Use of berberine hydrochloride in combination with stachydrine for modulating gut microbiota

Abstract

The application discloses a use of a pharmaceutical composition consisting of berberine hydrochloride and stachydrine in regulating intestinal flora of animals, and belongs to the technical field of medicines. The composition can selectively increase the number of a part of beneficial bacteria in the intestines of animals, and improve the structure of intestinal flora. In particular, the number of Akkermansia muciniphila in the intestines of animals can be significantly increased, and then the intestinal barrier function is improved through the regulating effect of intestinal flora, so that diseases such as obesity, diabetes, hyperlipidemia and the like are prevented or treated.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of medicine, and particularly relates to a method for improving intestinal flora structure and application thereof in preparation of medicines, health products and food. BACKGROUND

[0002] Stachyose (English name: stachyose, molecular formula C 24 H 42 O 21 ) is a natural functional oligosaccharide, can effectively proliferate beneficial bacteria (Bifidobacterium and Lactobacillus, etc.) in the human intestine, and has good physiological functions. In addition, stachyose is the highest content chemical component in fresh rehmannia (content up to 50%, dry basis), which is degraded during processing and preparation, thereby changing the drug properties.

[0003]

[0004] Berberine hydrochloride (i.e. Huanglian, English name: berberine, molecular formula C 20 H 18 ClNO4) is a commonly used antibacterial drug, which is clinically used for treating intestinal infections, such as gastrointestinal inflammation, etc., and also has reports for treating diabetes. Berberine hydrochloride is the main chemical component of traditional Chinese medicine Huanglian, and the content is about 9% (dry basis).

[0005]

[0006] We found in the previous study that stachyose in fresh rehmannia has certain effects of reducing blood sugar and reducing blood lipids, and has low cytotoxicity, and further found that the combination of stachyose and berberine hydrochloride has obvious effects of reducing blood sugar, reducing blood lipids, improving insulin resistance and improving related indicators of diabetic cardiomyopathy in ICR mice with high-fat diet and streptozotocin (STZ) induced diabetes model, and in most cases, the combination of the two is better than the single use. It is proposed to study the suitability of stachyose and berberine hydrochloride composition for type 2 diabetes and related heart complications, the raw materials used are abundant, the chemical structure is clear, and the problem of complex substances of traditional Chinese medicine compound is overcome, so as to become an innovative drug (patent publication number: 106176773A) through research and development in line with modern medical rules. The present application further found that the composition can regulate the intestinal flora of normal and high-fat diet plus STZ induced diabetic model mice, and increase the abundance of intestinal beneficial bacteria mucinophilic Akkermansia.

[0007] The vertebrate gut microbiota is one of the most complex ecosystems on Earth, containing over 100 trillion microbial cells—equivalent to 10 times the total number of human cells—and approximately 3 million metagenomic genomes, more than 100 times the number of genes in the human genome. The human gut microbiota is closely related to the host's health, and microorganisms have become an important component of human nutrition. Certain fermented foods containing large numbers of live bacteria, especially dairy products and fermented vegetables, are part of the daily diet of millions of people worldwide. The microbiota permanently residing in the human gut has a profound impact on human health, ranging from the digestive tract environment and digestive problems to issues like weight, hypertension, diabetes, hyperlipidemia, and cancer. Human life and health are inextricably linked to them; therefore, the human gut microbiota genome is often referred to as the second human genome. Different alterations in the gut microbiota spectrum can cause disease, as well as prevent and treat it.

[0008] Gut microbiota can be divided into mucus layer microbiota and intestinal lumen microbiota. While the composition of these two groups differs significantly, they both play crucial roles in nutrient exchange, information communication, immune system development, and resistance to pathogenic microorganisms. Microorganisms colonizing the gastrointestinal tract of mammals mainly belong to the phyla Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, and Verrucous Microbes. Akkermansia myxophilus, as a representative species of the Verrucous Microbe phylum, accounts for more than 80% of the total number of Verrucous Microbes. This bacterium colonizes the gastrointestinal mucus layer and is one of the most abundant species in the human gut microbiota, accounting for 1-4% of the total colonic bacteria. It has been a research hotspot in gut microbiota research in recent years, with numerous studies demonstrating a close relationship between this bacterium and host health.

[0009] Akkermansia myxophilus is closely associated with the development of various metabolic diseases, with its presence in obesity and type 2 diabetes (T2D) being the most extensively studied. Since its discovery, numerous studies have primarily linked the abundance of Akkermansia myxophilus to its beneficial effects on the body. No fewer than 25 studies have shown reduced levels of Akkermansia myxophilus in mouse models of obesity or other metabolic disorders induced by diet or genetic defects. Currently, Akkermansia myxophilus is widely considered a novel potential candidate for improving metabolic diseases such as obesity, diabetes, liver disease, and cardiometabolic disorders. Patent (Publication No. WO2014 / 076246) describes how repeated administration of Akkermansia myxophilus alone affects three potential functional impairments associated with obesity and related conditions: metabolic dysfunction, low-grade inflammation associated with elevated blood lipopolysaccharide (LPS) levels, and impaired intestinal barrier function.

[0010] During their research on the treatment of diabetes and its complications using a berberine and stachyose composition, the inventors discovered that this composition significantly increases the abundance of beneficial bacteria, Akkermansia myxophilus, in the gut. Therefore, this invention relates to the use of a berberine hydrochloride and stachyose composition in the prevention and treatment of obesity, type 2 diabetes, hyperlipidemia and / or type 2 diabetes complications, and other potential metabolic diseases by influencing gut microbiota. Summary of the Invention

[0011] The technical problem solved by this invention is to provide the application of a composition in the preparation of drugs or health products for regulating intestinal flora. The inventors' patent application (patent publication number: 106176773A) has already confirmed the improving effects of this composition on metabolism and cardiac complications in diabetic mice. Subsequent studies by the inventors found that after administration of a berberine hydrochloride and stachyose composition to normal and type 2 diabetic model mice, the intestinal flora structure of the mice changed. After administration, the ratio of the relative abundance of Bacteroidetes to Firmicutes increased, the alpha diversity index of the flora decreased, and the proportion of Verrucomicrobia in the total bacteria increased, with the most significant increase in the abundance of *Ackermania obliterans*, a representative species of Verrucomicrobia.

[0012] To solve the technical problem of this invention, the present invention provides the following technical solution:

[0013] The first aspect of the present invention provides the application of a composition in the preparation of drugs or health products for regulating intestinal flora, characterized in that the composition comprises two compounds, berberine hydrochloride and stachyose, the structural formulas of which are shown below.

[0014]

[0015] Preferably, the weight ratio of berberine hydrochloride to stachyose in the composition is 1:0.1 to 50. More preferably, the weight ratio of berberine hydrochloride to stachyose in the composition is 1:0.2 to 25. Most preferably, the weight ratio of berberine hydrochloride to stachyose in the composition is 1:1.

[0016] The composition's regulation of the intestinal flora refers to the adjustment of the proportions of Actinobacteria, Bacteroidetes, Firmicutes, Verrucomicrobia, and Proteobacteria in the total intestinal flora. Preferably, the composition increases the ratio of Bacteroidetes to Firmicutes. More preferably, the composition increases the proportion of Verrucomicrobia. More preferably, the composition increases the proportion of Akkermansia muciniphila in the intestine.

[0017] The second aspect of the present invention is to provide an application of a pharmaceutical composition in the preparation of drugs or health products for regulating intestinal flora, characterized in that the pharmaceutical composition comprises a composition of two compounds, berberine hydrochloride and stachyose, and a pharmaceutically acceptable carrier or excipient, wherein the structural formulas of berberine hydrochloride and stachyose are shown below.

[0018]

[0019] The pharmaceutical composition includes granules, capsules, tablets, oral liquids, pills, suspensions, drop pills, micro-pills, lozenges, orally disintegrating tablets, soft capsules, dispersible tablets, solutions, aerosols, or sprays.

[0020] The composition's regulation of the intestinal flora refers to the adjustment of the proportions of Actinobacteria, Bacteroidetes, Firmicutes, Verrucomicrobia, and Proteobacteria in the total intestinal flora. Preferably, the composition increases the ratio of Bacteroidetes to Firmicutes. Preferably, the composition increases the proportion of Verrucomicrobia. More preferably, the composition increases the proportion of Akkermansia muciniphila in the intestine.

[0021] In one embodiment of the invention, the composition is administered orally.

[0022] In the first and second aspects of the technical solution of the present invention, the weight ratio of berberine hydrochloride and stachyose in the composition is 1:0.1 to 50, preferably 1:0.2 to 25, and most preferably 1:1.

[0023] In the first and second aspects of the technical solution of the present invention, the dosage of the composition is 5 mg / kg to 320 mg / kg each of berberine hydrochloride and stachyose, preferably 40 mg / kg to 160 mg / kg each of berberine hydrochloride and stachyose, and more preferably 80 mg / kg each of berberine hydrochloride and stachyose. The dosage of berberine hydrochloride alone is 5 mg / kg to 320 mg / kg, preferably 40 mg / kg to 160 mg / kg, and more preferably 80 mg / kg. The dosage of stachyose alone is 5 mg / kg to 320 mg / kg, preferably 40 mg / kg to 160 mg / kg, and more preferably 80 mg / kg. Attached Figure Description

[0024] Figure 1 Principal component analysis diagram of gut microbiota, showing the effect of administration of berberine hydrochloride and stachyose combination on the gut microbiota structure of normal and diabetic mice.

[0025] Figure 2 Effects of berberine hydrochloride and stachyose combination on the Shannon index, a related index of intestinal flora alpha diversity, in normal and diabetic mice.

[0026] Figure 3 Effects of berberine hydrochloride and stachyose combination on the Simpson index, a related index of gut microbiota alpha diversity, in normal and diabetic mice.

[0027] Figure 4 Effects of berberine hydrochloride and stachyose combination on the Chau index, a related index of intestinal flora alpha diversity, in normal and diabetic mice.

[0028] Figure 5 The effect of administration of a berberine hydrochloride and stachyose combination on the relative abundance ratio of Bacteroidetes and Firmicutes in the gut microbiota of normal and diabetic mice. Bacteroidetes are representative of beneficial gut bacteria, while Firmicutes are representative of harmful gut bacteria. A higher ratio indicates a healthier gut microbiota.

[0029] Figure 6 The changes in the relative abundance of each bacterial group at the phylum level in the intestinal flora of normal and diabetic mice after administration of the berberine hydrochloride and stachyose combination were observed, with the most significant increase in the Verrucous microbe (marked with a black box).

[0030] Figure 7Administration of berberine hydrochloride and stachyose combination significantly increased the relative abundance of Akkermansia myxophilus in the intestines of normal and diabetic mice. The darker the color in the figure, the higher the relative abundance.

[0031] Figure 8 The absolute number of Akkermansia myxophilus bacteria per gram of feces was detected by real-time quantitative PCR in normal and diabetic mice after administration of a combination of berberine hydrochloride and stachyose.

[0032] Figure 9 The relationship between different dosages of berberine hydrochloride and stachyose and the number of Akkermansia muciniphila in the feces of normal mice.

[0033] Figure 10 Principal component analysis diagram of gut microbiota: Effects of berberine hydrochloride and stachyose, alone and in combination, on the gut microbiota structure of diabetic mice.

[0034] Figure 11 Effects of berberine hydrochloride and stachyose, alone and in combination, on the Shannon index, a related index of gut microbiota diversity in diabetic mice.

[0035] Figure 12 The effects of berberine hydrochloride and stachyose, alone and in combination, on the species index of the gut microbiota alpha diversity-related index in diabetic mice were observed.

[0036] Figure 13 Effects of berberine hydrochloride and stachyose, alone and in combination, on the Chau index, a correlation index related to the alpha diversity of gut microbiota in diabetic mice.

[0037] Figure 14 Effects of berberine hydrochloride and stachyose, alone and in combination, on the relative abundance ratio of Bacteroidetes to Chlamydia in the gut microbiota of diabetic mice.

[0038] Figure 15 The changes in the relative abundance of each bacterial group at the phylum level in the gut microbiota of diabetic mice after administration of berberine hydrochloride and stachyose alone and in combination were observed, with the most significant increase observed in the phylum Verrucomicrobia (marked with a black box).

[0039] Figure 16 The effects of berberine hydrochloride and stachyose on the relative abundance of various gut microbiota at the genus level in diabetic mice showed that Akkermansia myxophilus (marked with a black box) increased most significantly.

[0040] Figure 17 The absolute number of Akkermansia myxophilus bacteria per gram of feces was detected by real-time quantitative PCR after administration of berberine hydrochloride and stachyose alone and in combination to diabetic mice.

[0041] Figure 18 Typical H&E staining images of mouse colon tissue after administration of berberine hydrochloride and stachyose alone and in combination.

[0042] Figure 19 Changes in mucus layer thickness in mouse colon tissue and typical images after administration of berberine hydrochloride and stachyose alone and in combination. Detailed Implementation

[0043] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0044] In the following examples, berberine hydrochloride and stachyose were artificially extracted from Coptis chinensis and Rehmannia glutinosa, respectively.

[0045] The room temperature mentioned in the following examples is as is commonly known in the art, generally referring to 15–25°C.

[0046] Example 1: Effects of berberine hydrochloride and stachyose combination on gut microbiota in normal and diabetic mice (1) Model preparation, experimental grouping and administration regimen

[0047] SPF-grade male ICR mice (3-4 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and housed at the Laboratory Animal Center of the Institute of Materia Medica, Chinese Academy of Medical Sciences, under constant temperature and humidity, with free access to food. After one week of acclimatization, the mice were randomly divided into four groups according to sex and weight: ① normal group (n=10), ② normal diet group (n=10), ③ diabetic group (n=10), and ④ diabetic diet group (n=10). The specific modeling protocol was as follows: ICR mice were fed a high-fat, high-sugar diet (containing 35% fat, 18% protein, and 47% carbohydrates) for 4 weeks, followed by intraperitoneal injection of streptozotocin (STZ) 100 mg / kg (dissolved in 0.1 M citrate buffer, pH 4.5), while continuing to be fed the high-fat, high-sugar diet; the control and normal diet groups were intraperitoneally injected with 0.1 M citrate buffer. After 8 weeks, blood glucose (BG) was measured by tail vein sampling. Mice treated with high-fat + STZ were randomly divided into a model group and a model drug treatment group based on their blood glucose level >11.1 mM, and were continuously fed a high-fat, high-sugar diet. The control group and the normal drug treatment group were continuously fed a basal diet until the end of the experiment. After 12 weeks, the normal drug treatment group and the model drug treatment group were given a combination of berberine hydrochloride and stachyose by gavage.

[0048] The maximum dosage for each treatment group was determined with reference to commonly used clinical and daily health care dosages, as follows: Berberine hydrochloride (1.2 g / day for adults, equivalent to an adult dose of 18 mg / kg, which is then converted to a maximum dosage of 200 mg / kg for mice). Stachyose (6 g / day for adult health care, equivalent to an adult dose of 85 mg / kg, which is then converted to a maximum dosage of 1000 mg / kg for mice). Based on the previous patent application filed by the inventor (patent publication number 106176773A), the weight ratio of berberine and stachyose was determined to be 1:1, and the final dosage of the composition was determined to be 167 mg / kg each of berberine hydrochloride and stachyose.

[0049] The specific administration regimen was as follows: berberine hydrochloride and stachyose, 167 mg / kg each, were dissolved in pure water and administered by gavage once daily; the control and model groups were given the control solvent water and administered by gavage once daily. All mice were continuously administered the drugs for 8 weeks.

[0050] (2) Detection of relative abundance of intestinal flora in mice

[0051] Four mouse fecal samples were randomly selected from each group. DNA was first extracted from the samples, and the V3–V5 region of 16S rDNA was amplified by PCR. Then, the 545 platform was used for sequencing, with the sequencing direction from V5 to V3, and a read length of 300 EP. 16S analysis was mainly performed using Mothur software (http: / / www.mothur.org / wiki / Mothur_manual), including quality control, OTU clustering, annotation, and other analyses. Based on the completed species classification, the relative abundance of each species was analyzed.

[0052] (3) Detection of absolute amount of Akkermansia mycophila in mouse feces

[0053] Collect colonic feces from mice and determine the absolute amount of Akkermansia myxophilus per gram of feces according to the following method. Analyze the effect of the composition on the absolute amount of Akkermansia myxophilus in the intestines of normal and diabetic mice.

[0054] 1) DNA extraction from fecal samples: Genomic DNA was extracted from freshly collected mouse fecal samples or fecal samples immediately stored at -80°C using the Tiangen Fecal Genome Extraction Kit (catalog number DP328) according to the manufacturer's instructions. 2) qPCR detection: Primers used to detect *Ackermania pseudomallei* were based on the 16S rRNA gene sequence: F-5'CCTTGCGGTTGGCTTCAGAT3', R-5'CAGCACGTGAAGGTGGGGAC3'. Detection was performed using an ABI 7500 Fast real-time PCR system with the FastStart Universal SYBR Green Master (Roche) according to the manufacturer's instructions. Triple assays were performed in each round. The cycle threshold for each sample was then compared with a standard curve (repeated three times) obtained by diluting standard genomic DNA (5-fold serial dilution) (DSMZ, Germany). Data were expressed as the logarithm of bacterial count / gram of cecal contents (Log10).

[0055] (4) Data processing and statistical methods

[0056] Experimental data are expressed as mean ± standard error (mean ± SEM). One-way ANOVA was performed on the results using SPSS 17.0 software. p < 0.05 indicates a significant difference.

[0057] (5) Experimental Results

[0058] Principal component analysis (PCA) showed that the gut microbiota structure of diabetic mice was significantly altered compared to normal mice, and administration of the composition affected the gut microbiota structure of both normal and diabetic mice. Figure 1 ); reduce the alpha diversity index of the microbial community, including the Shannon index ( Figure 2 Table 1), Simpson Index ( Figure 3 (Table 1) and the Euro index ( Figure 4 (Table 1); It can significantly increase the ratio of Bacteroides to Firmicutes in the diabetic group (Bacteroides represents beneficial intestinal bacteria, while Firmicutes represents harmful intestinal bacteria; a higher ratio indicates a healthier intestinal flora). Figure 5 (Table 2). Furthermore, the relative abundance of Verrucous microbes significantly increased after administration of the composition ( Figure 6 (Table 2) Akkermansia myxophilus, as the only representative of enteric bacteria in the Verrucous phylum, showed the most significant increase in abundance after drug administration. Figure 7 (Table 3). Furthermore, after administration of the composition, the absolute number of Akkermansia myxophilus bacteria per gram of feces significantly increased, and the increase was even more significant in diabetic model mice compared to normal mice, exceeding 3000-fold compared to the model group.Figure 8 (Table 4).

[0059] Table 1. Effects of the composition on the alpha diversity index of gut microbiota in normal and diabetic mice

[0060]

[0061] Table 2. Effects of the composition on the abundance of Bacteroidetes, Firmicutes, and Verruciformis in the gut of normal and diabetic mice

[0062]

[0063] Table 3. Effects of the composition on the relative abundance of Akkermansia myxophila in the intestines of normal and diabetic mice.

[0064]

[0065] Table 4. Effects of the composition on the absolute number of Akkermansia myxophilus per gram of feces in normal and diabetic mice

[0066]

[0067] Example 2: Effects of different dosages of berberine hydrochloride and stachyose on the absolute amount of Akkermansia muciniphila in the intestines of normal mice

[0068] (1) Experimental scheme

[0069] SPF-grade ICR mice (male, 3-4 weeks old) were randomly divided into 8 groups of 5 mice each according to sex and weight. The composition was administered by gavage to each group at doses of 0, 5, 10, 20, 40, 80, 160, and 320 mg / kg. The control group, which received a dose of 0, was given the same volume of control solvent water. After two weeks of continuous gavage administration of the composition, fresh feces were collected from the mice, and the absolute amount of Akkermansia myxophilus per gram of feces was determined according to the method described in Example 1.

[0070] (2) Experimental Results

[0071] The abundance of Akkermansia myxophilus in the intestine increased with increasing dosage, reaching a peak at a dosage of 80 mg / kg. Subsequent increases in dosage did not significantly increase the abundance of Akkermansia myxophilus. Figure 9 (Table 5).

[0072] Table 5. Effects of different dosages of the composition on the absolute number of Akkermansia myxophilus per gram of feces in normal mice

[0073]

[0074] Example 3: Effects of berberine hydrochloride and stachyose alone and in combination on the gut microbiota of diabetic mice (1) Model preparation, experimental grouping and administration regimen

[0075] SPF-grade male ICR mice (3-4 weeks old) were randomly divided into four groups according to sex and weight: ① normal group (n=10), ② diabetic group (n=10), ③ diabetic group given berberine (n=10), ④ diabetic group given stachyose (n=10), and ⑤ diabetic group given a combination of drugs (n=10). The rearing environment, conditions, and modeling methods were the same as in Example 1. The normal group was fed a basal diet until the end of the experiment, while the diabetic mice were fed a high-fat diet until the end of the experiment. The diabetic groups given berberine hydrochloride, stachyose, and the combination of drugs were administered via gavage after 12 weeks. The berberine group received 80 mg / kg of berberine hydrochloride, the stachyose group received 80 mg / kg of stachyose, and the combination of drugs received 80 mg / kg each of berberine hydrochloride and stachyose. The compounds were dissolved in pure water and administered once daily for 12 weeks. The model group received water as a control.

[0076] (2) Method for detecting the relative abundance of gut microbiota: Same as in Example 1

[0077] (3) Effects of berberine hydrochloride and stachyose alone and in combination on the absolute amount of Akkermansia muciniphila in mouse colon.

[0078] Mouse colonic feces were collected, and the absolute amount of Akkermansia myxophilus per gram of feces was determined according to the method described in Example 2. The effects of single and combined administration of the compound on its absolute amount were statistically analyzed.

[0079] (4) Data processing and statistical methods: Same as in Example 1

[0080] (5) Experimental Results

[0081] Microbial community structure analysis showed that both single and combined administration of berberine hydrochloride and stachyose affected the microbial community structure of diabetic mice, but the effects of berberine hydrochloride and the combination were stronger, resulting in a larger difference in microbial community structure compared to the diabetic group. The microbial community structure of the stachyose-only group was more similar to that of the diabetic model group. Figure 10 Both berberine hydrochloride and its combination can reduce the alpha diversity index of the bacterial community, including the Shannon index. Figure 11 Table 6), Observable Species Index ( Figure 12 (Table 6) and the Euro index ( Figure 13 (Table 6). Both the combination therapy group and the stachyose therapy group significantly increased the ratio of Bacteroidetes to Firmicutes in the bacterial community. Figure 14 (Table 7) suggests that stachyose can promote a healthier gut microbiota. The relative abundance of Verrucous microbes was significantly increased in both the combined treatment group and the berberine hydrochloride-only group.Figure 15 (Table 7) The relative abundance of the genus *Ackermannia* also increased significantly. Figure 16 (Table 8). Real-time quantitative PCR results also showed that the absolute content of Akkermansia myxophilus in mouse feces was significantly increased in both the combination group and the berberine hydrochloride group after administration (Table 8). Figure 17 Table 9 shows that the main component in the composition that regulates the abundance of this bacterium is berberine hydrochloride.

[0082] Table 6. Changes in the alpha diversity index of gut microbiota after administration of berberine hydrochloride and stachyose alone and in combination.

[0083]

[0084] Table 7. Relative abundance of Bacteroidetes, Firmicutes, and Verrucous phyla in the gut after administration of berberine hydrochloride and stachyose alone and in combination.

[0085]

[0086] Table 8. Changes in the relative abundance of Akkermansia mycotoxin-loving bacteria in the intestinal flora after administration of berberine hydrochloride and stachyose alone and in combination.

[0087]

[0088] Table 9. Effects of berberine hydrochloride and stachyose, alone and in combination, on the absolute number of Akkermansia myxophilus bacteria per gram of feces in diabetic mice.

[0089]

[0090] Example 4. Effects of berberine hydrochloride and stachyose alone and in combination on the pathological structure of colon tissue in diabetic mice (1) H&E staining of colon tissue

[0091] In Example 3, mouse colon tissue was used for hematoxylin and eosin staining (H&E staining). The specific procedures included: fixing the colon tissue with a fixative (4% paraformaldehyde), embedding it in paraffin, dewaxing the sections with xylene, passing them through a gradient of alcohols to an aqueous solution, staining with hematoxylin aqueous solution for several minutes, differentiating with 1% hydrochloric acid alcohol, rinsing with running water, and staining with alcohol-eosin staining solution for 2-3 minutes. The stained sections were routinely dehydrated and mounted with clear neutral resin. The stained sections were then subjected to panoramic scanning (3D Histech, Pannoramic SCAN) to statistically analyze the changes in the pathological structure of mouse colon tissue caused by the single and combined administration of the compounds.

[0092] (2) Experimental Results

[0093] Compared with the normal group, the intestinal structure of high-fat diet and STZ-induced diabetic mice showed an increased number of inflammatory cells in the lamina propria, altered epithelial structure, and some crypt structures exhibiting irregular morphology. Administration of the combined treatment significantly reduced the number of inflammatory cells in the lamina propria, improved the integrity of the crypt structure, and ensured that goblet cells were normally distributed. Stachyose alone improved crypt structure to some extent, but had no significant effect on inflammatory cell infiltration in the lamina propria. Berberine hydrochloride alone had no significant protective effect on intestinal structure and even exacerbated inflammatory cell infiltration in the lamina propria to some extent. Figure 18 ).

[0094] Example 5. Effects of berberine hydrochloride and stachyose alone and in combination on the thickness of colonic mucus layer in diabetic mice (1) Alcian blue staining of colonic tissue

[0095] In Example 3, mouse colon tissue containing feces was stained with Alcian blue. The specific procedure included: fixing the colon tissue with Carnoy's fixative (ethanol: glacial acetic acid: chloroform = 6:1:3), dehydrating and embedding in paraffin, sectioning, dewaxing with xylene, passing through a gradient of alcohols to aqueous solution, staining with Alcian blue (pH 2.5) for 30 min, rinsing briefly with running water, counterstaining with nuclear solid red for 5-10 min, rinsing briefly with water, dehydrating routinely, and mounting with clear neutral resin. The stained sections were then subjected to panoramic scanning to statistically analyze the changes in colonic mucus layer thickness in mice, both alone and in combination.

[0096] (2) Experimental Results

[0097] Compared with normal mice, mice induced by a high-fat diet and STZ showed a significant decrease in colonic mucus thickness. Berberine alone had no significant effect on mucus thickness, while stachyose and the combined treatment significantly increased colonic mucus thickness, with the combined treatment showing a more significant increase. Figure 19 (Table 10).

[0098] Table 10. Effects of berberine hydrochloride and stachyose, alone and in combination, on colonic mucus layer thickness in diabetic mice.

[0099]

Claims

1. The use of a composition in the preparation of a drug for regulating intestinal flora, characterized in that, The composition comprises berberine hydrochloride and stachyose in a weight ratio of 1:

1. The structural formulas of berberine hydrochloride and stachyose are shown below. The composition regulates the intestinal flora by adjusting the proportions of Bacteroidetes, Firmicutes, and Verrucomicrobia in the total intestinal flora; the composition increases the proportion of Verrucomicrobia in the total intestinal flora.

2. The use of a pharmaceutical composition in the preparation of a drug for regulating intestinal flora, characterized in that, The pharmaceutical composition comprises the following components: berberine hydrochloride and stachyose in a weight ratio of 1:1, and a pharmaceutically acceptable carrier or excipient; the structural formulas of berberine hydrochloride and stachyose are shown below. The regulation of the intestinal flora by the pharmaceutical composition refers to the regulation of the proportion of Bacteroidetes, Firmicutes, and Verrucomicrobia in the total intestinal flora; the composition increases the proportion of Verrucomicrobia in the total intestinal flora.

3. The application according to claim 1 or 2, characterized in that, The increase in the proportion of Verrucous microbes in the total intestinal flora refers to the increase in the proportion of Akkermansia muciniphila in the total intestinal flora.

4. The application according to claim 1 or 2, characterized in that, This composition increases the ratio of Bacteroidetes to Firmicutes.

5. The application according to claim 2, characterized in that, The dosage form of the pharmaceutical composition is granules, capsules, tablets, solutions, pills, suspensions, aerosols, or sprays.

6. The application according to claim 5, characterized in that, The pills are drop pills, micro-pills, or capsules; the tablets are lozenges, disintegrating tablets, or dispersible tablets; the capsules are soft capsules; and the solutions are oral liquids.

Images