments, the interchain disulfide bonds are between two non-native cysteine ​​residues in the light chain fragment and heavy chain fragment, respectively. For example, in some embodiments, the Fab comprises a heavy chain fragment comprising an F174C substitution and / or a light chain fragment comprising an S176C substitution, numbered according to Kabat. Petition 870250067839, dated 01 / 08 / 2025, page 233 / 474 101 / 300 In some embodiments, the Fab comprises a heavy chain fragment comprising F174C and C233S substitutions and / or a light chain fragment comprising S176C and C214S substitutions, numbered according to Kabat. In some embodiments, the HSC target group comprises a C-terminal cysteine ​​residue. In some embodiments, the HSC target group comprises a Fab comprising a C-terminal cysteine ​​of the heavy or light chain fragment. In some embodiments, the Fab additionally comprises one or more amino acids between the Fab heavy chain and the C-terminal cysteine. For example, in some embodiments, the Fab comprises two or more amino acids derived from an antibody hinge region (e.g., a partial hinge sequence) between the C-terminal of the Fab and the C-terminal cysteine.In some embodiments, the Fab comprises a variable heavy chain domain linked to an antibody CH1 domain and a variable light chain domain linked to an antibody constant light chain domain, wherein the CH1 domain and the constant light chain domain are linked by one or more interchain disulfide bonds, and wherein the HSC target group further comprises a C-terminus variable single-chain fragment (scFv) linked by a constant light chain amino acid domain. In some embodiments, the Fab antibody is a Fab DS, a Fab Nods, a Fab BDS, or a Fab-ScFv BDS, as shown in Figure 12.

[0273] In some embodiments, the conjugate (e.g., a lipid-antibody conjugate) comprises a Fab, wherein the Fab comprises a heavy chain and a light chain fragment. In some embodiments, the heavy chain fragment comprises a variable heavy chain domain linked to an antibody CH1 domain. In some embodiments, the variable heavy chain domain is an IgG1 VH. In some embodiments, the CH1 domain of Petition 870250067839, dated 01 / 08 / 2025, pp. 234 / 474 102 / 300 antibody is a CH1 domain of IgG. In some embodiments, the light chain fragment comprises a variable light chain domain linked to a constant light chain domain of antibody. In some embodiments, the variable light chain domain is a VL kappa domain. In some embodiments, the constant light chain domain of antibody is a CL kappa domain. In some embodiments, the CH1 domain and the constant light chain domain are linked by one or more interchain disulfide bonds.

[0274] In some embodiments, the HSC target group (e.g., antibody binding to CD105 and / or CD117) comprises a single variable immunoglobulin domain, such as a Nanobody (e.g., a Vhh). In some embodiments, the Nanobody comprises a cysteine ​​at the C-terminus.

[0275] An exemplary HSC target group (e.g., the antibody that binds to CD105 and / or CD117) may comprise one or more amino acid sequences as described for the antibodies shown in Table B. In some embodiments, the HSC target group comprises the amino acid sequences as described for Ab1, as set forth in Table B. In some embodiments, the HSC target group comprises the amino acid sequences as described for Ab2, as shown in Table B. In some embodiments, the HSC target group comprises amino acid sequences as described for Ab3, as shown in Table B. Table B. Exemplary HSC target antibodies. Target Antibody Sequence Name SEQ ID NO Amino Acid Sequence Ab1 CD117 CDR-H1 1 FTFSNYAMS CDR-H2 2 AISGSGGSTYYADSVKG CDR-H3 3 AKGPPTYHTNYYYMDV CDR-L1 4 RASQGISSWLA CDR-L2 5 AASSLQS Petition 870250067839, dated 01 / 08 / 2025, p. 235 / 474 103 / 300 Anticorpo Alvo Nome da sequência SEQ ID NO Sequência de Aminoácidos CDR-L3 6 QQTNSFPYT VH 7 EVQLLESGGGLVQPGGSLRLSCA ASGFTFSNYAMSWVRQAPGKGL EWVSAISGSGGSTYYADSVKGRF TISRDNSKNTLYLQMNSLRAEDTA VYYCAKGPPTYHTNYYYMDVWG KGTTVTVSS VL 8 DIQMTQSPSSVSASVGDRVTITCR ASQGISSWLAWYQQKPGKAPKL LIYAASSLQSGVPSRFSGSGSGT DFTLTISSLQPEDFATYYCQQTNS FPYTFGGGTKVEIK Cadeia pesada 9 EVQLLESGGGLVQPGGSLRLSCA ASGFTFSNYAMSWVRQAPGKGL EWVSAISGSGGSTYYADSVKGRF TISRDNSKNTLYLQMNSLRAEDTA VYYCAKGPPTYHTNYYYMDVWG KGTTVTVSSASTKGPSVFPLAPSS KSTSGGTAALGCLVKDYFPEPVT VSWNSGALTSGVHTCPAVLQSS GLYSLSSVVTVPSSSLGTQTYICN VNHKPSNTKVDKKVEPKSSDKTH TCGGHHHHHH Cadeia leve 38 DIQMTQSPSSVSASVGDRVTITCR ASQGISSWLAWYQQKPGKAPKL LIYAASSLQSGVPSRFSGSGSGT DFTLTISSLQPEDFATYYCQQTNS FPYTFGGGTKVEIKRTVAAPSVFI FPPSDEQLKSGTASVVCLLNNFY PREAKVQWKVDNALQSGNSQES VTEQDSKDSTYSLCSTLTLSKADY EKHKVYACEVTHQGLSSPVTKSF NRGES Ab2 CD117 CDR-H1 10 FTFSDADMD CDR-H2 11 RTRNKAGSYTTEYAASVKG CDR-H3 12 AREPKYWIDFDL CDR-L1 13 RASQSISSYLN Petition 870250067839, dated 01 / 08 / 2025, pp. 236 / 474 104 / 300 Anticorpo Alvo Nome da sequência SEQ ID NO Sequência de Aminoácidos CDR-L2 14 AASSLQS CDR-L3 15 QQSYIAPYT VH 16 EVQLVESGGGLVQPGGSLRLSCA ASGFTFSDADMDWVRQAPGKGL EWVGRTRNKAGSYTTEYAASVK GRFTISRDDSKNSLYLQMNSLKTE DTAVYYCAREPKYWIDFDLWGR GTLVTVSS VL 17 DIQMTQSPSSLSASVGDRVTITCR ASQSISSYLNWYQQKPGKAPKLLI YAASSLQSGVPSRFSGSGSGTD FTLTISSLQPEDFATYYCQQSYIA PYTFGGGTKVEIK Cadeia pesada 18 EVQLVESGGGLVQPGGSLRLSCA ASGFTFSDADMDWVRQAPGKGL EWVGRTRNKAGSYTTEYAASVK GRFTISRDDSKNSLYLQMNSLKTE DTAVYYCAREPKYWIDFDLWGR GTLVTVSSASTKGPSVFPLAPSSK STSGGTAALGCLVKDYFPEPVTV SWNSGALTSGVHTCPAVLQSSGL YSLSSVVTVPSSSLGTQTYICNVN HKPSNTKVDKKVEPKSSDKTHTC GGHHHHHH Cadeia live 39 DIQMTQSPSSSLSASVGDRVTITCR ASQSISSYLNWYQQKPGKAPKLLI YAASSLQSGVPSRFSGSGSGTD FTLTISSLQPEDFATYYCQQSYIA PYTFGGGTKVEIKRTVAAPSVFIF PPSDEQLKSGTASVVCLLNNFYP REAKVQWKVDNALQSGNSQESV TEQDSKDSTYSLCSTLTLSKADYE KHKVYACEVTHQGLSSPVTKSFN RGES Ab3 CD105 CDR-H1 19 DAWMD CDR-H2 20 EIRSKASNHATYYAESVKG CDR-H3 21 WRRFFDS Petition 870250067839, on 01 / 08 / 2025, page. 237 / 474 105 / 300 Anticorpo Alvo Nome da sequência SEQ ID NO Sequência de Aminoácidos CDR-L1 22 RASSSVSYMH CDR-L2 23 ATSNLAS CDR-L3 24 QQWSSNPLT VH 25 EVKLEESGGGLVQPGGSMKLSC AASGFTFSDAWMDWVRQSPEKG LEWVAEIRSKASNHATYYAESVK GRFTISRDDSKSSVYLQMNSLRA EDTGIYYCTRWRRFFDSWGQGT TLTVSS VL 26 QIVLSQSPAILSASPGEKVTMTCR ASSSVSYMHWYQQKPGSSPKPW IYATSNLASGVPVRFSGSGSGTS YSLTISRVEAEDAATYYCQQWSS NPLTFGAGTKLELK Cadeia pesada 27 EVKLEESGGGLVQPGGSMKLSC AASGFTFSDAWMDWVRQSPEKG LEWVAEIRSKASNHATYYAESVK GRFTISRDDSKSSVYLQMNSLRA EDTGIYYCTRWRRFFDSWGQGT TLTVSSASTKGPSVFPLAPSSKST SGGTAALGCLVKDYFPEPVTVSW NSGALTSGVHTCPAVLQSSGLYS LSSVVTVPSSSLGTQTYICNVNHK PSNTKVDKKVEPKSSDKTHTCGG HHHHHH Cadeia leve 40 QIVLSQSPAILSASPGEKVTMTCR ASSSVSYMHWYQQKPGSSPKPW IYATSNLASGVPVRFSGSGSGTS YSLTISRVEAEDAATYYCQQWSS NPLTFGAGTKLELKRTVAAPSVFI FPPSDEQLKSGTASVVCLLNNFY PREAKVQWKVDNALQSGNSQES VTEQDSKDSTYSLCSTLTLSKADY EKHKVYACEVTHQGLSSPVTKSF NRGES mutAbl N / A (Ctrl de CDR-H1 28 FAAANYAMS CDR-H2 29 AISGAAASTYYADSVKG Petition 870250067839, dated 01 / 08 / 2025, pp. 238 / 474 106 / 300 Anticorpo Alvo Nome da sequência SEQ ID NO Sequência de Aminoácidos ligação para Ab1) CDR-H3 30 AKGPPTYAAAYYYMDV CDR-L1 31 RASQAAASWLA CDR-L2 32 AAASLQS CDR-L3 33 QQTAAAPYT VH 34 EVQLLESGGGLVQPGGSLRLSCA ASGFAAANYAMSWVRQAPGKGL EWVSAISGAAASTYYADSVKGRF TISRDNSKNTLYLQMNSLRAEDTA VYYCAKGPPTYAAAYYYMDVWG KGTTVTVSS VL 35 DIQMTQSPSSVSASVGDRVTITCR ASQAAASWLAWYQQKPGKAPKL LIYAAASLQSGVPSRFSGSGSGT DFTLTISSLQPEDFATYYCQQTAA APYTFGGGTKVEIK Cadeia pesada 36 EVQLLESGGGLVQPGGSLRLSCA ASGFAAANYAMSWVRQAPGKGL EWVSAISGAAASTYYADSVKGRF TISRDNSKNTLYLQMNSLRAEDTA VYYCAKGPPTYAAAYYYMDVWG KGTTVTVSSASTKGPSVFPLAPSS KSTSGGTAALGCLVKDYFPEPVT VSWNSGALTSGVHTCPAVLQSS GLYSLSSVVTVPSSSLGTQTYICN VNHKPSNTKVDKKVEPKSSDKTH TCGGHHHHHH Cadeia live 37 DIQMTQSPSSVSASVGDRVTITCR ASQAAASWLAWYQQKPGKAPKL 41 ASTKGPSVFPLAPSSKSTSGGTA Petition 870250067839, dated 01 / 08 / 2025, page 239 / 474 107 / 300 Target Antibody Sequence Name SEQ ID NO Constant Domain Heavy Amino Acid Sequence (CH1 of IaGD) ALGCLVKDYFPEPVTVSWNSGAL TSGVHTCPAVLQSSGLYSLSSVV TVPSSSLGTQTYICNVNHKPSNTK VDKKV NA NA C-terminal Sequence 42 EPKSSDKTHTCGGHHHHHH NA NA Constant Domain Light Chain (CL kappa) 43 RTVAAPSVFIFPPSDEQLKSGTAS VVCLLNNFYPREAKVQWKVDNAL QSGNSQESVTEQDSKDSTYSLCS TLTLSKADYEKHKVYACEVTHQG LSSPVTKSFNRGES

[0276] In some embodiments, the HSC target group (e.g., the antibody that binds to CD105 and / or CD117) comprises an amino acid spacer and / or ligand. In some embodiments, the spacer is between two antibody domains or antigen-binding fragments thereof. In some embodiments, the spacer is between the Vhh domain and the C-terminal cysteine. In some embodiments, the spacer is between the antibody or antigen-binding fragment thereof and the lipid. In some embodiments, the spacer is between the single variable antigen-binding domain and the lipid. In some embodiments, the spacer is between the Vhh and the lipid. In some embodiments, the HSC target group comprises an amino acid spacer and / or ligand shown in any of the sequences in Table C.In some embodiments, the HSC target group (e.g., antibody) comprises an amino acid spacer and / or ligand with the amino acid sequence AAA or an amino acid sequence shown in any of the SEQ ID NOs: 45-60. Table C: Spacer / Binder Sequences Name SEQ ID NO Amino acid sequence spacer 3A N / A AAA Petition 870250067839, dated 01 / 08 / 2025, pp. 240 / 474 108 / 300 Name SEQ ID NO Amino acid sequence spacer 5GS 45 GGGGS spacer 7GS 46 SGGSGGS spacer 8GS 47 GGGGSGGS spacer 9GS 48 GGGGSGGGS spacer 10GS 49 GGGGSGGGGS spacer 15GS 50 GGGGSGGGGSGGGGS spacer 18GS 51 GGGGSGGGGSGGGGSGGS spacer 20GS 52 GGGGSGGGGSGGGGSGGGGS spacer 25GS 53 GGGGSGGGGSGGGGSGGGGSGGGGS spacer 30GS 54 GGGGSGGGGSGGGGGSGGGGSGGGGSGGGS spacer 35GS 55 GGGGSGGGGSGGGGGSGGGGSGGGGSGGGS GGGGS spacer 40GS 56 GGGGSGGGGSGGGGGSGGGGGSGGGGSGGGGS GGGGSGGGGS hinge G1 57 EPKSCDKTHTCPPCP hinge 9GS-G1 58 GGGGSGGGSEPKSCDKTHTCPPCP upper long hinge region llama 59 EPKTPKPQPAAA hinge G3 60 ELKTPLGDTTHTCPRCPEPKSCDTPPPCPRCPEP KSCDTPPPCPRCPEPKSCDTPPPCPRCP

[0277] Examples of amino acid spacers include, but are not limited to, those shown in SEQ ID NOs: 45-60 and the amino acid sequence AAA. The spacers of the present invention may comprise at least 3, 5, 10, 15, 20, 25, or 30 amino acids in length. The spacers of the present invention may comprise between 3 and 50, 5 and 45, 7 and 40, 10 and 35, 12 and 30, or 15 and 25 amino acids. In some embodiments, the spacer is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids in length. The fusion protein monomer spacer described in this document may be Petition 870250067839, dated 01 / 08 / 2025, pp. 241 / 474 109 / 300 a flexible spacer or a rigid spacer. The HSC target group spacer (e.g., the antibody binding to CD105 and / or CD117) described in this document may be a short spacer or a long spacer. In some embodiments, the amino acid spacer comprises an amino acid sequence, as shown in Table C, comprising 1, 2, 3, 4, or 5 amino acid substitutions, insertions, or deletions. In some embodiments, the amino acid spacer comprises an amino acid sequence as presented in Table C. The spacers described in this document may be used to link two or more amino acid domains together.

[0278] In some embodiments, the HSC target group (e.g., the antibody that binds to CD105 and / or CD117) comprises one or more sequences of complementary determinant regions (CDRs). Conventional antibody CDR sequences are highly variable regions of the heavy and light chains in immunoglobulin antibodies that determine antigen specificity and represent the location where these molecules bind to their specific antigen. In some cases, single variable antigen-binding domains (i.e., a Vhh) comprise only one set of CDRs, located in the N-terminal portion of the structure. HSC target groups comprising a polypeptide comprising one or more CDR sequences having an amino acid length between 4 and 30, 6 and 28, 8 and 26, 10 and 24, 12 and 22, 14 and 20, or 16 and 18 residues are described in this document.In some embodiments, the CDR sequences are 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids in length. In some embodiments, the CDR sequences are between 4 and 20 amino acids in length. In some embodiments, the CDR sequences are between 5 and 15 amino acids in length. Petition 870250067839, dated 01 / 08 / 2025, pp. 242 / 474 In some embodiments, the CDR sequences comprise an amino acid sequence shown in Table B comprising substitutions, insertions, or deletions of amino acids 1, 2, 3, 4, or 5.

[0279] In some embodiments, the HSC target group (e.g., the antibody that binds to CD105 and / or CD117) provided in this document comprises a variable heavy domain comprising a CDR-H1, CDR-H2, and CDR-H3 sequence, and a variable light domain comprising a CDR-L1, CDR-L2, and CDR-L3 sequence. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a CDR-H1, CDR-H2, CDR-H3 sequence, a CDR-L1, CDR-L2, and CDR-L3 sequence, each with an amino acid sequence shown in Table B, where one or more CDR sequences comprise 1, 2, 3, 4, or 5 amino acid substitutions, insertions, or deletions.In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a CDR-H1 having the amino acid sequence shown in SEQ ID NO: 1, a CDR-H2 having the amino acid sequence shown in SEQ ID NO: 2, a CDR-H3 having the amino acid sequence shown in SEQ ID NO: 3, a CDRL1 having the amino acid sequence shown in SEQ ID NO: 4, a CDR-L2 having the amino acid sequence shown in SEQ ID NO: 5, and a CDR-L3 having the amino acid sequence shown in SEQ ID NO: 6, where one or more CDR sequences comprise 1, 2, 3, 4, or 5 amino acid substitutions, insertions, or deletions. In some embodiments, the HSC target group that binds to an HSC surface antigen comprising a CDR-H1 with the amino acid sequence shown in SEQ ID NO: 1, a CDRH2 with the amino acid sequence shown in SEQ ID NO: 2,. Petition 870250067839, dated 01 / 08 / 2025, pp. 243 / 474 111 / 300 a CDR-H3 with the amino acid sequence shown in SEQ ID NO: 3, a CDR-L1 with the amino acid sequence shown in SEQ ID NO: 4, a CDR-L2 with the amino acid sequence shown in SEQ ID NO: 5 and a CDR-L3 with the amino acid sequence shown in SEQ ID NO: 6.

[0280] In some embodiments, the HSC target group that binds to an HSC surface antigen comprising a CDR-H1 with the amino acid sequence shown in SEQ ID NO: 10, a CDR-H2 with the amino acid sequence shown in SEQ ID NO: 11, a CDR-H3 with the amino acid sequence shown in SEQ ID NO: 12, a CDR-L1 with the amino acid sequence shown in SEQ ID NO: 13, a CDR-L2 with the amino acid sequence shown in SEQ ID NO: 14 and a CDR-L3 with the amino acid sequence shown in SEQ ID NO: 15, wherein one or more CDR sequences comprise 1, 2, 3, 4 or 5 amino acid substitutions, insertions or deletions.In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a CDR-H1 with the amino acid sequence shown in SEQ ID NO: 10, a CDR-H2 with the amino acid sequence shown in SEQ ID NO: 11, a CDR-H3 with the amino acid sequence shown in SEQ ID NO: 12, a CDR-L1 with the amino acid sequence shown in SEQ ID NO: 13, a CDR-L2 with the amino acid sequence shown in SEQ ID NO: 14, and a CDR-L3 with the amino acid sequence shown in SEQ ID NO: 15.

[0281] In some embodiments, the HSC target group that binds to an HSC surface antigen comprising a CDR-H1 with the amino acid sequence shown in SEQ ID NO: 19, a CDR-H2 with the amino acid sequence shown in SEQ ID NO: 20, a CDR-H3 with the amino acid sequence shown in SEQ ID NO: 21, a CDR-L1 with the amino acid sequence shown in Petition 870250067839, dated 01 / 08 / 2025, pp. 244 / 474 112 / 300 SEQ ID NO: 22, a CDR-L2 with the amino acid sequence shown in SEQ ID NO: 23 and a CDR-L3 with the amino acid sequence shown in SEQ ID NO: 24, where one or more CDR sequences comprise 1, 2, 3, 4 or 5 amino acid substitutions, insertions or deletions. In some embodiments, the HSC target group that binds to an HSC surface antigen comprising a CDR-H1 with the amino acid sequence shown in SEQ ID NO: 19, a CDR-H2 with the amino acid sequence shown in SEQ ID NO: 20, a CDR-H3 with the amino acid sequence shown in SEQ ID NO: 21, a CDR-L1 with the amino acid sequence shown in SEQ ID NO: 22, a CDR-L2 with the amino acid sequence shown in SEQ ID NO: 23, and a CDR-L3 with the amino acid sequence shown in SEQ ID NO: 24.

[0282] In some embodiments, the HSC target group (e.g., antibody binding to CD105 and / or CD117) provided in this document comprises a variable heavy domain (VH) comprising CDR-H1, CDR-H2 and CDR-H3 sequences, and a variable light domain (VL) comprising CDR-L1, CDR-L2 and CDR-L3 sequences. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a VH domain comprising CDR-H1, CDR-H2, and CDR-H3 sequences, and a VL domain comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VH and VL domains have at least 85, 97, 95, 96, 90, 98, 99, or 99.5% sequence identity with amino acid sequences, as described for Ab1 in Table B.In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a VH domain comprising CDRH1, CDR-H2, and CDR-H3 sequences, wherein the VH domain has at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequence presented in SEQ ID NO: 7, and a VL domain. Petition 870250067839, dated 01 / 08 / 2025, pp. 245 / 474 113 / 300 comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VL domain has at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequence shown in SEQ ID NO: 8. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a VH domain comprising CDR-H1, CDR-H2, and CDR-H3 sequences, wherein the VH domain comprises the amino acid sequence shown in any of the SEQ ID NO: 7, and a VL domain comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VL domain comprises any of the SEQ ID NO: 8.

[0283] In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a VH domain comprising CDR-H1, CDR-H2, and CDR-H3 sequences and a VL domain comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VH and VL domains have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences as described for Ab2 in Table B. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a VH domain comprising CDRH1, CDR-H2, and CDR-H3 sequences, wherein the VH domain has at least 85, 90, 95, 96, 97, 98, 99, or 99.5% Sequence identity with the amino acid sequence shown in SEQ ID NO: 16, and a VL domain comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VL domain has at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequence shown in SEQ ID NO: 17.In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a VH domain comprising CDR-H1, CDR-H2, and CDR-H3 sequences, wherein the VH domain comprises the amino acid sequence shown in any of the SEQ ID NO: 16, and a VL domain that... Petition 870250067839, dated 01 / 08 / 2025, pp. 246 / 474 114 / 300 comprises CDR-L1, CDR-L2, and CDR-L3 sequences, where the VL domain comprises any of the SEQ ID NO: 17.

[0284] In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a VH domain comprising CDR-H1, CDR-H2, and CDR-H3 sequences and a VL domain comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VH and VL domains have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences as described for Ab3 in Table B. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a VH domain comprising CDRH1, CDR-H2, and CDR-H3 sequences, wherein the VH domain has at least 85, 90, 95, 96, 97, 98, 99, or 99.5% Sequence identity with the amino acid sequence shown in SEQ ID NO: 25, and a VL domain comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VL domain has at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequence shown in SEQ ID NO: 26.In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a VH domain comprising CDR-H1, CDR-H2, and CDR-H3 sequences, wherein the VH domain comprises the amino acid sequence shown in any of the SEQ ID NO: 25, and a VL domain comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VL domain comprises any of the SEQ ID NO: 26.

[0285] In some embodiments, the HSC target group (e.g., antibody binding to CD105 and / or CD117) provided in this document comprises a Fab, wherein the Fab comprises a variable heavy domain (VH) comprising CDR-H1, CDR-H2, and CDR-H3 sequences, and a variable light domain (VL) comprising CDR-L1, CDR-L2, and CDR-L3 sequences. In some embodiments, Petition 870250067839, dated 01 / 08 / 2025, pp. 247 / 474 115 / 300 The HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences listed for Ab1, as set forth in Table B. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID Nos: 7 and 8. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab comprise the sequences amino acids presented in SEQ IDs 7 and 8.

[0286] In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences listed for Ab2, as set forth in Table B. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID Nos: 16 and 17. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab These comprise the amino acid sequences presented in SEQ ID NOs: 16 and 17.

[0287] In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with amino acid sequences. Petition 870250067839, dated 01 / 08 / 2025, pp. 248 / 474 116 / 300 listed for Ab3, as set forth in Table B. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 25 and 26. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, in which the VH and VL domains of the Fab comprise the amino acid sequences shown in SEQ ID NOs: 25 and 26.

[0288] In some embodiments, the HSC target group (e.g., antibody that binds to CD105 and / or CD117) provided in this document comprises a Fab, wherein the Fab comprises a heavy chain domain and a light chain domain. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the heavy chain and light chain domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences listed for Ab1, as set forth in Table B. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the heavy chain and light chain domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 9 and 38.In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, in which the heavy chain and light chain domains of the Fab comprise the amino acid sequences shown in SEQ IDs 9 and 38.

[0289] In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, where the heavy chain and light chain domains of the Fab have at least 85, Petition 870250067839, dated 01 / 08 / 2025, pp. 249 / 474 117 / 300 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences listed for Ab2, as set forth in Table B. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the heavy chain and light chain domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 18 and 39. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the heavy chain and light chain domains of the Fab comprise the amino acid sequences presented in SEQ ID NOs: 18 and 39.

[0290] In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the heavy chain and light chain domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences listed for Ab3, as set forth in Table B. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the heavy chain and light chain domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID Nos: 27 and 40. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the heavy chain and light chain domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID Nos: 27 and 40. The Fab light sequences comprise the amino acid sequences presented in SEQ IDs 27 and 40.

[0291] In some embodiments, the HSC target group (e.g., antibody binding to CD105 and / or CD117) comprises two or more antigen-binding domains (e.g., two Vhh domains). In some embodiments, the two or more antigen-binding domains are linked by an amino acid linker. In some Petition 870250067839, dated 01 / 08 / 2025, pp. 250 / 474 In 118 / 300 embodiments, the two or more Vhh domains are linked by an amino acid linker. In some embodiments, the amino acid linker comprises one or more glycine and / or serine residues (e.g., one or more GGGGS sequence repeats). In some embodiments, the HSC target group comprises a first Vhh domain linked to an antibody CH1 domain and a second V HH domain linked to an antibody light chain constant domain, wherein the antibody CH1 domain and the antibody light chain constant domain are linked by one or more disulfide bonds (e.g., interchain disulfide bonds). In some embodiments, the HSC target group (e.g., the antibody binding to CD105 and / or CD117) comprises a VHH domain linked to an antibody CH1 domain, wherein the antibody CH1 domain is linked to an antibody light chain constant domain by one or more disulfide bonds.In some embodiments, the CH1 domain comprises F174C and C233S substitutions, and the constant light chain domain comprises S176C and C214S substitutions, numbered according to Kabat. In some embodiments, the antibody is an ScFv, a Vhh, a 2x Vhh, an empty VHH-CH1 / Vk, or a VHH1-CH1 / VHH-2-Nb bDS, as shown in Figure 12.

[0292] In some embodiments, the HSC target group (e.g., antibody binding to CD105 and / or CD117) comprises a polypeptide that binds to an HSC surface antigen with high binding affinity. In some embodiments, the binding affinity of the HSC target group to the HSC surface antigen is measured as an equilibrium dissociation constant (Kd). In some embodiments, the HSC target group binds to an HSC surface antigen with binding affinity less than 500, 400, 300, 200, 100, or 1 nM. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, in Petition 870250067839, dated 01 / 08 / 2025, pp. 251 / 474 119 / 300 that the VH and VL domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 7 and 8. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab comprise the amino acid sequences presented in SEQ ID NOs: 7 and 8. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 16 and 17. In some In these modes, the HSC target group that binds to an HSC surface antigen comprises a Fab, in which the VH and VL domains of the Fab comprise the amino acid sequences shown in SEQ ID NOs: 16 and 17.In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab have at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 25 and 26. In some embodiments, the HSC target group that binds to an HSC surface antigen comprises a Fab, wherein the VH and VL domains of the Fab comprise the amino acid sequences presented in SEQ ID NOs: 25 and 26.

[0293] In some embodiments, the HSC target group (e.g., the antibody that binds to CD105 and / or CD117) provided in this document targets a human HSC surface antigen, including, for example, any of the HSC surface antigens described in this application. In some modalities, the HSC target group includes human CD105 and / or human CD117.In some modalities, the HSC target group targets more than one human HSC surface antigen. Petition 870250067839, dated 01 / 08 / 2025, pp. 252 / 474 120 / 300

[0294] In some embodiments, the conjugate (e.g., a lipid-antibody conjugate) comprising an HSC target group is capable of binding to a non-human HSC surface antigen. In some embodiments, the conjugate (e.g., a lipid-antibody conjugate) comprising an HSC target group is capable of binding to a human HSC surface antigen. In some embodiments, the conjugate (e.g., a lipid-antibody conjugate) comprising an HSC target group is capable of binding to a human HSC surface antigen described in this document, e.g., human CD105 and / or human CD117.

[0295] In some embodiments, the HSC target group (e.g., the antibody that binds to CD105 and / or CD117) comprises a polypeptide sequence as disclosed herein. In some embodiments, the targeting chemical portion comprises all six CDRs of a polypeptide sequence (e.g., an antibody polypeptide sequence, e.g., a Fab polypeptide sequence) as disclosed herein. In some embodiments, the HSC target group comprises CDR1, CDR2, and CDR3 of an immunoglobulin single variable domain (ISVD), as disclosed herein. In further embodiments, the HSC target group (e.g., the antibody that binds to CD105 and / or CD117) binds to the same epitope on the target molecule (e.g., CD105 and / or CD117) to which a polypeptide sequence disclosed herein binds.In additional embodiments, the HSC target group (e.g., antibody binding to CD105 and / or CD117) competes with a polypeptide sequence as disclosed herein to bind to the same epitope on the target molecule.

[0296] In certain embodiments, the HSC target group (e.g., antibody that binds to CD105 and / or CD117) can be coupled Petition 870250067839, dated 01 / 08 / 2025, pp. 253 / 474 121 / 300 covalently bonds to a lipid via a polyethylene glycol (PEG)-containing ligand.

[0297] In other embodiments, the lipid used to create a conjugate (e.g., a lipid-antibody conjugate) may be selected from distearoyl-phosphatidylethanolamine (DSPE): Dipalmitoyl-phosphatidylethanolamine (DPPE): the Dimyrstoyl-phosphatidylethanolamine (DMPE): the Distearoyl-glycero-phosphoglycerol (DSPG): the Dimiristoylglycerol (DMG): the Distearoylglycerol (DSG): Petition 870250067839, dated 01 / 08 / 2025, pp. 254 / 474 122 / 300 O O e N-palmitoyl-sphingosine (C16-ceramide)

[0298] The HSC target group (e.g., antibody binding to CD105 and / or CD117) can be covalently coupled to a lipid directly or via a linker, for example, a polyethylene glycol (PEG)-containing linker. In certain embodiments, the PEG is PEG 1000, PEG 2000, PEG 3400, PEG 3000, PEG 3450, PEG 4000, or PEG 5000. In certain embodiments, the PEG is PEG 2000.

[0299] In some embodiments, the HSC lipid-target group conjugate (e.g., the lipid-antibody conjugate) is present in the LNP in a range of 0.001-0.5 mol%, 0.001-0.3 mol%, 0.002-0.2 mol%, 0.01-0.1 mol%, 0.1-0.3 mol%, or 0.1-0.2 mol%.

[0300] In certain embodiments, the lipid-target group conjugate of HSC (e.g., lipid-antibody conjugate) comprises DSPE, a PEG component, and a targeting antibody. In certain embodiments, the HSC target group conjugate is an antibody that binds to an HSC surface antigen described in this document, for example, an antibody that binds to CD105 and / or CD117.

[0301] An exemplary HSC lipid-target group conjugate (e.g., the lipid-antibody conjugate) comprises DSPE and PEG 2000, for example, as described in Nellis et al. (2005) Petition 870250067839, dated 01 / 08 / 2025, pp. 255 / 474 123 / 300 BIOTECHNOL. PROG. 21, 205-220. An exemplary conjugate comprises the structure of Formula (VII), wherein scFv represents an engineered antibody-binding site that binds to a target of interest. In certain embodiments, the engineered antibody-binding site binds to any of the targets described in this document. In certain embodiments, the engineered antibody-binding site may be, for example, an engineered anti-CD105 antibody or an engineered anti-CD117 antibody.

[0302] An example of a compound of Formula (VII) is as shown below: (Formula VII).

[0303] It is contemplated that the scFv in Formula (VII) may be replaced by an intact antibody or an antigen fragment thereof (e.g., a Fab).

[0304] Another example of a compound of Formula (VIII) is as shown below: (VIII), the production of which is described in Nellis et al. (2005) above, or US Patent No. 7,022,336. It is contemplated that the Fab in Formula (VIII) may be replaced by an intact antibody or an antigen fragment thereof. Petition 870250067839, dated 01 / 08 / 2025, pp. 256 / 474 124 / 300 (e.g., a (Fab')2 fragment) or an engineered antibody binding site (e.g., an scFv).

[0305] Other lipid antibody conjugates are described, for example, in US Patent No. 7,022,336, wherein the target group (e.g., antibody or antigen-binding fragment thereof) may be replaced by a target group of interest, for example, a target group that binds to any HSC surface antigen described herein.

[0306] In certain embodiments, the lipid component of an exemplary conjugate of Formula (I) or Formula (VI) may be any of the lipids described herein. In some embodiments, the lipid component of a conjugate of Formula (I) or Formula (VI) is based on an ionizable cationic lipid described herein, for example, an ionizable cationic lipid of Formula (II'), Formula (II), Formula (Ia), Formula (IIb), Formula (IIIa), Formula (IIIa), Formula (IIIlb), Formula (IV) or Formula (V) or a salt thereof. For example, an exemplary ionizable cationic lipid may be selected from Table A or a salt thereof.

[0307] In certain embodiments, the conjugate (e.g., lipid-antibody conjugate) based on a lipid of the present disclosure may include: , where scFv represents a designed antibody binding site that binds to a target (e.g., Petition 870250067839, dated 01 / 08 / 2025, pp. 257 / 474 125 / 300 a surface antigen of HSC) described in this document, for example, CD105 and / or CD117.

[0308] In certain embodiments, the LNP may additionally comprise free PEG-lipid in order to reduce the amount of non-specific binding through the HSC target group (e.g., antibody binding to CD105 and / or CD117). The free PEG-lipid may be the same as or different from the PEG-lipid included in the conjugate.In certain embodiments, the free PEG-lipid is selected from the group consisting of PEG-distearoyl-phosphatidylethanolamine (PEG-DSPE) or PEG-dimyristoylphosphatidylethanolamine (PEG-DMPE), N-(methylpolyoxyethylene oxycarbonyl)1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE-PEG), 1,2-Dimyristoyl-rac-glycero-3-methylpolyoxyethylene (PEG-DMG), 1,2-Dipalmitoyl-rac-glycero-3-methylpolyoxyethylene (PEG-DPG), 1,2-Dileoyl-rac-glycero, methoxypolyethylene glycol (DOG-PEG), 1,2-Distearoyl-rac-glycero-3-methylpolyoxyethylene (PEG-DSG), N-palmitoyl-sphingosine-1-{succinyl[methoxy(polyethylene glycol)] (PEG-ceramide), DSPE-PEG-cysteine, or a derivative thereof, all with average PEG lengths between 2000-5000, with 2000, 3400 or 5000. A final composition may contain a mixture of two or more of these pegylated lipids. In certain embodiments, the LNP composition comprises a mixture of PEG-lipids with myristoyl and stearic acyl chains.In certain embodiments, the LNP composition comprises a mixture of PEG lipids with palmitoyl and stearoyl acyl chains.

[0309] In certain embodiments, the PEG-lipid derivative has a methoxy, hydroxyl, or carboxylic acid terminal group at the PEG terminus.

[0310] The HSC lipid-target group conjugate (e.g., lipid-antibody conjugate) can be incorporated into LNPs as described below, for example, into LNPs containing, for example, an ionizable cationic lipid, a sterol, a neutral phospholipid, and a PEG-lipid. It is contemplated that, in certain embodiments, the LNPs that Petition 870250067839, dated 01 / 08 / 2025, pages 258 / 474 126 / 300 containing the HSC target lipid may contain an ionizable cationic lipid described herein or a cationic lipid described, for example, in U.S. Patents Nos. 10,221,127, 10,653,780 or U.S. Published Application Nos. US2018 / 0085474, US2016 / 0317676, International Publication No. WO2009 / 086558, or Miao et al. (2019) NATURE BIOTECH 37: 1174-1185, or Jayaraman et al. (2012) ANGEW CHEM INT. 51: 8529-8533.

[0311] In some embodiments, the cationic lipid may be selected from an ionizable cationic lipid presented in Table A or a salt thereof. Any variation or embodiment of R1, R2, R3, R1A r2A r3A R1A1 R1A2 r1A3 r2A1 r2A2 r2A3 r3A1 r3A2 r3A3 Ra1 Ra2 r3B r3B1 R3B2 r3B3 Rs1 Rs2 Rs3 Rs4 Rs5 Rs6 Rs7 Rs8 Rs9 Rs10 Rs11 Rs12, Rs13, Rs14, or Rs15 provided in this document may be combined with any other variation or embodiment of R1, R2, R3, R1A, R2A, R3A, R1A1, R1A2, R1A3, R2A1, R2A2, R2A3, R3A1, R3A2, R3A3, R1, R2, R3B, R3B1, R3B2, R3B3, Rs1, Rs2, Rs3, Rs4, Rs5, Rs6, Rs7, Rs8, Rs9, Rs10, Rs11, Rs12, Rs13 Rs14, or Rs15, as if each combination had been individually and specifically described.

[0312] LNPs can be formulated using the methods and other components described below in the following sections.

[0313] In certain embodiments, the LNP or lipid mixture may also include an HSC target group lipid conjugate (e.g., an antibody-lipid conjugate), as described in this document.

[0314] The HSC lipid-target group conjugate (e.g., the lipid-antibody conjugate) may be present in the LNP or lipid mixture in a range of 0.001-0.5 mol%, 0.001-0.1 mol%, 0.01-0.5 mol%, 0.05-0.5 mol%, 0.1-0.5 mol%, 0.45-0.5 mol%, 0.1-0.2 mol%, 0.2-0.3 mol%, about 0.01 mol%, about 0.05 mol%, about 0.1 mol%, about 0.15 mol% Petition 870250067839, dated 01 / 08 / 2025, pages 259 / 474 127 / 300 in mol, approximately 0.2 % in mol, approximately 0.25 % in mol, approximately 0.3 % in mol, approximately 0.35 % in mol, approximately 0.4 % in mol, approximately 0.1 % in mol, or approximately 0.3 % in mol. (f) Payloads

[0315] LNP compositions may comprise an agent, for example, a nucleic acid molecule for delivery to a cell (e.g., a hematopoietic stem cell (HSC)) or tissue, for example, a cell (e.g., an HSC) or tissue in a subject.

[0316] The LNP compositions of the present invention may include a nucleic acid, for example, DNA or RNA, such as mRNA, tRNA, microRNA, siRNA, guide RNA (gRNA), key-editing guide RNA (pegRNA), circRNA (circular RNA), ribozymes, decoy RNA, siRNA substrate labeler, or donor template DNA or RNA. The LNP compositions of the present invention may include single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), single-stranded RNA (ssRNA) and / or double-stranded RNA (dsRNA).It is contemplated that nucleic acids may contain naturally occurring components, such as bases, sugars, or naturally occurring linker groups (e.g., phosphodiester linker groups), or they may contain unnaturally occurring components or modifications (e.g., thioester linker groups). For example, nucleic acid may be synthesized to contain base, sugar, or linker modifications known to those skilled in the art. Furthermore, nucleic acids may be linear or circular, or have any desired configuration. LNP compositions may include multiple nucleic acid molecules, for example, multiple RNA molecules, which may be the same or different.

[0317] In certain embodiments, the payload is an mRNA. In certain embodiments, a particular LNP composition may contain a number of mRNA molecules that may be the same or different. In certain embodiments, one or more LNP compositions including Petition 870250067839, dated 01 / 08 / 2025, pp. 260 / 474 128 / 300 One or more different mRNAs can be combined and / or simultaneously contacted with a cell. It is contemplated that an mRNA may include one or more of a stem cell, a chain termination nucleoside, a polyA sequence, a polyadenylation signal, and / or a 5' cap structure. The mRNA may encode a site-directed nuclease, a chemical base editor, a master editor, or an epigenome editor as described in this document.

[0318] In some embodiments, one or more nucleic acids of the payload comprise an mRNA encoding a site-directed nuclease, a chemical base editor, a master editor, or an epigenome editor. In some embodiments, one or more nucleic acids comprise an mRNA encoding a site-directed nuclease. In some embodiments, the site-directed nuclease is a CRISPR-associated nuclease (Cas), a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a megaTAL. In some embodiments, the site-directed nuclease is a ZFN, TALEN, or megaTAL comprising an amino acid sequence that confers binding to a target nucleotide sequence.

[0319] In some embodiments, one or more nucleic acids of the payload comprise an mRNA encoding a CRISPR-associated nuclease (Cas) or a chemical base editor; and a guide RNA (gRNA) comprising a nucleotide sequence that confers binding to a target nucleotide sequence.

[0320] In some embodiments, one or more nucleic acids of the payload comprise an mRNA encoding a master editor; and a master editor guide RNA (pegRNA) comprising a nucleotide sequence that confers binding to a target nucleotide sequence.

[0321] In some embodiments, the payload comprises a gRNA or pegRNA. In some embodiments, the gRNA or pegRNA of Petition 870250067839, dated 01 / 08 / 2025, pp. 261 / 474 The 129 / 300 payload comprises a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence. In some embodiments, the gRNA or pegRNA of the payload comprises a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with at least 15 consecutive nucleotides of the target nucleotide sequence. In some embodiments, the payload gRNA or pegRNA comprises a sequence that has at least 80% identity for at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of the target nucleotide sequence.

[0322] In some embodiments, the payload comprises a gRNA or pegRNA. In some embodiments, the gRNA or pegRNA of the payload comprises a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence. In some embodiments, one or more nucleic acids of the payload additionally comprise a donor template nucleic acid that comprises a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence. In some embodiments, the payload donor template nucleic acid comprises a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with at least 15 consecutive nucleotides of the target nucleotide sequence.In some embodiments, the payload donor template nucleic acid comprises a sequence that has at least 80% identity with at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of the target nucleotide sequence.

[0323] In some embodiments, the target nucleotide sequence comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or Petition 870250067839, dated 01 / 08 / 2025, pp. 262 / 474 130 / 300 consecutive nucleotides and is located within a coding region of a gene, an intronic region associated with a gene, an exonic region associated with a gene, a 5' untranslated region associated with a gene, or a 3' untranslated region associated with a gene, wherein the gene is selected from the group consisting of the gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, IVAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III and protein C.In some modalities, the target nucleotide sequence is within a regulatory region of a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, VAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III and protein C.In some embodiments, the target nucleotide sequence is within an enhancer region or a repressor region of a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, VAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2,. Petition 870250067839, dated 01 / 08 / 2025, pp. 263 / 474 131 / 300 antithrombin III and protein C.

[0324] In some embodiments, the target nucleotide sequence is within the BCL11A erythroid enhancer. In some embodiments, the target nucleotide sequence comprises a polynucleotide sequence of the BCL11A erythroid enhancer. In some embodiments, the target nucleotide sequence comprises a polynucleotide sequence in intron-2 of the BCL11A gene. In some embodiments, the target nucleotide sequence comprises a polynucleotide sequence between approximately +54 kb and approximately +63 kb downstream (in the 3' direction) of the BCL11A transcription start site (TSS). In certain embodiments, the target nucleotide sequence comprises a polynucleotide sequence between about +54 kb and about +56 kb, a polynucleotide between about +57 kb and about +59 kb, or a polynucleotide between about +62 kb and about +63 kb downstream of the BCL11A TSS, or any combination thereof.In certain embodiments, the target nucleotide sequence comprises a polynucleotide sequence between approximately +54 kb and approximately +56 kb downstream of the BCL11A TSS. In certain embodiments, the target nucleotide sequence comprises a polynucleotide sequence between approximately +57 kb and approximately +59 kb downstream of the BCL11A TSS. In certain embodiments, the target nucleotide sequence enhancer comprises a polynucleotide sequence between approximately +62 kb and approximately +63 kb downstream of the BCL11A TSS. In some embodiments, the target nucleotide sequence comprises a polynucleotide sequence at a distance of approximately 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1.0 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb from the nucleotide position at +55 kb, +58 kb, or +62 kb downstream of the BCL11A TSS, or a combination thereof.In certain embodiments, the target nucleotide sequence comprises a polynucleotide sequence at a distance of approximately... Petition 870250067839, dated 01 / 08 / 2025, pp. 264 / 474 132 / 300 of 100 pb, 200 pb, 300 pb, 400 pb, 500 pb, 600 pb, 700 pb, 800 pb, 900 pb, 1.0 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb from the position to +55 kb downstream of BCL11A TSS. In certain embodiments, the target nucleotide sequence comprises a polynucleotide sequence at a distance of approximately 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1.0 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb from the +58 kb downstream position of the BCL11A TSS. In certain embodiments, the target nucleotide sequence comprises a polynucleotide sequence at a distance of approximately 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1.0 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb from the +62 kb downstream position of the BCL11A TSS.In certain embodiments, the target nucleotide sequence comprises the polynucleotide sequence GTGATAAAAGCAACTGTTAG (SEQ ID NO: 62), or a variant thereof comprising up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide substitutions.

[0325] In some embodiments, the target nucleotide sequence comprises at least 15 consecutive nucleotides from the coding region of a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, IVAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III, and protein C. In some embodiments, the target nucleotide sequence comprises at least 15 consecutive nucleotides from the 5' untranslated region or 3' untranslated region around a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, Petition 870250067839, dated 01 / 08 / 2025, pages 265 / 474 133 / 300 IL2RG, RAG1, RAG2, JAK3, BTK, IVAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III, and protein C. In some embodiments, the target nucleotide sequence comprises at least 15 consecutive nucleotides from an intronic region or exon region associated with a gene selected from the group. which consists of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, VAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III and protein W.In some embodiments, the target nucleotide sequence comprises at least 15 consecutive nucleotides from a regulatory region associated with a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, VAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III, and protein C. In some embodiments, the target nucleotide sequence comprises at least 15 consecutive nucleotides from an enhancer region associated with a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, VAS, F8, F9, F11, F10, PKLR, RPS19. Petition 870250067839, dated 01 / 08 / 2025, pages 266 / 474 134 / 300 CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III, and protein C. In some embodiments, the target nucleotide sequence comprises at least 15 consecutive nucleotides from a repressor region associated with a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, IVAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III, and protein C. In some embodiments, the target nucleotide sequence comprises or is within the BCL11A erythroid enhancer.In certain embodiments, the target nucleotide sequence comprises or is within a polynucleotide sequence in intron-2 of the BCL11A gene. In certain embodiments, the target nucleotide sequence comprises or is within a polynucleotide sequence between approximately +54 kb and approximately +63 kb downstream of the transcription start site (TSS) of BCL11A. In certain embodiments, the target nucleotide sequence comprises or is within a polynucleotide sequence between approximately +54 kb and approximately +56 kb, a polynucleotide sequence between approximately +57 kb and approximately +59 kb, or a polynucleotide sequence between approximately +62 kb and approximately +63 kb downstream of the BCL11A TSS, or a combination thereof. In certain embodiments, the target nucleotide sequence comprises or is within a polynucleotide sequence within a distance of approximately 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1.0 kb, 1.1 kb, 1.2 kb. Petition 870250067839, dated 01 / 08 / 2025, pp. 267 / 474 135 / 300 kb, 1.3 kb, 1.4 kb, or 1.5 kb from the nucleotide position to +55 kb, +58 kb, or +62 kb downstream of the BCL11A TSS, or a combination thereof. In certain embodiments, the target nucleotide sequence comprises the polynucleotide sequence GTGATAAAAGCAACTGTTAG (SEQ ID NO: 62), or a variant thereof comprising up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide substitutions.

[0326] In some embodiments, the payload comprises a gRNA or pegRNA that has at least 80% identity or complementarity to at least 15 consecutive nucleotides of a polynucleotide comprising the erythroid enhancer BCL11A. In some embodiments, the gRNA or pegRNA of the payload comprises a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% less identity or complementarity to at least 15 consecutive nucleotides of a polynucleotide comprising the erythroid enhancer BCL11A. In some embodiments, the payload gRNA or pegRNA comprises a sequence that has at least 80% identity or complementarity to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of a polynucleotide comprising the erythroid enhancer BCL11A.In some embodiments, the payload gRNA or pegRNA comprises a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity or complementarity to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of a polynucleotide comprising the erythroid enhancer BCL11A. In some embodiments, the gRNA or pegRNA of the payload comprises a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity or complementarity to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, . Petition 870250067839, dated 01 / 08 / 2025, pp. 268 / 474 136 / 300 24, 25, 26, 27, 28, 29 or 30 consecutive nucleotides of a polynucleotide comprising the erythroid enhancer BCL11A. In certain embodiments, the payload gRNA or pegRNA comprises a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity or complementarity to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of a polynucleotide sequence in intron-2 of the BCL11A gene. In certain embodiments, the payload gRNA or pegRNA comprises a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity or complementarity to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of a polynucleotide sequence between about +54 kb and about +63 kb downstream of the transcription start site (TSS) of BCL11A.In certain embodiments, the payload gRNA or pegRNA comprises a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity or complementarity to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of a polynucleotide sequence between about +54 kb and about +56 kb, a polynucleotide sequence between about +57 kb and about +59 kb, or a polynucleotide sequence between about +62 kb and about +63 kb. kb downstream of the BCL11A TSS, or a combination thereof.In certain embodiments, the gRNA or pegRNA of the payload comprises a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity or complementarity to at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of a polynucleotide sequence within a distance of about 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 pb, 1.0 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb from the position of. Petition 870250067839, dated 01 / 08 / 2025, pp. 269 / 474 137 / 300 nucleotide at +55 kb, +58 kb or +62 kb downstream of the BCL11A TSS. In certain embodiments, the gRNA comprises the polynucleotide sequence GTGATAAAAGCAACTGTTAG (SEQ ID NO: 62), or a variant thereof comprising up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) nucleotide substitutions.

[0327] In certain embodiments, the LNP composition may include one or more other components including, but not limited to, one or more pharmaceutically acceptable excipients, small hydrophobic molecules, therapeutic agents, carbohydrates, polymers, permeability-enhancing molecules and surface-altering agents.

[0328] In some embodiments, the weight / weight ratio of the lipid component to the payload (e.g., nucleic acid, e.g., mRNA) in the resulting LNP composition is from about 1:1 to about 50:1. In certain embodiments, the w / w ratio of the lipid component to the payload (e.g., nucleic acid, e.g., mRNA) in the resulting composition is from about 5:1 to about 50:1. In certain embodiments, the weight / weight ratio is from about 5:1 to about 40:1. In certain embodiments, the weight / weight ratio is from about 10:1 to about 40:1. In certain embodiments, the weight / weight ratio is from about 15:1 to about 25:1.

[0329] In certain embodiments, the encapsulation efficiency of the payload (e.g., nucleic acid, e.g., mRNA) in lipid nanoparticles is at least 50%. In certain embodiments, the encapsulation efficiency is at least 80%, at least 90%, or greater than 90%.

[0330] A lipid composition may be designed for one or more specific applications or targets. For example, an LNP composition may be designed to deliver nucleic acids (e.g., an mRNA, a gRNA, and / or a donor template nucleic acid) to a particular cell, tissue, organ, or system, or group thereof in Petition 870250067839, dated 01 / 08 / 2025, pp. 270 / 474 138 / 300 mammalian body. The physicochemical properties of LNP compositions can be altered in order to increase selectivity for a specific target site within a subject. For example, particle sizes can be adjusted based on the fenestration sizes of different organs. The nucleic acids included in an LNP composition can also depend on the desired delivery target or targets. For example, an mRNA, a gRNA, and / or a donor template nucleic acid can be selected for a particular disease and / or for delivery to a specific cell, tissue, organ, or system thereof (e.g., localized or specific delivery).

[0331] The amount of nucleic acids (e.g., an mRNA, a gRNA, and / or a donor template nucleic acid) in an LNP composition may depend on the size, sequence, and other characteristics of the nucleic acids. The amount of nucleic acids in an LNP may also depend on the size, composition, desired target, and other characteristics of the LNP composition. The relative amounts of nucleic acids and other elements (e.g., lipids) may also vary. The amount of nucleic acids in an LNP composition may, for example, be measured using absorption spectroscopy (e.g., ultraviolet visible spectroscopy).

[0332] In some embodiments, one or more nucleic acids (e.g., an mRNA, a gRNA, and / or a donor template nucleic acid), lipids, and polymers, and quantities thereof, may be selected to provide a specific N:P ratio (the ratio of positively charged lipid or polymer groups (N = nitrogen) to negatively charged nucleic acid phosphate groups). The N:P ratio of the composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in nucleic acid. In general, a lower N:P ratio is preferred. An N:P ratio may be dependent on a specific lipid and its pKa. In certain Petition 870250067839, dated 01 / 08 / 2025, pp. 271 / 474 In embodiments 139 / 300, the nucleic acids (e.g., an mRNA, a gRNA, and / or a donor template nucleic acid) and the LNP composition, and / or their relative amounts, can be selected to provide an N:P ratio of about 1:1 to about 30:1, or about 1:1 to about 20:1. In certain embodiments, the N:P ratio may be, for example, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1. In certain embodiments, the N:P ratio may be about 2:1 to about 5:1. In certain embodiments, the N:P ratio may be about 4:1. In other embodiments, the N:P ratio is about 4:1 to about 8:1. For example, the N:P ratio can be approximately 4:1, approximately 4.5:1, approximately 4.6:1, approximately 4.7:1, approximately 4.8:1, approximately 4.9:1, approximately 5.0:1, approximately 5.1:1, approximately 5.2:1, approximately 5.3:1, approximately 5.4:1, approximately 5.5:1, approximately 5.6:1, approximately 5.7:1, approximately 6.0:1, approximately 6.5:1, or approximately 7.0:1.

[0333] The amount of nucleic acids (e.g., an mRNA, a gRNA, and / or a donor template nucleic acid) in a lipid nanoparticle composition may depend on the size, sequence, and other characteristics of the nucleic acids. The amount of nucleic acids in a lipid nanoparticle composition may also depend on the size, composition, desired target, and other characteristics of the nanoparticle composition. The relative amounts of nucleic acids and other elements (e.g., lipids) may also vary. In some embodiments, the weight / weight ratio of the lipid component to a nucleic acid (e.g., an mRNA, a gRNA, and / or a donor template nucleic acid) in a lipid nanoparticle composition can be from about 5:1 to about 50:1, such as 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, and 50:1.For example, the weight-to-weight ratio of the lipid component to an mRNA can be from about 10:1 to about 40:1. The amount of nucleic acid in a nanoparticle composition can, for example, be measured using... Petition 870250067839, dated 01 / 08 / 2025, pages 272 / 474 140 / 300 absorption spectroscopy (e.g., ultraviolet visible spectroscopy).

[0334] The encapsulation efficiency of a nucleic acid (e.g., an mRNA, a gRNA, and / or a donor template nucleic acid) describes the amount of nucleic acid that is encapsulated or otherwise associated with a lipid composition after preparation, relative to the initial amount provided. Encapsulation efficiency is desirable to be high (e.g., close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of nucleic acid in a solution containing the LNP composition before and after breaking down the LNP composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free nucleic acids in a solution. For the LNP compositions of the invention, the encapsulation efficiency of a nucleic acid can be at least 50%, for example, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.In certain applications, encapsulation efficiency can be as low as 80%. I. RNA payload

[0335] In certain embodiments, the RNA payload comprises an mRNA, a guide RNA (gRNA), a key-editing guide RNA (pegRNA), a CRISPR-RNA (crRNA), a trans-activating CRISPR RNA (trarRNA), a tRNA, a microRNA and / or a siRNA.

[0336] In certain embodiments, lipid nanoparticle compositions are optimized for RNA delivery, for example, an mRNA for translation within the target cell (e.g., HSC) and / or a gRNA or pegRNA to complex with a site-directed nuclease (e.g., CRISPR-associated nuclease (Cas)) within the target cell (e.g., HSC). An mRNA may be a naturally occurring or non-naturally occurring mRNA. An mRNA, gRNA, or pegRNA may include one or Petition 870250067839, dated 01 / 08 / 2025, pp. 273 / 474 141 / 300 plus modified nucleobases, nucleosides, or nucleotides.

[0337] The nucleobases may be selected from the non-limiting group consisting of adenine, guanine, uracil, cytosine, 7-methylguanine, 5-methylcytosine, 5-hydroxymethylcytosine, thymine, pseudouracil, dihydrauracil, N1-methylpseudouracil, hypoxanthine, and xanthine. In some embodiments, the nucleobase is N1-methylpseudouracil.

[0338] A nucleoside of an RNA (e.g., an mRNA or gRNA) is a compound that includes a sugar molecule (e.g., a 5-carbon or 6-carbon sugar, such as pentose, ribose, arabinose, xylose, glucose, galactose, or a deoxy derivative thereof) in combination with a nucleobase. A nucleoside may be a canonical nucleoside (e.g., adenosine, guanosine, cytidine, uridine, 5-methyluridine, deoxyadenosine, deoxyguanosine, deoxycytidine, deoxyuridine, and thymidine) or an analog thereof and may include one or more substitutions or modifications.

[0339] An RNA nucleotide (e.g., mRNA or gRNA) is a compound containing a nucleoside and a phosphate group or alternative group (e.g., boron phosphate, thiophosphate, selenophosphate, phosphonate, alkyl group, amidate, and glycerol). A nucleotide may be a canonical nucleotide (e.g., adenosine, guanosine, cytidine, uridine, 5-methyluridine, deoxyadenosine, deoxyguanosine, deoxycytidine, deoxyuridine, and thymidine monophosphate) or an analog thereof and may include one or more substitutions or modifications, including, but not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkyloxy and / or thio substitutions; one or more fused or open rings; oxidation; and / or reduction of the nucleobase, sugar and / or phosphate or alternative component. A nucleotide can include one or more phosphate or alternative groups. For example, a nucleotide can include a nucleoside and a triphosphate group.A “nucleoside triphosphate” (e.g., guanosine triphosphate, adenosine triphosphate, cytidine triphosphate, and triphosphate). Petition 870250067839, dated 01 / 08 / 2025, pages 274 / 474 142 / 300 uridine) may refer to the canonical nucleoside triphosphate or an analogue or derivative thereof and may include one or more substitutions or modifications as described herein.

[0340] An RNA (e.g., an mRNA or gRNA) may include any number of base pairs, including tens, hundreds, or thousands of base pairs. Any number (e.g., all, some, or none) of nucleobases, nucleosides, or nucleotides may be an analog of a canonical species, substituted, modified, or otherwise unnaturally occurring. In certain embodiments, an entire particular type of nucleobase may be modified. For example, all cytosine in an RNA (e.g., an mRNA or gRNA) may be 5-methylcytosine. In certain embodiments, one or more or all uridine bases may be N1-methylpseudouridine. An mRNA may include a 5' untranslated region, a 3' untranslated region, and / or a coding or translation sequence.

[0341] In certain embodiments, an mRNA may include a 5' cap structure, a chain termination nucleotide, a stem loop, a polyA sequence and / or a polyadenylation signal.

[0342] A cap structure or cap species is a compound that includes two nucleotide moieties joined by a linker and may be selected from a naturally occurring cap, a non-naturally occurring cap, or a cap analog. A cap species may include one or more modified nucleosides and / or linker moieties. For example, a natural mRNA cap may include a guanine nucleotide and a guanine (G) nucleotide methylated at the 7' position, joined by a triphosphate bond at their 5' positions, for example, m7G(5')ppp(5')G, commonly written as m7GpppG. A cap species may also be an antireverse cap analog. A non-limiting list of possible cap species includes m7GpppG, m7Gpppm7G, m73'dGpppG, m7Gpppm7G, m73'dGpppG, and m27 Petition 870250067839, dated 01 / 08 / 2025, pages 275 / 474 143 / 300 02'GppppG.

[0343] Alternatively or additionally, an mRNA may include a chain-terminating nucleoside. For example, a chain-terminating nucleoside may include such deoxygenated nucleosides at the 2' and / or 3' positions of its sugar group. Such species may include 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, and 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, and 2',3'-dideoxythymine.

[0344] Alternatively or additionally, an mRNA may include a stem loop, such as a histone stem loop. A stem loop may include 1, 2, 3, 4, 5, 6, 7, 8 or more nucleotide base pairs. For example, a stem loop may include 4, 5, 6, 7 or 8 nucleotide base pairs. A stem loop may be located in any region of an mRNA. For example, a stem loop may be located before or after an untranslated region (a 5' untranslated region or a 3' untranslated region), a coding region, or a polyA sequence or tail.

[0345] Alternatively or additionally, an mRNA may include a polyA sequence and / or polyadenylation signal. A polyA sequence may be comprised wholly or mainly of adenine nucleotides or analogues or derivatives thereof. A polyA sequence may be a tail located adjacent to a 3' untranslated region of an mRNA.

[0346] An mRNA can encode any polypeptide of interest, including any naturally occurring or unnaturally occurring or otherwise modified polypeptide. A polypeptide encoded by an mRNA can be of any size and can have any structure or secondary activity. In some embodiments, a polypeptide encoded by an mRNA can have a therapeutic effect when expressed in a Petition 870250067839, dated 01 / 08 / 2025, pages 276 / 474 144 / 300 cell. In some embodiments, the mRNA may encode an antibody, enzyme, growth factor, hormone, cytokine, viral protein (e.g., a viral capsid protein), antigen, vaccine, or receptor. In some embodiments, the mRNA may encode one or more polypeptides capable of editing a genomic sequence within target cells (e.g., within HSCs). Consequently, in some embodiments, the mRNA encodes one or more polypeptides that function as part of a gene-editing system. In certain embodiments, the mRNA encodes a site-directed nuclease, a chemical base editor, a core editor, or an epigenome editor. In certain embodiments, the LNP comprises an mRNA encoding a CRISPR-associated nuclease (Cas) or a base editor and additionally comprises a gRNA. In other embodiments, the LNP comprises an mRNA encoding a core editor and additionally comprises pegRNA.

[0347] In certain embodiments, a gRNA or pegRNA may comprise one or more chemically modified nucleotides or nucleosides, resulting in greater gRNA stability and increased efficiency and decreased off-target editing of an RNA-guided gene editing system (e.g., a CAS nuclease / gRNA system, a base editor / gRNA system, or a core editor / pegRNA system). For example, a gRNA may include one or more nucleotides with a 2'-ribose substitution, for example, a 2'O-methyl substitution or a 2'-fluoro substitution. Additionally, a gRNA may include one or more linkage modifications, such as a phosphorothioate modification, a phosphonoacetate modification, or a thiophosphonoacetate modification. Typically, linkage modifications and 2'-ribose substitutions are combined, for example, 2'-O-methyl substitutions and phosphorothioate linkages, or 2'-O-methyl substitutions and thiophosphonoacetate linkages.In certain modes, gRNA. Petition 870250067839, dated 01 / 08 / 2025, pp. 277 / 474 145 / 300 comprises 2'-O-methyl substitutions and phosphorothioate linkages. In some cases, a gRNA may additionally or alternatively include modifications that create intramolecular linkages within the sugar chemical portion of the nucleotide, for example, blocked nucleic acids (LNAs) and bridged nucleic acids (BNAs) with linkages between the 2' oxygen and the 4' carbon of ribose. LNAs and BNAs can be incorporated, for example, into the guide nucleotide sequence 20 of a gRNA. A gRNA may also include one or more DNA nucleotides. Such modifications can be incorporated into any nucleotide or linkage within the gRNA, for example, in the 5' terminal residue(s) or the 3' terminal residue(s) of the gRNA. A gRNA may comprise a modification described herein in one, two, three, four, five, ten or more 5' terminal nucleotides and / or 3' terminal nucleotides of a gRNA.

[0348] Additional RNA modifications, including mRNAs and gRNAs, are known in the art and are described, for example, in Chen et al. (“Recent advances in chemical modifications of guide RNA, mRNA and donor template for CRISPR-mediated genome editing”. Advanced Drug Delivery Reviews 168 (2021): 246-258) and in Qui et al. (“Lipid nanoparticle-mediated codelivery of Cas9 mRNA and single guide RNA reaches genome-specific Angptl3 editing in vivo” Proc Natl Acad Sci, 2021; 118 (10): e2020401118).

[0349] In addition to the lipids present in the LNP or lipid mixture, LNP compositions may additionally comprise a payload, for example, a payload described in this document. In some embodiments, the payload is a nucleic acid, for example, DNA or RNA, for example, an mRNA, transfer RNA (tRNA), a microRNA or small interfering RNA (siRNA). In certain embodiments, the payload is an mRNA, for example, an mRNA encoding a site-directed nuclease, a chemical base editor, an editor Petition 870250067839, dated 01 / 08 / 2025, pp. 278 / 474 146 / 300 principal or an epigenome editor as described in this document.

[0350] In certain forms, the number of nucleotides in the nucleic acid is from about 400 to about 6000. (g) Physical properties of lipid nanoparticles

[0351] The characteristics of an LNP composition may depend on the components, their absolute or relative amounts, contained in a lipid nanoparticle (LNP) composition. The characteristics may also vary depending on the method and conditions of preparation of the LNP composition.

[0352] The physicochemical properties of LNP compositions can be altered in order to increase selectivity for the particular target site within a subject. For example, particle sizes can be adjusted based on the fenestration sizes of different organs. The mRNA RNA (e.g., mRNA and / or gRNA) included in an LNP composition can also depend on the desired delivery target or targets. For example, an mRNA and / or gRNA can be selected for a particular disease and / or for delivery to a particular cell, tissue, organ, or system or group thereof (e.g., localized or specific delivery).

[0353] The amount of mRNA (e.g., mRNA and / or gRNA) of RNA in an LNP composition can depend on the size, sequence, and other characteristics of the mRNA. The amount of mRNA (e.g., mRNA and / or gRNA) in an LNP can also depend on the size, composition, desired target, and other characteristics of the LNP composition. Relative amounts of mRNA (e.g., mRNA and / or gRNA) and other elements (e.g., lipids) can also vary. The amount of mRNA (e.g., mRNA and / or gRNA) in an LNP composition can, for example, be measured using absorption spectroscopy (e.g., Petition 870250067839, dated 01 / 08 / 2025, pp. 279 / 474 147 / 300 ultraviolet-visible spectroscopy).

[0354] In some embodiments, one or more mRNAs, lipids, and polymers, and their quantities, can be selected to provide a specific N:P ratio (the ratio of positively charged lipid or polymeric amine groups (N = nitrogen) to negatively charged nucleic acid phosphate groups (P)). The compositional N:P ratio refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in an mRNA. In general, a lower N:P ratio is preferred. An N:P ratio can be dependent on a specific lipid and its pKa. In certain embodiments, the mRNA and LNP composition and / or their relative quantities can be selected to provide an N:P ratio of about 1:1 to about 30:1, or about 1:1 to about 20:1. In certain forms, the N:P ratio can be, for example, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1 or 8:1. In certain forms, the N:P ratio can be from about 2:1 to about 5:1.In certain embodiments, the N:P ratio may be approximately 4:1. In other embodiments, the N:P ratio ranges from approximately 4:1 to approximately 8:1. For example, the N:P ratio may be approximately 4:1, approximately 4.5:1, approximately 4.6:1, approximately 4.7:1, approximately 4.8:1, approximately 4.9:1, approximately 5.0:1, approximately 5.1:1, approximately 5.2:1, approximately 5.3:1, approximately 5.4:1, approximately 5.5:1, approximately 5.6:1, approximately 5.7:1, approximately 6.0:1, approximately 6.5:1, or approximately 7.0:1.

[0355] LNP compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of an LNP composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) can be used to measure zeta potentials. Dynamic light scattering can also be used to determine particle sizes. Petition 870250067839, dated 01 / 08 / 2025, pages 280 / 474 148 / 300 Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure multiple characteristics of an LNP composition, such as particle size, polydispersity index, and zeta potential. RNA encapsulation efficiency is determined by a combination of methods that rely on RNA-binding dyes (ribogreen, virtual green to determine the fraction of RNA accessible to dye) and LNP deformulation followed by HPLC analysis for total RNA content.

[0356] In some embodiments, the LNP may have an average diameter in the range of 1-250 nm, 1-200 nm, 1-150 nm, 1-100 nm, 50-250 nm, 50-200 nm, 50-150 nm, 50-100 nm, 75-250 nm, 75-200 nm, 75-150 nm, 75-100 nm, 100-250 nm, 100-200 nm, 100-150 nm. In certain embodiments, LNP compositions may have an average diameter of approximately 1 nm, approximately 10 nm, approximately 20 nm, approximately 30 nm, approximately 40 nm, approximately 50 nm, approximately 60 nm, approximately 70 nm, approximately 80 nm, approximately 90 nm, approximately 100 nm, approximately 110 nm, approximately 120 nm, approximately 130 nm, approximately 140 nm, approximately 150 nm, approximately 160 nm, approximately 170 nm, approximately 180 nm, approximately 190 nm, or approximately 200 nm. In some embodiments, the LNP has an average diameter of approximately 100 nm.

[0357] Alternatively or additionally, the compositions of LNPs may have a polydispersity index in the range of 0.05-1, 0.05-0.75, 0.05-0.5, 0.05-0.4, 0.05-0.3, 0.05-0.2, 0.08-1, 0.08-0.75, 0.08-0.5, 0.08-0.4, 0.08-0.3, 0.08-0.2, 0.1-1, 0.1-0.75, 0.1-0.5, 0.1-0.4, 0.1-0.3, 0.1-0.2. In certain modalities, the polydispersity index is in the range of 0.1-0.25, 0.1-0.2, 0.1-0.19, 0.1-0.18, 0.1-0.17, 0.1-0.16, or 0.1-0.15.

[0358] Alternatively or additionally, the compositions of LNPs can have a zeta potential of about -30 mV to about 30 mV. Petition 870250067839, dated 01 / 08 / 2025, pp. 281 / 474 149 / 300 In certain embodiments, the LNP composition has a zeta potential of about -10 mV to about 20 mV. The zeta potential can vary depending on the pH. As a result, in certain embodiments, LNP compositions may have a zeta potential of about 0 mV to about +30 mV or about +10 mV to +30 mV or about +20 mV to about +30 mV at pH 5.5 or pH 5, and / or a zeta potential of about -30 mV to about +5 mV or about -20 mV to about +15 mV at pH 7.4.

[0359] In some embodiments, the LNP provided in this document comprises an ionizable cationic lipid and one or more of a sterol, a neutral phospholipid, a PEG-lipid and a lipid-HSC target group conjugate (e.g., lipid-antibody conjugate).In some embodiments, the LNP comprises lipid 15, an HSC target group that binds to an HSC surface antigen comprising a VH domain comprising CDR-H1, CDR-H2, and CDR-H3 sequences, wherein the VH domain has at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequence shown in SEQ ID NO: 7, and a VL domain comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VL domain has at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequence shown in SEQ ID NO: 8, and a payload comprising one or more nucleic acids encoding components of a gene editing system targeting a locus (or loci) in which gene editing results in increased HbF for the treatment of sickle cell disease or beta-thalassemia. In some modalities, the target nucleotide sequence is within the BCL11A erythroid enhancer.In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence in intron-2 of the BCL11A gene. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence between approximately +54 kb and approximately +63 kb downstream of the target site. Petition 870250067839, dated 01 / 08 / 2025, pp. 282 / 474 150 / 300 transcription start sequence (TSS) of BCL11A. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence between approximately +54 kb and approximately +56 kb, a polynucleotide sequence between approximately +57 kb and approximately +59 kb, or a polynucleotide sequence between approximately +62 kb and approximately +63 kb downstream of the BCL11A TSS, or a combination thereof. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence within a distance of approximately 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1.0 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb from the nucleotide position to +55 kb, +58 kb, or +62 kb downstream of the BCL11A TSS, or a combination thereof.In certain embodiments, the target nucleotide sequence comprises the polynucleotide sequence GTGATAAAAGCAACTGTTAG (SEQ ID NO: 62), or a variant thereof comprising up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide substitutions. In some embodiments, the LNP comprises lipid 15, an HSC target group that binds to an HSC surface antigen comprising a VH domain comprising CDR-H1, CDR-H2, and CDR-H3 sequences, wherein the VH domain comprises the amino acid sequence shown in SEQ ID NO: 7, and a VL domain comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VL domain comprises the amino acid sequence set forth in SEQ ID NO: 8, and a payload comprising one or more nucleic acids encoding components of a gene-editing system targeting a locus (or loci) wherein gene editing results in increased HbF for the treatment of sickle cell anemia or beta-thalassemia.In some embodiments, the target nucleotide sequence is within the BCL11A erythroid enhancer. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence in intron-2 of the BCL11A gene. In certain embodiments... Petition 870250067839, dated 01 / 08 / 2025, pp. 283 / 474 In 151 / 300 embodiments, the target nucleotide sequence is within a polynucleotide sequence between approximately +54 kb and approximately +63 kb downstream of the transcription start site (TSS) of BCL11A. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence between approximately +54 kb and approximately +56 kb, a polynucleotide sequence between approximately +57 kb and approximately +59 kb, or a polynucleotide sequence between approximately +62 kb and approximately +63 kb downstream of the BCL11A TSS, or a combination thereof. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence within a distance of approximately 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1.0 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb from the nucleotide position to +55 kb, +58 kb, or +62 kb downstream of the BCL11A TSS, or a combination thereof.In certain embodiments, the target nucleotide sequence comprises the polynucleotide sequence GTGATAAAAGCAACTGTTAG (SEQ ID NO: 62), or a variant thereof comprising up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide substitutions. In some embodiments, the exemplary LNP provided herein is delivered to a subject with disease for in vivo gene editing and disease treatment. In some embodiments, the exemplary LNP provided herein is delivered to a subject with sickle cell disease or beta-thalassemia for in vivo gene editing and treatment of the subject. In some embodiments, the use of the exemplary LNP provided herein for the treatment of sickle cell disease in a subject is safe and effective. In some embodiments, the use of the exemplary LNP provided herein for the treatment of beta-thalassemia in a subject is safe and effective. III. Method for producing lipid nanoparticles

[0360] In some forms, LNPs are produced using Petition 870250067839, dated 01 / 08 / 2025, pages 284 / 474 152 / 300 rapid mixing by an orbital vortex or by microfluidic mixing. Orbital vortex mixing is performed by rapidly adding lipid solution in ethanol to an aqueous solution of a nucleic acid of interest followed immediately by vortexing at 2,500 rpm. In some embodiments, LNPs are produced using a microfluidic mixing step. In some embodiments, microfluidic mixing is achieved by mixing aqueous and organic streams at a controlled flow rate in a microfluidic channel using, for example, a NanoAssemblr device and microfluidic chips characterized by featuring an optimized mixing chamber geometry (Precision Nanosystems, Vancouver, BC). In some embodiments, LNPs are produced using a microfluidic mixing step to rapidly mix the ethanolic lipid solution and aqueous nucleic acid solution, resulting in the encapsulation of the nucleic acid in solid lipid nanoparticles.The nanoparticle suspension is then buffered in an all-aqueous buffer using a membrane filtration device of choice for ethanol removal and nanoparticle maturation.

[0361] In certain embodiments, the resulting LNP compositions comprise a lipid mixture containing, for example, from about 40 mol% to about 60 mol% of one or more ionizable cationic lipids described herein, from about 35 mol% to about 50 mol% of one or more sterols, from about 5 mol% to about 15 mol% of one or more neutral lipids, and from about 0.5 mol% to about 5 mol% of one or more PEG-lipids. V. Formulation and delivery method

[0362] The LNP compositions of the invention may be formulated in whole or in part as a pharmaceutical composition. The pharmaceutical compositions may additionally include one or more pharmaceutically acceptable excipients or accessory ingredients, such as those described herein. General guidelines for formulation Petition 870250067839, dated 01 / 08 / 2025, pages 285 / 474 Information on the manufacture of pharmaceutical compositions and agents, as outlined in 153 / 300, is available, for example, in Remington's (2006) supra. Conventional excipients and accessory ingredients may be used in any pharmaceutical composition of the invention, except to the extent that any conventional excipient or accessory ingredient may be incompatible with one or more components of an LNP composition of the invention. An excipient or accessory ingredient may be incompatible with a component of an LNP composition if its combination with the component could result in any undesirable biological effect or otherwise deleterious effect.

[0363] In some embodiments, one or more excipients or accessory ingredients may represent more than 50% by mass or total volume of a pharmaceutical composition including an LNP composition of the invention. For example, one or more excipients or accessory ingredients may represent 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of a pharmaceutical composition. In certain embodiments, the excipient is approved for use in humans and for veterinary use, for example, by the United States Food and Drug Administration. In certain embodiments, the excipient is of pharmaceutical grade. In certain embodiments, an excipient meets the standards of the United States Pharmacopeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia and / or the International Pharmacopoeia.

[0364] The relative amounts of one or more lipids or LNPs, one or more pharmaceutically acceptable excipients and / or any additional ingredients in a pharmaceutical composition will vary depending on the identity, size and / or condition of the subject being treated and also depending on the route by which the composition is to be administered.

[0365] Lipid compositions and / or pharmaceutical compositions, including one or more LNP compositions, may be administered to any subject, including a human patient who may be Petition 870250067839, dated 01 / 08 / 2025, pages 286 / 474 154 / 300 benefit from a therapeutic effect provided by the administration of a nucleic acid, for example, an RNA (e.g., mRNA, gRNA, tRNA or siRNA) to one or more cells, tissues, organs or specific groups thereof, such as the renal system. Although the descriptions provided herein of LNP compositions and pharmaceutical compositions including LNP compositions are primarily directed to compositions that are suitable for administration to humans, it will be understood by the skilled person that such compositions are generally suitable for administration to any other mammal. The modification of compositions suitable for administration to humans in order to make the compositions suitable for administration to various animals is understood.

[0366] A pharmaceutical composition according to the present disclosure may be prepared, packaged and / or sold in bulk, as a single unit dose and / or as a plurality of single unit doses. As used herein, a “unit dose” is a discrete quantity of the pharmaceutical composition comprising a predetermined amount of the active ingredient (e.g., the payload).

[0367] The pharmaceutical compositions of the invention can be prepared in a variety of forms suitable for a variety of routes and methods of administration. For example, pharmaceutical compositions of the invention can be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and other forms.

[0368] Liquid dosage forms for oral administration and Petition 870250067839, dated 01 / 08 / 2025, pages 287 / 474 155 / 300 parenteral dosage forms include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and / or elixirs. In addition to the active ingredients, liquid dosage forms may comprise inert diluents commonly used in the art, such as water or other solvents, solubilizing and emulsifying agents such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, peanut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and sorbitan fatty acid esters and mixtures thereof. In addition to inert diluents, oral compositions may include adjuvants such as humectants, emulsifying and suspending agents, sweeteners, flavorings and / or fragrance agents.

[0369] Injectable preparations, for example, sterile aqueous or oily injectable suspensions, may be formulated according to known techniques using suitable dispersing agents, wetting agents and / or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions and / or emulsions in non-toxic and parenterally acceptable diluents and / or solvents, for example, a solution in 1,3-butanediol. Acceptable vehicles and solvents that may be used include water, Ringer's solution, USP and isotonic sodium chloride solution. Sterile fixed oils are conventionally used as solvent or suspension medium. For this purpose, any mild fixed oil may be used, including synthetic mono- or diglycerides. Fatty acids, such as oleic acid, may be used in the preparation of injectables.

[0370] Injectable formulations can be sterilized, for example, by filtration through a bacteria-retention filter and / or by incorporating sterilizing agents in the form of compositions. Petition 870250067839, dated 01 / 08 / 2025, pages 288 / 474 156 / 300 sterile solids that can be dissolved or dispersed in sterile water or other sterile injectable medium before use. (a) Other components

[0371] Furthermore, it is contemplated that pharmaceutical compositions may include one or more components in addition to those described in this document.

[0372] Pharmaceutical compositions may also include one or more permeability-enhancing molecules, carbohydrates, polymers, therapeutic agents, surface-altering agents, or other components. A permeability-enhancing molecule may be a molecule described, for example, in U.S. Patent Application Publication No. 2005 / 0222064. Carbohydrates may include simple sugars (e.g., glucose) and polysaccharides (e.g., glycogen and derivatives and analogues thereof).

[0373] Pharmaceutical compositions may also contain a surface-altering agent, including, for example, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), polymers (e.g., heparin, polyethylene glycol, and poloxamer), mucolytic agents (e.g., acetylcysteine, mugwort, bromelain, papain, clerodendrum, bromohexine, carbocysteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, estepronine, tiopronine, gelsolin, thymosin β4, dornase alfa, neltenexine, and erdosteine) and DNases (e.g., rhDNase). A surface alteration agent may be disposed within and / or on the surface of a composition described in this document.

[0374] In addition to these components, a pharmaceutical composition containing an LNP composition of the invention may include any substance useful in pharmaceutical compositions. For example, the Petition 870250067839, dated 01 / 08 / 2025, pages 289 / 474 157 / 300 pharmaceutical composition may include one or more pharmaceutically acceptable excipients or accessory ingredients, such as, but not limited to, one or more solvents, dispersing media, diluents, dispersing aids, suspending aids, granulating aids, disintegrants, fillers, glidants, liquid vehicles, binders, surface-active agents, isotonic agents, thickening or emulsifying agents, buffering agents, lubricating agents, oils, preservatives, and other species. Excipients such as waxes, butters, coloring agents, coating agents, flavorings, and fragrance agents may also be included. Pharmaceutically acceptable excipients are well known in the art (see, for example, Remington's (2006) supra).

[0375] Dispersing agents may be selected from a non-limiting list consisting of potato starch, corn starch, tapioca starch, sodium starch glycolate, clays, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, cation exchange resins, calcium carbonate, silicates, sodium carbonate, crosslinked poly(vinylpyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethylcellulose, crosslinked sodium carboxymethylcellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water-insoluble starch, calcium carboxymethylcellulose, aluminum magnesium silicate (VEEGUM®), sodium lauryl sulfate, quaternary ammonium compounds and / or combinations thereof.

[0376] Surfactants and / or emulsifiers may include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondroitin, cholesterol, xanthan gum, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax and lecithin), colloidal clays (e.g., bentonite [aluminum silicate] and VEEGUM® [aluminum magnesium silicate]), Petition 870250067839, dated 01 / 08 / 2025, pages 290 / 474 158 / 300 long-chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g., polymethylene carboxyl, polyacrylic acid, acrylic acid polymer and carboxyvinyl polymer), carrageenan, cellulosic derivatives (e.g., sodium carboxymethylcellulose, powdered cellulose, hydroxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, methylcellulose), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate [TWEEN®20], polyoxyethylene sorbitan [TWEEN® 60], polyoxyethylene sorbitan monooleate) [TWEEN®80], sorbitan monopalmitate [SPAN®40], sorbitan monostearate [SPAN®60], sorbitan triestearate [SPAN®65], glyceryl monooleate, sorbitan monooleate [SPAN®80]),Polyoxyethylene esters (e.g., polyoxyethylene monostearate [MYRJ® 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate and SOLUTOL®), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [BRIJ® 30]), poly(vinylpyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, PLURONIC®F 68, POLOXAMER® 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium and / or combinations thereof.

[0377] Examples of preservatives may include, but are not limited to, antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acid preservatives and / or other preservatives. Examples of antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, acorbyl palmitate, Petition 870250067839, dated 01 / 08 / 2025, pp. 291 / 474 Examples of chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and / or trisodium edetate. Examples of chelating agents include 159 / 300 butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and / or sodium sulfite. Examples of antimicrobial preservatives include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and / or thimerosal.Examples of antifungal preservatives include, but are not limited to, butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and / or sorbic acid. Examples of alcohol preservatives include, but are not limited to, ethanol, polyethylene glycol, benzyl alcohol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and / or phenylethyl alcohol. Examples of acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroascorbic acid, ascorbic acid, sorbic acid, and / or phytic acid.Other preservatives include, but are not limited to, tocopherol, tocopherol acetate, deuroxime mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite.

[0378] Examples of buffering agents include, but are not limited to, citrate buffer solutions, acetate buffer solutions, phosphate buffer solutions, ammonium chloride, calcium carbonate, calcium chloride. Petition 870250067839, dated 01 / 08 / 2025, pages 292 / 474 160 / 300 calcium citrate, calcium gluconate, calcium gluceptate, calcium gluconate, d-gluconic acid, calcium glycerophosphate, calcium lactate, calcium lactobionate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, aminosulfonate buffers (e.g., HEPES), magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, Isotonic saline solution, Ringer's solution, ethyl alcohol and / or combinations thereof.

[0379] In certain embodiments, the lipid nanoparticle compositions and their formulations are adapted for administration via intravenous, intramuscular, intradermal, subcutaneous, intraosseous infusion, intra-arterial, intratumoral, or inhalation routes. In certain embodiments, a dose of about 0.001 mg / kg to about 10 mg / kg is administered to a subject. The compositions according to the present disclosure may be formulated in dosage unit form for ease of administration and dosage uniformity. It will be understood, however, that the total daily use of a composition of the present disclosure will be decided by a responsible physician within the scope of sound medical judgment.

[0380] The specific therapeutically effective, prophylactically effective, or otherwise appropriate dose level (e.g., for imaging) for any particular patient will depend on a variety of factors, including the severity and identification of a disease being treated, if any; one or more nucleic acids (for Petition 870250067839, dated 01 / 08 / 2025, pages 293 / 474 161 / 300 example, mRNAs, gRNAs and / or donor model nucleic acids) employed; the age, specific body weight, body composition, overall weight, age, body weight, body weight, age, body composition, overall weight employed; and diet of the patient; time of administration, route of administration and excretion rate of the specific pharmaceutical composition employed; duration of treatment; drugs used in combination with or coinciding with the specific pharmaceutical composition employed; and similar factors well known in medical techniques. VI. Methods of delivering nucleic acids to hematopoietic stem cells

[0381] The present disclosure provides methods for delivering a payload to a target cell or tissue, for example, a target cell or tissue in a subject, and LNPs or pharmaceutical compositions containing the LNPs for use in such methods. Any disclosure hereof of a method of, for example, delivering a nucleic acid to a cell or, for example, expressing a polypeptide of interest in a cell shall also be interpreted as a disclosure of an LNP or pharmaceutical composition comprising said LNP for use in such methods.

[0382] In some aspects, a method for delivering nucleic acids to hematopoietic stem cells (HSCs) is provided in this document. In certain embodiments, the method comprises producing a polypeptide of interest (e.g., a protein of interest, for example, a site-directed nuclease, a chemical base editor, a master editor, or an epigenome editor) in a mammalian HSC and LNPs or pharmaceutical compositions containing the LNPs for use in such methods. The methods for producing polypeptides in HSCs involve contacting one or more HSCs with an LNP composition comprising an mRNA of interest (e.g., an mRNA Petition 870250067839, dated 01 / 08 / 2025, pages 294 / 474 162 / 300 which encodes a site-directed nuclease, a chemical base editor, a core editor or an epigenome editor and, optionally, a gRNA or a pegRNA). Upon contact with the HSC containing the LNP composition, the mRNA can be taken up and translated in the cell to produce the polypeptide of interest.

[0383] In general, the contact step of a mammalian HSC with an LNP composition including an mRNA encoding a polypeptide of interest can be performed in vivo, ex vivo, or in vitro. The amount of an LNP composition contacted with a cell and / or the amount of nucleic acid (e.g., mRNA) in the same may depend on the type of HSC or tissue being contacted, the means of administration, the physicochemical characteristics of the LNP composition and the mRNA (e.g., size, charge, and chemical composition) in the same, and other factors. In general, an effective amount of the LNP composition will allow for efficient polypeptide production in the HSC. Efficiency metrics may include polypeptide translation (indicated by polypeptide expression), mRNA degradation level, and indicators of immune response.

[0384] The step of contacting an LNP compound including an mRNA with a cell may involve or cause transfection in which the LNP compound may fuse with the cell membrane to allow delivery of the mRNA into the cell. After introduction into the cell cytoplasm, the mRNA is then translated into a protein or peptide via the protein synthesis machinery within the cell cytoplasm.

[0385] The present disclosure provides methods for delivering a nucleic acid (e.g., an mRNA) to a mammalian HSC or tissue, for example, a mammalian HSC or tissue in a subject. The administration of a nucleic acid (e.g., an mRNA) to such a cell or tissue involves the administration of an LNP composition. Petition 870250067839, dated 01 / 08 / 2025, pages 295 / 474 163 / 300 including nucleic acid (e.g., mRNA) to a subject, for example, by injection, e.g., via intramuscular injection or intravascular administration into the subject. After administration, the LNP can target and / or come into contact with an HSC. Upon contact with the HSC containing the LNP, a translatable mRNA can be translated in the cell to produce a polypeptide of interest (e.g., a polypeptide from a gene editing system).

[0386] In certain embodiments, an LNP composition of the invention may target a particular type or class of cells, for example, HSCs. This targeting may be facilitated by using the lipids described herein to form LNPs, which may also include a targeting group for cells of interest. In certain embodiments, specific delivery may result in more than 2-fold, 5-fold, 10-fold, 15-fold, or 20-fold increases in the amount of nucleic acid (e.g., mRNA) to the target destination (e.g., HSCs that express certain surface antigens at high levels (e.g., CD105 and / or CD117) that bind to the antibody-lipid conjugate of the LNPs) compared to other destinations (e.g., cells that do not express or only express at low levels said surface antigens).

[0387] In some embodiments, no more than 1%, no more than 2%, no more than 3%, no more than 4%, no more than 5%, no more than 6%, no more than 7%, no more than %, no more than 9%, no more than 10%, no more than 15%, no more than 20%, no more than 25%, no more than 30%, no more than 35%, no more than 40%, no more than 45%, or no more than 50% of the cells not intended to be the delivery destination are transfected by LNP. In some embodiments, the cells not intended to be the delivery destination are any cells except hematopoietic stem cells. In some Petition 870250067839, dated 01 / 08 / 2025, pages 296 / 474 164 / 300 modes, no more than 1%, no more than 2%, no more than 3%, no more than 4%, no more than 5%, no more than 6%, no more than 7%, no more than 8%, no more than 9%, no more than 10%, no more than 15%, no more than 20%, no more than 25%, no more than 30%, no more than 35%, no more than 40%, no more than 45% or no more than 50% of non-HSC cells that are not intended to be the delivery destination are transfected by LNP. In some modes, the cells that are not intended to be the delivery destination are non-target cells by the method. In some modalities, the cells that are not intended to be the delivery destination are cells of the subject not targeted by the method.

[0388] In some embodiments, the half-life of the nucleic acid delivered by the LNP described herein to the HSC or a polypeptide encoded by the nucleic acid delivered by the LNP and expressed on the HSC is at least 1%, at least %, at least 10%, at least 15%, at least 5%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, or at least 10 times greater than the half-life of the nucleic acid delivered by a reference LNP to the HSCs or a polypeptide encoded by the nucleic acid delivered by the LNP and expressed on the HSC. by the nucleic acid delivered by the reference LNP and expressed in the HSC.

[0389] In some embodiments, the LNP composition differs from the reference LNP composition in the type of ionizable cationic lipid, relative amount of ionizable cationic lipid, length of the lipid anchor in the PEG lipid, major or principal structural group of the PEG lipid, relative amount of PEG lipid or type of group of Petition 870250067839, dated 01 / 08 / 2025, pages 297 / 474 165 / 300 HSC targeting (e.g., antibody type that binds to CD105 and / or CD117), or any combination thereof. In some embodiments, the LNP composition differs from the reference LNP composition only in the type of ionizable cationic lipid. In some embodiments, the LNP composition differs from the reference LNP composition only in the amount of PEG lipid. In some embodiments, the reference LNP comprises Dlin-KC3DMA cationic lipid, but is otherwise the same as a tested LNP. In some embodiments, the reference LNP comprises Dlin-KC2-DMA cationic lipid, but is otherwise the same as a tested LNP. In some embodiments, the reference LNP comprises ALC-0315 cationic lipid, but is otherwise the same as a tested LNP. In some embodiments, the reference LNP comprises SM-102 cationic lipid, but otherwise is the same as a tested LNP. In some embodiments, PEG lipid is a free PEG lipid.

[0390] In some modalities, at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% or more of the HSCs are transfected by LNP. In some modes, at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% or more of the HSCs intended to be the delivery destination are transfected by LNP. In some modes, the HSCs are HSCs from a single subject. In some modes, the HSCs are targeted HSCs. Petition 870250067839, dated 01 / 08 / 2025, pages 298 / 474 166 / 300 by the method (e.g., a subpopulation of HSCs targeted by the method). In some modalities, the HSCs are HSCs from a subject targeted by the method (e.g., a subpopulation of the subject's HSCs targeted by the method).

[0391] In some embodiments, the nucleic acid expression level provided by the LNP is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 1.5 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 15 times or at least 20 times higher than the nucleic acid expression level in the same HSCs provided by a reference LNP. In some embodiments, the expression level is measured and compared with a method described in this document. In some embodiments, the expression level is measured by the ratio of HSCs (e.g., transfected HSCs) that express the encoded polypeptide.In some modalities, the expression level is measured with FACS. In some modalities, the expression level is measured by the average amount of the encoded polypeptide expressed in the HSCs. In some modalities, the expression level is measured as average fluorescence intensity. In some modalities, the expression level is measured by the amount of the encoded polypeptide or other materials secreted by the HSCs.

[0392] In another aspect, methods are provided in this document for targeting the delivery of a nucleic acid to a hematopoietic stem cell (HSC) from a subject. In some embodiments, the method comprises placing the HSC in contact with a lipid nanoparticle (LNP). In some embodiments, the LNP comprises a Petition 870250067839, dated 01 / 08 / 2025, pages 299 / 474 167 / 300 ionizable cationic lipid. In some embodiments, the LNP comprises a conjugate comprising the compound of the following formula: [Lipid] - [optional ligand] - [HSC target group]. In certain embodiments, the LNP comprises a lipid-antibody conjugate comprising the compound of the following formula: [Lipid] - [optional ligand] [antibody] in which the antibody binds to CD105 and / or CD117. In some embodiments, the antibody that binds to CD117 comprises the amino acid sequences of Ab1, as described in Table B. In some embodiments, the antibody that binds to CD117 comprises the amino acid sequences of Ab2, as described in Table B. In some embodiments, the antibody that binds to CD105 comprises the amino acid sequences of Ab3, as described in Table B. In some embodiments, the antibody that binds to CD117 is Ab1. In some modalities, the antibody that binds to CD117 is Ab2. In some modalities, the antibody that binds to CD105 is Ab3.In some embodiments, the LNP comprises a sterol or other structural lipid. In some embodiments, the LNP comprises a neutral phospholipid. In some embodiments, the LNP comprises a polyethylene glycol (PEG)-free lipid. In some embodiments, the LNP comprises one or more nucleic acids. In some embodiments, the LNP comprises one or more nucleic acids that encode a gene-editing system that targets a locus (or loci) where gene editing results in increased HbF for the treatment of a disease (e.g., sickle cell disease and beta-thalassemia).

[0393] In some embodiments, an aspect of the disclosure relates to an LNP or a pharmaceutical composition containing the same, as disclosed herein, for use in a method of targeting the delivery of a nucleic acid to a hematopoietic stem cell (HSC) of a subject. Such a method may be for the treatment of a disease as disclosed below. In some Petition 870250067839, dated 01 / 08 / 2025, pp. 300 / 474 168 / 300 embodiments, a method as disclosed herein may comprise contacting a subject's HSC in vitro or ex vivo with a lipid nanoparticle (LNP). In a preferred embodiment, a method as disclosed herein may comprise contacting a subject's HSC in vivo with a lipid nanoparticle (LNP). In some embodiments, the LNP is an LNP as described in this disclosure.

[0394] In some modalities, LNP provides at least one of the following benefits: (I) increased specificity of delivery targeted at HSCs compared to a reference LNP; (II) increased half-life of the nucleic acid or of a nucleic acid-encoded polypeptide in the HSC compared with a reference LNP; (III) increased transfection rate compared to a reference LNP; and. (iv) a low level of dye-accessible nucleic acid encapsulation efficiencies (e.g., mRNA and / or gRNA; less than 15%) and high nucleic acid (e.g., mRNA and / or gRNA), wherein at least 80% of nucleic acid (e.g., mRNA and / or gRNA) was recovered in the final formulation relative to the total nucleic acid (e.g., mRNA and / or gRNA) used in the batch preparation of LNP).

[0395] In some embodiments, methods are provided for expressing a polypeptide of interest in a targeted HSC from a subject. In some embodiments, the method comprises contacting the HSC with a lipid nanoparticle (LNP). In some embodiments, the LNP comprises an ionizable cationic lipid. In some embodiments, the LNP comprises a conjugate comprising the following structure: [Lipid] - [optional ligand] - [HSC target group]. In certain embodiments, the LNP comprises a lipid conjugate Petition 870250067839, dated 01 / 08 / 2025, pp. 301 / 474 169 / 300 antibody comprising the compound of the following formula: [Lipid] [optional ligand] - [antibody], wherein the antibody binds to CD105 and / or CD117. In some embodiments, the antibody that binds to CD117 comprises the amino acid sequences of Ab1, as described in Table B. In some embodiments, the antibody that binds to CD117 comprises the amino acid sequences of Ab2, as described in Table B. In some embodiments, the antibody that binds to CD105 comprises the amino acid sequences of Ab3, as described in Table B. In some embodiments, the antibody that binds to CD117 is Ab1. In some embodiments, the antibody that binds to CD117 is Ab2. In some embodiments, the antibody that binds to CD105 is Ab3. In some embodiments, the LNP comprises a sterol or other structural lipid. In some embodiments, the LNP comprises a neutral phospholipid. In some embodiments, LNP comprises a polyethylene glycol (PEG)-free lipid.In some embodiments, the LNP comprises a nucleic acid encoding the polypeptide. In some embodiments, an aspect of the disclosure relates to an LNP or a pharmaceutical composition containing the same, as disclosed herein, for use in a method of expressing a polypeptide of interest in a targeted HSC from a subject. Such a method may be for the treatment of a disease as disclosed below. In some embodiments, a method as disclosed herein may comprise contacting a subject's HSC in vitro or ex vivo with a lipid nanoparticle (LNP). In a preferred embodiment, a method as disclosed herein may comprise contacting a subject's HSC in vivo with a lipid nanoparticle (LNP).

[0396] In some modalities, LNP provides at least one of the following benefits: (I) increased expression level in HSC compared Petition 870250067839, dated 01 / 08 / 2025, pp. 302 / 474 170 / 300 with a reference LNP; (II) increased expression specificity in HSC compared to a reference LNP; (III) increased half-life of the nucleic acid or of a nucleic acid-encoded polypeptide in the HSC compared with a reference LNP; (iv) increased transfection rate compared to a reference LNP; and. (v) a low level of dye-accessible nucleic acid encapsulation efficiencies (e.g., mRNA and / or gRNA; less than 15%) and high nucleic acid (e.g., mRNA and / or gRNA), wherein at least 80% of nucleic acid (e.g., mRNA and / or gRNA) was recovered in the final formulation relative to the total nucleic acid (e.g., mRNA and / or gRNA) used in the batch preparation of LNPs. The LNPs disclosed in the present disclosure and, as claimed, are suitable for the methods described above.

[0397] In some embodiments, the LNP delivered in the methods provided in this document comprises a lipid, an HSC target group that binds to an HSC surface antigen comprising a VH domain comprising CDR-H1, CDR-H2, and CDR-H3 sequences, wherein the VH domain has at least 85, 97, 95, 96, 90, 15, 98, 99, or 99.5% sequence identity with the amino acid sequence shown in SEQ ID NO: 7, and a VL domain comprising CDR-L1, CDR-L2, and CDR-L3 sequences, wherein the VL domain has at least 85, 90, 95, 96, 97, 98, 99, or 99.5% sequence identity with the amino acid sequence shown in SEQ ID NO: 8, and a payload comprising one or more nucleic acids encoding components of a Gene editing systems that target a locus (or loci) where gene editing results in increased HbF for the treatment of sickle cell disease or beta-thalassemia. Petition 870250067839, dated 01 / 08 / 2025, pp. 303 / 474 171 / 300In some embodiments, the target nucleotide sequence is within the BCL11A erythroid enhancer. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence in intron-2 of the BCL11A gene. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence between approximately +54 kb and approximately +63 kb downstream of the transcription start site (TSS) of BCL11A. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence between approximately +54 kb and approximately +56 kb, a polynucleotide sequence between approximately +57 kb and approximately +59 kb, or a polynucleotide sequence between approximately +62 kb and approximately +63 kb downstream of the BCL11A TSS, or a combination thereof.In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence within a distance of approximately 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1.0 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb from the nucleotide position to +55 kb, +58 kb, or +62 kb downstream of the BCL11A TSS, or a combination thereof. In certain embodiments, the target nucleotide sequence comprises the polynucleotide sequence GTGATAAAAGCAACTGTTAG (SEQ ID NO: 62), or a variant thereof comprising up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide substitutions.In some embodiments, the LNP delivered in the methods provided in this document comprises lipid 15, an HSC target group that binds to an HSC surface antigen comprising a VH domain comprising CDRH1, CDR-H2 and CDR-H3 sequences, wherein the VH domain comprises the amino acid sequence shown in SEQ ID NO: 7, and a VL domain comprising CDR-L1, CDR-L2, CDR and CDR-L3 sequences, wherein the VL domain comprises the amino acid sequence shown in SEQ ID NO: 8, and a payload comprising one or more acids. Petition 870250067839, dated 01 / 08 / 2025, pp. 304 / 474 172 / 300 nucleic acids that encode components of a gene editing system targeting a locus (or loci) where gene editing results in increased HbF for the treatment of sickle cell disease or beta-thalassemia. In some embodiments, the target nucleotide sequence is within the BCL11A erythroid enhancer. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence in intron-2 of the BCL11A gene. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence between approximately +54 kb and approximately +63 kb downstream of the transcription start site (TSS) of BCL11A.In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence between approximately +54 kb and approximately +56 kb, a polynucleotide sequence between approximately +57 kb and approximately +59 kb, or a polynucleotide sequence between approximately +62 kb and approximately +63 kb downstream of the BCL11A TSS, or a combination thereof. In certain embodiments, the target nucleotide sequence is within a polynucleotide sequence within a distance of approximately 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1.0 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb from the nucleotide position to 55 kb, 58 kb, or 62 kb downstream of the BCL11A TSS, or a combination thereof. In certain embodiments, the target nucleotide sequence comprises the polynucleotide sequence GTGATAAAAGCAACTGTTAG (SEQ ID NO: 62), or a variant thereof comprising up to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotide substitutions.In some embodiments, the exemplary LNP provided herein is used to edit HSC cells in vitro, ex vivo, and in vivo. In some embodiments, the exemplary LNP provided herein is used to edit HSC cells in vivo. In some embodiments, the exemplary LNP provided herein is delivered to a subject with... Petition 870250067839, dated 01 / 08 / 2025, pp. 305 / 474 173 / 300 disease for in vivo gene editing and disease treatment. In some embodiments, the exemplary LNP provided herein is delivered to a subject with sickle cell disease or beta-thalassemia for in vivo gene editing and treatment of the subject. In some embodiments, the use of the exemplary LNP provided herein for the treatment of sickle cell disease in a subject is safe and effective. In some embodiments, the use of the exemplary LNP provided herein for the treatment of beta-thalassemia in a subject is safe and effective. VII. Gene editing methods in hematopoietic stem cells

[0398] The present disclosure provides methods for delivering a payload encoding a gene-editing system (e.g., a site-directed nuclease and, optionally, a guide RNA) to a target cell or tissue, for example, a target cell or tissue in a subject, and LNPs or pharmaceutical compositions containing the LNPs for use in such methods. The present disclosure further provides methods for genetically modifying hematopoietic stem cells (HSCs), both in vitro and in vivo in a subject. Any disclosure hereof of a method of, for example, treating a disease or, for example, delivering a nucleic acid to a cell, for example, expressing a gene-editing system in a cell or, for example, genetically modifying a cell, shall also be interpreted as a disclosure of an LNP or pharmaceutical composition comprising said LNP for use in such methods. (a) Gene editing systems and methods

[0399] In some embodiments, the LNPs disclosed herein may comprise one or more nucleic acids encoding components of gene editing systems. Gene editing systems are designed to specifically recognize a Petition 870250067839, dated 01 / 08 / 2025, pages 306 / 474 174 / 300 target nucleic acid sequences in a DNA molecule and thus induce a modification in the DNA molecule. The modification may comprise a modification in the nucleotide sequence of the DNA molecule or may comprise a chemical modification of one or more nucleotides in the DNA molecule (e.g., methylation). Gene editing systems useful in the methods disclosed here include, for example, site-targeted nuclease gene editing systems, chemical base editors, core editors, and epigenome editors.

[0400] In particular embodiments, the methods disclosed herein utilize LNPs comprising one or more nucleic acids encoding components of site-directed nuclease gene editing systems, for example, an mRNA encoding a site-directed nuclease. Site-directed nucleases can generate one or more single-stranded DNA fragments or double-stranded DNA breaks (DSBs) in a target nucleotide sequence. In some cases, a DSB can be achieved in a DNA molecule comprising the target nucleotide sequence by the use of two nucleases that generate single-strand nicks (nickases). Each nickase can cleave one strand of DNA, and the use of two or more nickases can create a DSB (e.g., a staggered DSB) in a target nucleotide sequence.In preferred embodiments, site-directed nucleases are used in combination with a donor template nucleic acid, which is introduced into the target nucleotide sequence at the DNA DSB site via homologous recombination.

[0401] In some embodiments, the LNPs disclosed herein may comprise an mRNA encoding a site-directed nuclease. In the methods disclosed herein, site-directed nucleases may generate one or more single-stranded DNA nicks or double-stranded DNA breaks (DSBs) in a sequence of Petition 870250067839, dated 01 / 08 / 2025, pp. 307 / 474 175 / 300 target nucleotides. In some cases, a DSB can be achieved on a DNA molecule comprising the target nucleotide sequence by using two nucleases that generate single-stranded nicks (nickases). Each nickase can cleave one strand of DNA, and the use of two or more nickases can create a DSB (e.g., a stepped DSB) on a target nucleotide sequence. In preferred embodiments, site-directed nucleases are used in combination with a donor template nucleic acid, which is introduced into the target nucleotide sequence at the DNA DSB site via homologous recombination.

[0402] Site-directed nucleases may comprise one or more DNA-binding domains and one or more DNA-cleavage domains (e.g., one or more endonuclease and / or exonuclease domains) and, optionally, one or more polypeptide linkers. The site-directed nuclease may be designed and / or modified from a naturally occurring site-directed nuclease or from a previously designed site-directed nuclease. Designed site-directed nucleases may further comprise one or more additional functional domains, for example, an end-processing enzyme domain of an end-processing enzyme exhibiting 35' exonuclease (e.g., Trex2), 5-3' alkaline exonuclease, 5-3' exonuclease, 5' tab endonuclease, helicase, or template-independent DNA polymerase activity.

[0403] The LNPs described herein may comprise an mRNA encoding any known site-directed nuclease, including, for example, CRISPR-associated short regularly spaced palindromic repeat (CRISPR) nucleases (Cas), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), megaTALs, and homing enducleases (meganucleases). In some cases, a site-directed nuclease is a nuclease Petition 870250067839, dated 01 / 08 / 2025, pages 308 / 474 RNA-guided nucleases require an RNA sequence to direct the nuclease to a target site (e.g., CRISPR / CAS). In other cases, site-directed nucleases comprise one or more heterologous DNA-binding and cleavage domains (e.g., ZFNs, TALENs, megals). In still other cases, the DNA-binding domain of a naturally occurring nuclease can be altered to bind to a selected target site (e.g., a meganuclease that has been engineered to bind to a site other than the cognate-binding site). I. CRISPR / CAS gene editing systems

[0404] In some embodiments, the site-directed nuclease is a Cas nuclease. CRISPR (clustered regularly interspaced short palindromic repeats) / CAS (CRISPR-associated) nuclease systems can be introduced into a cell and engineered to bind to, and introduce, single-strand breaks or double-strand breaks (DSBs) into a target nucleotide sequence. CRISPR / CAS gene-editing systems are based on a natural bacterial system that has been used for mammalian genome engineering. CRISPR-CAS systems are known in the art and described, for example, in Jinek (“A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity”. Science 337.6096 (2012): 816821); Jinek (“RNA-programmed genome editing in human cells”. Elife 2 (2013): e00471); Mali (“RNA-guided human genome engineering via Cas9”. Science 339.6121 (2013): 823-826); Qi (“Repercussing CRISPR as an RNA-guided platform for specific gene expression sequence control”. Cell 152.5 (2013): 1173-1183); Ran (“Genome engineering using the CRISPR-Cas9 system”. Nature protocols 8.11 (2013): 2281-2308); Zetsche (“Cpf1 is a unique RNA-guided endonuclease of a class 2 CRISPR-Cas system”. Cell 163.3 (2015): 759-771).

[0405] In some embodiments, the LNP comprises an mRNA encoding a Cas nuclease and one or more RNAs that confer the Petition 870250067839, dated 01 / 08 / 2025, pp. 309 / 474 177 / 300 Cas nuclease binding to the target nucleotide sequence, for example, a transactivator cRNA (tracrRNA) and a CRISPR RNA (crRNA), or, more commonly, guide RNA (gRNA, also known as single guide RNA (sgRNA)), in which the crRNA and tracrRNA are engineered onto an RNA molecule.

[0406] In some cases, the Cas nuclease is designed as a double-stranded DNA endonuclease, a nickase, or a catalytically killed Cas (dCas) and forms a target complex with a gRNA or crRNA / tracrRNA for site-specific DNA recognition in the target nucleotide sequence. GRNAs and cRNAs comprise a protospacer sequence that shares homology / complementarity with the target protospacer sequence of the target nucleotide sequence. The protospacer confers binding of the CAS / gRNA complex to the target nucleotide sequence. The target protospacer sequence lies in a motif adjacent to the short protospacer (PAM), which plays a role in recruiting a CAS / RNA complex to the target site. Different types of CAS nucleases recognize different PAM-specific motifs.A CRISPR / CAS system can be used to target and cleave the target nucleotide sequence flanked by particular 3' PAM sequences specific to the particular Cas nuclease of the CRISPR / CAS system. PAMs for specific CAS nucleases are known in the art and can also be identified using bioinformatics or experimental methods described in the art, including, for example, in Esgult (“Orthogonal Cas9 proteins for RNA-guided gene regulation and editing”. Nature methods 10.11 (2013):. 1116-1121).

[0407] In certain embodiments, the Cas nuclease may comprise one or more heterologous DNA binding domains, which may increase the efficiency and specificity of DNA cleavage at the target nucleotide sequence. A Cas nuclease may optionally Petition 870250067839, dated 01 / 08 / 2025, pp. 310 / 474 178 / 300 comprise one or more additional linkers and / or functional domains, for example, an end-processing enzyme domain of an end-processing enzyme exhibiting 5-3' exonuclease, 5-3' alkaline exonuclease, 3-5' exonuclease (e.g., Trex2), 5' tab endonuclease, helicase-independent DNA polymerase activity, or template. In some embodiments, a CAS nuclease can be introduced into a hematopoietic stem cell (HSC) with an end-processing enzyme exhibiting 5-3' exonuclease, 5-3' alkaline exonuclease, 3-5' exonuclease (e.g., Trex2), 5' tab endonuclease, helicase-independent DNA polymerase activity, or template.The CAS nuclease and the 3' processing enzyme can be introduced separately, for example, in different vectors or separate nucleic acids, or together, for example, as a fusion protein, or in a polycistronic construct separated by a viral autocleavage peptide or an IRES element.

[0408] In several embodiments, the Cas nuclease is Cas9 or Cpf1.

[0409] A Cas9 nuclease suitable for use in particular embodiments can be obtained, for example, from bacterial species including, but not limited to: Enterococcus faecium, Enterococcus italicus, Listeria innocua, Listeria monocytogenes, Listeria seeligeri, Listeria ivanovii, Streptococcus agalactiae, Streptococcus anginosus, Streptococcus bovis, Streptococcus dysgalactiae, Streptococcus equinus, Streptococcus gallolyticus, Streptococcus macacae, Streptococcus mutans, Streptococcus pseudoporcinus, Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus gordonii, Streptococcus infantarius, Streptococcus macedonicus, Streptococcus mitis, Streptococcus pasteurianus, Streptococcus suis, Streptococcus vestibularis, Streptococcus sanguinis, Streptococcus downei, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria meningitidis, Neisseria subflava, Lactobacillus brevis, Lactobacillus buchneri, Petition 870250067839, dated 01 / 08 / 2025, pp. 311 / 474 179 / 300 Lactobacillus casei, Lactobacillus paracasei, Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus johnsonii, Lactobacillus rhamnosus, Lactobacillus ruminis, Lactobacillus salivarius, Lactobacillus sanfranciscensis, Corynebacterium accolens, Corynebacterium diphtheriae, Corynebacterium matruchotii, Campylobacter jejuni, Clostridium perfringens, Treponema vincentii, Treponema phagedenis, and Treponema denticola. In some cases, the nucleotide encoding the Cas9 nuclease comprises a portion of the Cas9 nuclease sequence from any of the bacterial species described herein.

[0410] Similarly, a Cpf1 nuclease suitable for use in particular embodiments can be obtained from bacterial species including, but not limited to: Francisella spp., Acidaminococcus spp., Prevotella spp., Lachnospiraceae spp., among others. In some cases, the nucleotide encoding the CPFL nuclease comprises a portion of the Cas9 nuclease sequence from any of the bacterial species described in this document.

[0411] Conserved regions of Cas9 orthologs include a central HNH endonuclease domain and a split RuvC / RNase H domain. Cpf1 orthologs possess a RuvC / RNase H domain but no discernible HNH domain. HNH-like and RuvC-like domains are each responsible for cleaving one strand of the target double-stranded DNA sequence. The HNH domain of the Cas9 nuclease cleaves the DNA strand complementary to trarRNA:crRNA or sgRNA. The RuvC-like domain of the Cas9 nuclease cleaves the DNA strand that is not complementary to trarRNA:crRNA or sgRNA. Cpf1 is predicted to act as a dimer in which each RuvC-like domain of Cpf1 cleaves either the complementary or non-complementary strand of the target site. In particular embodiments, a Cas9 nuclease variant (e.g., Cas9 nickase) is contemplated comprising one or more additions, Petition 870250067839, dated 01 / 08 / 2025, pp. 312 / 474 180 / 300 deletions, mutations, or amino acid substitutions in HNH-like or RuvC-like endonuclease domains that decrease or eliminate nuclease activity of the variant domain.

[0412] In some embodiments, the methods described herein involve modifying the Cas9 nuclease activity. In some embodiments, the Cas9 nuclease activity is decreased or eliminated. Illustrative examples of HNH Cas9 mutations that decrease or eliminate nuclease activity in the domain include, but are not limited to: S. pyogenes (D10A); S. thermophilis (D9A); T. denticola (D13A); and N. meningitidis (D16A). Illustrative examples of RuvC-like Cas9 domain mutations that decrease or eliminate nuclease activity in the domain include, but are not limited to: S. pyogenes (D839A, H840A, or N863A); S. thermophilis (D598A, H599A, or N622A); T. denticola (D878A, H879A, or N902A); and N. meningitidis (D587A, H588A or N611A). In some cases, the methods described in this document involve decreasing the activity and / or efficiency of the Cas9 nuclease against a biological target.In some cases, the methods described in this document involve decreasing the activity of the Cas9 nuclease and / or efficiency with respect to a disease target.

[0413] Similarly, naturally occurring or non-naturally occurring (e.g., engineered or recombinant) Cas9 equivalents, variants, homologs, orthologs, or paralogs, and a Cas9 equivalent of any Class 2 CRISPR system (e.g., Type II and V), including Cas12a (Cpf1), Cas12e (CasX), Cas12b1 (C2c1), Cas12b2, and Cas12c (C2c3), are suitable for use in particular embodiments of the present disclosure. Other CAS equivalents are described in Makarova et al., “C2c2 is a single-component RNA-guided RNA-targeted CRISPR effector”, Science 2016; 353 (6299) and Makarova et al., “Classification and Nomenclature of CRISPRCas Systems: Where from Here?”, The CRISPR Journal, volume 1. No. Petition 870250067839, dated 01 / 08 / 2025, pp. 313 / 474 181 / 300 May 5, 2018.

[0414] CasX (Cas12e) is a Cas9 equivalent that supposedly has the same function as Cas9, but evolved through convergent evolution. Thus, the CasX (Cas12e) protein described in Liu et al., “CasX enzymes comprise a distinct family of RNA-guided genome editors”, Nature, 2019, volume 566: 218-223, is considered to be used with the gene editing system described in this document. Furthermore, any variant or modification of CasX (Cas12e) is conceivable and within the scope of this disclosure.

[0415] In several other embodiments, the Cas nuclease described herein (for example, a Cas9, a Cas12a (Cpf1), a Cas12e (CasX), a Cas12d (Casy), a Cas12b1 (C2c1), a Cas12c (C2c3), a Cas12g, a Cas12h, a Cas14, or a variant thereof) is suitable for use in particular embodiments of the present disclosure. ii. Homing endonucleases / meganucleases

[0416] In several embodiments, a plurality of homing endonucleases or meganucleases is introduced into a cell and engineered to bind to and introduce single-strand nicks or double-strand breaks (DSBS) into a plurality of genomic target sites including, but not limited to, genes encoding proteins associated with specific diseases (e.g., sickle cell disease). In some embodiments, homing endonucleases or meganucleases are suitable for use in particular embodiments of the present disclosure. Furthermore, any variant or modification of endonucleases or meganucleases is conceivable and within the scope of the present disclosure. “Homing endonuclease” and “meganuclease” are used interchangeably and refer to naturally occurring nucleases or engineered meganucleases that recognize 12–45 base-pair cleavage sites and are commonly grouped into five families based on Petition 870250067839, dated 01 / 08 / 2025, pages 314 / 474 182 / 300 sequence and structure motifs: LAGLIDADG (SEQ ID NO: 61), GIYYIG, HNH, His-Cys box and PD-(D / E)XK.

[0417] Engineered HEs do not exist in nature and can be obtained by recombinant DNA technology or random mutagenesis. Engineered HEs can be obtained by making one or more amino acid changes, for example, by mutating, substituting, adding, or deleting one or more amino acids, in a naturally occurring HE or a previously engineered HE. In particular embodiments, an engineered HE comprises one or more amino acid changes at the DNA recognition interface.

[0418] The engineered HES contemplated in particular embodiments may additionally comprise one or more additional linkers and / or functional domains, for example, an end-processing enzyme domain of an end-processing enzyme exhibiting 5-3' exonuclease, 5-3' alkaline exonuclease, 3-5' exonuclease (e.g., Trex2), 5' tab endonuclease, helicase-independent DNA polymerase activity, or template. In particular embodiments, the modified HES are introduced into a T cell with an end-processing enzyme exhibiting 5-3' exonuclease, 5-3' alkaline exonuclease, 3-5' exonuclease (e.g., Trex2), 5' tab endonuclease, helicase-independent DNA polymerase activity, or template.The HE and 3' processing enzyme can be introduced separately, for example, in different vectors or separate mRNAs, or together, for example, as a fusion protein, or in a polycistronic construct separated by a viral autocleavage peptide or an IRES element.

[0419] A “DNA recognition interface” refers to the HE amino acid residues that interact with nucleic acid target bases, as well as those residues that are adjacent. For each HE, the DNA recognition interface comprises an extensive network Petition 870250067839, dated 01 / 08 / 2025, pages 315 / 474 183 / 300 of side-chain to side-chain and side-chain to DNA contacts, most of which are necessarily unique to recognize a particular nucleic acid target sequence. Thus, the amino acid sequence of the DNA recognition interface corresponding to a particular nucleic acid sequence varies significantly and is a characteristic of any natural or engineered HE. By way of non-limiting example, an engineered HE contemplated in particular embodiments can be derived by constructing HE variant libraries in which one or more amino acid residues located at the DNA recognition interface of the natural HE (or a previously engineered HE) are varied. The libraries can be screened for target cleavage activity against each predicted TCRα locus target site using cleavage assays (see, for example, Jarjour et al., 2009. Nuc. Acids Res. 37 (20): 6871-6880).

[0420] LAGLIDADG homing endonucleases (LHEs) (SEQ Laglidadg (SEQ ID NO: 61) are the most well-studied family of meganucleases, encoded primarily in archaea and organellar DNA in algae and green fungi, and exhibit the highest overall specificity for DNA recognition. Laglidadg proteins comprise one or two catalytic Laglidadg (SEQ ID NO: 61) motifs per protein chain and function as homodimers or single-stranded monomers, respectively. Structural studies of Laglidadg (SEQ ID NO: 61) proteins have identified a highly conserved core structure (Stoddard 2005), characterized by an αββαββα fold, with the Laglidadg (SEQ ID NO: 61) motif belonging to the first helix of this fold. The highly efficient and specific cleavage of Laglidadg represents a protein framework for deriving innovative and highly specific endonucleases.However, LHEs designed to bind to and cleave a non-natural or non-canonical target site require the selection of the appropriate LHE framework, examination of the target locus, selection of putative target sites, and... Petition 870250067839, dated 01 / 08 / 2025, pp. 316 / 474 184 / 300 extensive LHE modification to alter its DNA contact points and cleavage specificity, in up to two-thirds of the base pair positions at a target site.

[0421] Illustrative examples of LHEs from which projected screens may be designed include, but are not limited to, I-AabMI, IAaemi, I-AniI, I-AapMI, I-CapIII, I-CapIV, I-CkaMI, I-CpaMI, I-CpaMII, ICpaMIII, I-CpaMIV, I-CpaMV, I-CpaV, I-CraMI, I-EjeMI, I-GpeMI, I-GpiI, I-GzeMI, I-GzeMII, I-GzeMIII, I-HjeMI, I-LtrII, I-LtrI, I-LtrWI, I-MpeMI, IMveMI, I-NcrII, I-NCRI, I-NcrMI, I-OheMI, I-OnuI, I-OsoMI, I-OsoMII, IOsoMIII, I-OsoMIV, I-PanMI, I-PanMII, I-PanMIII, I-PnoMI, I-SCUMI, ISmaMI, I-SscMI and I-Vdi141I.

[0422] Other illustrative examples of LHEs from which projected screens can be designed include, but are not limited to, ICrei and I-SceI.

[0423] In one embodiment, the projected LHE is selected from the group consisting of: I-CpaMI, I-HjeMI, I-OnuI, I-PanMI and SmaMI.

[0424] In one embodiment, the projected LHE is I-OnuI.

[0425] In one embodiment, engineered I-OnuI LHEs targeting the human TCRα gene were generated from a natural I-OnuI. In a preferred embodiment, engineered I-OnuI LHEs targeting the human TCRα gene were generated from a previously engineered I-OnuI.

[0426] In a particular embodiment, the designed LHE I-OnuI comprises one or more amino acid substitutions at the DNA recognition interface. In particular embodiments, the LHE I-OnuI comprises at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, by Petition 870250067839, dated 01 / 08 / 2025, pp. 317 / 474 185 / 300 less 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the I-OnuI DNA recognition interface (Taekuchi et al. 2011. Proc Natl Acad Sci USA August 9, 2011; 108(32):13077-13082) or an engineered variant of I-OnuI.

[0427] In one embodiment, the LHE I-OnuI comprises at least %, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99% sequence identity with the DNA recognition interface of I-OnuI (Taekuchi et al. 2011. Proc Natl Acad Sci USA Aug 9, 2011; 108(32):13077-13082) or an engineered variant of I-OnuI.

[0428] In a particular embodiment, an engineered I-OnuI LHE comprises one or more amino acid substitutions or modifications at the DNA recognition interface, particularly in the subdomains located at positions 24-50, 68-82, 180-203 and 223-240 of I-OnuI.

[0429] In one embodiment, a designed I-OnuI LHE comprises one or more amino acid substitutions or modifications at additional positions located anywhere within the entire I-OnuI sequence. Residues that may be substituted and / or modified include, but are not limited to, amino acids that come into contact with the nucleic acid target or that interact with the nucleic acid structure or nucleotide bases, directly or through a water molecule. In a non-limiting example, a designed I-OnuI LHE contemplated herein comprises one or more substitutions and / or modifications, preferably at least Petition 870250067839, dated 01 / 08 / 2025, pages 318 / 474 186 / 300 5, preferably at least 10, preferably at least 15, more preferably at least 20, even more preferably at least 25 in at least one position selected from the group of positions consisting of positions: 19, 24, 26, 28, 30, 32, 34, 35, 36, 37, 38, 40, 42, 44, 46, 48, 68, 70, 72, 75, 76, 77, 78, 80, 82, 168, 180, 182, 184, 186, 188, 189, 190, 191, 192, 193, 195, 197, 199, 201, 203, 223, 225, 227, 229, 231,232, 234, 236, 238, 240 of I-Onul. iii. MegaTALS

[0430] In several embodiments, a plurality of megaTALs is introduced into a cell and engineered to bind to and introduce DSBs into a plurality of genome target sites, including. In some embodiments, megaTALs are suitable for use in particular embodiments of the present disclosure. Furthermore, any variant or modification of megaTALs is conceivable and within the scope of the present disclosure. A “megaTAL” refers to an engineered nuclease comprising an engineered TALE DNA-binding domain and an engineered meganuclease, and optionally comprising one or more additional linkers and / or functional domains, for example, an end-processing enzyme domain of an end-processing enzyme exhibiting 5-3' exonuclease, 5-3' alkaline exonuclease, 3-5' exonuclease (e.g., Trex2), 5' flap endonuclease, helicase, or template-independent DNA polymerase activity.In particular embodiments, a megaTAL can be introduced into a T cell with a final processing enzyme exhibiting 53' exonuclease, 5-3' alkaline exonuclease, 3-5' exonuclease (e.g., Trex2), 5' flap endonuclease, helicase-independent DNA polymerase, or template activity. The megaTAL and the 3' processing enzyme can be introduced separately, for example, in different vectors or separate mRNAs, or together, for example, as a fusion protein, or in a polycistronic construct separated by a peptide. Petition 870250067839, dated 01 / 08 / 2025, pp. 319 / 474 187 / 300 viral autocleavage or an IRES element.

[0431] A “TALE DNA binding domain” is the DNA-binding portion of transcription activator-like effectors (TALEs or TAL effectors), which mimics plant transcriptional activators to manipulate the plant transcriptome (see, for example, Kay et al., 2007. Science 318: 648-651). The TALE DNA binding domains contemplated in particular embodiments are designed de novo or from naturally occurring tales, for example, AvrBs3 from Xanthomonas campestris pv. vesicatoria, Xanthomonas gardneri, Xanthomonas translucens, Xanthomonas axonopodis, Xanthomonas perforans, Xanthomonas alfafa, Xanthomonas citri, Xanthomonas euvesicatoria and Xanthomonas oryzae and brg11 and hpx17 from Ralstonia solanacearum. Illustrative examples of TALE proteins for deriving and designing DNA-binding domains are disclosed in U.S. Patent No. 9,017,967, and references cited, all of which are incorporated herein by reference in their entirety.

[0432] In particular embodiments, a megaTAL comprises a TALE DNA-binding domain comprising one or more repeat units that are involved in binding the TALE DNA-binding domain to its corresponding target DNA sequence. A single “repeat unit” (also referred to as a “repeat”) is typically 33–35 amino acids in length. Each TALE DNA-binding domain repeat unit includes 1 or 2 DNA-binding residues that make up the variable repeat residue (RVD), typically at positions 12 and / or 13 of the repeat. The natural (canonical) code for DNA recognition of these TALE DNA-binding domains has been determined, such that an HD sequence at positions 12 and 13 leads to cytosine I binding, NG binds to T, NI to A, NN binds to G or A, and NG binds to T. In certain embodiments, non-canonical (atypical) RVDs are contemplated. Petition 870250067839, dated 01 / 08 / 2025, pp. 320 / 474 188 / 300

[0433] Illustrative examples of non-canonical RVDs suitable for use in particular megaTALs contemplated in particular modalities include, but are not limited to, HH, KH, NH, NK, NQ, RH, RN, SS, NN, SN, KN for guanine (G) recognition; NI, KI, RI, HI, si for adenine (A) recognition; NG, HG, kg, RG for thymine (T) recognition; RD, SD, HD, ND, KD, YG for cytosine (C) recognition; Nv, HN for A or G recognition; and H*, HA, KA, N*, NA, NC, NS, RA, S* for A or T or G or C recognition, where (*) means that the amino acid at position 13 is absent. Additional illustrative examples of RVDs suitable for use in particular metaTALs contemplated in particular embodiments include those disclosed in U.S. Patent No. 8,614,092, which is incorporated herein by reference in its entirety.

[0434] In particular embodiments, a megaTAL contemplated herein comprises a TALE DNA-binding domain comprising 3 to 30 repeat units. In certain embodiments, a megaTAL comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 repeat units of a TALE DNA-binding domain. In a preferred embodiment, a megaTAL contemplated herein comprises a TALE DNA-binding domain comprising 5-16 repeat units, more preferably 7-15 repeat units, more preferably 9-12 non-obvious repeat units, and most preferably 9, 10, or 11 repeat units.

[0435] In particular embodiments, a megaTAL contemplated herein comprises a TALE DNA-binding domain comprising 3 to 30 repeat units and an additional single truncated TALE repeat unit comprising 20 amino acids located at the C-terminus of a set of TALE repeat units, i.e., a DNA-binding domain repeat unit of Petition 870250067839, dated 01 / 08 / 2025, pp. 321 / 474 189 / 300 additional C-terminal half-TALE (amino acids -20 to -1 of the C-cap disclosed elsewhere herein, below). Thus, in particular embodiments, a megaTAL contemplated in the present document comprises a TALE DNA-binding domain comprising 3.5 to 30.5 repeat units. In certain embodiments, a megaTAL comprises 3.5, 4.5, 5.5, 6.5, 7.5, 8.5, 9.5, 10.5, 11.5, 12.5, 13.5, 14.5, 15.5, 16.5, 17.5, 18.5, 19.5, 20.5, 21.5, 22.5, 23.5, 24.5, 25.5, 26.5, 27.5, 28.5, 29.5, or 30.5 DNA-binding domain repeat units of TALE. In a preferred embodiment, a megaTAL contemplated in this document comprises a TALE DNA-binding domain comprising 5.5-13.5 repeat units, more preferably 7.5-12.5 repeat units, more preferably 9.5-11.5 repeat units, and most preferably 9.5, 10.5, or 11.5 repeat units.

[0436] In particular embodiments, a megaTAL comprises an N-terminal domain (NTD) polypeptide, one or more TALE repeat domains / units, a C-terminal domain (CTD) polypeptide, and an engineered meganuclease.

[0437] As used in this document, the term “N-terminal domain (NTD)” polypeptide refers to the sequence flanking the N-terminal portion or fragment of a naturally occurring TALE DNA-binding domain. The NTD sequence, if present, may be of any length, provided that the repeat units of the TALE DNA-binding domain retain the ability to bind to DNA. In particular embodiments, the NTD polypeptide comprises at least 120 to at least 140 or more N-terminal amino acids to the TALE DNA-binding domain (0 being amino acid 1 of the most N-terminal repeat unit). In particular embodiments, the NTD polypeptide comprises at least about 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, Petition 870250067839, dated 01 / 08 / 2025, pp. 322 / 474 190 / 300 or at least 140 amino acids N-terminal to the DNA-binding domain of TALE. In one embodiment, a megaTAL contemplated herein comprises an NTD polypeptide of at least about amino acids +1 to +122 to at least about +1 to +137 of a Xanthomonas TALE protein (0 is amino acid 1 of the most N-terminal repeat unit). In particular embodiments, the NTD polypeptide comprises at least about 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, or 137 amino acids N-terminal to the DNA-binding domain of TALE of a Xanthomonas TALE protein. In one embodiment, a megaTAL contemplated herein comprises an NTD polypeptide of at least amino acids +1 to +121 from a Ralstonia TALE protein (0 being amino acid 1 of the most N-terminal repeating unit).In particular embodiments, the NTD polypeptide comprises at least about 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136 or 137 amino acids N-terminal to the TALE DNA-binding domain of a Ralstonia TALE protein.

[0438] As used in this document, the term “C-terminal domain (CTD)” polypeptide refers to the sequence flanking the C-terminal portion or fragment of a naturally occurring TALE DNA-binding domain. The CTD sequence, if present, may be of any length, provided that the repeat units of the TALE DNA-binding domain retain the ability to bind to DNA. In particular embodiments, the CTD polypeptide comprises at least 20 to at least 85 or more C-terminal amino acids up to the last complete repeat of the TALE DNA-binding domain (the first 20 amino acids are the C-terminal half-repeat unit up to the last complete C-terminal repeat unit). In particular embodiments, the CTD polypeptide comprises at least about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, Petition 870250067839, dated 01 / 08 / 2025, pp. 323 / 474 191 / 300 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 or at least 85 C-terminal amino acids up to the last complete repeat of the TALE DNA-binding domain. In one embodiment, a megaTAL contemplated herein comprises a CTD polypeptide of at least about amino acids -20 to -1 of a Xanthomonas TALE protein (-20 being amino acid 1 from a C-terminal half-repeat unit to the last C-terminal full-repeat unit). In particular embodiments, the CTD polypeptide comprises at least about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 C-terminal amino acid to the last full-repeat of the TALE DNA-binding domain of a Xanthomonas TALE protein.In one embodiment, a megaTAL contemplated herein comprises a CTD polypeptide of at least about amino acids -20 to -1 of a Ralstonia TALE protein (-20 being amino acid 1 from a half C-terminal repeat unit to the last complete C-terminal repeat unit). In particular embodiments, the CTD polypeptide comprises at least about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 C-terminal amino acid to the last complete repeat of the TALE DNA-binding domain of a Ralstonia TALE protein.

[0439] In particular embodiments, a megaTAL contemplated herein comprises a fusion polypeptide comprising a TALE DNA-binding domain designed to bind a target sequence, a meganuclease designed to bind and cleave a target sequence, and optionally an NTD and / or CTD polypeptide, optionally linked together with one or more linker polypeptides contemplated elsewhere herein. Without wishing to be bound by any particular theory, it is contemplated that a megaTAL comprising a TALE DNA-binding domain and, Petition 870250067839, dated 01 / 08 / 2025, pages 324 / 474 Optionally, a 192 / 300 NTD and / or CTD polypeptide is fused to a linker polypeptide which is further fused to an engineered meganuclease. Thus, the DNA-binding domain of TALE binds to a target DNA sequence that is within approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides away from the target sequence bound by the meganuclease's DNA-binding domain. In this way, the megaTALs contemplated in this document increase the specificity and efficiency of genome editing.

[0440] In particular embodiments, a megaTAL contemplated in...

Claims

1. Lipid nanoparticle (LNP) for targeted delivery of one or more nucleic acids into a hematopoietic stem cell (HSC), characterized by comprising: (a) a lipid-antibody conjugate comprising the compound of Formula (I): [Lipid] - [optional ligand] - [antibody] (I), wherein the antibody binds to CD105 and / or CD117; (b) an ionizable cationic lipid comprising: i. a compound of Formula (II'): or a salt thereof, wherein: R1, R2 and R3 are each independently a C1-3 alkylene linkage; R1A, R2A and R3A are each independently a C1-10 alkylene linkage; R1A1, R1A2, R1A3, R2A1, R2A2, R2A3, R3A1, R3A2 and R3A3 are each independently H, C1-20 alkyl, C1-20 alkenyl, -(CH2)oioC(O)ORa1 or -(CH2)o-ioOC(O)Ra2; Ra1 and Ra2 are each independently C1-20 alkyl or C1-20 alkenyl; Petition 870250067839, dated 01 / 08 / 2025, p. 435 / 474 2 / 32 p3B2 R3B1 ' I R3B θ r3B3 .R3B1 is C1-6 alkylene; and R3B2 and R3B3 are each independently H or C1-6 alkyl optionally substituted by one or more substituents, each independently selected from the group consisting of -OH and -O-(C1-6 alkyl); or ii. a compound having the following structure: a salt thereof; and (c) one or more nucleic acids arranged in the LNP.

2. LNP, according to claim 1, characterized by comprising two lipid-antibody conjugates comprising the compound of Formula (I), wherein the first lipid-antibody conjugate and the second lipid-antibody conjugate are the same or different.

3. LNP, according to claim 1 or 2, characterized in that the antibody comprises a variable heavy chain (VH) region of antibody and a variable light chain (VL) region of antibody, wherein: (a) the antibody binds to CD117, and wherein (i) the VH comprises a CDR-H1 comprising the amino acid sequence of FTFSNYAMS (SEQ ID NO: 1), a CDR-H2 comprising the amino acid sequence of AISGSGGSTYYADSVKG (SEQ ID NO: 2) and a CDR-H3 comprising the amino acid sequence of AKGPPTYHTNYYYMDV (SEQ ID NO: Petition 870250067839, 01 / 08 / 2025, p. 436 / 474 3 / 32 3), and (ii) the VL comprises CDR-L1 comprising the amino acid sequence of RASQGISSWLA (SEQ ID NO: 4), a CDR-L2 comprising the amino acid sequence of AASSLQS (SEQ ID NO: 5) and a CDR-L3 comprising the amino acid sequence of QQTNSFPYT (SEQ ID NO: 6);(b) the antibody binds to CD117, wherein (i) VH comprises a CDR-H1 comprising the amino acid sequence of FTFSDADMD (SEQ ID NO: 10), a CDR-H2 comprising the amino acid sequence of RTRNKAGSYTTEYAASVKG (SEQ ID NO: 11) and a CDR-H3 comprising the amino acid sequence of AREPKYWIDFDL (SEQ ID NO: 12), and (ii) VL comprises CDR-L1 comprising the amino acid sequence of RASQSISSYLN (SEQ ID NO: 13), a CDR-L2 comprising the amino acid sequence of AASSLQS (SEQ ID NO: 14) and a CDR-L3 comprising the amino acid sequence of QQSYIAPYT (SEQ ID NO: 15);or (c) the antibody binds to CD105, and wherein (i) VH comprises a CDR-H1 comprising the amino acid sequence of DAWMD (SEQ ID NO: 19), a CDR-H2 comprising the amino acid sequence of EIRSKASNHATYYAESVKG (SEQ ID NO: 20) and a CDR-H3 comprising the amino acid sequence of WRRFFDS (SEQ ID NO: 21), and (ii) VL comprises CDR-L1 comprising the amino acid sequence of RASSSVSYMH (SEQ ID NO: 22), a CDR-L2 comprising the amino acid sequence of ATSNLAS (SEQ ID NO: 23) and a CDR-L3 comprising the amino acid sequence of QQWSSNPLT (SEQ ID NO: 24).

4. LNP, according to any one of claims 1 to 3, characterized in that the antibody binds to CD117 and comprises a Petition 870250067839, dated 01 / 08 / 2025, p. 437 / 474 4 / 32 antibody heavy chain (HC) variable region and antibody light chain (LC) variable region, wherein (a) HC comprises a HC1 comprising the amino acid sequence of FTFSNYAMS (SEQ ID NO: 1), a HC2 comprising the amino acid sequence of AISGSGGSTYYADSVKG (SEQ ID NO: 2) and a HC3 comprising the amino acid sequence of AKGPPTYHTNYYYMDV (SEQ ID NO: 3), and (b) LC comprises a L1 comprising the amino acid sequence of RASQGISSWLA (SEQ ID NO: 4), a L2 comprising the amino acid sequence of AASSLQS (SEQ ID NO: 5) and a L3 comprising the amino acid sequence of QQTNSFPYT (SEQ ID NO: 6).

5. LNP, according to any one of claims 1 to 3, characterized in that the antibody binds to CD117 and comprises a variable heavy chain (VH) region of antibody and a variable light chain (VL) region of antibody, wherein (a) VH comprises a CDR-H1 comprising the amino acid sequence of FTFSDADMD (SEQ ID NO: 10), a CDR-H2 comprising the amino acid sequence of RTRNKAGSYTTEYAASVKG (SEQ ID NO: 11) and a CDR-H3 comprising the amino acid sequence of AREPKYWIDFDL (SEQ ID NO: 12), and (b) VL comprises a CDR-L1 comprising the amino acid sequence of RASQSISSYLN (SEQ ID NO: 13), a CDR-L2 comprising the amino acid sequence of AASSLQS (SEQ ID NO: 14) and a CDR-L3 comprising the amino acid sequence of QQSYIAPYT (SEQ ID NO: 15).

6. LNP, according to any one of claims 1 to 3, characterized in that the antibody binds to CD105 and comprises a Petition 870250067839, dated 01 / 08 / 2025, p. 438 / 474 5 / 32 antibody variable heavy chain (VH) region and antibody variable light chain (VL) region, wherein (a) VH comprises a CDR-H1 comprising the amino acid sequence of DAWMD (SEQ ID NO: 19), a CDR-H2 comprising the amino acid sequence of EIRSKASNHATYYAESVKG (SEQ ID NO: 20) and a CDR-H3 comprising the amino acid sequence of WRRFFDS (SEQ ID NO: 21), and (b) VL comprises a CDR-L1 comprising the amino acid sequence of RASSSVSYMH (SEQ ID NO: 22), a CDR-L2 comprising the amino acid sequence of ATSNLAS (SEQ ID NO: 23) and a CDR-L3 comprising the amino acid sequence of QQWSSNPLT (SEQ ID NO: 24).

7. LNP, according to any one of claims 1 to 6, characterized in that the antibody comprises a variable heavy chain (VH) region of antibody and a variable light chain (VL) region of antibody, wherein (a) the antibody binds to CD117, and wherein VH comprises the amino acid sequence of SEQ ID NO: 7 and VL comprises the amino acid sequence of SEQ ID NO: 8; (b) the antibody binds to CD117, and wherein VH comprises the amino acid sequence of SEQ ID NO: 16 and VL comprises the amino acid sequence of SEQ ID NO: 17; or (c) the antibody binds to CD105, and wherein VH comprises the amino acid sequence of SEQ ID NO: 25 and VL comprises the amino acid sequence of SEQ ID NO:

26.

8. LNP, according to any one of claims 1 to 3, characterized in that the antibody binds to CD117 and comprises a variable heavy chain (VH) region of antibody and a variable light chain (VL) region of antibody, wherein the VH comprises the amino acid sequence of SEQ ID NO: 7 and the VL comprises the amino acid sequence of SEQ ID NO:

8.

9. LNP, according to any one of claims 1 to 3, characterized in that the antibody binds to CD117 and comprises a variable heavy chain (VH) region of antibody and a variable light chain (VL) region of antibody, wherein VH comprises the amino acid sequence of SEQ ID NO: 16 and VL comprises the amino acid sequence of SEQ ID NO:

17.

10. LNP, according to any one of claims 1 to 3, characterized in that the antibody binds to CD105 and comprises a variable heavy chain (VH) region of antibody and a variable light chain (VL) region of antibody, wherein the VH comprises the amino acid sequence of SEQ ID NO: 25 and the VL comprises the amino acid sequence of SEQ ID NO:

26.

11. LNP, according to any one of claims 1 to 10, characterized in that the antibody comprises a Fab, F(ab')2, Fab'-SH, Fv, scFv fragment, or single variable immunoglobulin domain.

12. LNP, according to any one of claims 1 to 11, characterized in that the antibody comprises a Fab.

13. LNP, according to claim 12, characterized in that the Fab comprises a heavy chain domain and a light chain domain, and wherein (a) the heavy chain and light chain domains of the Fab comprise the amino acid sequences presented in SEQ ID NOs: 9 and 38, or have at least 85, 90, 95, 96, 97, 98, 99 or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 9 and 38; (b) the heavy chain and light chain domains of Fab comprise the amino acid sequences presented in SEQ ID NOs: 18 and 39, or have at least 85, 90, 95, 96, 97, 98, 99 or 99.5% sequence identity with the amino acid sequences Petition 870250067839, dated 01 / 08 / 2025, page 1.440 / 474 7 / 32 presented in SEQ ID NOs: 18 and 39; or (c) the Fab heavy chain and light chain domains comprise the amino acid sequences shown in SEQ ID NOs: 27 and 40, or have at least 85, 90, 95, 96, 97, 98, 99 or 99.5% sequence identity with the amino acid sequences shown in SEQ ID NOs: 27 and 40.

14. LNP, according to claim 12, characterized in that the Fab comprises a heavy chain domain and a light chain domain, and wherein the heavy chain and light chain domains of the Fab comprise the amino acid sequences presented in SEQ ID NOs: 9 and 38, or have at least 85, 90, 95, 96, 97, 98, 99 or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 9 and 38.

15. LNP, according to claim 12, characterized in that the Fab comprises a heavy chain domain and a light chain domain, and wherein the heavy chain and light chain domains of the Fab comprise the amino acid sequences presented in SEQ ID NOs: 18 and 39, or have at least 85, 90, 95, 96, 97, 98, 99 or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 18 and 39.

16. LNP, according to claim 12, characterized in that the Fab comprises a heavy chain domain and a light chain domain, and wherein the heavy chain and light chain domains of the Fab comprise the amino acid sequences presented in SEQ ID NOs: 27 and 40, or have at least 85, 90, 95, 96, 97, 98, 99 or 99.5% sequence identity with the amino acid sequences presented in SEQ ID NOs: 27 and 40.

17. LNP, according to any one of claims 12 to 16, characterized in that the Fab comprises a heavy chain domain and a light chain domain and wherein the heavy chain domain, the light chain domain or both comprise a cysteine ​​residue at the C-terminal.

18. LNP, according to any one of claims 1 to 17, characterized in that the antibody comprises an Fc domain.

19. LNP, according to any one of claims 11 to 18, characterized in that the Fab does not have the native interchain disulfide bond at the C-terminal.

20. LNP, according to any one of claims 11 to 19, characterized in that the Fab is designed to replace one or both cysteines in the native constant light chain and in the native constant heavy chain that form the native interchain disulfide bond with a non-cysteine ​​amino acid, to remove the native interchain disulfide bond in the Fab.

21. LNP, according to any one of claims 11 to 20, characterized in that the Fab comprises a heavy chain fragment comprising C233S substitution and a light chain fragment comprising C214S substitution, numbered according to Kabat.

22. LNP, according to any one of claims 11 to 21, characterized in that the Fab has an unnatural interchain disulfide bond.

23. LNP, according to any one of claims 11 to 22, characterized in that the Fab has a projected and buried interchain disulfide bond.

24. LNP, according to any one of claims 11 to 23, characterized in that the Fab comprises F174C substitution in the heavy chain fragment, and S176C substitution in the light chain fragment, with numbering according to Kabat.

25. LNP, according to any of claims 11 to 24, characterized in that the Fab comprises a cysteine ​​at the C-terminal Petition 870250067839, dated 01 / 08 / 2025, page 442 / 474 9 / 32 of the heavy or light chain fragment.

26. LNP, according to any one of claims 11 to 25, characterized in that the Fab further comprises one or more amino acids between the Fab heavy chain fragment and the C-terminal cysteine.

27. LNP, according to any one of claims 1 to 26, characterized in that the antibody comprises a unique immunoglobulin (ISV) variable domain.

28. LNP, according to claim 27, characterized in that the ISV domain is a Nanobody® ISV domain.

29. LNP, according to claim 27 or 28, characterized in that the single variable immunoglobulin domain comprises a cysteine ​​at the C-terminus.

30. LNP, according to any one of claims 27 to 29, characterized in that the antibody comprises two or more VHH domains.

31. LNP, according to any one of claims 27 to 30, characterized in that the single variable immunoglobulin domain comprises a VHH domain and further comprises a spacer comprising one or more amino acids between the VHH domain and the C-terminal cysteine.

32. LNP, according to any one of claims 27 to 31, characterized in that the two or more VHH domains are linked by an amino acid spacer.

33. LNP, according to any one of claims 27 to 32, characterized in that the antibody comprises a first VHH domain linked to a CH1 antibody domain and a second VHH domain linked to a constant light chain antibody domain.

34. LNP, according to any one of claims 27 to 33, characterized in that the CH1 domain of antibody and the antibody light chain constant domain are linked by one or more disulfide bonds.

35. LNP, according to any one of claims 27 to 34, characterized by the CH1 domain comprising F174C and C233S substitutions, and the light chain constant domain comprising S176C and C214S substitutions, with numbering according to Kabat.

36. LNP, according to any one of claims 1 to 35, characterized in that the antibody comprises an amino acid spacer or ligand with the amino acid sequence AAA or with an amino acid sequence presented in any one of the SEQ ID NOS: 45-60.

37. LNP, according to any one of claims 1 to 36, characterized in that the antibody comprises a bispecific antibody.

38. LNP, according to any one of claims 1 to 37, characterized in that one or more nucleic acids are DNA or RNA.

39. LNP, according to claim 38, characterized in that the RNA is an mRNA.

40. LNP, according to any one of claims 1 to 39, characterized in that one or more nucleic acids comprise an mRNA encoding a site-directed nuclease, a chemical base editor, a master editor, or an epigenome editor.

41. LNP, according to any one of claims 1 to 40, characterized in that one or more nucleic acids comprise an mRNA encoding a site-directed nuclease.

42. LNP, according to claim 41, characterized in that the site-directed nuclease is a CRISPR-associated nuclease (Cas), a zinc finger nuclease (ZFN), a transcription-like activator effector nuclease (TALEN) or a megaTAL.

43. LNP, according to claim 41 or 42, characterized in that the site-directed nuclease is a Cas, ZFN, TALEN or megaTAL nuclease comprising an amino acid sequence that confers binding to a target nucleotide sequence.

44. LNP, according to any one of claims 1 to 43, characterized in that one or more nucleic acids comprise (a) an mRNA encoding a CRISPR-associated nuclease (Cas) or a chemical base editor; and (b) a guide RNA (gRNA) comprising a nucleotide sequence that confers binding to a target nucleotide sequence.

45. LNP, according to any one of claims 1 to 43, characterized in that one or more nucleic acids comprise (a) an mRNA encoding a master editor; and (b) a master editor guide RNA (pegRNA) comprising a nucleotide sequence that confers binding to a target nucleotide sequence.

46. ​​LNP, according to claim 44 or 45, characterized in that the Cas nuclease is a Cas Type II or Type V enzyme or a variant thereof.

47. LNP, according to any one of claims 44 to 46, characterized in that the Cas nuclease is a Cas9 enzyme, a Cas12 enzyme, a CasX enzyme, a Cas14 enzyme, or a variant thereof.

48. LNP, according to any one of claims 44 to 47, characterized in that the gRNA or pegRNA comprises a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence.

49. LNP, according to any of the claims 1 Petition 870250067839, dated 01 / 08 / 2025, p. 445 / 474 12 / 32 to 48, characterized in that one or more nucleic acids further comprise a donor template nucleic acid comprising a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence.

50. LNP, according to any one of claims 1 to 49, characterized in that the target nucleotide sequence comprises at least 15 consecutive nucleotides and is located within a) a coding region of a gene; b) an intronic region associated with a gene; c) an exonic region associated with a gene; d) a 5' untranslated region associated with a gene; or e) a 3' untranslated region associated with a gene; where the gene is selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, WAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III and protein C.

51. LNP, according to any one of claims 1 to 50, characterized in that the target nucleotide sequence is within a regulatory region, optionally an enhancer region or a repressor region, of a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, WAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, Petition 870250067839, dated 01 / 08 / 2025, page 446 / 474 13 / 32 CXCR4, F5, F2, antithrombin Ilie protein C.

52. LNP, according to any one of claims 1 to 51, characterized in that the target nucleotide sequence is within the BCL11A erythroid enhancer.

53. LNP, according to any one of claims 1 to 52, characterized in that the ionizable cationic lipid comprises a compound of Formula (II').

54. LNP, according to claim 53, characterized in that R3B2 and R3B3 are each H or C1-6 alkyl independently substituted by one or more substituents, each independently selected from the group consisting of -OH and -O-(C1-6 alkyl).

55. LNP, according to claim 53 or 54, characterized in that R3B2 and R3B3 are each independently methyl or ethyl, each optionally substituted with one or more -OH groups.

56. LNP, according to claim 55, characterized in that R3B2 and R3B3 are each unsubstituted methyl.

57. LNP, according to claim 55, characterized 58. LNP, according to claim 57, characterized Petition 870250067839, dated 01 / 08 / 2025, p. 447 / 474 14 / 32 59. LNP, according to any one of claims 5 to 58, characterized in that R1, R2 and R3 are each independently a linkage or methylene.

60. LNP, according to any one of claims 53 to 59, characterized in that R1 and R2 are each methylene and R3 is a linkage.

61. LNP, according to any one of claims 53 to 60, characterized in that the ionizable cationic lipid is a compound of 62. LNP, according to any one of claims 53 to 61, characterized in that R1A, R2A and R3A are each independently a linkage or -(CH2)i-io-.

63. LNP, according to any one of claims 53 to 62, characterized in that R1A and R2A are each independently a linkage, -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, -(CH2)6-, (CH2)7- or -(CH2)8-.

64. LNP, according to any one of claims 53 to 63, characterized in that R1A and R2A are each independently a linkage, -(CH2)2-, -(CH2)4-, -(CH2)e-, -(CHk)- or -(CH2)8-.

65. LNP, according to any of the claims in Petition 870250067839, dated 01 / 08 / 2025, pp. 448 / 474 15 / 32 to 64, characterized by R3A being a linkage, -CH2-, -(CH2)2- or -(ChL)?- 66. LNP, according to any one of claims 53 to 65, characterized in that R1A1, R1A2, R1A3, R2A1, R2A2 and R2A3 are each independently H, C1-15 alkyl, -CH=CH-(C1-15 alkyl), CH=CH-CH2-CH=CH-(C1-10 alkyl), -(CH2)o-4C(O)OCH(C1-10 alkyl)(C1-15 alkyl), -(CH2)o-4OC(O)CH(C1-10 alkyl)(C1-15 alkyl), -(CH2)o-4OC(O)OCH2(C1-15 alkyl) or -(CH2)o-4OC(O)CH2(C1-10 alkyl).

67. LNP, according to any one of claims 53 to 66, characterized in that R1A1 and R2A1 are each independently -CH=CH-(C1-i5 alkyl), -CH=CH-CH2-CH=CH-(C1-i5 alkyl), -(CH2)o4C(O)OCH(C1-w alkyl)(C1-i5 alkyl) or -(CH2)o-4OC(O)CH(C1-w alkyl)(C1-i5 alkyl); and R1A2, R1A3, R2A2 and R2A3 are each H.

68. LNP, according to any one of claims 53 to 67, characterized by R1A1 and R2A1 each being, 69. LNP, according to any of the claims in Petition 870250067839, dated 01 / 08 / 2025, pp. 449 / 474 16 / 32 to 68, characterized by R1A1 and R2A1 each being, 70. LNP, according to any one of claims 53 to 69, characterized in that R3A1, R3A2 and R3A3 are each independently H, C1-15 alkyl, -(CH2)o-4C(O)OCH(C1-5 alkyl)(C1-w alkyl), (CH2)o-4OC(O)CH(C1-5 alkyl)(C1-w alkyl), -(CH2)o-4C(O)OCH2(C1-w alkyl) or -(CH2)o-4OC(O)CH2(C1-w alkyl).

71. LNP, according to any one of claims 53 to 70, characterized in that R3A1 and R3A2 are each C1-15 alkyl; and R3A3 is H.

72. LNP, according to any one of claims 53 to 71, characterized in that R3A1 and R3A2 are each independently 73. LNP, according to any one of claims 53 to 72, characterized in that R3A1 is propyl and R3A2 is 74. LNP, according to any one of claims 53 to 73, characterized by the ionizable cationic lipid being 75. LNP, according to any of claims 53 to 73, characterized by the ionizable cationic lipid being Petition 870250067839, dated 01 / 08 / 2025, page 450 / 474 17 / 32 76. LNP, according to any one of claims 53 to 73, characterized in that the ionizable cationic lipid is 77. LNP, according to any one of claims 53 to 73, characterized in that the ionizable cationic lipid comprises the compound having the structure 78. LNP, according to any one of claims 1 to 77, characterized in that the antibody is covalently coupled to a lipid in the LNP via a polyethylene glycol (PEG)-containing ligand.

79. LNP, according to claim 78, characterized in that the lipid covalently coupled to the antibody through a PEG-containing ligand is distearoylglycerol (DSG), distearoylphosphatidylethanolamine (DSPE), dimyrtoylphosphatidylethanolamine (DMPE), distearoylglycerophosphoglycerol (DMG), dipalmitoylphosphatidylethanolamine (DEPI), dipalmitoylglycerol (DPG), or ceramide. Petition 870250067839, dated 01 / 08 / 2025, pp. 451 / 474 18 / 32 80. LNP, according to either of claims 78 and 79, characterized in that the PEG is PEG 2000 or PEG 3400.

81. LNP, according to any one of claims 1 to 80, characterized in that the lipid-antibody conjugate comprises [DSPE]-[PEG(2000)-maleimide]-[anti-hCD117 Fab], wherein [DSPE][PEG(2000)-maleimide] is conjugated to anti-hCD117 Fab via covalent coupling between the maleimide group and a C-terminal cysteine ​​in the heavy chain (HC) of anti-hCD117 Fab.

82. LNP, according to any one of claims 1 to 80, characterized in that the lipid-antibody conjugate comprises [DSPE]-[PEG(2000)-maleimide]-[anti-hCD105 Fab], wherein [DSPE][PEG(2000)-maleimide] is conjugated to anti-hCD105 Fab via covalent coupling between the maleimide group and a C-terminal cysteine ​​in the heavy chain (HC) of the anti-hCD105 Fab.

83. LNP, according to claim 81 or 82, characterized in that the ionizable cationic lipid is 84. LNP, according to any one of claims 81 to 83, characterized by further comprising DSPE-PEG(2000)-maleimide (cysteine-terminated) and DSPE-PEG-OCH3.

85. LNP, according to any one of claims 1 to 84, characterized in that 0 lipid-antibody conjugate is present in the LNP in a range of 0.001 to 0.5 mol%.

86. LNP, according to any one of claims 1 to 85, characterized by the presence of a lipid-antibody conjugate in the LNP in a range of 0.002 to 0.2 mol%.

87. LNP, according to any one of claims 1 to 86, characterized by further comprising one or more of a structural lipid, a neutral phospholipid and a free PEG-lipid.

88. LNP, according to claim 87, characterized in that the structural lipid is a sterol.

89. LNP, according to claim 88, characterized in that the sterol is cholesterol.

90. LNP, according to any one of claims 1 to 89, characterized in that the ionizable cationic lipid is present in the LNP in a range of 30-70 mol%.

91. LNP, according to any one of claims 1 to 90, characterized in that the ionizable cationic lipid is present in the LNP in a range of 40-60 mol%.

92. LNP, according to any one of claims 88 to 91, characterized in that the sterol is present in the LNP in a range of 20-70 mol%.

93. LNP, according to any one of claims 88 to 92, characterized in that the sterol is present in the LNP in a range of 30-50 mol%.

94. LNP, according to claim 87, characterized in that the neutral phospholipid is selected from the group consisting of phosphatidylcholine, phosphatidylethanolamine, distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and sphingomyelin.

95. LNP, according to any one of claims 87 and 94, characterized in that the neutral phospholipid is present in the LNP in a range of 5-15 mol%.

96. LNP, according to claim 87, characterized in Petition 870250067839, dated 01 / 08 / 2025, pp. 453 / 474 20 / 32, by the free PEG-lipid being selected from the group consisting of PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols and PEG-modified dialkylglycerols.

97. LNP, according to any one of claims 87 to 96, characterized in that the PEG-free lipid comprises PEG-dioleoylglycerol (PEG-DOG), PEG-dimyristoylglycerol (PEG-DMG), PEG-dipalmitoylglycerol (PEG-DPG), PEG-dilinoleoylglycerophosphatidylethanolamine (PEG-DLPE), PEG-dimyristoylphosphatidylethanolamine (PEG-DMPE), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), PEG-distearoylglycerol (PEG-DSG), N-palmitoylsphingosine-1-{succinyl[methoxy(polyethylene glycol)] (PEG-ceramide), PEG-distearoylglycerophosphoglycerol (PEGDSPG), PEG-dioleoylglycerophosphoethanolamine (PEG-DOPE), 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, PEG-distearoyl-phosphatidylethanolamine (PEG-DSPE) or a derivative thereof.

98. LNP, according to any one of claims 87, 96 and 97, characterized in that the free PEG-lipid comprises a diacylphosphatidylethanolamine comprising a dipalmitoyl (C16) chain or a distearoyl (C18) chain, and optionally the free PEG-lipid comprises PEG-DPG and PEG-DMG.

99. LNP, according to any one of claims 87 and 96 to 98, characterized in that the free PEG-lipid is present in the LNP in a range of 1 to 4 mol%.

100. LNP, according to any one of claims 87 and 96 to 99, characterized in that the PEG-free lipid comprises the same lipid or a different lipid from the lipid in the lipid-antibody conjugate.

101. LNP, according to any one of claims 87 and 96 to 100, characterized in that the free PEG-lipid comprises a PEG that has a molecular weight of at least 2000 daltons.

102. LNP, according to claim 92, characterized in that the PEG has a molecular weight of about 3,000 to 5,000 daltons.

103. LNP, according to any one of claims 1 to 102, characterized by having an average diameter in the range of 50 to 200 nm.

104. LNP, according to any one of claims 1 to 103, characterized by having an average diameter of about 100 nm.

105. LNP, according to any one of claims 1 to 104, characterized by having a polydispersity index in a range of 0.05 to 1.

106. LNP, according to any one of claims 1 to 105, characterized by having a zeta potential of about 10 mV to about 30 mV at pH 5.

107. LNP, according to any one of claims 1 to 105, characterized by having a zeta potential of about -30 mV to about 5 mV at pH 7.

4.

108. LNP, according to any one of claims 87 to 107, characterized by comprising: (a) an ionizable cationic lipid; (b) a lipid-antibody conjugate comprising the compound of the following formula: [Lipid] - [optional ligand] - [antibody], wherein the antibody binds to CD105 and / or CD117; (c) a sterol or other structural lipid; (d) a neutral phospholipid; (e) a polyethylene glycol (PEG)-free lipid; and (f) one or more nucleic acids.

109. Method for targeting the delivery of a nucleic acid to a hematopoietic stem cell (HSC), optionally ex Petition 870250067839, dated 01 / 08 / 2025, p. 455 / 474 22 / 32 vivo or in vivo in a subject, characterized by comprising administering to the subject the LNP, as defined in any one of claims 1 to 108, wherein the LNP comprises nucleic acid.

110. Method according to claim 109, characterized by further comprising administering to the subject an HSC-mobilizing agent and wherein the LNP is administered to the subject intravenously.

111. Method, according to claim 110, characterized in that the HSC mobilization agent is administered to the subject before, during, or before and during the administration of LNP.

112. Method according to any one of claims 110 to 111, characterized in that the HSC mobilization agent comprises plerixafor, granulocyte colony-stimulating factor (GCSF), granulocyte-macrophage colony-stimulating factor (GMCSF) or any combination thereof.

113. Method, according to any one of claims 110 to 112, characterized in that the HSC mobilization agent comprises plerixafor and G-CSF.

114. A method for genetically modifying a hematopoietic stem cell (HSC), optionally ex vivo or in vivo in a subject, characterized by comprising administering to the subject the LNP, as defined in any one of claims 1 to 108, wherein the one or more nucleic acids disposed in the LNP comprise an mRNA encoding a site-directed nuclease, a chemical base editor, a master editor, or an epigenome editor.

115. A method for treating a disease in a subject in need thereof, characterized by comprising administering to the subject LNP, as defined in any one of claims 1 to 108, wherein one or more nucleic acids disposed in the LNP comprise a sequence, optionally an mRNA, that encodes a site-directed nuclease, a chemical base editor, a master editor or an epigenome editor.

116. Method, according to any one of claims 114 to 115, characterized by further comprising administering to the subject an HSC-mobilizing agent and wherein the LNP is administered to the subject intravenously.

117. Method according to claim 116, characterized in that the HSC mobilization agent is administered to the subject before, during, or before and during the administration of LNP.

118. Method according to any one of claims 116 to 117, characterized in that the HSC mobilization agent comprises plerixafor, granulocyte colony-stimulating factor (GCSF), granulocyte-macrophage colony-stimulating factor (GMCSF) or any combination thereof.

119. Method, according to any one of claims 116 to 118, characterized in that the HSC mobilization agent comprises plerixafor and G-CSF.

120. Method, according to any one of claims 115 to 119, characterized in that the disease is a blood disease.

121. A method, according to any one of claims 115 to 119, characterized in that the disease is a hemoglobinopathy, a primary immunodeficiency (PID), a congenital cytopenia, a hemophilia, a thrombophilia, an inborn error of metabolism, a neuropathy, or a viral disease.

122. Method, according to claim 121, characterized in that the disease is an α-hemoglobinopathy or a β-hemoglobinopathy.

123. Method, according to any of claims 121 and 122, characterized in that β-hemoglobinopathy is β-thalassemia or sickle cell disease. Petition 870250067839, dated 01 / 08 / 2025, p. 457 / 474 24 / 32 124. A method according to any one of claims 121 to 123, characterized in that the administration of LNPs results in one or more of the following: (a) insertion of an HBB transgene or a fragment thereof into at least one HSC of the subject; (b) increased expression of β-globin in the subject; (c) an increased amount of adult hemoglobin (HbA) in the subject; (d) insertion of an HBG1 transgene or a fragment thereof into at least one HSC of the subject; (e) insertion of an HBG2 transgene or a fragment thereof into at least one HSC of the subject; (f) increased expression of γ-globin in the subject; (g) an increased amount of fetal hemoglobin (HbF) in the subject; (h) disruption of the HBA1 gene, the HBA2 gene, or a combination thereof in at least one HSC of the subject; (i) decreased expression of α-globin in the subject; and (j) a decreased amount of heterotetramers or aglobin in the subject.

125. Method according to claim 121, characterized in that the disease is a PID.

126. Method, according to claim 125, characterized in that the PID is a severe combined immunodeficiency (SCID), Wiskott-Aldrich syndrome, chronic granulomatous disease, X-linked polyendocrinopathy enteropathy (IPEX) immunoregulatory disorder, a hyper IgM syndrome or X-linked agammaglobulinemia.

127. Method according to claim 126, characterized in that the PID is a SCID.

128. Method according to claim 127, Petition 870250067839, dated 01 / 08 / 2025, p. 458 / 474 25 / 32 characterized by SCID being Artemis-SCID (ART-SCID), recombinant activator gene SCID (RAG-SCID), X-linked SCID (X-SCID), adenosine deaminase deficient SCID, interleukin 7 receptor deficient SCID or JAK3 SCID.

129. Method according to claim 128, characterized in that the SCID is ART-SCID, and wherein administration of the LNP results in the insertion of a DCLREIC transgene or a fragment thereof into at least one HSC of the subject; increased expression of functional Artemis protein in the subject; or a combination thereof.

130. Method according to claim 128, characterized in that the SCID is RAG-SCID, and wherein the administration of LNP results in the insertion of an RAG1 transgene or an RAG2 transgene or a fragment thereof, into at least one HSC of the subject; increased expression of functional RAG1 protein or RAG2 protein in the subject; or a combination thereof.

131. A method according to claim 128, characterized in that the SCID is X-SCID, and wherein administration of the LNP results in the insertion of an IL2RG transgene or a fragment thereof into at least one HSC of the subject; increased expression of functional IL2RG protein in the subject; or a combination thereof.

132. Method, according to any one of claims 125 and 126, characterized in that PID is Wiskott-Aldrich syndrome.

133. A method according to claim 132, characterized in that the PID is Wiskott-Aldrich syndrome, and wherein administration of LNP results in the insertion of an l / l / AS transgene or a fragment thereof into at least one HSC of the subject; increased expression of the functional expression of the WASP protein in the subject; or a combination thereof. Petition 870250067839, dated 01 / 08 / 2025, pp. 459 / 474 26 / 32 134. Method, according to any one of claims 125 and 126, characterized in that PID is chronic granulomatous disease.

135. Method, according to any one of claims 125, 126 and 134, characterized in that PID is X-linked chronic granulomatous disease.

136. A method according to any one of claims 125, 126, and 134, characterized in that PID is a chronic granulomatous disease, and in which administration of LNP results in one or more of the following: (a) insertion of a CYBA transgene, a CYBB transgene, an NCF1 transgene, an NCF2 transgene, or an NCF4 transgene, or a fragment thereof, into at least one HSC of the subject; (b) introduction of a point mutation at point 676C>T in the CYBB gene of at least one HSC in the subject; (c) increased expression of functional CYBA protein, CYBB protein, NCF1 protein, NCF2 protein, or NCF4 protein in the subject; and (d) an increased amount of functional NADPH oxidase enzyme complex in the subject.

137. Method, according to any one of claims 125 to 126, characterized in that the PID is IPEX.

138. A method according to any one of claims 125, 126 and 137, characterized in that the PID is IPEX, and in which the administration of the LNP results in the insertion of an FOXP3 transgene or a fragment thereof into at least one HSC of the subject; increased expression of functional FOXP3 protein in the subject; or a combination thereof.

139. Method, according to any of claims 125 and 126, characterized by PID being hyper IgM syndrome. Petition 870250067839, dated 01 / 08 / 2025, pp. 460 / 474 27 / 32 140. A method according to any one of claims 125, 126 and 139, characterized in that PID is hyper-IgM syndrome and in which administration of LNP results in one or more of the following: (a) insertion of an AICDA transgene, a UNG transgene, a CD40 transgene or a CD40LG transgene or a fragment thereof into at least one HSC of the subject; (b) increased expression of functional AICDA protein, UNG protein, CD40 protein or CD40LG protein in the subject; (c) a decreased amount of IgM antibodies in the subject; and (d) an increased amount of IgG, IgA or IgE antibodies in the subject.

141. Method, according to claim 121, characterized in that the disease is a congenital cytopenia.

142. Method according to claim 141, characterized in that the congenital cytopenia is Fanconia anemia, Shwachman-Diamond syndrome, Blackfan-Diamond anemia, congenital dyskeratosis, congenital amegakaryocytic thrombocytopenia or reticular dysgenesis.

143. A method according to any one of claims 141 to 142, characterized in that congenital cytopenia is Fanconia anemia, and in which administration of LNP results in the insertion of one or more FANC genes, or a fragment thereof, into at least one HSC in the subject; increased expression of one or more functional FANC proteins in the subject; or a combination thereof.

144. Method, according to any one of claims 141 to 143, characterized in that congenital cytopenia is Fanconia anemia, and in which the administration of an LNP insertion of a FANCA transgene or a fragment thereof into at least one HSC of the subject; increased expression of functional FANCA in the subject; or a combination thereof.

145. Method according to claim 121, characterized in that the disease is hemophilia.

146. Method according to claim 145, characterized in that the hemophilia is hemophilia A, hemophilia B or hemophilia C.

147. Method according to claim 121, characterized in that the disease is hemophilia and in which the administration of LNP results in: (a) insertion of an F8 transgene, an F9 transgene or an F11 transgene or a fragment thereof into at least one HSC of the subject; (b) increased expression of functional factor VIII protein, factor IX protein or factor XI protein in the subject; and (c) increased blood coagulation in the subject.

148. Method, according to claim 121, characterized in that the disease is a thrombophilia.

149. Method according to claim 148, characterized in that the thrombophilia is amegakaryocytic thrombocytopenia or factor X deficiency.

150. Method according to claim 121, characterized in that the disease is a thrombophilia, and in which the administration of LNP results in one or more of the following: (a) insertion of an F5 transgene, an F2 transgene, an antithrombin III encoding transgene, a protein C encoding transgene, or a protein S encoding transgene or a fragment thereof in at least one HSC of the subject; (b) increased expression of functional factor V protein, factor II protein, antithrombin III protein, protein C, or protein S in the subject; and (c) reduced blood coagulation in the subject. Petition 870250067839, dated 01 / 08 / 2025, pp. 462 / 474 29 / 32 151. Method according to claim 121, characterized in that the disease is an inborn error of metabolism.

152. Method according to claim 151, characterized in that the inborn error of metabolism is phenylketonuria (PKU), medium-chain acyl-CoA dehydrogenase (MCAD) deficiency, a lysosomal storage disease, a glycogen storage disorder, a peroxisomal disorder, Fabry disease, Gaucher disease, Hurler syndrome, Hunter syndrome, Wolman disease, or pyruvate kinase deficiency.

153. Method according to claim 152, characterized in that the peroxisomal disorder is X-linked adrenoleukodystrophy.

154. Method according to claim 152, characterized in that the lysosomal storage disease is metachromatic leukodystrophy, mucopolysaccharidosis I or mucopolysaccharidosis II.

155. Method, according to claim 121, characterized in that the disease is a neuropathy.

156. Method according to claim 155, characterized in that the neuropathy is Friedrich's ataxia.

157. Method according to claim 121, characterized in that the disease is a viral disease.

158. Method according to claim 157, characterized in that the viral disease is HIV / AIDS.

159. A method, according to any one of claims 157 and 158, characterized in that the viral disease is HIV / AIDS, and in which the administration of LNP prevents HIV infection, HIV / AIDS progression, or a combination thereof.

160. Method, according to any one of claims 109 to 159, characterized in that one or more nucleic acids arranged in the LNP comprise an mRNA encoding a site-directed nuclease. Petition 870250067839, dated 01 / 08 / 2025, pp. 463 / 474 30 / 32 161. Method according to claim 160, characterized in that the site-directed nuclease is a CRISPR-associated nuclease (Cas), a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a megaTAL.

162. Method, according to any one of claims 160 to 161, characterized in that the site-directed nuclease is a Cas, ZFN, TALEN or megaTAL nuclease comprising an amino acid sequence that confers binding to a target nucleotide sequence.

163. A method according to any one of claims 109 to 162, characterized in that one or more nucleic acids arranged in the LNP comprise: (a) an mRNA encoding a CRISPR-associated nuclease (Cas) or a chemical base editor; and (b) a guide RNA (gRNA) comprising a nucleotide sequence that confers binding to a target nucleotide sequence.

164. A method according to any one of claims 109 to 163, characterized in that one or more nucleic acids arranged in the LNP comprise: (a) an mRNA encoding a master editor; and (b) a master editor guide RNA (pegRNA) comprising a nucleotide sequence that confers binding to a target nucleotide sequence.

165. Method according to any one of claims 161 to 164, characterized in that the Cas nuclease is a Type II CAS enzyme or a Type V CAS enzyme or a variant thereof.

166. Method, according to any one of claims 161 to 165, characterized in that the Cas nuclease is a Cas9 enzyme, a Cas12 enzyme, a CasX enzyme or a Cas 14 enzyme or a variant thereof.

167. A method according to any one of claims 109 to 166, characterized in that the gRNA or pegRNA comprises a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence.

168. A method according to any one of claims 109 to 167, characterized in that one or more nucleic acids arranged in the LNP additionally comprise a donor template nucleic acid comprising a sequence that has at least 80% identity with at least 15 consecutive nucleotides of the target nucleotide sequence.

169. A method according to any one of claims 162 to 168, characterized in that the target nucleotide sequence comprises at least 15 consecutive nucleotides and is located within a) a coding region of a gene; b) an intronic region associated with a gene; c) an exonic region associated with a gene; d) a 5' untranslated region associated with a gene; or e) a 3' untranslated region associated with a gene; where the gene is selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, WAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, FOXP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III and protein C.

170. Method, according to any one of claims 162 to 169, characterized by the target nucleotide sequence Petition 870250067839, dated 01 / 08 / 2025, p. 465 / 474 32 / 32 to be within a regulatory region, optionally an enhancer region or a repressor region, of a gene selected from the group consisting of HBB, HBG1, HBG2, HBA1, HBA2, HBD, BCL11A, BACH2, KLF1, LRF, ADA, DCLREIC, IL2RG, RAG1, RAG2, JAK3, BTK, WAS, F8, F9, F11, F10, PKLR, RPS19, CYBA, CYBB, NCF1, NCF1B, NCF1C, NCF2, NCF4, ELANE, ABCD1, ARSA, FXN, GBA, IDS, IDUA, TCIRG, AICDA, UNG, CD40, CD40LG, F0XP3, IL4, IL10, IL13, IL7R, PRF1, FANCA, FANCB, FANCC, FANCD1 / BRACA2, FANCD2, MPL, CCR5, CXCR4, F5, F2, antithrombin III and protein C.

171. Method, according to any one of claims 162 to 170, characterized in that the target nucleotide sequence is within the BCL11A erythroid enhancer.

172. Method, according to any one of claims 109 to 171, characterized by the individual being a human being.

Images