3'3'-cyclic dinucleotide

Abstract

The present invention relates to a 3'3'-cyclic dinucleotide (I) modified by a 3'-phosphonoalkyl bond and its derivatives or pharmaceutically acceptable salts thereof, which can regulate the activity of the STING adaptor protein, wherein L 1 For ‑O‑ or ‑K‑C(R 6 R 7 )‑L 2 K-C(R 6 R 7 )‑.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 62 / 654,058, filed on April 6, 2018, which is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing submitted electronically in ASCII format, the entire contents of which are incorporated herein by reference. The ASCII copy was created on January 23, 2019, with a file name of 052838_541001US_ST25.txt and a file size of 6914 bytes. Technical Field

[0005] The present invention relates to novel 3'3'-cyclic dinucleotides, such as 3'3'-cyclic dinucleotides modified with 3'-phosphonoalkyl substituents, and derivatives thereof. Such 3'3'-cyclic dinucleotides modulate the activity of the STING adaptor protein (stimulator of interferon genes). Therefore, it is believed that the 3'3'-cyclic dinucleotides of the present invention are useful for treating diseases in which modulation of the STING adaptor protein is beneficial, such as inflammation, allergic and autoimmune diseases, cancer, viral infections caused by viruses such as hepatitis B and human immunodeficiency virus, and are useful in immunogenic compositions or vaccine adjuvants. Background Art

[0006] The innate immune system recognizes the presence of pathogens or the destruction of the host's homeostasis through a series of pattern recognition receptors (PRRs), which detect small ligand sets associated with pathogens or damage. These ligands are generally referred to as pathogen-associated molecular patterns (PAMPs) or damage-associated molecular patterns (DAMPs) (Takeuchi O et al., Cell, 2010: 140, 805-820). In the past two decades, a variety of PRRs have been identified, including Toll-like receptors, retinoic acid-inducible gene (RIG-I)-like receptors, nucleotide-binding oligomerization domain-like (NOD) receptors, C-type lectin receptors, and cytoplasmic DNA sensors (Brubaker SW et al., Annu Rev Immunol, 2015: 33, 257-290). PRR recognition of PAMPs and DAMPs ultimately causes the upregulation of cytokines and chemokines (including interferons), and immune cells are recruited to the site of infection. All of these processes slow down pathogen replication and promote the generation of adaptive immunity.

[0007] Cellular DNA is usually confined to the nucleus and mitochondria of healthy cells. Therefore, DNA present in the cytosol represents a signal indicating the presence of pathogens or disruption of homeostasis in the host. Sensing of exogenous DNA is initiated by several DNA sensors, such as DNA-dependent activator (DAI) of IRF or DEAD box polypeptide 41 (DDX41). These DNA sensors trigger the activation of transcription factors NF-κB (nuclear factor κB) and IRF-3 (interferon-regulated primer 3) by recruiting protein kinase TBK1, which triggers the activation of transcription factors NF-κB (nuclear factor κB) and IRF-3 (interferon-regulated primer 3), and signal transduction via STING adapter protein (interferon gene stimulator, also known as STING, STING protein, TMEM173, MITA or ERIS) (Unterholzner L, Immunology, 2013: 218, 1312-1321). Activation of the STING adaptor protein is believed to ultimately lead to the release of type I and type III interferons, as well as a variety of cytokines and chemokines such as interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), and interferon-γ (INF-γ).

[0008] Alternatively, the STING protein can be activated by second messenger cyclic dinucleotides (CDNs) (Burdette et al., Nature 2011: 478, 515-518). CDNs with affinity for STING contain two purine nucleotide monophosphates linked to two 3′-5′ (3′3′-CDN), two 2′-5′ (2′2′-CDN), or 2′-5′ and 3′-5′ phosphodiester bonds (3′3′-CDN). The prototype 2′3′-cGAMP (c[G(2′,5′)pA(3′,5′)p]) is the product of the activation of the host cGAS protein in the presence of pathogens or self-dsDNA (Zhang et al., Molecular Cell 2013: 51, 226-235).

[0009] Type I interferon (IFN) is an immunomodulatory cytokine that plays a key role in viral immunity. It can induce maturation and activation of dendritic cells (DC) and macrophages (Galluci et al., Nat Med, 1999: 5, 1249-1255) and promote T cell and B cell survival, activation and differentiation. In addition, interferon can activate a large number of intracellular pathways that inhibit viral replication. The clinical utility of type I interferon has been demonstrated by its effectiveness in treating chronic hepatitis B and C (Lin and Young, Cytokine Growth Factor Rev, 2014: 25, 369-376).

[0010] In addition, interferon has shown efficacy in the treatment of human cancer (Cohen et al., N Engl J Med, 2005: 353, 2477-2490, Tsao et al., N Engl J Med, 2004: 351, 998-1012). It can inhibit tumor cell proliferation and can synergize with many approved anticancer agents. In addition, type I IFN can act on immune cells to induce anti-tumor responses (Musella et al., Oncoimmunology 2017: 6: e1314424). It has been shown that type I IFN signaling is crucial in tumor-initiating T cell activation in mice. Animals lacking IFN-α / β receptors in dendritic cells are unable to suppress immunogenic tumors and are defective in cross-presenting antigens to CD8+ T cells (Fuertes et al., J Exp Med, 2011: 208, 2005-2016, Diamond et al., J Exp Med, 2011: 208: 1989-2003). Consistent with these observations, intratumoral injection of STING agonists has recently been shown to induce regression of established tumors in mice and generate substantial systemic immune responses that are able to suppress distant cancer metastasis and provide immunological memory for long-term survival (Corrales et al., Cell Rep, 2015: 11, 1018-1030).

[0011] It is believed that CDN can promote the activation of cellular and humoral immunity. For example, CDN has been shown to be an effective adjuvant in animal models (Dubensky et al., Ther Adv Vaccines, 2013: 1, 131-143).

[0012] Patent publications WO 2014 / 093936, WO 2014 / 189805, WO 2013 / 185052, US 2014 / 03441976, WO 2015 / 077354, WO 2015 / 185565, WO 2016 / 145102, WO 2017 / 093933、WO 2017 / 027646、WO 2017 / 027645、WO 2017 / 175156、WO 2017 / 175147、WO 2017 / 123657、WO 2018 / 013908、WO 2018 / 013887, WO2018 / 009652, WO 2018 / 009648 and WO 2018 / 009466 discloses certain CDNs and their use in inducing immune responses.

[0013] The object of the present invention is to describe novel 3'3'-cyclic phosphonate dinucleotides and derivatives thereof, which bind and activate the STING adaptor protein and thereby stimulate signal transduction pathways for the induction of interferons and other cytokines / chemokines. The advantages over previously disclosed CDNs are believed to arise from the replacement of the phosphate bond with a phosphonoalkyl bond, which is resistant to hydrolysis by phosphodiesterases present in tissues and body fluids. Such compounds may be useful as antiviral or anticancer agents, as vaccine adjuvants or for the treatment of allergic or other inflammatory diseases. Summary of the invention

[0014] In one embodiment, the present invention provides a structure according to formula (I):

[0015]

[0016] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof,

[0017] in

[0018] L 1 -O- or -KC(R 6 R 7 )-;

[0019] L 2 -KC(R 6 R 7 )-;

[0020] Y 1 and Y 2 Each is independently -O-, -S- or -CH2-;

[0021] X 1 and X 3 Each independently represents OH, SH, OR 13 , SR 13 or N(R 13 )2;

[0022] X 2 and X 4 Each independently is O or S;

[0023] R 1 , R 5 , R 8 and R 12 Each independently represents H, CH2F, CHF2, CF3, CN, N3, F, Cl, Br, I, COOR 13 、CON(R 13)2, CH2OH, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, OR 13 , SR 13 or N(R 13 )2;

[0024] R 2 , R 3 , R 4 , R 9 , R 10 and R 11 Each independently represents H, OH, F, Cl, Br, I, CN, N3, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, OR 13 , SR 13 or N(R 13 )2;

[0025] R 6 and R 7 Each independently represents H, CH2F, CHF2, CF3, CN, N3, F, Cl, Br, I, COOR 13 、CON(R 13 )2, CH2OH, CH2N3, OR 13 , SR 13 、N(R 13 )2, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C2-C 10 Substituted heterocycloalkyl, C6-C 10 Aryl, C6-C 10 Substituted aryl, C2-C 10 Heteroaryl or C2-C 10 substituted heteroaryl;

[0026] Each R 13 are independently H, -C(=Z)R 14 、-C(=Z)OR 14 、-C(=Z)SR 14 、-C(=Z)N(R 14 )2, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C2-C10 Substituted heterocycloalkyl, C6-C 10 Aryl, C6-C 10 Substituted aryl, C2-C 10 Heteroaryl or C2-C 10 substituted heteroaryl;

[0027] Each R 14 are independently H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C2-C 10 Substituted heterocycloalkyl, C6-C 10 Aryl, C6-C 10 Substituted aryl, C2-C 10 Heteroaryl or C2-C 10 substituted heteroaryl;

[0028] Each Z is independently O, S or NR 13 ;

[0029] K represents -O-, -S-, -S(O)-, -S(O)2-, -NH- or -NR 13 - variables;

[0030] Base 1 and bases 2 Each independently is:

[0031]

[0032] in

[0033] A. A 1 , A 2 , A 3 and A 4 Each independently represents H, OH, SH, F, Cl, Br, I, NH2, OR 13 , SR 13 、NHR 13 、N(R 13 )2 or R 14 ;and

[0034] Among them, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, C2-C 10 Substituted heterocycloalkyl, C6-C 10 Substituted aryl or C2-C 10The substituted heteroaryl is substituted with 1, 2, 3 or 4 substituents independently selected from the group consisting of: -OH, -SH, -NH2, =O, =NH, =S, ≡N, halogen, -N3, C 1-6 Alkyl, C 1-6 Alkoxy, -CN and -COOR p , where R p is hydrogen or C1 to C6 alkyl.

[0035] The present invention includes a pharmaceutical composition comprising a cyclic dinucleotide of formula (I) or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, excipient and / or diluent.

[0036] Also provided is a method for treating a disease or condition, for example, a method for treating or preventing a viral infection, a hepatitis B virus infection, an HIV infection, a hyperproliferative disease or a cancer, comprising administering to a human or animal in need thereof a therapeutically effective amount of a cyclic dinucleotide of formula (I) or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof, or a pharmaceutical composition of any of the foregoing.

[0037] Further provided is a method for enhancing vaccine efficacy, comprising administering a therapeutically effective amount of a cyclic dinucleotide of formula (I) or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof, or a pharmaceutical composition of any of the foregoing.

[0038] Further provided is a method of modulating the activity of a STING adaptor protein to induce the production of type I interferons, cytokines and / or chemokines that are dependent on the STING adaptor protein (e.g., inducing STING adaptor protein-dependent type I interferons, cytokines or chemokines in humans or animals), comprising administering a therapeutically effective amount of a cyclic dinucleotide of formula (I) or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof, or a pharmaceutical composition of any of the foregoing. DETAILED DESCRIPTION

[0039] I. Overview

[0040] The present invention provides novel cyclic dinucleotides, for example comprising at least one phosphonoalkyl group, which bind to the STING protein and modulate its activity, for example, activate the STING protein.

[0041] II. Definitions

[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. A dash at the beginning or end of a chemical group is used for convenience to indicate the point of attachment to the parent group; a chemical group may be depicted with or without one or more dashes without losing its general meaning. Prefixes such as "C u-v ” or “C u -C v " indicates that the subsequent group has u to v carbon atoms, where u and v are integers. For example, "C 1-6 "Alkyl" or "C1-C6 alkyl" indicates that the alkyl group has 1 to 6 carbon atoms.

[0043] "Alkyl" is a straight or branched chain saturated monovalent hydrocarbon. For example, an alkyl group may have 1 to 10 carbon atoms (i.e., C 1-10 alkyl), or 1 to 8 carbon atoms (i.e. C 1-8 alkyl), or 1 to 6 carbon atoms (i.e. C 1-6 alkyl), or 1 to 4 carbon atoms (i.e. C 1-4Examples of alkyl groups include, but are not limited to, methyl (Me, -CH3), ethyl (Et, -CH2CH3), 1-propyl (n-Pr, n-propyl, -CH2CH2CH3), 2-propyl (i-Pr, isopropyl, -CH(CH3)2), 1-butyl (n-Bu, n-butyl, -CH2CH2CH2CH3), 2-methyl-1-propyl (i-Bu, isobutyl, -CH2CH(CH3)2), 2-butyl (s-Bu, sec-butyl, -CH(CH3)2), )CH2CH3), 2-methyl-2-propyl (t-Bu, tert-butyl, -C(CH3)3), 1-pentyl (n-pentyl, -CH2CH2CH2CH2CH3), 2-pentyl (-CH(CH3)CH2CH2CH3), 3-pentyl (-CH(CH2CH3)2), 2-methyl-2-butyl (-C(CH3)2CH2CH3), 3-methyl-2-butyl (-CH(CH3)CH(CH3)2), 3-methyl-1-butyl (-CH 2CH2CH(CH3)2), 2-methyl-1-butyl (-CH2CH(CH3)CH2CH3), 1-hexyl (-CH2CH2CH2CH2CH2CH3), 2-hexyl (-CH(CH3)CH2CH2CH2CH3), 3-hexyl (-CH(CH2CH3)(CH2CH2CH3)), 2-methyl-2-pentyl (-C(CH3)2CH2CH2CH3), 3-methyl-2-pentyl (-CH(CH3)CH(C H3)CH2CH3), 4-methyl-2-pentyl (-CH(CH3)CH2CH(CH3)2), 3-methyl-3-pentyl (-C(CH3)(CH2CH3)2), 2-methyl-3-pentyl (-CH(CH2CH3)CH(CH3)2), 2,3-dimethyl-2-butyl (-C(CH3)2CH(CH3)2), 3,3-dimethyl-2-butyl (-CH(CH3)C(CH3)3 and octyl (-(CH2)7CH3).

[0044] "Alkoxy" refers to the group -O-alkyl, where alkyl is as defined above. For example, C 1-4 Alkoxy refers to an -O-alkyl group having 1 to 4 carbons.

[0045] "Alkenyl" is a straight or branched monovalent hydrocarbon radical having at least one carbon-carbon double bond. For example, an alkenyl group can have 2 to 8 carbon atoms (i.e., C 2-8 alkenyl), or 2 to 6 carbon atoms (i.e. C 2-6 alkenyl), or 2 to 4 carbon atoms (i.e. C 2-4Examples of alkenyl groups include, but are not limited to, vinyl (-CH=CH2), allyl (-CH2CH=CH2), and -CH2-CH=CH-CH3.

[0046] "Alkynyl" is a straight or branched monovalent hydrocarbon radical having at least one carbon-carbon triple bond. For example, an alkynyl group can have 2 to 8 carbon atoms (i.e., C 2-8 Alkynyl), or 2 to 6 carbon atoms (i.e., C 2-6 Alkynyl), or 2 to 4 carbon atoms (i.e. C 2-4 Examples of alkynyl groups include, but are not limited to, ethynyl (-C≡CH), propargyl (-CH2C≡CH), and -CH2-C≡C-CH3.

[0047]

[0046] "Halo" or "halogen" as used herein refers to fluorine (-F), chlorine (-Cl), bromine (-Br), and iodine (-I).

[0048] As used herein, "haloalkyl" refers to an alkyl group as defined herein, wherein one or more hydrogen atoms of the alkyl group are independently replaced by a halo substituent, which may be the same or different. 1-4 The haloalkyl group is C 1-4 One or more hydrogen atoms of the alkyl group have been replaced by a halogen substituent. 1-4 Examples of haloalkyl include, but are not limited to, fluoromethyl, fluorochloromethyl, difluoromethyl, difluorochloromethyl, trifluoromethyl, 1,1,1-trifluoroethyl, and pentafluoroethyl.

[0049] As used herein, "aryl" refers to a single all-carbon aromatic ring or a polycondensed all-carbon ring system in which at least one ring is aromatic. For example, in certain embodiments, the aryl group has 6 to 20 carbon atoms, 6 to 14 carbon atoms, or 6 to 12 carbon atoms. Aryl includes phenyl. Aryl also includes polycondensed ring systems (e.g., ring systems comprising 2, 3, or 4 rings) having about 9 to 20 carbon atoms, in which at least one ring is aromatic and in which the other rings may be aromatic or non-aromatic (i.e., carbocyclic). Such polycondensed ring systems are optionally substituted with one or more (e.g., 1, 2, or 3) pendant oxy groups on any carbocyclic portion of the polycondensed ring system. The rings of the polycondensed ring system may be connected to each other via fusion, spirocyclic, and bridging bonds when valence requirements permit. It should also be understood that when referring to a specific atomic range member aryl (e.g., a 6-membered to 10-membered aryl), the atomic range is for the total ring atoms of the aryl group. For example, a 6-membered aryl would include phenyl and a 10-membered aryl would include naphthyl and 1,2,3,4-tetrahydronaphthyl. Non-limiting examples of aryl include, but are not limited to, phenyl, indenyl, naphthyl, 1,2,3,4-tetrahydronaphthyl, anthracenyl, and the like.

[0050] As used herein, the term "heteroaryl" refers to a single aromatic ring having at least one atom other than carbon in the ring, wherein the atom is selected from the group consisting of oxygen, nitrogen, and sulfur; "heteroaryl" also includes multiple fused ring systems having at least one such aromatic ring, which multiple fused ring systems are further described below. Thus, "heteroaryl" includes a single aromatic ring having about 1 to 6 carbon atoms and about 1 to 4 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur. The sulfur and nitrogen atoms may also be present in oxidized form, with the proviso that the ring is aromatic. Exemplary heteroaromatic ring systems include, but are not limited to, pyridinyl, pyrimidinyl, oxazolyl, or furanyl. "Heteroaryl" also includes multiple fused ring systems (e.g., ring systems comprising 2, 3, or 4 rings), wherein a heteroaryl as defined above is fused to one or more rings selected from the following to form a multiple fused ring system: heteroaryl (forming, for example, 1,8-naphthyridinyl), heterocyclic (forming, for example, 1,2,3,4-tetrahydro-1,8-naphthyridinyl), carbocyclic (forming, for example, 5,6,7,8-tetrahydroquinolinyl), and aryl (forming, for example, indazolyl). Thus, a heteroaryl (single aromatic ring or multiple fused ring systems) has about 1 to 20 carbon atoms and about 1 to 6 heteroatoms within the heteroaromatic ring. Such multiple fused ring systems may be optionally substituted with one or more (e.g., 1, 2, 3, or 4) pendant oxy groups on the carbocyclic or heterocyclic portions of the fused rings. The rings of the multiple fused ring systems may be connected to each other via fusion, spirocyclic, and bridging bonds when valence requirements permit. It should be understood that the individual rings of the multiple fused ring systems may be connected in any order relative to each other. It is understood that the point of attachment of the heteroaryl or heteroaryl polycondensed ring system can be at any suitable atom of the heteroaryl or heteroaryl polycondensed ring system, including carbon atoms and heteroatoms (e.g., nitrogen). It is also understood that when referring to a specific atomic range member aryl (e.g., a 5- to 10-membered heteroaryl), the atomic range is for the total ring atoms of the heteroaryl and includes carbon atoms and heteroatoms. For example, a 5-membered heteroaryl would include thiazolyl and a 10-membered heteroaryl would include quinolinyl. Exemplary heteroaryl groups include, but are not limited to, pyridinyl, pyrrolyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrazolyl, thienyl, indolyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, furanyl, oxadiazolyl, thiadiazolyl, quinolyl, isoquinolyl, benzothiazolyl, benzoxazolyl, indazolyl, quinoxalinyl, quinazolinyl, 5,6,7,8-tetrahydroisoquinolyl, benzofuranyl, benzimidazolyl, thianaphthenyl, pyrrolo[2,3-b]pyridinyl, quinazolinyl-4(3H)-one, and triazolyl.

[0051] "Cycloalkyl" refers to a single saturated or partially unsaturated all-carbon ring (i.e., C 3-20The term "cycloalkyl" also includes polycondensed, saturated and partially unsaturated all-carbon ring systems (e.g., ring systems containing 2, 3 or 4 carbocyclic rings). Thus, cycloalkyl includes polycyclic carbocycles, such as bicyclic carbocycles (e.g., bicyclic carbocycles having about 6 to 12 ring carbon atoms, such as bicyclo[3.1.0]hexane and bicyclo[2.1.1]hexane), and polycyclic carbocycles (e.g., tricyclic and tetracyclic carbocycles having up to about 20 ring carbon atoms). The rings of polycondensed ring systems may be connected to each other via fusion, spiro and bridging bonds when valence requirements permit. Non-limiting examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, 1-cyclopent-1-enyl, 1-cyclopent-2-enyl, 1-cyclopent-3-enyl, cyclohexyl, 1-cyclohex-1-enyl, 1-cyclohex-2-enyl, and 1-cyclohex-3-enyl.

[0052] As used herein, "heterocyclyl" or "heterocycle" or "heterocycloalkyl" refers to a single saturated or partially unsaturated non-aromatic ring or a non-aromatic polycyclic ring system having at least one heteroatom in the ring (i.e., at least one ring heteroatom selected from oxygen, nitrogen and sulfur). Unless otherwise specified, a heterocyclyl group has 3 to about 20 ring atoms, such as 3 to 12 ring atoms, such as 3 to 10 ring atoms, or 3 to 8 ring atoms, or 3 to 6 ring atoms, or 3 to 5 ring atoms, or 4 to 6 ring atoms, or 4 to 5 ring atoms. Thus, the term includes a single saturated or partially unsaturated ring (e.g., a 3-membered, 4-membered, 5-membered, 6-membered or 7-membered ring) having about 1 to 6 ring carbon atoms and about 1 to 3 ring heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur in the ring. The rings of multiple fused ring (e.g., bicyclic heterocyclyl) systems may be connected to each other via fusion, spiro and bridging bonds when valence requirements permit. Heterocycles include, but are not limited to, azetidine, aziridine, imidazoline, morpholine, oxirane (epoxide), oxetane, thietane, piperazine, piperidine, pyrazolidine, pyrrolidine, pyrrolidone, tetrahydrofuran, tetrahydrothiophene, dihydropyridine, tetrahydropyridine, quinuclidine, 2-oxa-6-azaspiro[3.3]hept-6-yl, 6-oxa-1-azaspiro[3.3]hept-1-yl, 2-thiophene

[00136] 1-aza-6-yl, 2,6-diaza-spiro[3.3]hept-2-yl, 2-aza-bicyclo[3.1.0]hex-2-yl, 3-aza-bicyclo[3.1.0]hex-2-yl, 2-aza-bicyclo[2.1.1]hex-2-yl, 2-aza-bicyclo[2.2.1]hept-2-yl, 4-aza-spiro[2.4]hept ...5-aza-spiro[2.4]hept-2-yl and the like.

[0053] As used herein, "oxo" refers to =0.

[0054] As used herein, "substituted" refers to substitution with one or more substituents (e.g., 1, 2, 3, or 4 or more substituents) selected from the group consisting of: -OH, -SH, -NH2, =O, =NH, =S, ≡N, halogen, -N3, C 1-6 Alkyl, C 1-6 Alkoxy, -CN and -COOR p , where R p is hydrogen or C1 to C6 alkyl.

[0055] "Compounds of the present invention" include compounds disclosed herein, for example, compounds of the present invention include compounds of formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig), including the compounds of the following examples.

[0056] As used herein, "treatment / treat / treating" refers to a method for obtaining a beneficial or desired result. For the purposes of the present invention, beneficial or desired results include, but are not limited to, relief of symptoms and / or reduction of the degree of symptoms and / or prevention of worsening of symptoms associated with a disease or condition. In one embodiment, "treatment / treating" includes one or more of the following: a) inhibiting a disease or condition (e.g., reducing one or more symptoms caused by a disease or condition, and / or reducing the degree of a disease or condition); b) slowing down or curbing the development of one or more symptoms associated with a disease or condition (e.g., stabilizing a disease or condition, delaying worsening or progression of a disease or condition); and c) alleviating a disease or condition, such as regression of clinical symptoms, improvement of the disease condition, delaying disease progression, improving quality of life, and / or prolonging survival.

[0057] As used herein, "delay" means to postpone, hinder, slow, arrest, stabilize and / or delay the development of a disease or condition. This delay can be of varying lengths of time, depending on the disease being treated and / or the individual's medical history. As will be apparent to one skilled in the art, sufficient or significant delay can actually encompass prevention, such that the individual does not develop the disease or condition.

[0058] As used herein, "prevention (prevent / prevention / preventing)" refers to a therapy that prevents the onset of a disease or illness so that the clinical symptoms of the disease do not develop. Therefore, "prevention" is about administering treatment (e.g., administering a therapeutic substance) to an individual before signs of disease can be detected in the individual (e.g., administering a therapeutic substance to an individual in the absence of a detectable infectious agent (e.g., a virus) in the individual). An individual may be an individual at risk of developing a disease or illness, such as an individual with one or more risk factors known to be associated with the development or onset of a disease or illness. Therefore, in certain embodiments, the term "prevention of HBV infection" refers to administering an anti-HBV therapeutic substance to an individual who does not have a detectable HBV infection. It should be understood that an individual of an anti-HBV preventive treatment may be an individual at risk of being infected with the HBV virus. It should also be understood that prevention does not require a 100% success rate. In some cases, prevention can be understood as reducing the risk of infection, rather than completely eliminating the occurrence of infection.

[0059] As used herein, "modulation" or "modulating" the activity of a protein (e.g., a STING adaptor protein) refers to changing the activity such that the activity is increased or decreased. In some embodiments, modulation can increase the activity.

[0060] As used herein, the term "viral infection" describes a disease state in which a virus invades a healthy cell, multiplies or replicates using the cell's reproductive machinery and eventually lyses the cell, causing cell death, releasing viral particles and infecting other cells through the newly produced progeny viruses. Latent infection caused by certain viruses is also a possible outcome of a viral infection.

[0061] As used herein, the term "enhancing" refers to any form of increase in the immunogenic activity of an effective dose of a vaccine due to administration of a therapeutically effective dose of a compound of the invention (e.g., a cyclic dinucleotide of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig)) to an animal or human, wherein the compound is administered at any time prior to, simultaneously with, or just after administration of an effective dose of a vaccine to the same animal or human.

[0062] As used herein, "animal" refers to a mammal, e.g., a livestock animal such as a pig, cow, horse, dog, cat, rat, or mouse, or a non-human primate such as a macaque or chimpanzee.

[0063] As used herein, "subject at risk" refers to an individual who is at risk of developing a condition to be treated. An individual "at risk" may or may not have a detectable disease or condition, and may or may not display detectable disease prior to treatment with the methods described herein. "At risk" indicates that an individual has one or more so-called risk factors, which are measurable parameters associated with the development of a disease or condition and are known in the art. An individual who has one or more of these risk factors has a higher chance of developing a disease or condition than an individual who does not have these risk factors.

[0064] As used herein, "therapeutically effective amount" or "effective amount" refers to an amount that effectively induces a desired biological or medical response, including an amount of a compound sufficient to achieve treatment of such a disease when administered to an individual for the treatment of a disease. The effective amount will vary depending on the compound, the disease and its severity, and the age, weight, etc. of the individual to be treated. The effective amount may include a range of amounts. As understood in the art, an effective amount may be in one or more doses, that is, a single dose or multiple doses may be required to achieve the desired treatment index. An effective amount may be considered in the case of administration of one or more therapeutic agents, and a single agent may be considered to be given in an effective amount if a desired or beneficial result can be achieved or has been achieved in combination with one or more other agents. The suitable dose of any co-administered compound may be reduced as appropriate due to the combined action of the compounds (e.g., additive or synergistic effects).

[0065] "Pharmaceutically acceptable excipients" include, but are not limited to, any adjuvant, carrier, excipient, lubricant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent or emulsifier that has been approved by the United States Food and Drug Administration as acceptable for use in humans or livestock.

[0066] As used herein, "co-administration" refers to administering a unit dose of a compound disclosed herein before or after administering a unit dose of one or more other therapeutic agents, for example, administering a compound disclosed herein within seconds, minutes, or hours of administering one or more other therapeutic agents. For example, in some embodiments, a unit dose of a compound of the present invention is administered first, followed by a unit dose of one or more other therapeutic agents within seconds or minutes. Alternatively, in other embodiments, a unit dose of one or more other therapeutic agents is administered first, followed by a unit dose of a compound of the present invention within seconds or minutes. In some embodiments, a unit dose of a compound of the present invention is administered first, followed by a unit dose of one or more other therapeutic agents after a period of time (e.g., 1 to 12 hours). In other embodiments, a unit dose of one or more other therapeutic agents is administered first, followed by a unit dose of a compound of the present invention after a period of time (e.g., 1 to 12 hours). Co-administration of a compound disclosed herein with one or more other therapeutic agents generally refers to administering a compound disclosed herein and one or more other therapeutic agents simultaneously or sequentially, so that a therapeutically effective amount of each agent is present in the patient's body.

[0067] Also provided are pharmaceutically acceptable salts, hydrates, solvates, tautomeric forms, polymorphs, and prodrugs of the compounds described herein. "Pharmaceutically acceptable" or "physiologically acceptable" means that the compounds, salts, compositions, dosage forms, and other materials are suitable for use in the preparation of pharmaceutical compositions suitable for veterinary or human medical use.

[0068] The compounds described herein can be prepared and / or formulated as pharmaceutically acceptable salts or as free bases when appropriate. Pharmaceutically acceptable salts are non-toxic salts of free base forms of compounds having the pharmacological activity of the desired free base. Such salts can be derived from inorganic or organic acids or bases. For example, compounds containing basic nitrogen can be prepared as pharmaceutically acceptable salts by contacting the compound with an inorganic or organic acid. Non-limiting examples of pharmaceutically acceptable salts include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, monohydrogen phosphates, dihydrogen phosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caproates, heptanoates, propiolates, oxalates, malonates, succinates, suberates, sebacates, fumarates, maleates , butyne-1,4-dioate, hexyne-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, sulfonate, methylsulfonate, propylsulfonate, benzenesulfonate, xylenesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, gamma-hydroxybutyrate, glycolate, tartrate, and mandelate. A list of other suitable pharmaceutically acceptable salts is found in Remington: The Science and Practice of Pharmacy, 21st ed., Lippincott Wiliams and Wilkins, Philadelphia, Pa., 2006.

[0069] Examples of "pharmaceutically acceptable salts" of the compounds disclosed herein also include salts derived from appropriate bases such as alkali metals (e.g., sodium, potassium), alkaline earth metals (e.g., magnesium), ammonium and NX4 + (wherein X is C1-C4 alkyl). Base addition salts such as sodium or potassium salts are also included.

[0070] Also provided are compounds described herein or pharmaceutically acceptable salts, isomers or mixtures thereof, wherein 1 to n hydrogen atoms attached to a carbon atom may be replaced by deuterium atoms or D, wherein n is the number of hydrogen atoms in the molecule. As known in the art, deuterium atoms are non-radioactive isotopes of hydrogen atoms. Such compounds may increase metabolic resistance and, therefore, when administered to mammals, may be useful for increasing the half-life of the compounds described herein or pharmaceutically acceptable salts, isomers or mixtures thereof. See, e.g., Foster, "Deuterium Isotope Effects in Studies of Drug Metabolism", Trends Pharmacol. Sci., 5(12): 524-527 (1984). Such compounds are synthesized by means well known in the art, for example, by using starting materials in which one or more hydrogen atoms have been replaced by deuterium.

[0071] Examples of isotopes that may be incorporated into the disclosed compounds also include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, chlorine, and iodine, such as 2 H. 3 H. 11 C. 13 C. 14 C. 13 N. 15 N. 15 O. 17 O. 18 O. 31 P. 32 P. 35 S. 18 F. 36 Cl, 123 I and 125 I. Positron-emitting isotopes (such as 11 C. 18 F. 15 O and 13 N) substitution may be useful in positron emission tomography (PET) studies to examine substrate receptor occupancy. Isotopically labeled compounds of formula (I) may generally be prepared by conventional techniques known to those skilled in the art or by methods analogous to those described in the Examples as set forth below, using an appropriate isotopically labeled reagent in place of the non-labeled reagent previously used.

[0072] The compounds of the embodiments disclosed herein, or their pharmaceutically acceptable salts, may contain one or more asymmetric centers and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms, which may be defined in terms of absolute stereochemistry for amino acids as (R)- or (S)- or (D)- or (L)-. The present invention is meant to include all such possible isomers, as well as racemic and optically pure forms thereof. Optically active (+) and (-), (R)- and (S)- or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques such as chromatography and fractional crystallization. Conventional techniques for preparing / separating individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of racemates (or racemates of salts or derivatives) using, for example, chiral high pressure liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry and unless specified otherwise, it is intended that the compounds include E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included. When compounds are represented in their chiral form, it is understood that the embodiments encompass, but are not limited to, specific diastereoisomers or enantiomerically enriched forms. When chirality is not specified but is present, it is understood that the embodiments are directed to specific diastereoisomers or enantiomerically enriched forms; or racemic or non-racemic mixtures of such compounds. As used herein, a "non-racemic mixture" is a mixture of stereoisomers in a ratio that is not 1:1.

[0073] As used herein, "stereoisomers" refer to compounds made up of the same atoms bound by the same bonds but having different three-dimensional structures that are not interchangeable. The present invention encompasses various stereoisomers and mixtures thereof and includes "enantiomers," which refer to two stereoisomers whose molecules are non-superimposable mirror images of each other.

[0074] As used herein, "tautomer" refers to a proton shift from one atom of a molecule to another atom of the same molecule. The present invention includes tautomers of any such compounds.

[0075] As used herein, "solvate" refers to the result of the interaction of a solvent and a compound. Also provided are solvates of the salts of the compounds described herein. Also provided are hydrates of the compounds described herein.

[0076] As used herein, "hydrate" refers to a compound of the present invention chemically associated with one or more water molecules.

[0077] As used herein, "prodrug" refers to a derivative of a drug that is converted into the parent drug according to some chemical or enzymatic pathway when administered to the human body.

[0078] III. Compounds

[0079] The present invention includes cyclic dinucleotides of formula (I),

[0080]

[0081] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof,

[0082] in

[0083] L 1 -O- or -KC(R 6 R 7 )-;

[0084] L 2 -KC(R 6 R 7 )-;

[0085] Y 1 and Y 2 Each is independently -O-, -S- or -CH2-;

[0086] X 1 and X 3 Each independently represents OH, SH, OR 13 , SR 13 or N(R 13 )2;

[0087] X 2 and X 4 Each independently is O or S;

[0088] R 1 , R 5 , R 8 and R 12 Each independently represents H, CH2F, CHF2, CF3, CN, N3, F, Cl, Br, I, COOR 13 、CON(R 13 )2, CH2OH, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, OR 13 , SR 13 or N(R 13 )2;

[0089] R 2 , R 3 , R 4 , R 9 , R 10 and R 11Each independently represents H, OH, F, Cl, Br, I, CN, N3, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, OR 13 , SR 13 or N(R 13 )2;

[0090] R 6 and R 7 Each independently represents H, CH2F, CHF2, CF3, CN, N3, F, Cl, Br, I, COOR 13 、CON(R 13 )2, CH2OH, CH2N3, OR 13 , SR 13 、N(R 13 )2, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C2-C 10 Substituted heterocycloalkyl, C6-C 10 Aryl, C6-C 10 Substituted aryl, C2-C 10 Heteroaryl or C2-C 10 substituted heteroaryl;

[0091] Each R 13 are independently H, -C(=Z)R 14 、-C(=Z)OR 14 、-C(=Z)SR 14 、-C(=Z)N(R 14 )2, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C2-C 10 Substituted heterocycloalkyl, C6-C 10 Aryl, C6-C 10 Substituted aryl, C2-C 10 Heteroaryl or C2-C 10 substituted heteroaryl;

[0092] Each R 14 are independently H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, C3-C7 cycloalkyl, C2-C 10Heterocycloalkyl, C2-C 10 Substituted heterocycloalkyl, C6-C 10 Aryl, C6-C 10 Substituted aryl, C2-C 10 Heteroaryl or C2-C 10 substituted heteroaryl;

[0093] Each Z is independently O, S or NR 13 ;

[0094] K represents -O-, -S-, -S(O)-, -S(O)2-, -NH- or -NR 13 - variables;

[0095] Base 1 and bases 2 Each independently is:

[0096]

[0097] in

[0098] A. A 1 , A 2 , A 3 and A 4 Each independently represents H, OH, SH, F, Cl, Br, I, NH2, OR 13 , SR 13 、NHR 13 、N(R 13 )2 or R 14 ;and

[0099] Among them, C1-C6 substituted alkyl, C2-C6 substituted alkenyl, C2-C6 substituted alkynyl, C2-C 10 Substituted heterocycloalkyl, C6-C 10 Substituted aryl or C2-C 10 The substituted heteroaryl is substituted with 1, 2, 3 or 4 substituents independently selected from the group consisting of: -OH, -SH, -NH2, =O, =NH, =S, ≡N, halogen, -N3, C 1-6 Alkyl, C 1-6 Alkoxy, -CN and -COOR p , where R p is hydrogen or C1 to C6 alkyl.

[0100] In some embodiments, the compound is a compound of formula (I):

[0101]

[0102] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof,

[0103] in

[0104] L 1 -O- or -KC(R 6 R 7 )-;

[0105] L 2 -KC(R 6 R 7 )-;

[0106] Y 1 and Y 2 Each is independently -O-, -S- or -CH2-;

[0107] X 1 and X 3 Each independently represents OH, SH, OR 13 , SR 13 or N(R 13 )2;

[0108] X 2 and X 4 Each independently is O or S;

[0109] R 1 , R 5 , R 8 and R 12 Each independently represents H, CH2F, CHF2, CF3, CN, N3, F, Cl, Br, I, COOR 13 、CON(R 13 )2, CH2OH, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, OR 13 , SR 13 or N(R 13 )2;

[0110] R 2 , R 3 , R 4 , R 9 , R 10 and R 11 Each independently represents H, OH, F, Cl, Br, I, CN, N3, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, OR 13 , SR 13 or N(R 13 )2;

[0111] R 6 and R 7 Each independently represents H, CH2F, CHF2, CF3, CN, N3, F, Cl, Br, I, COOR13 、CON(R 13 )2, CH2OH, CH2N3, OR 13 , SR 13 、N(R 13 )2, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C6-C 10 Aryl or C2-C 10 heteroaryl;

[0112] Each R 13 are independently H, -C(=Z)R 14 、-C(=Z)OR 14 、-C(=Z)SR 14 、-C(=Z)N(R 14 )2, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C6-C 10 Aryl, or C2-C 10 heteroaryl;

[0113] Each R 14 are independently H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C6-C 10 Aryl or C2-C 10 heteroaryl;

[0114] Each Z is independently O, S or NR 13 ;

[0115] K represents -O-, -S-, -S(O)-, -S(O)2-, -NH- or -NR 13 - variables;

[0116] Base 1 and bases 2 Each independently is:

[0117]

[0118] in

[0119] A. A 1 , A 2 , A 3 and A 4 Each independently represents H, OH, SH, F, Cl, Br, I, NH2, OR 13 , SR 13 、NHR 13 、N(R13 )2 or R 14 .

[0120] In some embodiments, Y 1 and Y 2 is O.

[0121] In some embodiments, X 2 and X 4 is O, and X 1 and X 3 Each independently is OH or OR 13 In some embodiments, X 2 and X 4 is O, and X 1 and X 3 For OH.

[0122] In some embodiments, L 1 In some embodiments, L 1 -OC(R 6 R 7 )-. In some embodiments, L 1 It is -O-CH2-.

[0123] In some embodiments, L 2 -OC(R 6 R 7 )-. In some embodiments, L 2 It is -O-CH2-.

[0124] In some embodiments, L 1 -O- or -OC(R 6 R 7 )-, and L 2 -OC(R 6 R 7 )-. In some embodiments, L 1 is -O- or -O-CH2-, and L 2 is -O-CH2-. In some embodiments, L 1 is -O-, and L 2 is -O-CH2-. In some embodiments, L 1 is -O-CH2-, and L 2 It is -O-CH2-.

[0125] In some embodiments, R 1 , R 5 , R 8 and R 12 Each independently represents H, CH2F, CHF2, CF3, CN, N3, F, Cl, Br, I, COOR 13、CON(R 13 )2, CH2OH, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR 13 , SR 13 or N(R 13 ) 2. In some embodiments, R 1 , R 5 , R 8 and R 12 Each independently represents H, CN, N3, F, Cl, Br, I, COOR 13 、CON(R 13 )2, CH2OH, C 1-3 Haloalkyl, C 1-6 Alkyl, OR 13 , SR 13 or N(R 13 ) 2. In some embodiments, R 1 , R 5 , R 8 and R 12 Each is H.

[0126] In some embodiments, R 2 , R 3 , R 4 , R 9 , R 10 and R 11 Each independently represents H, OH, F, Cl, Br, I, CN, N3, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, OR 13 , SR 13 or N(R 13 ) 2. In some embodiments, R 2 , R 3 , R 4 , R 9 , R 10 and R 11 Each independently represents H, OH, F, Cl, Br, I, CN, N3, C1-C6 alkyl, OR 13 , SR 13 or N(R 13 )2.

[0127] In some embodiments, R 2 , R 4 , R 9 and R 10 Each is independently H, OH, F, Cl, Br, I, CN or N3. In some embodiments, R 2 , R 4 , R9 and R 10 Each is H.

[0128] In some embodiments, R 6 and R 7 Each independently represents H, CH2F, CHF2, CF3, CN, N3, F, Cl, Br, I, COOR 13 、CON(R 13 )2, CH2OH, CH2N3, OR 13 , SR 13 、N(R 13 )2, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C6-C 10 Aryl or C2-C 10 In some embodiments, R 6 and R 7 Each independently represents H, CN, N3, F, Cl, Br, I, COOR 13 、CON(R 13 )2, CH2OH, CH2N3, OR 13 , SR 13 、N(R 13 )2, C1-C3 haloalkyl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C6-C 10 Aryl or C2-C 10 In some embodiments, R 6 and R 7 are each independently H, C1-C3 haloalkyl, CN, N3, F, Cl, Br and I. In some embodiments, R 6 and R 7 Each is independently H, CH2F, CHF2, CF3, CN, N3, F, Cl, Br and I. In some embodiments, R 6 and R 7 Each is H.

[0129] In some embodiments, each R 13 are independently H, -C(=Z)R 14 、-C(=Z)OR 14 、-C(=Z)SR 14 、-C(=Z)N(R 14 )2, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C6-C 10Aryl or C2-C 10 In some embodiments, each R 13 are independently H or C1-C6 alkyl.

[0130] In some embodiments, each R 14 are independently H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C2-C 10 Heterocycloalkyl, C6-C 10 Aryl or C2-C 10 In some embodiments, each R 14 are independently H or C1-C6 alkyl.

[0131] In some embodiments, the cyclic dinucleotide of formula (I) has the structure of formula (I-1):

[0132]

[0133] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0134] In some embodiments, the cyclic dinucleotide of formula (I) has the structure of formula (I-2):

[0135]

[0136] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0137] In some embodiments, the cyclic dinucleotide of formula (I) has the structure of formula (Ia-1):

[0138]

[0139] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0140] In some embodiments of structures (I) and / or (Ia-1), L 1 -O- or -OC(R 6 R 7 )-, and L 2 -OC(R 6 R 7 )-. In some embodiments, L 1 is -O- or -O-CH2-, and L 2 is -O-CH2-. In some embodiments, L 1 is -O-, and L 2 is -O-CH2-. In some embodiments, L 1 is -O-CH2-, and L2 It is -O-CH2-.

[0141] In some embodiments, the cyclic dinucleotide of formula (I) has the structure of formula (Ia-2):

[0142]

[0143] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0144] In some embodiments of the structure of Formula (Ia-2), L 1 -O- or -OC(R 6 R 7 )-. In some embodiments, L 1 In some embodiments, L 1 In some embodiments, L 1 It is -O-CH2-.

[0145] In some embodiments, the cyclic dinucleotide of Formula (I) has the structure of Formula (Ib):

[0146]

[0147] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0148] In some embodiments, the cyclic dinucleotide of Formula (I) has the structure of Formula (Ic):

[0149]

[0150] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0151] In some embodiments, the cyclic dinucleotide of Formula (I) has the structure of Formula (Id):

[0152] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0153] In some embodiments, the cyclic dinucleotide of Formula (I) has the structure of Formula (Ie):

[0154]

[0155] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0156] In some embodiments, the cyclic dinucleotide of Formula (I) has the structure of Formula (If):

[0157]

[0158] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0159] In some embodiments, the cyclic dinucleotide of Formula (I) has the structure of Formula (Ig):

[0160]

[0161] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0162] In some embodiments of the structures of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig), the base 1 and bases 2 Each independently is:

[0163]

[0164] In some embodiments, the base 1 and bases 2 Each independently is:

[0165]

[0166] In some embodiments, the base 1 and bases 2 Each independently is:

[0167]

[0168] In some embodiments, the base 1 and bases 2 Each independently is:

[0169]

[0170] In some embodiments, the base 1 and bases 2 Each independently is:

[0171]

[0172] In some embodiments, the base 1 for And base 2 for

[0173] In some embodiments, the base 1 for And base 2 for

[0174] In some embodiments, the base 1 and bases 2 Each

[0175] In some embodiments, the base 1 and bases 2 Each

[0176] In some embodiments of the structures of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If), and / or (Ig), A, A 1 , A 2 , A 3 and A 4 Each independently represents H, OH, SH, F, Cl, Br, I, and NH2.

[0177] In some embodiments of the structures of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If), and / or (Ig), A 1 , A 2 and A 3 Each is independently H, OH, SH, F, Cl, Br, I, NH2. In some embodiments, A 1 , A 2 and A 3 Each is independently H, OH and NH2.

[0178] In some embodiments of the structures of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If), and / or (Ig), R 3 and R 10 Each independently represents H, OH, F, Cl, Br, I, CN, N3 or OR 13 In some embodiments, R 3 and R 10 Each independently is H, OH, F, Cl, Br or OR 13 In some such embodiments, R 13 is a C1-C6 alkyl group. 3 and R 10 Each is independently H, OH or F. In some embodiments, R 3 and R 10Each is independently OH or F. In some embodiments, R 3 is OH, and R 10 is F. In some embodiments, R 3 is F, and R 10 is OH. In some embodiments, R 3 is H, and R 10 is F. In some embodiments, R 3 is F, and R 10 is H. In some embodiments, R 3 and R 10 Each is OH. In some embodiments, R 3 and R 10 Each is F.

[0179] In some embodiments, the cyclic dinucleotide of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig) has the following structure:

[0180]

[0181]

[0182]

[0183] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0184] In some embodiments, the cyclic dinucleotide of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig) has the following structure:

[0185]

[0186] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0187] In some embodiments, the cyclic dinucleotide of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig) has the following structure:

[0188]

[0189] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0190] In some embodiments, the cyclic dinucleotide of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig) has the following structure:

[0191]

[0192] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0193] In some embodiments, the cyclic dinucleotide of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig) has the following structure:

[0194]

[0195] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0196] In some embodiments, the cyclic dinucleotide of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig) has the following structure:

[0197]

[0198] or an enantiomer, hydrate, solvate or pharmaceutically acceptable salt thereof.

[0199] The presence of a chiral center allows compounds to exist in the form of one of the two possible optical isomers ((R)-enantiomers or (S)-enantiomers) or as a racemic mixture of the two. In the presence of substituents that may be attached at different positions in the molecule, all positional isomers and mixtures of positional isomers formed are included within the scope of formula (I) described herein.

[0200] Compounds of the invention, such as compounds of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If), and / or (Ig), may be shown in multiple equivalent chemical formulas. For example, compounds of Formula (Ia-2) are generally depicted herein as shown below:

[0201]

[0202] The compound of formula (Ia-2) above is equivalent to the compound of formula (Ia-2) depicted below:

[0203]

[0204] Furthermore, each of the preceding chemical formulae is equivalent to the following depiction of a compound of formula (Ia-2):

[0205]

[0206] IV. Composition

[0207] In certain embodiments, the present invention provides a pharmaceutical composition comprising a compound of the present invention (e.g., a compound of Formula ((I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig)), a hydrate, a solvate or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

[0208] In certain embodiments, pharmaceutical compositions comprise one or more additional therapeutic agents, as described more fully below.

[0209] Pharmaceutical compositions comprising compounds disclosed herein or pharmaceutically acceptable salts thereof can be prepared with one or more pharmaceutically acceptable excipients that can be selected according to routine. Tablets may contain excipients including sliding agents, fillers, adhesives and the like. Aqueous compositions can be prepared in a sterile form and are generally isotonic when intended for delivery by administration other than oral administration. All compositions may optionally contain excipients such as those described in Rowe et al., Handbook of Pharmaceutical Excipients, 6th edition, American Pharmacists Association, 2009. Excipients may include ascorbic acid and other antioxidants, chelating agents (such as EDTA), carbohydrates (such as dextrin), hydroxyalkyl cellulose, hydroxyalkyl methyl cellulose, stearic acid and the like. In certain embodiments, the composition is provided in a solid dosage form, including a solid oral dosage form.

[0210] The composition includes those suitable for various routes of administration, including oral administration. The composition may be present in unit dosage form and may be prepared by any method known in the art of pharmacy. Such methods include the step of combining an active ingredient (e.g., a compound of the invention or a pharmaceutically acceptable salt thereof) with one or more pharmaceutically acceptable excipients. The composition may be prepared by uniformly and closely combining the active ingredient with a liquid excipient or a finely powdered solid excipient or both, and then forming the product as needed. Technology and formulations are generally found in Remington: The Science and Practice of Pharmacy, 21st edition, Lippincott Wiliams and Wilkins, Philadelphia, Pa., 2006.

[0211] Compositions described herein suitable for oral administration may be presented as discrete units (unit dosage forms) including but not limited to capsules, cachets or tablets, each containing a predetermined amount of the active ingredient. In one embodiment, the pharmaceutical composition is a tablet.

[0212] The pharmaceutical compositions disclosed herein include one or more compounds disclosed herein, or pharmaceutically acceptable salts thereof, and pharmaceutically acceptable excipients and other therapeutic agents selected as appropriate. The pharmaceutical composition containing the active ingredient may be in any form suitable for the intended method of administration. When used for oral use, for example, tablets, lozenges, buccal lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, syrups or elixirs may be prepared. Compositions intended for oral use may be prepared according to any method known in the art of manufacturing pharmaceutical compositions, and such compositions may contain one or more excipients, including sweeteners, flavoring agents, coloring agents and preservatives, so as to provide a palatable preparation. Tablets containing active ingredients blended with pharmaceutically acceptable non-toxic excipients are acceptable, and such excipients are suitable for making tablets. Such excipients may be, for example, inert diluents such as calcium or sodium carbonate, lactose, lactose monohydrate, croscarmellose sodium, povidone, calcium or sodium phosphate; granulating and disintegrants such as corn starch or alginic acid; binders such as cellulose, microcrystalline cellulose, starch, gelatin or acacia; and lubricants such as magnesium stearate, stearic acid or talc. Tablets may be uncoated or may be coated using known techniques (including microencapsulation) to delay disintegration and adsorption in the gastrointestinal tract and thereby provide a sustained action over a longer period of time. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be used alone or with a wax.

[0213] The amount of active ingredients that can be combined with inactive ingredients to produce a dosage form can vary depending on the intended treatment of the individual and the particular mode of administration. For example, in some embodiments, a dosage form for oral administration to humans may contain approximately 1 to 1000 mg of active material formulated with an appropriate and suitable amount of a pharmaceutically acceptable excipient. In certain embodiments, the range of pharmaceutically acceptable excipients is from about 5 to about 95% (weight:weight) of the total composition.

[0214] In certain embodiments, a composition comprising a compound of the invention (e.g., a compound of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If) and / or (Ig)) or a pharmaceutically acceptable salt thereof, in one variation, does not contain an agent that affects the metabolic rate of the active ingredient. Thus, it is understood that a composition comprising a compound of the invention, in one aspect, does not contain an agent that would affect (e.g., slow, hinder, or stop) the metabolism of a compound of the invention or any other active ingredient that is administered separately, sequentially, or simultaneously with a compound of the invention. It is also understood that any method, kit, article of manufacture, and the like described in detail herein, in one aspect, does not contain an agent that would affect (e.g., slow, hinder, or stop) the metabolism of a compound of the invention or any other active ingredient that is administered separately, sequentially, or simultaneously with a compound of the invention.

[0215] The present invention further includes a pharmaceutical composition as described above, which is used to modulate the activity of the STING protein to induce the STING-dependent production of type I interferons, cytokines or chemokines.

[0216] The present invention further includes a pharmaceutical composition as described above for use in treating or preventing a viral infection, an infection caused by hepatitis B virus, HIV, a hyperproliferative disease or cancer.

[0217] The present invention further includes compounds of the present invention for administration as the sole active ingredient of a pharmaceutically acceptable composition which can be prepared by conventional methods known in the art, for example by combining the active ingredient with or by mixing with pharmaceutically acceptable therapeutically inert organic and / or inorganic carriers or excipients.

[0218] Another possibility is the use of the compounds according to the invention as second or further active ingredients having a synergistic effect with other active ingredients in known medicaments, or the administration of the compounds according to the invention together with such medicaments.

[0219] The compounds of the invention may also be used in the form of prodrugs or other forms suitable for modifying the release of the active ingredient in vivo.

[0220] V. Methods

[0221] In one embodiment, provided herein is a method of treating a disease or disorder comprising administering to a human or animal in need thereof a therapeutically effective amount of a compound of the present invention, or an enantiomer, pharmaceutically acceptable salt, hydrate or solvate thereof.

[0222] Also provided is a method for modulating (eg, increasing) the activity of a STING protein, comprising administering a therapeutically effective amount of a compound of the present invention or an enantiomer, a pharmaceutically acceptable salt, a hydrate or a solvate thereof.

[0223] Stimulator of interferon genes adaptor protein (STING), also known as STING, STING protein, transmembrane protein 173 (TMEM173), MPYS, mediator of IRF3 activation (MITA), or endoplasmic reticulum interferon stimulator (ERIS), is a protein encoded by the TMEM173 gene (UniProt code Q86WV6; NCBI reference sequence: NP_938023.1 (isoform 1) and NP_001288667 (isoform 2)) in humans. The STING adaptor protein is believed to act as a direct cytoplasmic DNA sensor (CDS) and an adaptor protein for type I interferon signaling via different molecular mechanisms. The STING adaptor protein has been shown to activate downstream transcription factors STAT6 and IRF3 via TBK1, and NF-κB via IKKβ, which can achieve antiviral responses or innate immune responses against intracellular pathogens. When cells are infected by intracellular pathogens such as viruses, mycobacteria, and intracellular parasites, the STING adaptor protein plays a role in innate immunity by inducing the production of type I interferons. Type I interferons mediated by the STING adaptor protein protect infected cells and neighboring cells from local infection caused by autocrine and paracrine signaling.

[0224] Further provided is a method for preventing or treating a disease or condition responsive to modulation of the STING adaptor protein, comprising administering to a human or animal in need thereof a therapeutically effective amount of a compound of the invention or an enantiomer, pharmaceutically acceptable salt, hydrate or solvate thereof.

[0225] Further provided is a method of inducing STING adaptor protein-dependent type I interferon, cytokine or chemokine in a human or animal, comprising administering a therapeutically effective amount of a compound of the invention or an enantiomer, pharmaceutically acceptable salt, hydrate or solvate thereof.

[0226] Activation of the STING adaptor protein in turn activates the protein kinase TBK1, which in turn activates the downstream transcription factors NF-κB and IRF-3. It is believed that activation of the STING adaptor protein ultimately leads to the release of type I and type III interferons and a variety of cytokines and chemokines, such as IL-6, TNF-α, and INF-γ. Therefore, inducing STING adaptor protein-dependent type I interferons, cytokines, or chemokines in a human or animal results in the activation of one or more of NF-κB, IRF-3, type I interferons, type III interferons, IL-6, TNF-α, and INF-γ in the human or animal.

[0227] Further provided is a method for treating or preventing viral infection (eg, infection caused by hepatitis B or HIV), comprising administering to a human or animal in need thereof a therapeutically effective amount of a compound of the present invention or an enantiomer, pharmaceutically acceptable salt, hydrate or solvate thereof.

[0228] The viral infection that can be treated or prevented by the method of the present invention can be any infection caused by a virus, such as a virus from the Hepadnaviridae family of viruses, such as hepatitis B; or any retrovirus, such as an alpha retrovirus, such as Rous sarcoma virus; a beta retrovirus, such as a simian retrovirus; a delta retrovirus, such as a bovine leukemia virus or a human T-lymphotropic virus (HTLV), including HTLV-1, HTLV-2, and HTLV-3; a gamma retrovirus, such as a murine leukemia virus or a feline leukemia virus; or a lentivirus, such as a human immunodeficiency virus (HIV) (including HIV-1 and HIV-2), a simian immunodeficiency virus, an equine infectious anemia virus, a bovine immunodeficiency virus, a rabbit endogenous lentivirus K (RELIK), or a feline immunodeficiency virus.

[0229] Further provided is a method for treating or preventing a hyperproliferative disease or cancer, comprising administering to a human or animal in need thereof a therapeutically effective amount of a compound of the present invention or an enantiomer, a pharmaceutically acceptable salt, a hydrate or a solvate thereof.

[0230] Hyperproliferative diseases include diseases caused by excessive growth of non-cancerous cells. Such conditions include, but are not limited to, psoriasis, actinic keratosis and seborrheic keratosis, warts, keloids, and eczema.

[0231] Cancers that can be treated or prevented by the methods of the invention include solid tumors and lymphomas, including but not limited to adrenal cancer, bladder cancer, bone cancer, brain cancer, breast cancer, colon cancer, colorectal cancer, eye cancer, head and neck cancer, kidney cancer (such as renal cell carcinoma), liver cancer, lung cancer (such as non-small cell lung cancer), ovarian cancer, pancreatic cancer, prostate cancer, skin cancer (such as squamous cell carcinoma and melanoma), thyroid cancer, uterine cancer, vaginal cancer and myeloma (such as multiple myeloma). Cancer can be primary, or relapsed and / or refractory.

[0232] Further provided is a method of enhancing vaccine efficacy, comprising administering to a human or animal in need thereof a therapeutically effective amount of a compound of the present invention or an enantiomer, pharmaceutically acceptable salt, hydrate or solvate thereof.

[0233] The present invention further includes a compound of the present invention or an enantiomer, a pharmaceutically acceptable salt, a hydrate or a solvate thereof, which is suitable for use as a medicament in humans or animals.

[0234] The present invention further includes the compound of the present invention or its enantiomer, pharmaceutically acceptable salt, hydrate or solvate for use in regulating the activity of STING protein.

[0235] The present invention further includes a compound of the present invention or an enantiomer, a pharmaceutically acceptable salt, a hydrate or a solvate thereof for use in preventing or treating a disease or condition in a human or animal that is responsive to modulation of a STING protein.

[0236] The present invention further includes a compound of the present invention or an enantiomer, pharmaceutically acceptable salt, hydrate or solvate thereof, alone or in combination with one or more therapeutically active substances, for use in STING-dependent induction of type I interferons, cytokines or chemokines in humans or animals.

[0237] The present invention further includes a compound of the present invention or an enantiomer, pharmaceutically acceptable salt, hydrate or solvate thereof, alone or in combination with one or more therapeutically active agents, for use in treating or preventing viral infections in humans or animals.

[0238] The present invention further includes a compound of the present invention or an enantiomer, pharmaceutically acceptable salt, hydrate or solvate thereof, alone or in combination with one or more therapeutically active substances, for use in the treatment or prevention of infection caused by hepatitis B virus or HIV in humans or animals.

[0239] The present invention further includes a compound of the present invention or an enantiomer, pharmaceutically acceptable salt, hydrate or solvate thereof, alone or in combination with one or more therapeutically active agents, for use in the treatment or prevention of a hyperproliferative disease or cancer in humans or animals.

[0240] The present invention further includes a compound of the present invention, or an enantiomer, pharmaceutically acceptable salt, hydrate or solvate thereof, for use in enhancing vaccine efficacy in humans or animals.

[0241] The present invention further includes a pharmaceutical composition for modulating the activity of STING protein to induce STING-dependent production of type I interferon, cytokine or chemokine in humans or animals.

[0242] The present invention further includes a pharmaceutical composition for treating or preventing viral infection, infection caused by hepatitis B virus, HIV, hyperproliferative disease or cancer in humans or animals.

[0243] The present invention further includes the use of the compounds of the present invention or their enantiomers, pharmaceutically acceptable salts, hydrates or solvates for the production of medicaments for the treatment or prevention of infections caused by hepatitis B virus, HIV, hyperproliferative diseases or cancer.

[0244] VI. Application

[0245] The compounds of the invention (also referred to herein as active ingredients) can be administered by any route appropriate to the condition to be treated. Suitable routes include oral, rectal, nasal, topical (including buccal and sublingual), transdermal, vaginal and parenteral (including subcutaneous, intramuscular, intravenous, intradermal, intrathecal and epidural) and the like. It should be understood that the preferred route may vary depending on, for example, the condition of the recipient. An advantage of certain compounds disclosed herein is that they are orally bioavailable and can be orally administered.

[0246] The compounds of the invention can be administered to an individual for a desired period of time or duration according to an effective dosing regimen, such as at least about one month, at least about 2 months, at least about 3 months, at least about 6 months, or at least about 12 months or longer. In one variation, the compound is administered daily or intermittently for the duration of an individual's life.

[0247] The dosage or administration frequency of the compounds of the invention may be adjusted during the course of treatment based on the judgment of the administering physician.

[0248] An effective amount of the compound can be administered to an individual (eg, a human). In certain embodiments, the compound is administered once daily.

[0249] The compound can be used by any applicable route and means, such as by oral or parenteral (e.g., intravenous) administration. The therapeutically effective amount of the compound may include about 0.00001 mg per kg of body weight per day to about 10 mg per kg of body weight per day, such as about 0.0001 mg per kg of body weight per day to about 10 mg per kg of body weight per day, or such as about 0.001 mg per kg of body weight per day to about 1 mg per kg of body weight per day, or such as about 0.01 mg per kg of body weight per day to about 1 mg per kg of body weight per day, or such as about 0.05 mg per kg of body weight per day to about 0.5 mg per kg of body weight per day, or such as about 0.3 mg to about 30 mg per day, or such as about 30 mg to about 300 mg per day.

[0250] The compounds of this invention can be combined with one or more other therapeutic agents in the form of any dosage (e.g., 1mg to 1000mg compound) of the compounds of this invention. Therapeutic effective amount may include about 1mg per dose to about 1000mg per dose, such as about 50mg per dose to about 500mg per dose, or such as about 100mg per dose to about 400mg per dose, or such as about 150mg per dose to about 350mg per dose, or such as about 200mg per dose to about 300mg per dose. Other therapeutic effective amounts of the compounds of this invention are about 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475 or about 500mg per dose. Other therapeutically effective amounts of the compounds of the present invention are about 100 mg per dose, or about 125, 150, 175, 200, 225, 250, 275, 300, 350, 400, 450 or about 500 mg per dose. Single doses may be administered hourly, daily or weekly. For example, a single dose may be administered once every 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 8 hours, 12 hours, 16 hours or once every 24 hours. A single dose may also be administered once every 1 day, 2 days, 3 days, 4 days, 5 days, 6 days or once every 7 days. A single dose may also be administered once every 1 week, 2 weeks, 3 weeks, or once every 4 weeks. In certain embodiments, a single dose may be administered once every other week. A single dose may also be administered once a month.

[0251] The present invention also includes a kit comprising a compound of the present invention or an enantiomer, a pharmaceutically acceptable salt, a hydrate or a solvate thereof, or a pharmaceutical composition containing any of the foregoing.

[0252] In one embodiment, a kit is provided comprising a combination of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, and one or more (e.g., one, two, three, four, one or two, or one to three, or one to four) other therapeutic agents.

[0253] VII. Combination therapy

[0254] In certain embodiments, a method for treating or preventing an infectious disease, viral infection, hepatitis B infection, HIV infection, cancer, or hyperproliferative disease in a human suffering from or at risk of the disease is provided, comprising administering to the human a therapeutically effective amount of a compound of the invention (e.g., a compound of Formula (I), (I-1), (I-2), (Ia-1), (Ia-2), (Ib), (Ic), (Id), (Ie), (If), and / or (Ig)), or a pharmaceutically acceptable salt thereof, in combination with a therapeutically effective amount of one or more (e.g., one, two, three, four, one or two, one to three, or one to four) other therapeutic agents. In one embodiment, a method for treating an infectious disease, viral infection, hepatitis B infection, HIV infection, cancer, or hyperproliferative disease in a human suffering from or at risk of the disease is provided, comprising administering to the human a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, in combination with a therapeutically effective amount of one or more (e.g., one, two, three, four, one or two, one to three, or one to four) other therapeutic agents.

[0255] In certain embodiments, the present invention provides a method for treating a viral infection, comprising administering to an individual in need thereof a therapeutically effective amount of a compound disclosed herein or a pharmaceutically acceptable salt thereof in combination with a therapeutically effective amount of one or more (e.g., one, two, three, four, one or two, one to three, or one to four) other therapeutic agents suitable for treating viral infection. In some embodiments, the viral infection is hepatitis B infection. In some embodiments, the viral infection is HIV infection.

[0256] In certain embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with one, two, three, four, or more other therapeutic agents. In certain embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with two other therapeutic agents. In other embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with three other therapeutic agents. In other embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with four other therapeutic agents. One, two, three, four, or more other therapeutic agents may be different therapeutic agents selected from the same class of therapeutic agents, and / or they may be selected from different classes of therapeutic agents.

[0257] Administration of combination therapy

[0258] In certain embodiments, the compounds disclosed herein are administered together with one or more other therapeutic agents. Co-administration of compounds disclosed herein with one or more other therapeutic agents generally refers to the simultaneous or sequential administration of the compounds disclosed herein and one or more other therapeutic agents, such that a therapeutically effective amount of the compounds disclosed herein and one or more other therapeutic agents is present in the subject. When administered sequentially, the combination may be administered in two or more administrations.

[0259] Co-administration of a compound disclosed herein with one or more additional therapeutic agents generally refers to administering a compound disclosed herein and one or more additional therapeutic agents simultaneously or sequentially such that a therapeutically effective amount of each agent is present in the patient's body.

[0260] In certain embodiments, the compounds of the invention may be combined with one or more (e.g., one, two, three, four, one or two, one to three, or one to four) other therapeutic agents at any dose of the compound (e.g., 10 mg to 1000 mg of the compound).

[0261] Co-administration includes administering a unit dose of a compound disclosed herein before or after administering a unit dose of one or more other therapeutic agents. The compounds disclosed herein may be administered within seconds, minutes, or hours of administering one or more other therapeutic agents. For example, in some embodiments, a unit dose of a compound disclosed herein is first administered, followed by a unit dose of one or more other therapeutic agents within seconds or minutes. Alternatively, in other embodiments, a unit dose of one or more other therapeutic agents is first administered, followed by a unit dose of a compound disclosed herein within seconds or minutes. In some embodiments, a unit dose of a compound disclosed herein is first administered, followed by a unit dose of one or more other therapeutic agents after a period of time (e.g., 1 to 12 hours). In other embodiments, a unit dose of one or more other therapeutic agents is first administered, followed by a unit dose of a compound disclosed herein after a period of time (e.g., 1 to 12 hours).

[0262] In certain embodiments, the compounds disclosed herein are combined with one or more other therapeutic agents in a single dosage form for simultaneous administration to a subject, for example, in a solid dosage form for oral administration.

[0263] In certain embodiments, the compounds of the invention are formulated as tablets, which may optionally contain one or more other compounds useful for treating the disease being treated. In certain embodiments, the tablets may contain another active ingredient useful for treating viral diseases (e.g., hepatitis B virus or HIV).

[0264] In certain embodiments, the tablets are suitable for once-daily administration.

[0265] In one embodiment, a pharmaceutical composition is provided that includes a compound disclosed herein, or a pharmaceutically acceptable salt thereof, in combination with one or more (e.g., one, two, three, one or two, one to three) other therapeutic agents, and a pharmaceutically acceptable carrier, diluent, or excipient.

[0266] In one embodiment, a kit is provided comprising a compound disclosed herein, or a pharmaceutically acceptable salt thereof, in combination with one or more (e.g., one, two, three, four, one or two, or one to three, or one to four) other therapeutic agents.

[0267] Viral combination therapy

[0268] The compounds described herein can be used or combined with one or more antiviral agents, including abacavir, aciclovir, adefovir, amantadine, amprenavir, arbidol, atazanavir, artipla, brivudine, cidofovir, combivir, edoxudin, e), efavirenz, emtricitabine, enfuvirtide, entecavir, fomvirsen, fosamprenavir, foscarnet, fosfonet, ganciclovir, gardasil, ibacitabine, immunovir, idoxuridine , imiquimod, indinavir, inosine, integrase inhibitors, interferon (including type III interferon, type II interferon, type I interferon), lamivudine, lopinavir, loviride, MK-0518, maraviroc, moroxydine, nelfinavir, nevirapine, nexavir, nucleoside analogs, oseltamivir ( oseltamivir), penciclovir, peramivir, pleconaril, podophyllotoxin, protease inhibitors, reverse transcriptase inhibitors, ribavirin, rimantadine, ritonavir, saquinavir, stavudine, tenofovir, tenofovir disoproxildisoproxil, tipranavir, trifluridine, trizivir, tromantadine, truvada, valganciclovir, vicriviroc, vidarabine, viramidine, zalcitabine, zanamivir, zidovudine, and combinations thereof.

[0269] In certain embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with 5 to 30 mg of tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate, or tenofovir alafenamide. In certain embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with 5 to 10, 5 to 15, 5 to 20, 5 to 25, 25 to 30, 20 to 30, 15 to 30, or 10 to 30 mg of tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate, or tenofovir alafenamide. In certain embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with 10 mg of tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate, or tenofovir alafenamide. In certain embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with 25 mg of tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate, or tenofovir alafenamide. As disclosed herein, compounds (e.g., compounds of formula (I)) can be combined with the agents provided herein in any dose of the compound (e.g., 50 mg to 500 mg of the compound), as is the case with each dose combination being specifically and individually listed.

[0270] In certain embodiments, a compound disclosed herein, or a pharmaceutically acceptable salt thereof, is combined with 100 to 400 mg of tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate, or tenofovir disoproxil. In certain embodiments, a compound disclosed herein, or a pharmaceutically acceptable salt thereof, is combined with 100-150, 100-200, 100-250, 100-300, 100-350, 150-200, 150-250, 150-300, 150-350, 150-400, 200-250, 200-300, 200-350, 200-400, 250-350, 250-400, 350-400, or 300-400 mg of tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate, or tenofovir disoproxil. In certain embodiments, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with 300mg of tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate or tenofovir disoproxil. In certain embodiments, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with 250mg of tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate or tenofovir disoproxil. In certain embodiments, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with 150mg of tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate or tenofovir disoproxil. As disclosed herein, the compounds (e.g., compounds of formula (I)) can be combined with the pharmaceutical agents provided herein in the form of any dose of the compound (e.g., 50mg to 500mg compound), which is the same as the case where each dose combination is specifically and individually listed.

[0271] HIV combination therapy

[0272] In certain embodiments, a method for treating or preventing HIV infection in a human or animal with infection or at risk of infection is provided, comprising administering to the human or animal a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, in combination with a therapeutically effective amount of one or more (e.g., one, two, three, one or two, or one to three) other therapeutic agents. In one embodiment, a method for treating HIV infection in a human or animal with infection or at risk of infection is provided, comprising administering to the human or animal a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, in combination with a therapeutically effective amount of one or more (e.g., one, two, three, one or two, or one to three) other therapeutic agents.

[0273] In certain embodiments, the present invention provides a method for treating HIV infection, comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, in combination with a therapeutically effective amount of one or more other therapeutic agents suitable for treating HIV infection.

[0274] In certain embodiments, the compounds disclosed herein are formulated in the form of tablets, which may optionally contain one or more other compounds useful for treating HIV. In certain embodiments, the tablets may contain another active ingredient for treating HIV, such as HIV protease inhibitors, HIV non-nucleoside or non-nucleotide reverse transcriptase inhibitors, HIV nucleoside or nucleotide reverse transcriptase inhibitors, HIV integrase inhibitors, HIV non-catalytic site (or allosteric) integrase inhibitors, pharmacokinetic enhancers, and combinations thereof.

[0275] In certain embodiments, the tablets are suitable for once-daily administration.

[0276] In the above embodiments, the other therapeutic agent may be an anti-HIV agent. In some embodiments, the other therapeutic agent is selected from the group consisting of: HIV combination drugs, HIV protease inhibitors, HIV non-nucleoside or non-nucleotide reverse transcriptase inhibitors, HIV nucleoside or nucleotide reverse transcriptase inhibitors, HIV integrase inhibitors, HIV non-catalytic site (or ectopic) integrase inhibitors, HIV entry inhibitors, HIV maturation inhibitors, immunomodulators, immunotherapeutics, antibody-drug conjugates, gene regulators, gene editing factors (such as CRISPR / Cas9, zinc finger nucleases, homing nucleases, synthetic nucleases, TALEN), cell therapies (such as chimeric antigen receptor T cells, CAR-T and engineered T cell receptors, TCR-T), latency reversal agents, compounds targeting HIV capsid, immune-based therapies, phosphatidylinositol 3-kinase (PI3K) inhibitors, alpha-4 / beta-7 antagonists, HIV antibodies, bispecific antibodies and "antibody-like" therapeutic proteins, HIV p17 matrix protein inhibitors, IL-13 antagonists, peptidyl-prolyl cis-trans isomerase A modulators, disulfide protein isomerase inhibitors, complement C5a receptor antagonists, DNA methyltransferase inhibitors, HIV vif gene modulators, Vif dimerization antagonists, HIV-1 viral infectivity factor inhibitors, TAT protein inhibitors, HIV-1 Nef modulators, Hck tyrosine kinase modulators, mixed lineage kinase-3 (MLK-3) inhibitors, HIV-1 splicing inhibitors, Rev protein inhibitors, integrin antagonists, nuclear protein inhibitors, splicing factor modulators, COMM domain-containing protein 1 modulators, HIV ribonuclease H inhibitors, reverse cell cycle regulators, CDK-9 inhibitors, dendritic ICAM-3 capture non-integrin 1 inhibitors, HIV GAG protein inhibitors, HIV POL protein inhibitors, complement factor H regulators, ubiquitin ligase inhibitors, deoxycytidine kinase inhibitors, cyclin-dependent kinase inhibitors, proprotein convertase PC9 stimulators, ATP-dependent RNA helicase DDX3X inhibitors, reverse transcriptase activation complex inhibitors, G6PD and NADH-oxidase inhibitors, pharmacokinetic enhancers, HIV gene therapy, HIV vaccines and other HIV therapeutic agents and combinations thereof.

[0277] In some embodiments, the other therapeutic agent is selected from the group consisting of: combination drugs for HIV, other drugs for treating HIV, HIV protease inhibitors, HIV reverse transcriptase inhibitors, HIV integrase inhibitors, HIV non-catalytic site (or ectopic) integrase inhibitors, HIV entry (fusion) inhibitors, HIV maturation inhibitors, latency reversal agents, capsid inhibitors, immune-based therapies, PI3K inhibitors, HIV antibodies, and bispecific antibodies, and "antibody-like" therapeutic proteins, and combinations thereof.

[0278] HIV combination drugs

[0279] Examples of combination drugs include (efavirenz, tenofovir disoproxil fumarate, and emtricitabine); ( rilpivirine, tenofovir disoproxil fumarate, and emtricitabine); (elvitegravir, cobicistat, tenofovir disoproxil fumarate, and emtricitabine); (tenofovir disoproxil fumarate and emtricitabine; TDF+FTC); (tenofovir alafenamide and emtricitabine); (tenofovir alafenamide, emtricitabine and rilpivirine), (tenofovir alafenamide, emtricitabine, cobicistat, and elvitegravir); (bictegravir, emtricitabine, tenofovir alafenamide); darunavir, tenofovir alafenamide hemifumarate, emtricitabine and cobicistat; efavirenz, lamivudine and tenofovir disoproxil fumarate; lamivudine and tenofovir disoproxil fumarate; tenofovir and lamivudine; tenofovir alafenamide and emtricitabine; tenofovir alafenamide hemifumarate and emtricitabine; tenofovir alafenamide hemifumarate, emtricitabine and rilpivirine; tenofovir alafenamide hemifumarate, emtricitabine, cobicistat and elvitegravir; (zidovudine and lamivudine; AZT+3TC); ( Abacavir sulfate and lamivudine; ABC+3TC); ( Lopinavir and ritonavir); (dolutegravir, abacavir, and lamivudine); (abacavir sulfate, zidovudine and lamivudine; ABC+AZT+3TC); atazanavir and cobicistat; atazanavir sulfate and cobicistat; atazanavir sulfate and ritonavir; darunavir and cobicistat; dolutegravir and rilpivirine; dolutegravir and rilpivirine hydrochloride; dolutegravir, abacavir sulfate and lamivudine; lamivudine, nevirapine and zidovudine; raltegravir and lamivudine; doravirine, lamivudine and tenofovir disoproxil fumarate; doravirine, lamivudine and tenofovir Disoproxil; dolutegravir + lamivudine, lamivudine + abacavir + zidovudine, lamivudine + abacavir, lamivudine + tenofovir disoproxil fumarate, lamivudine + zidovudine + nevirapine, clopinavir + ritonavir, clopinavir + ritonavir + abacavir + lamivudine, clopinavir + ritonavir + zidovudine + lamivudine, tenofovir + lamivudine, and tenofovir disoproxil fumarate + emtricitabine + rilpivirine hydrochloride, clopinavir, ritonavir, zidovudine and lamivudine; Vacc-4x and romidepsin; and APH-0812.

[0280] HIV protease inhibitors

[0281] Examples of HIV protease inhibitors include amprenavir, atazanavir, brecanavir, darunavir, fosamprenavir, fosamprenavir calcium, indinavir, indinavir sulfate, lopinavir, nelfinavir, nelfinavir mesylate, ritonavir, saquinavir, saquinavir mesylate, tipranavir, DG-17, TMB-657 (PPL-100), T-169, BL-008, and TMC-310911.

[0282] HIV reverse transcriptase inhibitors

[0283] Examples of HIV non-nucleoside or non-nucleotide reverse transcriptase inhibitors include dapivirine, delavirdine, delavirdine mesylate, doravirine, efavirenz, etravirine, lentinan, nevirapine, rilpivirine, ACC-007, AIC-292, KM-023, PC-1005, and VM-1500.

[0284] Examples of HIV nucleoside or nucleotide reverse transcriptase inhibitors include adefovir, adefovir dipivoxil, azvudine, emtricitabine, tenofovir, tenofovir alafenamide, tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate, tenofovir disoproxil, tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate, and VIDEX (didanosine, ddl), abacavir, abacavir sulfate, alovudine, apricitabine, censavudine, didanosine, elvucitabine, festinavir, fosalvudine tidoxil, CMX-157, dapivirine, doravirine, etravirine, OCR-5753, tenofovir disoproxil orotate, fozivudine tidoxil, lamivudine, phosphazid, stavudine, zalcitabine, zidovudine, GS-9131, GS-9148, MK-8504 and KP-1461.

[0285] HIV integrase inhibitors

[0286] Examples of HIV integrase inhibitors include elvitegravir, curcumin, a derivative of curcumin, chicoric acid, a derivative of chicoric acid, 3,5-dicaffeoylquinic acid, a derivative of 3,5-dicaffeoylquinic acid, a golden tricarboxylic acid, a derivative of a golden tricarboxylic acid, caffeic acid phenethyl ester, a derivative of caffeic acid phenethyl ester, a tyrosine phosphorylation inhibitor, a derivative of a tyrosine phosphorylation inhibitor, quercetin, a derivative of quercetin, raltegravir, dolutegravir, JTK-351, bictegravir, AVX- 15567, cabotegravir (long-acting injectable), diketoquinoline-4-1 derivative, integrase-LEDGF inhibitor, ledgin, M-522, M-532, NSC-310217, NSC-371056, NSC-48240, NSC-642710, NSC-699171, NSC-699172, NSC-699173, NSC-699174, stilbene disulfonic acid, T-169 and cabotegravir.

[0287] Examples of HIV non-catalytic site or allosteric integrase inhibitors (NCINIs) include CX-05045, CX-05168, and CX-14442.

[0288] HIV entry inhibitors

[0289] Examples of HIV entry (fusion) inhibitors include cenicriviroc, CCR5 inhibitors, gp41 inhibitors, CD4 attachment inhibitors, gpl20 inhibitors, and CXCR4 inhibitors.

[0290] Examples of CCR5 inhibitors include apraviroc, vicriviroc, maraviroc, seneviroc, PRO-140, adaptavir (RAP-101), nifeviroc (TD-0232), anti-GP120 / CD4 or CCR5 bispecific antibodies, B-07, MB-66, polypeptide C25P, TD-0680, and vMIP (Haimipu).

[0291] Examples of gp41 inhibitors include albuvirtide, enfuvirtide, BMS-986197, enfuvirtide biobetter, enfuvirtide biosimilar, HIV-1 fusion inhibitor (P26-Bapc), ITV-1, ITV-2, ITV-3, ITV-4, PIE-12 trimer, and sifuvirtide.

[0292] Examples of CD4 attachment inhibitors include ibalizumab and CADA analogs.

[0293] Examples of gp120 inhibitors include Radha-108 (receptor) 3B3-PE38, BanLec, bentonite-based nanomedicine, fostemsavir tromethamine, IQP-0831, and BMS-663068.

[0294] Examples of CXCR4 inhibitors include plerixafor, ALT-1188, N15 peptide, and vMIP (hemicept).

[0295] HIV maturation inhibitors

[0296] Examples of HIV maturation inhibitors include BMS-955176 and GSK-2838232.

[0297] Latency reversal agents

[0298] Examples of latency reversing agents include histone deacetylase (HDAC) inhibitors, proteasome inhibitors such as velcade, protein kinase C (PKC) activators, Smyd2 inhibitors, BET-bromodomain 4 (BRD4) inhibitors, ionomycin, PMA, SAHA (suberoylanilide hydroxamic acid, or suberoyl, aniline, and hydroxamic acid), AM-0015, ALT-803, NIZ-985, NKTR-255, IL-15 modulating antibodies, JQ1, disulfiram, amphotericin B, and ubiquitin inhibitors such as largazole analogs, and GSK-343.

[0299] Examples of HDAC inhibitors include romidepsin, vorinostat, and panobinostat.

[0300] Examples of PKC activators include indolactam, prostratin, ingenol B and DAG lactone.

[0301] Capsid inhibitors

[0302] Examples of capsid inhibitors include capsid polymerization inhibitors or capsid cleavage compounds, HIV nucleoprotein capsid p7 (NCp7) inhibitors such as azodicarbonamide, HIV p24 capsid protein inhibitors, AVI-621, AVI-101, AVI-201, AVI-301, and AVI-CAN1-15 series.

[0303] Immune-based therapies

[0304] Examples of immune-based therapies include Toll-like receptor modulators, such as TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12, and TLR13; progressive cell death protein 1 (Pd-1) modulators; progressive death ligand 1 (Pd-L1) modulators; IL-15 modulators; DermaVir; interleukin-7; chloroquine (hydroxychloroquine); proleukin (aldesleukin, IL-2); interferon alpha; interferon alpha-2b; interferon alpha-n3; pegylated interferon alpha; interferon gamma; hydroxyurea; mycophenolic acid morpholino ethyl (MPA) and its ester derivative mycophenolic acid morpholino ethyl (MMF); ribavirin; rintatolimod, polymer polyethyleneimine (PEI); gepon; rintatolimod; IL-12; WF-10; VGV-1; MOR-22; BMS-936559; CYT-107, interleukin-15 / Fc fusion protein, normferon, pegylated interferon alpha-2a, pegylated interferon alpha-2b, recombinant interleukin-15, RPI-MN, GS-9620, STING modulators, RIG-I modulators, NOD2 modulators, and IR-103.

[0305] Examples of TLR8 modulators include motolimod, resiquimod, 3M-051, 3M-052, MCT-465, IMO-4200, VTX-763, VTX-1463, and modulators disclosed in the following documents: US20140045849 (Janssen), US20140073642 (Janssen), WO2014 / 056953 (Janssen), WO2014 / 076221 (Janssen), WO2014 / 128189 (Janssen), US20140350031 (Janssen), WO2014 / 023813 (Janssen), US20080234251 (Array Biopharma), US20080306050 (Array Biopharma). Biopharma), US20100029585 (Ventirx Pharma), US20110092485 (Ventirx Pharma), US20110118235 (Ventirx Pharma), US20120082658 (Ventirx Pharma), US20120219615 (Ventirx Pharma), US20140066432 (Ventirx Pharma), US20140088085 (VentirxPharma), US20140275167 (Novira therapeutics), US20130251673 (Novira therapeutics), U.S. Patent No. 9670205 (Gilead Sciences Inc.), US20160289229 (Gilead Sciences Inc.), U.S. Patent Application No. 15 / 692161 (Gilead Sciences Inc.) and U.S. Patent Application No. 15 / 692,093 (Gilead Sciences Inc.).

[0306] Phosphatidylinositol 3-kinase (PI3K) inhibitors

[0307] Examples of PI3K inhibitors include idelalisib, alpelisib, buparlisib, CAI orotate, copanlisib, duvelisib, gedatolisib, neratinib, panulisib, perifosine, pictilisib, pilaralisib, puquitinib mesylate, and selenirib. mesylate), rigosertib, rigosertib sodium, sonolisib, taselisib, AMG-319, AZD-8186, BAY-1082439, CLR-1401, CLR-457, CUDC-907, DS-7423, EN-3342, GSK-2126458, GSK-22 69577, GSK-2636771, INCB-040093, LY-3023414, MLN-1117, PQR-309, RG-7666, RP-6530, RV- 1729, SAR-245409, SAR-260301, SF-1126, TGR-1202, UCB-5857, VS-5584, XL-765, and ZSTK-474.

[0308] Alpha-4 / beta-7 antagonists

[0309] Examples of integrin α-4 / β-7 antagonists include PTG-100, TRK-170, abrilumab, etrolizumab, carotegrast methyl, and vedolizumab.

[0310] HIV antibodies, bispecific antibodies, and "antibody-like" therapeutic proteins

[0311] Examples of HIV antibodies, bispecific antibodies, and "antibody-like" therapeutic proteins include Fab derivatives, bnABs (broadly neutralizing HIV-1 antibodies), BMS-936559, TMB-360 and antibodies targeting HIV gp120 or gp41, antibody recruitment molecules targeting HIV, anti-CD63 monoclonal antibodies, anti-GB virus C antibodies, anti-GP120 / CD4, CCR5 bispecific antibodies, anti-nef single domain antibodies, anti-Rev antibodies, camel-derived anti-CD18 antibodies, camel-derived anti-ICAM-1 antibodies, DCVax-001, antibodies targeting gp140, gp41-based HIV therapeutic antibodies, human recombinant mAb (PGT-121), ibalizumab, Immuglo and MB-66.

[0312] Examples of antibodies that target HIV in this manner include bavituximab, UB-421, C2F5, 2G12, C4E10, C2F5+C2G12+C4E10, 8ANC195, 3BNC117, 3BNC60, 10-1074, PGT145, PGT121, PGT-151, PGT-133, MDX010 (ipilimumab), DH511, N6, VRC01 PGDM1400, A32, 7B2, 10E8, 10E8v4, CAP256-VRC26.25, DRVIA7, VRC-07-523, VRC-HIVMAB080-00-AB, VRC-HIVMAB060-00-AB, MGD-014, and VRC07. Examples of HIV bispecific antibodies include MGD014.

[0313] Pharmacokinetic enhancers

[0314] Examples of pharmacokinetic enhancers include cobicistat and ritonavir.

[0315] HIV vaccine

[0316] Examples of HIV vaccines include peptide vaccines, recombinant subunit protein vaccines, live vector vaccines, DNA vaccines, CD4-derived peptide vaccines, vaccine combinations, rgp120 (AIDSVAX), ALVAC HIV (vCP1521) / AIDSVAX B / E (gp120) (RV144), monomeric gp120 HIV-1 subtype C vaccine, Remune, ITV-1, Contre Vir, Ad5-ENVA-48, DCVax-001 (CDX-2401), Vacc-4x, Vacc-C5, VAC-3S, multiclade DNA recombinant adenovirus-5 (rAd5), Pennvax-G, Pennvax-GP, HIV-TriMix-mRNA vaccine, HIV-LAMP-vax, Ad35, Ad35-GRIN, NAcGM3 / VSSP ISA-51, poly-ICLC adjuvanted vaccine, TatImmune, GTU-multiHIV (FIT-06), gp140[δ]V2.TV1+MF-59, rVSVIN HIV-1 gag vaccine, SeV-Gag vaccine, AT-20, DNK-4, ad35-Grin / ENV, TBC-M4, HIVAX, HIVAX-2, NYVAC-HIV-PT1, NYVAC-HIV-PT4, DNA-HIV-PT123, rAAV1-PG9DP, GOVX-B11, GOVX-B21, TVI-HIV-1, Ad-4 (Ad4-env evolutionary branch C + Ad4-mGag), EN41-UGR7C, EN41-FPA2, PreVaxTat, AE-H, MYM-V101, CombiHIVvac, ADVAX, MYM-V201, MVA-CMDR, DNA-Ad5 gag / pol / nef / nev(HVTN505), MVATG-17401, ETV-01, CDX-1401, rcAD26.MOS1.HIV-Env, Ad26.Mod.HIV vaccine, AGS-004, AVX-101, AVX-201, PEP-6409, SAV-001, ThV-01, TL-01, TUTI-16, VGX-3300, IHV-001 and virus-like particle vaccines (such as pseudovirion vaccines), CombiVICHvac, LFn-p24 B / C fusion vaccine, GTU-based DNA vaccine, HIV gag / pol / nef / env DNA vaccine, anti-TAT HIV vaccine, conjugated peptide vaccine, dendritic cell vaccine, gag-based DNA vaccine, GI-2010, gp41 HIV-1 vaccine, HIV vaccine (PIKA adjuvant), II-key / MHC class II antigen determinant hybrid peptide vaccine, ITV-2, ITV-3, ITV-4, LIPO-5, multi-clade Env vaccine, MVA vaccine, Pennvax-GP, pp71-deleted HCMV vector HIV gag vaccine, recombinant peptide vaccine (HIV infection), NCI, rgp160 HIV vaccine, RNActive HIV vaccine, SCB-703, Tat Oyi vaccine, TBC-M4, therapeutic HIV vaccine, UBI HIV gp120, Vacc-4x+romidepsin, variant gp120 peptide vaccine, rAd5 gag-pol env A / B / C vaccine, DNA.HTI and MVA.HTI. .

[0317] Additional HIV treatments

[0318] Examples of other therapeutic agents include compounds disclosed in WO 2004 / 096286 (Gilead Sciences), WO 2006 / 015261 (Gilead Sciences), WO 2006 / 110157 (Gilead Sciences), WO 2012 / 003497 (Gilead Sciences), WO 2012 / 003498 (Gilead Sciences), WO 2012 / 145728 (Gilead Sciences), WO 2013 / 006738 (Gilead Sciences), WO 2013 / 159064 (Gilead Sciences), WO 2014 / 100323 (Gilead Sciences), US 2013 / 0165489 (University of Pennsylvania), US 2014 / 0221378 (Japan Tobacco), US 2014 / 0221380 (Japan Tobacco), WO 2009 / 062285 (Boehringer Ingelheim), WO 2010 / 130034 (Boehringer Ingelheim), WO 2013 / 006792 (Pharma Resources), US 20140221356 (Gilead Sciences), US 20100143301 (GileadSciences) and WO 2013 / 091096(Boehringer Ingelheim).

[0319] Examples of other drugs used to treat HIV include acemannan, alisporivir, BanLec, deferiprone, Gamimune, metenkefalin, naltrexone, Prolastin, REP 9, RPI-MN, VSSP, H1viral, SB-728-T, 1,5-dicaffeoylquinic acid, rHIV7-shl-TAR-CCR5RZ, AAV-eCD4-Ig gene therapy, MazF gene therapy, BlockAide, ABX-464, AG-1105, APH-0812, BIT-225, CYT-107, HGTV-43, HPH-116, HS-10234, IM O-3100, IND-02, MK-1376, MK-8507, MK-8591, NOV-205, PA-1050040 (PA-040), PGN-007, SCY-635, SB -9200, SCB-719, TR-452, TEV-90110, TEV-90112, TEV-90111, TEV-90113, RN-18, Immuglo, and VIR-576.

[0320] Gene therapy and cell therapy

[0321] Gene therapy and cell therapy include: genetic modification to silence genes; genetic methods to directly kill infected cells; immune cell infusions designed to replace large parts of an individual's own immune system to enhance the immune response to infected cells or activate an individual's own immune system to kill infected cells, or to seek out and kill infected cells; genetic methods to modify cellular activity to further alter the endogenous immune response to infection.

[0322] Examples of dendritic cell therapies include AGS-004.

[0323] Gene editing factors

[0324] Examples of gene editing systems include the CRISPR / Cas9 system, zinc finger nuclease system, TALEN system, homing endonuclease system, and meganuclease system.

[0325] Examples of CRISPR / Cas9 systems targeting HIV include EBT101.

[0326] CAR-T cell therapy

[0327] CAR-T cell therapy includes a population of immune effector cells engineered to express a chimeric antigen receptor (CAR), wherein the CAR comprises an HIV antigen binding domain. HIV antigens include HIV envelope proteins or portions thereof, gp120 or portions thereof, CD4 binding sites on gp120, CD4 induction binding sites on gp120, N-glycans on gp120, V2 of gp120, and proximal membrane regions on gp41. Immune effector cells are T cells or NK cells. In some embodiments, T cells are CD4+T cells, CD8+T cells, or a combination thereof.

[0328] Examples of HIV CAR-T include VC-CAR-T.

[0329] TCR-T cell therapy

[0330] TCR-T cell therapy involves T cells engineered to target HIV-derived peptides on the surface of virus-infected cells.

[0331] Those skilled in the art will appreciate that the above-listed additional therapeutic agents may be included in more than one of the above-listed classes. Specific classes are not intended to limit the functionality of those compounds listed in those classes.

[0332] In a specific embodiment, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with HIV nucleoside or nucleotide reverse transcriptase inhibitors and HIV non-nucleoside reverse transcriptase inhibitors. In another specific embodiment, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with HIV nucleoside or nucleotide reverse transcriptase inhibitors and HIV protease inhibitor compounds. In another embodiment, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with HIV nucleoside or nucleotide reverse transcriptase inhibitors, HIV non-nucleoside reverse transcriptase inhibitors and pharmacokinetic enhancers. In certain embodiments, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with at least one HIV nucleoside reverse transcriptase inhibitor, an integrase inhibitor and a pharmacokinetic enhancer. In another embodiment, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with two HIV nucleoside or nucleotide reverse transcriptase inhibitors.

[0333] In certain embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with one, two, three, four or more additional therapeutic agents selected from: (efavirenz, tenofovir disoproxil fumarate, and emtricitabine); ( rilpivirine, tenofovir disoproxil fumarate, and emtricitabine); (elvitegravir, cobicistat, tenofovir disoproxil fumarate, and emtricitabine); (tenofovir disoproxil fumarate and emtricitabine; TDF+FTC); (tenofovir alafenamide and emtricitabine); (tenofovir alafenamide, emtricitabine, and rilpivirine); (tenofovir alafenamide, emtricitabine, cobicistat, and elvitegravir); (Bitutegravir, Emtricitabine, Tenofovir Alafenamide); Adefovir; Adefovir Dipivoxil; Cobicistat; Emtricitabine; Tenofovir; Tenofovir Disoproxil; Tenofovir Disoproxil Fumarate; Tenofovir Alafenamide; Tenofovir Hemifumarate; (durulavir, abacavir and lamivudine);durulavir, abacavir sulfate and lamivudine;raltegravir;raltegravir and lamivudine;maraviroc;enfuvirtide; ( lopinavir and ritonavir); (zidovudine and lamivudine; AZT+3TC); ( Abacavir sulfate and lamivudine; ABC+3TC); (abacavir sulfate, zidovudine and lamivudine; ABC+AZT+3TC); Rilpivirine; Rilpivirine hydrochloride; Atazanavir sulfate and cobicistat; Atazanavir and cobicistat; Darunavir and cobicistat; Atazanavir; Atazanavir sulfate; Dolulavir; Elvitegravir; Ritonavir; Atazanavir sulfate and ritonavir; Darunavir; Lamivudine; Pralastine; Fosamprenavir; Fosamprenavir calcium efavirenz; Etravirine; Nelfinavir; Nelfinavir mesylate; Interferon; Didanosine; stavudine; indinavir; indinavir sulfate; tenofovir and lamivudine; zidovudine; nevirapine; saquinavir; saquinavir mesylate; aldesleukin; zalcitabine; tipranavir; amprenavir; delavirdine; delavirdine mesylate; Radha-108 (resipitor); lamivudine and tenofovir disoproxil fumarate; efavirenz, lamivudine and tenofovir disoproxil fumarate; fosfezin; lamivudine, nevirapine and zidovudine; abacavir; and abacavir sulfate.

[0334] In specific embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with abacavir sulfate, tenofovir, tenofovir disoproxil, tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate, tenofovir alafenamide, tenofovir alafenamide hemifumarate, or biclavir.

[0335] In certain embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with tenofovir, tenofovir disoproxil, tenofovir disoproxil fumarate, tenofovir alafenamide, tenofovir alafenamide hemifumarate, or bictegravir.

[0336] In a specific embodiment, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with: a first additional therapeutic agent selected from the group consisting of abacavir sulfate, tenofovir, tenofovir disoproxil, tenofovir disoproxil fumarate, tenofovir alafenamide, tenofovir alafenamide hemifumarate, and bisoprolol; and a second additional therapeutic agent selected from the group consisting of emtricitabine and lamivudine.

[0337] In certain embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with a first additional therapeutic agent and a second additional therapeutic agent selected from the group consisting of tenofovir, tenofovir disoproxil, tenofovir disoproxil fumarate, tenofovir alafenamide, tenofovir alafenamide hemifumarate, and bistegravir, wherein the second additional therapeutic agent is emtricitabine.

[0338] In certain embodiments, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with 5 to 30 mg of tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate or tenofovir alafenamide and 200 mg of emtricitabine. In certain embodiments, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with 5 to 10 mg, 5 to 15 mg, 5 to 20 mg, 5 to 25 mg, 25 to 30 mg, 20 to 30 mg, 15 to 30 mg or 10 to 30 mg of tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate or tenofovir alafenamide and 200 mg of emtricitabine. In certain embodiments, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with 10 mg of tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate or tenofovir alafenamide and 200 mg of emtricitabine. In certain embodiments, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with 25 mg of tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate, or tenofovir alafenamide and 200 mg of emtricitabine. As disclosed herein, compounds (e.g., compounds of formula (I)) can be combined with the agents provided herein in any dose of the compound (e.g., 1 mg to 500 mg of the compound), as is the case with each dose combination being specifically and individually listed.

[0339] In certain embodiments, a compound disclosed herein, or a pharmaceutically acceptable salt thereof, is combined with 200 to 400 mg of tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate, or tenofovir disoproxil and 200 mg of emtricitabine. In certain embodiments, a compound disclosed herein, or a pharmaceutically acceptable salt thereof, is combined with 200 to 250 mg, 200 to 300 mg, 200 to 350 mg, 250 to 350 mg, 250 to 400 mg, 350 to 400 mg, 300 to 400 mg, or 250 to 400 mg of tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate, or tenofovir disoproxil and 200 mg of emtricitabine. In certain embodiments, a compound disclosed herein or a pharmaceutically acceptable salt thereof is combined with 300 mg of tenofovir disoproxil fumarate, tenofovir disoproxil hemifumarate or tenofovir disoproxil and 200 mg of emtricitabine. A compound as disclosed herein (e.g., a compound of formula (I)) can be combined with an agent provided herein in any dose of the compound (e.g., 1 mg to 500 mg of the compound), as is the case with each dose combination being specifically and individually listed.

[0340] HBV combination therapy

[0341] In certain embodiments, a method for treating or preventing HBV infection in a human with infection or at risk of infection is provided, comprising administering to the human a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of one or more (e.g., one, two, three, four, one or two, one to three, or one to four) other therapeutic agents in combination. In one embodiment, a method for treating HBV infection in a human with infection or at risk of infection is provided, comprising administering to the human a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of one or more (e.g., one, two, three, four, one or two, one to three, or one to four) other therapeutic agents in combination.

[0342] In certain embodiments, the present invention provides a method for treating HBV infection, comprising administering to a patient in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, in combination with a therapeutically effective amount of one or more (e.g., one, two, three, four, one or two, one to three, or one to four) other therapeutic agents suitable for treating HBV infection.

[0343] The compounds described herein can be used or combined with one or more of the following: chemotherapeutic agents, immunomodulatory agents, immunotherapeutic agents, therapeutic antibodies, therapeutic vaccines, bispecific antibodies, and "antibody-like" therapeutic proteins (such as Fab derivatives), antibody-drug conjugates (ADCs), gene modifiers or gene editing factors (such as CRISPR Cas9, zinc finger nucleases, homing endonucleases, synthetic nucleases, TALENs), cell therapies (such as CAR-T (chimeric antigen receptor T cells) and TCR-T (engineered T cell receptor) agents), or any combination thereof.

[0344] In certain embodiments, the compound of formula (I) is formulated as a tablet, which may optionally contain one or more other compounds useful for treating HBV. In certain embodiments, the tablet may contain another active ingredient for treating HBV, such as 3-dioxygenase (IDO) inhibitors, apolipoprotein A1 modulators, arginase inhibitors, B lymphocyte and T lymphocyte attenuation inhibitors, Bruton's tyrosine kinase (BTK) inhibitors, CCR2 chemokine antagonists, CD137 inhibitors, CD160 inhibitors, CD305 inhibitors, CD4 agonists and modulators, compounds targeting HBcAg, compounds targeting hepatitis B core antigen (HBcAg), core protein allosteric modulators, covalently closed circular DNA (cccDNA) inhibitors, cyclophilin inhibitors, cytotoxic T lymphocyte-associated protein 4 (ipi4) inhibitors, DNA polymerase inhibitors, endonuclease modulators, epigenetic modulators, farnesoid X receptor agonists, HBsAg inhibitors, HBsAg secretion or assembly inhibitors, HBV DNA polymerase inhibitors, HBV replication inhibitors, HBVRNAse inhibitors, HBV virus entry inhibitors, HBx inhibitors, hepatitis B large envelope protein regulators, hepatitis B large envelope protein stimulators, hepatitis B structural protein regulators, hepatitis B surface antigen (HBsAg) inhibitors, hepatitis B surface antigen (HBsAg) secretion or assembly inhibitors, hepatitis B virus E antigen inhibitors, hepatitis B virus replication inhibitors, hepatitis virus structural protein inhibitors, HIV-1 reverse transcriptase inhibitors, hyaluronidase inhibitors, IAPs inhibitors, IL-2 agonists, IL-7 agonists, immunomodulators, indoleamine-2 inhibitors, ribonucleotide reductase inhibitors, interleukin-2 ligands, ipi4 inhibitors, lysine demethylase inhibitors, histone demethylase inhibitors, KDM1 inhibitors, KDM5 inhibitors, killer cell lectin-like receptor subfamily G member 1 inhibitors, lymphocyte activation gene 3 inhibitors, lymphotoxin beta Receptor activators, Axl modulators, B7-H3 modulators, B7-H4 modulators, CD160 modulators, CD161 modulators, CD27 modulators, CD47 modulators, CD70 modulators, GITR modulators, HEVEM modulators, ICOS modulators, Mer modulators, NKG2A modulators, NKG2D modulators, OX40 modulators, SIRPα modulators, TIGIT modulators, Tim-4 modulators, Tyro modulators, Na+-taurocholate co-transporting polypeptide (NTCP) inhibitors, natural killer cell receptor 2B4 inhibitors, NOD2 gene stimulators, nuclear protein inhibitors, nuclear protein modulators, PD-1 inhibitors, PD-L1 inhibitors, peptidyl prolyl isomerase inhibitors, phosphatidylcyclohexane hexol-3 kinase (PI3K) inhibitors, retinoic acid-inducible gene 1 stimulators, reverse transcriptase inhibitors, ribonuclease inhibitors, RNA DNA polymerase inhibitors, SLC10A1 gene inhibitors, SMAC mimetics, Src tyrosine kinase inhibitors, interferon gene (STING) promoter stimulators, NOD1 stimulators, T cell surface glycoprotein CD28 inhibitors, T cell surface glycoprotein CD8 regulators, thymosin agonists, thymosin α1 ligands, Tim-3 inhibitors, TLR-3 agonists, TLR-7 agonists, TLR-9 agonists, TLR9 gene stimulators, Toll-like receptor (TLR) regulators, viral ribonucleotide reductase inhibitors, and combinations thereof.

[0345] HBV combination drugs

[0346] Examples of combination drugs used to treat HBV include (tenofovir disoproxil fumarate and emtricitabine); ABX-203, lamivudine, and PEG-IFN-α; ABX-203 adefovir and PEG-IFNα; and INO-1800 (INO-9112 and RG7944).

[0347] Other HBV drugs

[0348] Examples of other drugs used to treat HBV include alpha-hydroxyphenol, amdoxovir, beta-hydroxycytidine, AL-034, CCC-0975, elvucitabine, ezetimibe, cyclosporine A, gentiopicrin / gentiopicroside, JNJ-56136379, nitazoxanide, birinapant, NJK14047, NOV-205 (molixan, BAM-205), oligonucleotides, mivotilate, feron, GST-HG-131, levamisole, Ka Shu Ning, alloferon, WS-007, Y-101 (Ti Fen Tai), rSIFN-co, PEG-IIFNm, KW-3, BP-Inter-014, oleanolic acid, HepB-nRNA, cTP-5 (rTP-5), HSK-II-2, HEISCO-106-1, HEISCO-106, Hepbarna, IPB-006IA, and Hepuyinfen, DasKloster 0014-01, ISA-204, Jiangantai (Ganxikang), MIV-210, OB-AI-004, PF-06, picroside, DasKloster-0039, hepulantai, IMB-2613, TCM-800B, reduced glutathione, RO-6864018, RG-7834, UB-551 and ZH-2N,and compounds disclosed in US20150210682 (Roche), US 2016 / 0122344 (Roche), WO2015173164, WO2016023877, US2015252057A (Roche), WO16128335A1 (Roche), WO16120186A1 (Roche), US2016237090A (Roche), WO16107833A1 (Roche), WO16107832A1 (Roche), US2016176899A (Roche), WO16102438A1 (Roche), WO16012470A1 (Roche), US2016220586A (Roche) and US2015031687A (Roche). ,

[0349] HBV vaccine

[0350] HBV vaccines include both preventive and therapeutic vaccines. Examples of HBV preventive vaccines include Vaxelis, Hexaxim, Heplisav, Mosquirix, DTwP-HBV vaccine, Bio-Hep-B, D / T / P / HBV / M (LBVP-0101; LBVW-0101), DTwP-Hepb-Hib-IPV vaccine, Heberpenta L, DTwP-HepB-Hib, V-419, CVI-HBV-001, Tetrabhay, hepatitis B preventive vaccine (Advax Super D), Hepatrol-07, GSK-223192A, ENGERIX Recombinant Hepatitis B Vaccine (Intramuscular, Kangtai Biological Products), Recombinant Hepatitis B Vaccine (Hansen Polymorphic Yeast, Intramuscular, Hualan Biological Engineering), Recombinant Hepatitis B Surface Antigen Vaccine, Bimmugen, Euforavac, Eutravac, anrix-DTaP-IPV-Hep B, HBAI-20, Infanrix-DTaP-IPV-Hep B-Hib, Pentabio Vaksin DTP-HB-Hib, Comvac 4, Twinrix, Euvax-B, Tritanrix HB, Infanrix HepB, Comvax, DTP-Hib-HBV Vaccine, DTP-HBV Vaccine, Yi Tai, Heberbiovac HB, Trivac HB, GerVax, DTwP-Hep B-Hib Vaccine, Bilive, Hepavax-Gene, SUPERVAX, Comvac5, Shanvac-B, Hebsulin, Recombivax HB, Revac B mcf, Revac B+, Fendrix, DTwP-HepB-Hib, DNA-001, Shan5, Shan6, rhHBsAG vaccine, HBI pentavalent vaccine, LBVD, Infanrix HeXa, and DTaP-rHB-Hib vaccine.

[0351] Examples of HBV therapeutic vaccines include HBsAG-HBIG complex, ARB-1598, Bio-Hep-B, NASVAC, abi-HB (intravenous), ABX-203, Tetrabhay, GX-110E, GS-4774, peptide vaccine (εPA-44), Hepatrol-07, NASVAC (NASTERAP), IMP-321, BEVAC, Revac B mcf, Revac B+, MGN-1333, KW-2, CVI-HBV-002, AltraHepB, VGX-6200, FP-02, FP-02.2, TG-1050, NU-500, HBVax, im / TriGrid / antigen vaccine, Mega-CD40L-adjuvanted vaccine, HepB-v, RG7944 (INO-1800), recombinant VLP-based therapeutic vaccines (HBV infection, VLP Biotech), AdTG-17909, AdTG-17910, AdTG-18202, ChronVac-B, TG-1050 and LmHBV.

[0352] HBV DNA polymerase inhibitors

[0353] Examples of HBV DNA polymerase inhibitors include adefovir Emtricitabine Tenofovir Disoproxil Fumarate Tenofovir alafenamide, tenofovir, tenofovir disoproxil, tenofovir alafenamide fumarate, tenofovir alafenamide hemifumarate, tenofovir dipivoxil, tenofovir disoproxil fumarate, tenofovir octadecyloxyethyl, CMX-157, besifovir, entecavir Entecavir maleate, telbivudine Filoxavir, pradefovir, clevudine, ribavirin, lamivudine (EPIVIR- ), phosphazide, famciclovir, fusolin, metacavir, SNC-019754, FMCA, AGX-1009, AR-II-04-26, HIP-1302, tenofovir disoproxil aspartate, tenofovir disoproxil orotate, and HS-10234.

[0354] Immunomodulators

[0355] Examples of immunomodulators include retalide, imidol hydrochloride, ingaron, demavir, chloroquine (hydroxychloroquine), proleukin, hydroxyurea, mycophenolate mofetil (MPA) and its ester derivative mycophenolate mofetil (MMF), JNJ-440, WF-10, AB-452, ribavirin, IL-12, INO-9112, polymer polyethyleneimine (PEI), Gepon, VGV-1, MOR-22, CRV-431, JNJ-0535, TG-1050, ABI-H2158, BMS-936559, GS-9688, RO-7011785, RG-7854, AB-506, RO-6871765, AIC-649 and IR-103.

[0356] Toll-like receptor (TLR) modulators

[0357] TLR modulators include modulators of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 and TLR13. Examples of TLR3 modulators include retalide, polyICLC, Apoxxim, IPH-33, MCT-465, MCT-475 and ND-1.1.

[0358] Examples of TLR7 modulators include GS-9620, GSK-2245035, imiquimod, resiquimod, DSR-6434, DSP-3025, IMO-4200, MCT-465, MEDI-9197, 3M-051, SB-9922, 3M-052, Limtop, D, telratolimod), SP-0509, TMX-30X, TMX-202, RG-7863, RG-7795, LHC-165, RG-7854, and compounds disclosed in US20100143301 (Gilead Sciences), US20110098248 (Gilead Sciences), and US20090047249 (Gilead Sciences).

[0359] Examples of TLR8 modulators include motomod, resimod, 3M-051, 3M-052, MCT-465, IMO-4200, VTX-763, VTX-1463, GS-9688, and compounds disclosed in US20140045849 (Janssen), US20140073642 (Janssen), WO2014 / 056953 (Janssen), WO2014 / 076221 (Janssen), WO2014 / 128189 (Janssen), US20140350031 (Janssen), WO2014 / 023813 (Janssen), US20080234251 (Array Biopharma), US20080306050 (Array Biopharma). Biopharma), US20100029585 (VentirxPharma), US20110092485 (Ventirx Pharma), US20110118235 (Ventirx Pharma), US20120082658 (Ventirx Pharma), US20120219615 (Ventirx Pharma), US20140066432 (Ventirx Pharma), US20140088085 (Ventirx Pharma), US20140275167 (NoviraTherapeutics), US20130251673 (Novira Therapeutics), U.S. Patent No. 9670205, US20160289229, U.S. Patent Application No. 15 / 692161 and U.S. Patent Application No. 15 / 692093.

[0360] Examples of TLR9 modulators include BB-001, BB-006, CYT-003, IMO-2055, IMO-2125, IMO-3100, IMO-8400, IR-103, IMO-9200, agatolimod, DIMS-9054, DV-1079, DV-1179, AZD-1419, leftolimod (MGN-1703), litenimod, and CYT-003-QbG10.

[0361] Examples of TLR7, TLR8 and TLR9 modulators include compounds disclosed in WO2017047769 (Teika Seiyaku), WO2015014815 (Janssen), WO2018045150 (Gilead Sciences Inc), WO2018045144 (Gilead Sciences Inc), WO2015162075 (Roche), WO2017034986 (University of Kansas), WO2018095426 (Jiangsu Hengrui Medicine Co Ltd), WO2016091698 (Roche), WO2016075661 (GlaxoSmithKline Biologicals), WO2016180743 (Roche), WO2018089695 (Dynavax Technologies), WO2016055553 (ROche), WO2015168279 (Novartis), WO2016107536 (Medshine Discovery), WO2018086593 (Livo (Shanghai) Pharmaceutical), WO2017106607 (Merck), WO2017061532 (Sumitomo Dainippon Pharma), WO2016023511 (ChiaTai Tianqing Pharmaceutical), WO2017076346 (Chia Tai Tianqing Pharmaceutical), WO2017046112 (ROche), WO2018078149 (Roche), WO2017040233 (3M Co), WO2016141092 (Gilead Sciences), WO2018049089 (BristolMyers Squibb), WO2015057655 (Eisai Co Ltd), WO2017001307 (Roche), WO2018005586 (BristolMyers Squibb), WO201704023 (3MCo),WO2017163264 (Council of Scientific and Industrial Research (India)), WO2018046460 (GlaxoSmithKline Biologicals), WO2018047081 (Novartis), WO2016142250 (Roche), WO2015168269 (Novartis), WO201804163 (Roche), WO2018038877 (3M Co), WO2015057659 (Eisai Co Ltd), WO2017202704 (Roche), WO2018026620 (Bristol Myers Squibb), WO2016029077 (Janus Biotherapeutics), WO201803143 (Merck), WO2016096778 (Roche), WO2017190669 (Shanghai De Novo Pharmatech), US09884866 (University of Minnesota), WO2017219931 (SichuanKelunBiotech Biopharmaceutical), WO2018002319 (Janssen Sciences), WO2017216054 (Roche), WO2017202703 (Roche), WO2017184735 (IFM Therapeutics), WO2017184746 (IFM Therapeutics), WO2015088045 (Takeda Pharmaceutical), WO2017038909 (Takeda Pharmaceutical), WO2015095780 (University of Kansas), WO2015023958 (University of Kansas). ,

[0362] Interferon alpha receptor ligand

[0363] Examples of interferon alpha receptor ligands include interferon alpha-2b (INTRON ), pegylated interferon α-2a Pegylated interferon α-1b, interferon α1b Veldona, Infradure, Interferon-A, YPEG-interferon α-2a (YPEG-rhIFNα-2a), P-1101, Algeron, Alfarona, Ingaron (interferon gamma), rSIFN-co (recombinant super compound interferon), Ypeg interferon α-2b (YPEG-rhIFNα-2b), MOR-22, peg interferon α-2b (PEG- )、Bioferon、Novaferon、Inmutag(Inferon), Interferon α-n1 Interferon beta-1a Shaferon, interferon alpha-2b (Axxo), alfaferone, interferon alpha-2b (BioGeneric Pharma), interferon-alpha 2 (CJ), Laferonum, VIPEG, BLAUFERON-A, BLAUFERON-B, Intermax alpha, Realdiron, Lanstion, Pegaferon, PDferon-B PDferon-B, interferon alpha-2b (IFN, Laboratorios Bioprofarma), alfainterferona 2b, Kalferon, Pegnano, Feronsure, PegiHep, interferon alpha 2b (Zydus-Cadila), interferon alpha 2a, Optipeg A, Realfa 2B, Reliferon, interferon alpha-2b (Amega), interferon alpha-2b (Virchow), ropeg interferon alpha-2b, rHSA-IFNα-2a (recombinant human serum albumin interferon alpha 2a fusion protein), rHSA-IFNα2b, recombinant human interferon alpha-(1b,2a,2b), peg interferon alpha-2b (Amega), peg interferon alpha-2a, Reaferon-EC, Proquiferon, Uniferon, Urifron, interferon alpha-2b (Changchun Institute of Biological Products), Anterferon, Shanferon, Layfferon, ShangSheng Lei Tai, INTEFEN, SINOGEN, Fukangtai, Pegstat, rHSA-IFNα-2b, SFR-9216, and Interapo (Interapa).

[0364] Hyaluronidase inhibitors

[0365] Examples of hyaluronidase inhibitors include astodrimer.

[0366] Hepatitis B surface antigen (HBsAg) inhibitors

[0367] Examples of HBsAg inhibitors include HBF-0259, PBHBV-001, PBHBV-2-15, PBHBV-2-1, REP-9AC, REP-9C, REP-9, REP-2139, REP-2139-Ca, REP-2165, REP-2055, REP-2163, REP-2165, REP-2053, REP-2031 and REP-006, and REP-9AC′.

[0368] Examples of HBsAg secretion inhibitors include BM601.

[0369] Cytotoxic T-lymphocyte-associated protein 4 (ipi4) inhibitor

[0370] Examples of cytotoxic T-lymphocyte-associated protein 4 (ipi4) inhibitors include AGEN-2041, AGEN-1884, ipilumimab, belatacept, PSI-001, PRS-010, Probody mAb, tremelimumab, and JHL-1155.

[0371] Cyclophilin inhibitors

[0372] Examples of cyclophilin inhibitors include CPI-431-32, EDP-494, OCB-030, SCY-635, NVP-015, NVP-018, NVP-019, STG-175, and compounds disclosed in US8513184 (Gilead Sciences), US20140030221 (Gilead Sciences), US20130344030 (Gilead Sciences), and US20130344029 (Gilead Sciences).

[0373] HBV viral entry inhibitors

[0374] Examples of HBV viral entry inhibitors include Myrcludex B.

[0375] Antisense oligonucleotides targeting viral mRNA

[0376] Examples of antisense oligonucleotides targeting viral mRNA include ISIS-HBVRx, IONIS-HBVRx, IONIS-GSK6-LRx, GSK-3389404, RG-6004.

[0377] Short interfering RNA (siRNA) and ddRNAi

[0378] Examples of siRNA include TKM-HBV (TKM-HepB), ALN-HBV, SR-008, HepB-nRNA, and ARC-520, ARC-521, ARB-1740, ARB-1467.

[0379] Examples of DNA-directed RNA interference (ddRNAi) include BB-HB-331.

[0380] Endonuclease modulators

[0381] Examples of endonuclease modulators include PGN-514.

[0382] Ribonucleotide reductase inhibitors

[0383] Examples of ribonucleotide reductase inhibitors include Trimidox.

[0384] HBV E antigen inhibitors

[0385] Examples of HBV E antigen inhibitors include wogonin.

[0386] Covalently closed circular DNA (cccDNA) inhibitors

[0387] Examples of cccDNA inhibitors include BSBI-25 and CHR-101.

[0388] Farnesoid X receptor agonists

[0389] Examples of farnesoid x receptor agonists are such as EYP-001, GS-9674, EDP-305, MET-409, Tropifexor, AKN-083, RDX-023, BWD-100, LMB-763, INV-3, NTX-023-1, EP-024297 and GS-8670.

[0390] HBV antibodies

[0391] Examples of HBV antibodies targeting the surface antigen of hepatitis B virus include GC-1102, XTL-17, XTL-19, KN-003, IV Hepabulin SN, and fully human monoclonal antibody therapy (Hepatitis B Virus Infection, Humabs BioMed).

[0392] Examples of HBV antibodies, including monoclonal antibodies and polyclonal antibodies, include Zutectra, ShangSheng Gan Di, Uman Big (hepatitis B hyperimmune), Omri-Hep-B, Nabi-HB, Hepatect CP, HepaGamB, igantibe, Niuliva, CT-P24, hepatitis B immune globulin (intravenous, pH 4, HBV infection, Shanghai RAASBlood Products) and Fovepta (BT-088).

[0393] Fully human monoclonal antibodies include HBC-34.

[0394] CCR2 chemokine antagonists

[0395] Examples of CCR2 chemokine antagonists include propagermanium.

[0396] Thymosin agonists

[0397] Examples of thymosin agonists include Thymalfasin, recombinant thymosin α1 (GeneScience)

[0398] Cytokines

[0399] Examples of cytokines include recombinant IL-7, CYT-107, interleukin-2 (IL-2, Immunex), recombinant human interleukin-2 (Shenzhen Neptunus), IL-15, IL-21, IL-24, and celmoleukin.

[0400] Nuclear protein regulator

[0401] Nucleoprotein modulators may be HBV core or capsid protein inhibitors. Examples of nucleoprotein modulators include GS-4882, AB-423, AT-130, GLS4, NVR-1221, NVR-3778, AL-3778, BAY 41-4109, morphothiadine mesilate, ARB-168786, ARB-880, JNJ-379, RG-7907, HEC-72702, AB-506, ABI-H0731, JNJ-440, ABI-H2158, and DVR-23.

[0402] Examples of capsid inhibitors include compounds disclosed in US20140275167 (Novira Therapeutics), US20130251673 (Novira Therapeutics), US20140343032 (Roche), WO2014037480 (Roche), US20130267517 (Roche), WO2014131847 (Janssen), WO2014033176 (Janssen), WO2014033170 (Janss en), WO2014033167(Janssen), WO2015 / 059212(Janssen), WO2015118057(Janssen), WO2015011281(Janssen), WO2014184365(Janssen), WO2014184350(Janssen), WO 2014161888(Janssen)、WO2013096744(Novira)、US20150225355(Novira)、US20140178337(Novira)、US20150315159(Novira)、US20150197533(Novira)、US20150274 US 20170334882(Novira)、US 20170334898(Roche), WO2017202798(Roche), WO2017214395(Enanta), WO2018001944(Roche), WO2018001952(Roche), WO2018005881(Novira), WO2018005 883 (Novira), WO2018011100 (Roche), WO2018011160 (Roche), WO2018011162 (Roche), WO2018011163 (Roche), WO2018036941 (Roche), WO2018043747 (Kyoto Univ), US20180065929(Janssen), WO2016168619(Indiana University), WO2016195982(The Penn StateFoundation), WO2017001655 (Janssen), WO2017048950 (Assembly Biosciences), WO2017048954 (Assembly Biosciences), WO2017048962 (Assembly Biosciences), US20170121328 (Novira), US20170121329 (Novira).

[0403] Examples of transcript inhibitors include compounds disclosed in WO2017013046 (Roche), WO2017016960 (Roche), WO2017017042 (Roche), WO2017017043 (Roche), WO2017061466 (Toyoma chemicals), WO2016177655 (Roche), WO2016161268 (Enanta). WO2017001853 (Redex Pharma), WO2017211791 (Roche), WO2017216685 (Novartis), WO2017216686 (Novartis), WO2018019297 (Ginkgo Pharma), WO2018022282 (Newave Pharma), US20180030053 (Novartis), WO2018045911 (Zhejiang Pharma).

[0404] retinoic acid inducible gene 1 stimulator

[0405] Examples of retinoic acid-inducible gene 1 stimulators include SB-9200, SB-40, SB-44, ORI-7246, ORI-9350, ORI-7537, ORI-9020, ORI-9198, and ORI-7170, RGT-100.

[0406] NOD2 Stimulator

[0407] Examples of NOD2 stimulators include SB-9200.

[0408] Phosphatidylinositol 3-kinase (PI3K) inhibitors

[0409] Examples of PI3K inhibitors include idelalisib, ACP-319, AZD-8186, AZD-8835, buparlisib, CDZ-173, CLR-457, pictilisib, neratinib, rigosertib, regosertib sodium, EN-3342, TGR-1202, alpelisib, duvelisib, IPI-549, UCB-5857, taselisib , XL-765, gedatolisib, ME-401, VS-5584, copanlisib, CAI orotic acid, perifosine, RG-7666, GSK-2636771, DS-7423, panulisib, GSK-2269557, GSK-2126458, CUDC-907, PQR-309, INCB-40093, pilaralisib, BAY-1082439, puquitinib mesylate mesylate), SAR-245409, AMG-319, RP-6530, ZSTK-474, MLN-1117, SF-1126, RV-1729, sonolisib, LY-3023414, SAR-260301, TAK-117, HMPL-689, tenalisib, voxtalisib, and CLR-1401.

[0410] Indoleamine-2,3-dioxygenase (IDO) pathway inhibitors

[0411] Examples of IDO inhibitors include epacadostat (INCB24360), resminostat (4SC-201), indoximod, F-001287, SN-35837, NLG-919, GDC-0919, GBV-1028, GBV-1012, NKTR-218, and compounds disclosed in US20100015178 (Incyte), US2016137652 (Flexus Biosciences, Inc.), WO2014073738 (Flexus Biosciences, Inc.), and WO2015188085 (Flexus Biosciences, Inc.).

[0412] PD-1 inhibitors

[0413] Examples of PD-1 inhibitors include cemiplimab, nivolumab, pembrolizumab, pidilizumab, BGB-108, STI-A1014, SHR-1210, PDR-001, PF-06801591, IBI-308, GB-226, STI-1110, JNJ-63723283, CA-170, durvalumab, atezolizumab, and mDX-400, JS-0 01. Camrelizumab, Sintilimab, tislelizumab, BCD-100, BGB-A333, JNJ-63723283, GLS-010 (WBP-3055), CX-072, AGEN-2034, GNS-1480 (epidermal growth factor receptor antagonist; progressive cell death ligand 1 inhibitor), CS-1001, M-7824 (PD-L1 / TGF-β bifunctional fusion protein), Genolizumab, and BMS-936559.

[0414] PD-L1 inhibitors

[0415] Examples of PD-L1 inhibitors include atezolizumab, avelumab, AMP-224, MEDI-0680, RG-7446, GX-P2, durvalumab, KY-1003, KD-033, MSB-0010718C, TSR-042, ALN-PDL, STI-A1014, GS-4224, CX-072, and BMS-936559.

[0416] Examples of PD-1 inhibitors include the compounds disclosed in the following: WO2017112730 (Incyte Corp), WO2017087777 (Incyte Corp), WO2017017624, WO2014151634 (Bristol Myers Squibb Co), WO201317322 (Bristol Myers Squibb Co), WO2018119286 (Incyte Corp), WO2018119266 (Incyte Corp), WO2018119263 (Incyte Corp), WO2018119236 (Incyte Corp), WO2018119221 (Incyte Corp), WO2018118848 (Bristol Myers Squibb Co), WO20161266460 (Bristol Myers Squibb Co), WO2017087678 (Bristol Myers Squibb Co), WO2016149351 (Bristol Myers Squibb Co), WO2015033299 (Aurigene Discovery Technologies Ltd), WO2015179615 (Eisai Co Ltd; Eisai Research Institute), WO2017066227 (Bristol Myers Squibb Co), WO2016142886 (Aurigene Discovery Technologies Ltd), WO2016142852 (Aurigene Discovery Technologies Ltd), WO2016142835 (Aurigene Discovery Technologies Ltd; Individual), WO2016142833 (Aurigene Discovery Technologies Ltd), WO2018085750 (Bristol Myers Squibb Co), WO2015033303 (Aurigene Discovery Technologies Ltd), WO2017205464 (Incyte Corp), WO2016019232 (3M Co; Individual;Texas A&M University System)、WO2015160641(BristolMyers Squibb Co)、WO2017079669(Incyte Corp)、WO2015033301(Aurigene Discovery Technologies Ltd)、WO2015034820(BristolMyers Squibb Co)、WO2018073754(Aurigene DiscoveryTechnologies Ltd)、WO2016077518(BristolMyers Squibb Co)、WO2016057624(BristolMyers Squibb Co)、WO2018044783(Incyte Corp)、WO2016100608(BristolMyersSquibb Co)、WO2016100285(BristolMyers Squibb Co)、WO2016039749(BristolMyersSquibb Co)、WO2015019284(Cambridge Enterprise Ltd)、WO2016142894(AurigeneDiscovery Technologies Ltd)、WO2015134605(BristolMyers Squibb Co)、WO2018051255(Aurigene Discovery Technologies Ltd)、WO2018051254(Aurigene DiscoveryTechnologies Ltd)、WO2017222976(Incyte Corp)、WO2017070089(Incyte Corp)、WO2018044963(BristolMyers Squibb Co)、WO2013144704(Aurigene DiscoveryTechnologies Ltd)、WO2018013789(Incyte Corp)、WO2017176608(BristolMyers SquibbCo)、WO2018009505(BristolMyers Squibb Co)、WO2011161699(Aurigene DiscoveryTechnologies Ltd)、WO2015119944(Incyte Corp;Merck Sharp & Dohme Corp), WO2017192961 (Incyte Corp), WO2017106634 (Incyte Corp), WO2013132317 (Aurigene Discovery Technologies Ltd), WO2012168944 (Aurigene Discovery Technologies Ltd), WO2015036927 (Aurigene Discovery Technologies Ltd) Ltd), WO2015044900 (Aurigene Discovery Technologies Ltd), WO2018026971 (Arising International). ;

[0417] Recombinant Thymosin Alpha-1

[0418] Examples of recombinant thymosin alpha-1 include NL-004 and pegylated thymosin alpha-1.

[0419] Bruton's tyrosine kinase (BTK) inhibitors

[0420] Examples of BTK inhibitors include ABBV-105, acalabrutinib (ACP-196), ARQ-531, BMS-986142, dasatinib, ibrutinib, GDC-0853, PRN-1008, SNS-062, ONO-4059, BGB-3111, ML-319, MSC-2364447, RDX-022, X-022, AC-058, RG-7845, spebrutinib, TAS-5315, TP-0158, TP-4207, HM-71224, KBP-7536, M-2951, TAK-020, AC-0025, and ONO-4059, ... Compounds disclosed in US20130079327 (Ono Pharmaceutical), US20130217880 (Ono Pharmaceutical).

[0421] KDM inhibitors

[0422] Examples of KDM5 inhibitors include compounds disclosed in WO2016057924 (Genentech / Constellation Pharmaceuticals), US20140275092 (Genentech / Constellation Pharmaceuticals), US20140371195 (Epitherapeutics) and US20140371214 (Epitherapeutics), US20160102096 (Epitherapeutics), US20140194469 (Quanticel), US20140171432, US20140213591 (Quanticel), US20160039808 (Quanticel), US20140275084 (Quanticel), WO2014164708 (Quanticel).

[0423] Examples of KDM1 inhibitors include compounds disclosed in US9186337B2 (Oryzon Genomics), GSK-2879552, and RG-6016.

[0424] STING agonists

[0425] Examples of STING agonists include SB-11285, AdVCA0848, STINGVAX, and compounds disclosed in WO 2018065360 (Biolog Life Science Institute Forschungslabor und Biochemica-Vertrieb GmbH, Germany), WO 2018009466 (Aduro Biotech), WO 2017186711 (InvivoGen), WO 2017161349 (Immune Sensor), WO 2017106740 (Aduro Biotech), US 20170158724 (Glaxo Smithkiline), WO 2017075477 (Aduro Biotech), US 20170044206 (Merck), WO2014179760 (University of California), WO2018098203 (Janssn), WO2018118665 (Merck), WO2018118664 (Merck), WO2018100558 (Takeda), WO2018067423 (Merck), WO2018060323 (Boehringer).

[0426] Non-nucleoside reverse transcriptase inhibitors (NNRTIs)

[0427] Examples of NNRTIs include compounds disclosed in WO2018118826 (Merck), WO2018080903 (Merck), WO2018119013 (Merck), WO2017100108 (Idenix), WO2017027434 (Merck), WO2017007701 (Merck), WO2008005555 (Gilead).

[0428] HBV replication inhibitors

[0429] Examples of hepatitis B virus replication inhibitors include isothiafludine, IQP-HBV, RM-5038, and Xingantie.

[0430] Arginase inhibitors

[0431] Examples of arginase inhibitors include CB-1158, C-201 and ramustat.

[0432] Gene therapy and cell therapy

[0433] Gene therapy and cell therapy include genetic modification to silence genes; genetic approaches to directly kill infected cells; infusions of immune cells designed to replace large portions of a patient's own immune system to boost the immune response to infected cells or to activate the patient's own immune system to kill infected cells, or to seek out and kill infected cells; and genetic approaches to modify cellular activity to further alter the endogenous immune response to infection.

[0434] Gene editing factors

[0435] Examples of genome editing systems include CRISPR / Cas9 systems, zinc finger nuclease systems, TALEN systems, homing endonuclease systems, and meganuclease systems; such as cccDNA elimination via targeted cleavage, and altering one or more of the hepatitis B virus (HBV) viral genes. Alteration (e.g., gene knockout and / or blocking gene expression) of PreC, C, X, PreSI, PreS2, S, P or SP gene refers to (1) reducing or eliminating PreC, C, X, PreSI, PreS2, S, P or SP gene expression, (2) interfering with the function of prenuclear protein (Precore), core protein (Core), X protein, long surface protein, middle surface protein, S protein (also known as HBs antigen and HBsAg), polymerase protein and / or hepatitis B splicing protein (HBe, HBc, HBx, PreS1, PreS2, S, Pol and / or HBSP) or (3) reducing or eliminating the intracellular, serum and / or brain parenchyma HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol and / or HBSP protein levels. Blocking gene expression of one or more of PreC, C, X, PreSI, PreS2, S, P and / or SP genes is performed by targeting HBV cccDNA and / or genes integrated into HBV DNA.

[0436] CAR-T cell therapy

[0437] CAR T cell therapy includes a population of immune effector cells engineered to express a chimeric antigen receptor (CAR), wherein the CAR comprises an HBV antigen binding domain. The immune effector cells are T cells or NK cells. In some embodiments, the T cells are CD4+T cells, CD8+T cells, or a combination thereof. The cells may be autologous or allogeneic.

[0438] TCR-T cell therapy

[0439] TCR T cell therapy includes T cells that express HBV-specific T cell receptors. TCR-T cell lines are engineered to target HBV-derived peptides presented on the surface of cells infected with the virus. In certain embodiments, T cells express HBV surface antigen (HBsAg)-specific TCRs. Examples of TCR-T therapies for the treatment of HBV include LTCR-H2-1.

[0440] In another specific embodiment, the compounds disclosed herein, or pharmaceutically acceptable salts thereof, are combined with: an HBV DNA polymerase inhibitor; one or two other therapeutic agents selected from the group consisting of: an immunomodulator, a TLR modulator, a HBsAg inhibitor, an HBsAg secretion or assembly inhibitor, an HBV therapeutic vaccine, an HBV antibody (including an HBV antibody and a bispecific antibody targeting a surface antigen of hepatitis B virus), and an "antibody-like" therapeutic protein (such as Fab derivatives or TCR-like antibodies), cyclophilin inhibitors, retinoic acid-inducible gene 1 stimulators, RIG-I-like receptor stimulators, PD-1 inhibitors, PD-L1 inhibitors, arginase inhibitors, PI3K inhibitors, IDO inhibitors and NOD2 stimulators; and one or two other therapeutic agents selected from the group consisting of: HBV virus entry inhibitors, NTCP inhibitors, HBx inhibitors, cccDNA inhibitors, HBV antibodies targeting the surface antigen of hepatitis B virus, siRNA, miRNA gene therapy agents, sshRNA, KDM5 inhibitors and nucleoprotein modulators (HBV core or capsid protein modulators).

[0441] In another embodiment, a compound disclosed herein, or a pharmaceutically acceptable salt thereof, is combined with an HBV DNA polymerase inhibitor and at least one second additional therapeutic agent selected from the group consisting of an immunomodulator, a TLR modulator, an HBsAg inhibitor, an HBV therapeutic vaccine, an HBV antibody (including an HBV antibody and a bispecific antibody targeting the surface antigen of hepatitis B virus), and an "antibody-like" therapeutic protein (such as Fab derivatives or TCR-like antibodies), cyclophilin inhibitors, retinoic acid-inducible gene 1 stimulators, RIG-I-like receptor stimulators, PD-1 inhibitors, PD-L1 inhibitors, arginase inhibitors, PI3K inhibitors, IDO inhibitors and NOD2 stimulators.

[0442] In another embodiment, the compound disclosed herein or a pharmaceutically acceptable salt thereof is combined with an HBV DNA polymerase inhibitor and at least one second additional therapeutic agent selected from the group consisting of: HBV viral entry inhibitors, NTCP inhibitors, HBx inhibitors, cccDNA inhibitors, HBV antibodies targeting hepatitis B virus surface antigen, siRNA, miRNA gene therapy agents, sshRNA, KDM5 inhibitors, and nucleoprotein modulators (HBV core or capsid protein inhibitors).

[0443] In certain embodiments, the compounds disclosed herein or their pharmaceutically acceptable salts are combined with compounds and other drugs for treating HBV and combinations thereof, such as compounds disclosed in U.S. Publication No. 2010 / 0143301 (Gilead Sciences), U.S. Publication No. 2011 / 0098248 (Gilead Sciences), U.S. Publication No. 2009 / 0047249 (Gilead Sciences), U.S. Patent No. 8722054 (Gilead Sciences), and U.S. Patent No. 1068557 (Gilead Sciences). Sciences), U.S. Publication No. 2014 / 0045849 (Janssen), U.S. Publication No. 2014 / 0073642 (Janssen), WO2014 / 056953 (Janssen), WO2014 / 076221 (Janssen), WO2014 / 128189 (Janssen), U.S. Publication No. 2014 / 0350031 (Janssen), WO2014 / 023813 (Janssen), U.S. Publication No. 2008 / 0234251 (Array Biopharma), U.S. Publication No. 2008 / 0306050 (ArrayBiopharma), U.S. Publication No. 2010 / 0029585 (Ventirx Pharma), U.S. Publication No. 2011 / 0092485 (Ventirx Pharma), US2011 / 0118235 (Ventirx Pharma), U.S. Publication No. 2012 / 0082658 (Ventirx Pharma), U.S. Publication No. 2012 / 0219615 (Ventirx Pharma), U.S. Publication No. 2014 / 0066432 (Ventirx Pharma), U.S. Publication No. 2014 / 0088085 (VentirxPharma), U.S. Publication No. 2014 / 0275167 (Novira Therapeutics), U.S. Publication No. 2013 / 0251673 (Novira Therapeutics), U.S. Patent No. 8513184 (Gilead Sciences), U.S. Publication No. 2014 / 0030221 (Gilead Sciences), U.S. Publication No. 2013 / 0344030 (Gilead Sciences), U.S. Publication No. 2013 / 0344029 (Gilead Sciences), US20140275167 (Novira Therapeutics), US20130251673 (NoviraTherapeutics), U.S. Publication No. 2014 / 0343032 (Roche), WO2014037480 (Roche), U.S. Publication No. 2013 / 0267517 (Roche), WO2014131847 (Janssen), WO2014033176 (Janssen), WO2014033170 (Janssen), WO2014033167 (Janssen), WO2015 / 059212 (Janssen), WO2015118057 (Janssen), WO2015011281 (Janssen), WO2014184365 (Janssen), WO2014184350 (Janssen), WO2014161888 (Janssen), WO 2013096744(Novira)、US20150225355(Novira)、US20140178337(Novira)、US20150315159(N ovira), US20150197533 (Novira), US20150274652 (Novira), US20150259324, (Novira), US20 150132258(Novira)、US9181288(Novira)、WO2014184350(Janssen)、WO2013144129(Roche)、 US20100015178 (Incyte), US2016137652 (Flexus Biosciences, Inc.), WO2014073738 (Flexus Biosciences, Inc.), WO2015188085 (Flexus Biosciences, Inc.), U.S. Publication No. 2014 / 0330015 (Ono Pharmaceutical), U.S. Publication No. 2013 / 0079327 (Ono Pharmaceutical), U.S. Publication No. 2013 / 0217880 (Onopharmaceutical), WO2016057924 (Genentech / Constellation Pharmaceuticals), US20140275092 (Genentech / Constellation Pharmaceuticals),Pharmaceuticals), US20140371195 (Epitherapeutics) and US20140371214 (Epitherapeutics), US20160102096 (Epitherapeutics), US20140194469 (Quanticel ), US20140171432, US20140213591(Quanticel), US20160039808(Quanticel), US20140275084(Quanticel), WO2014164708(Quanticel), US9186337B2(Oryzon Genomics).

[0444] Cancer combination therapy

[0445] In one embodiment, the compounds of the present invention can be used together with other therapeutic methods for cancer treatment. Preferably, combination therapy with chemotherapeutic agents, hormones, antibodies, surgery and / or radiation therapy is contemplated.

[0446] In some embodiments, the additional anti-cancer therapy is surgery and / or radiation therapy.

[0447] In some embodiments, the additional anti-cancer therapy is at least one additional cancer agent.

[0448] In some embodiments, a combination is provided comprising a compound of formula (or a pharmaceutically acceptable salt thereof and at least one other cancer agent.

[0449] In some embodiments, a combination is provided for use in therapy comprising a compound of the invention, or a pharmaceutically acceptable salt thereof, and at least one other cancer agent.

[0450] In some embodiments, there is provided a use of a combination in the manufacture of a medicament for treating cancer, the combination comprising a compound of the invention or a pharmaceutically acceptable salt thereof and at least one cancer agent.

[0451] Examples of additional cancer agents include intercalating substances such as anthracyclines, doxorubicin, idarubicin, epirubicin, and daunorubicin; topoisomerase inhibitors such as irinotecan, topotecan, camptothecin, lamellarin D, etoposide, teniposide, mitoxantrone, amsacrine, ellipticines, and aurintricarboxylic acid; acid; nitrosourea compounds such as carmustine (BCNU), lomustine (CCNU), and streptozocin; nitrogen mustards such as cyclophosphamide, mechlorethamine, uramustine, bendamustine, melphalan, chlorambucil, mafosfamide, trofosfamid, and ifosfamide alkyl sulfonates such as busulfan and treosulfan; alkylating agents such as procarbazin, dacarbazin, temozolomid, and thiotepa; platinum analogs such as cisplatin, carboplatin, nedaplatin, oxaliplatin, satraplatin, and triplatin tetranitrate; tetranitrate); microtubule-disrupting drugs such as vinblastine, colcemid, and nocodazole; antifolates such as methotrexate, aminopterin, dichloromethopterin, pemetrexed, raltitrexed, and pralatrexate; purine analogs such as azathioprine, mercaptopurine, thioguanine, fludarabine, fludarabine phosphate, pentostatin, and cladribine;Pyrimidine analogs, such as 5-fluorouracil, floxuridine, cytarabine, 6-azauracil, gemcitabine; steroids, such as gestagene, androgene, glucocorticoids, dexamethasone, prednisolone and prednisone; anticancer antibodies, such as monoclonal antibodies, for example, alemtuzumab, apolizumab, cetuximab mab), epratuzumab, galiximab, gemtuzumab, ipilimumab, labetuzumab, panitumumab, rituximab, trastuzumab, nimotuzumab, mapatumumab, matuzumab, rhMab ICR62 and pertuzumab, radiolabeled antibodies and antibody-drug conjugates; anticancer peptides, such as radiolabeled peptides and peptide-drug conjugates; and taxanes and taxane analogs, such as paclitaxel and docetaxel. ;

[0452] In certain embodiments, a method for treating or preventing a hyperproliferative disorder or cancer in a human or animal suffering from or at risk of suffering from a hyperproliferative disorder or cancer comprises administering to the human or animal a therapeutically effective amount of a compound of the invention as disclosed herein, or a pharmaceutically acceptable salt thereof, in combination with a therapeutically effective amount of one or more (e.g., one, two, three, one or two, or one to three) other therapeutic agents. In one embodiment, a method for treating a hyperproliferative disorder or cancer in a human or animal suffering from or at risk of suffering from a hyperproliferative disorder or cancer comprises administering to the human or animal a therapeutically effective amount of a compound as disclosed herein, or a pharmaceutically acceptable salt thereof, in combination with a therapeutically effective amount of one or more (e.g., one, two, three, one or two, or one to three) other therapeutic agents.

[0453] In certain embodiments, the present invention provides a method for treating a hyperproliferative disorder or cancer, comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt thereof, in combination with a therapeutically effective amount of one or more additional therapeutic agents suitable for treating a hyperproliferative disorder or cancer.

[0454] The compounds described herein may be used or combined with one or more of the following: chemotherapeutic agents, anti-cancer agents, anti-angiogenic agents, anti-fibrotic agents, immunotherapeutic agents, therapeutic antibodies, bispecific antibodies, and "antibody-like" therapeutic proteins (such as Fab derivatives), antibody-drug conjugates (ADCs), radiotherapeutics, antitumor agents, antiproliferative agents, oncolytic viruses, gene regulators or editing factors (such as CRISPR / Cas9, zinc finger nucleases or synthetic nucleases, TALENs), CAR (chimeric antigen receptor) T cell immunotherapeutics, engineered T cell receptors (TCR-T) or any combination thereof. Such therapeutic agents may be in the form of compounds, antibodies, polypeptides or polynucleotides. In one embodiment, a product is provided herein, comprising compounds described herein and other therapeutic agents in the form of a combined preparation for simultaneous, separate or sequential use in therapy.

[0455] The one or more therapeutic agents include, but are not limited to, inhibitors, agonists, antagonists, ligands, modulators, stimulators, blockers, activators or inhibitors of genes, ligands, receptors, proteins or factors. Non-limiting examples of other therapeutic agents include: Abelson murine leukemia virus oncogene homolog 1 gene (ABL, such as ABL1), acetyl-CoA carboxylase (such as ACC1 / 2), activated CDC kinase (ACK, such as ACK1), adenosine deaminase, adenosine receptors (such as A2B, A2a, A3), adenylate cyclase, ADP-ribosyl cyclase-1, adrenocorticotropic hormone receptor (ACTH), Aerolysin, AKT1 gene, Alk-5 protein kinase, alkaline phosphatase, α1 adrenergic receptor, α2 adrenergic receptor, α-ketoglutarate dehydrogenase (KGDH), amino peptidase N, AMP-activated protein kinase, anaplastic lymphoma kinase (ALK, such as ALK1), androgen receptor, angiopoietin (such as ligand-1, ligand-2), angiotensinogen (AGT) gene, murine thymoma viral oncogene homolog 1 (AKT) protein kinase (such as AKT1, AKT2, AKT3), apolipoprotein AI (APOA1) gene, apoptosis-inducing factor, apoptosis protein (such as 1, 2), apoptosis signal-regulating kinase (ASK, such as ASK1), arginase (I), arginine deiminase, aromatase, astrocyte homolog 1 (ASTE1) gene, ataxia telangiectasia and Rad 3-related (ATR) serine / threonine protein kinase, Aurora protein kinase (such as 1, 2), Axl tyrosine kinase receptor, baculovirus containing IAP repeat 5 (BIRC5) gene, basic immunoglobulin, B cell lymphoma 2 (BCL2) gene, Bcl2 binding component 3, Bcl2 protein, BCL2L11 gene, BCR (breakpoint cluster region) protein and gene, beta adrenergic receptor, beta catenin, B lymphocyte antigen CD19, B lymphocyte antigen CD20, B lymphocyte adhesion molecule, B lymphocyte stimulator ligand, bone morphogenetic protein-10 ligand, bone morphogenetic protein leukocyte antigen-9 ligand regulator, brachyuratin, bradykinin receptor, B-raf proto-oncogene (BRAF), Brc-Abl tyrosine kinase, bromodomain and extracellular domain (BET) bromodomain-containing proteins (such as BRD2, BRD3, BRD4), Bruton's tyrosine kinase (BTK), calmodulin, calmodulin-dependent protein kinase (CaMK, such as CAMKII), testicular cancer antigen 2, testicular cancer antigen NY-ESO-1, cancer / testicular antigen 1B (CTAG1) gene, cannabinoid receptors (such as CB1, CB2), carbonic anhydrase, casein kinase (CK,Such as CKI, CKII), caspases (such as caspases-3, caspases-7, caspases-9), caspases 8 apoptosis-related cysteine ​​peptidase CASP8-FADD class regulators, caspases recruitment domain protein-15, cathepsin G, CCR5 gene, CDK activated kinase (CAK), checkpoint kinases (such as CHK1, CHK2), chemokine (CC main structure) receptors (such as CCR2, CCR4, CCR5), chemokine (CX C main structure) receptors (such as CXCR4, CXCR1 and CXCR2), chemokine CC21 ligand, cholecystokinin CCK2 receptor, chorionic gonadotropin, c-Kit (tyrosine-protein kinase Kit or CD117), tight junction proteins (such as 6, 18), cluster of differentiation (CD), such as CD4, CD27, CD29, CD30, CD33, CD37, CD40, CD40 ligand receptor, CD40 ligand, CD40LG gene, CD44, CD45, CD47, CD49b, CD51, CD52, CD55, CD58, CD66e, CD70 gene, CD74, CD79, CD79b, CD79B gene, CD80, CD95, CD99, CD117, CD122, CDw123, CD134, CDw137, CD158a, CD158b1, CD158b2, CD223, CD276 antigen; clusterin (CLU) gene, clusterin, c-Met (hepatocyte growth factor C3, connective tissue growth factor, COP9 signaling subunit 5, CSF-1 (colony stimulating factor 1 receptor), CSF2 gene, CTLA-4 (cytotoxic T lymphocyte protein 4) receptor, cyclin D1, cyclin G1, cyclin-dependent kinases (CDKs, such as CDK1, CDK1B, CDK2-9), cyclooxygenases (such as 1, 2), CYP2B1 gene, porcupine cysteine ​​palmitoyltransferase, cytochrome P450 11B2, cytochrome P450 17, cytochrome P45017A1, cytochrome P450 2D6, cytochrome P450 3A4, cytochrome P450 reductase, cytokine signaling-1, cytokine signaling-3, cytoplasmic isocitrate dehydrogenase, cytosine deaminase, cytosine DNA methyltransferase, cytotoxic T lymphocyte protein-4, DDR2 gene, delta-like protein ligand (such as 3, 4), deoxyribonuclease, Dickkopf-1 ligand, dihydrofolate reductase (DHFR), dihydropyrimidine dehydrogenase, dipeptidyl peptidase IV, discoidin domain receptor (DDR,such as DDR1), DNA binding proteins (such as HU-β), DNA-dependent protein kinases, DNA gyrase, DNA methyltransferase, DNA polymerase (such as α), DNA primase, dUTP pyrophosphatase, L-dopachrome tautomerase, echinoderm tubulin 4, EGFR tyrosine kinase receptor, elastase, elongation factor 1α2, elongation factor 2, endoglin, endonuclease, endoplasmic reticulin, endosialin, endostatin, endothelin (such as ET-A, ET-B), enhancer of zeste homolog 2 ( EZH2), Ephrelin (EPH) tyrosine kinase (such as Epha3, Ephb4), Ephrelin B2 ligand, epidermal growth factor, epidermal growth factor receptor (EGFR), epidermal growth factor receptor (EGFR) gene, epigenetic factor, epithelial cell adhesion molecule (EpCAM), Erb-b2 (v-erb-B2 avian erythroblastic leukemia virus oncogene homolog 2) tyrosine kinase receptor, Erb-b3 tyrosine kinase receptor, Erb-b4 tyrosine kinase receptor, E-selectin, estradiol 17β dehydrogenase, estrogen estrogen receptors (such as α, β), estrogen-related receptors, eukaryotic translation initiation factor 5A (EIF5A) gene, nuclear export protein 1, extracellular signal-related kinases (such as 1, 2), extracellular signal-regulated kinases (ERK), factors (such as Xa, VIIa), farnesoid x receptor (FXR), Fas ligand, fatty acid synthase (FASN), ferritin, FG-2 ligand, FGF-5 ligand, fibroblast growth factor (FGF, such as FGF1, FGF2, FGF4), fibronectin, Fms-related tyrosine kinase 3 (Flt 3), focal adhesion kinase (FAK, such as FAK2), folate hydroxylase prostate-specific membrane antigen 1 (FOLH1), folate receptor (such as α), folic acid, folate transporter 1, FYN tyrosine kinase, paired alkaline amino acid cleavage enzyme (FURIN), β-glucuronidase, galactosyltransferase, galectin-3, ganglioside GD2, glucocorticoids, glucocorticoid-induced TNFR-related protein GITR receptor, glutamate carboxypeptidase II, glutaminase, glutathione S-transferase P, glycogen synthase kinase (GSK,such as 3-β), phosphatidylinositol proteoglycan 3 (GPC3), gonadotropin-releasing hormone (GNRH), granulocyte macrophage colony stimulating factor (GM-CSF) receptor, granulocyte colony stimulating factor (GCSF) ligand, growth factor receptor binding protein 2 (GRB2), Grp78 (78kDa glucose-regulated protein) calcium binding protein, molecular chaperone protein groEL2 gene, heat shock protein (such as 27, 70, 90α, β), heat shock protein gene, heat-stable enterotoxin receptor, hedgehog protein, heparanase, hepatocyte growth factor, HERV-H LTR-associated protein 2, hexokinase, histamine H2 receptor, histone methyltransferase (DOT1L), histone deacetylase (HDAC, such as 1, 2, 3, 6, 10, 11), histone H1, histone H3, HLA class I antigen (A-2α), HLA Class II antigens, homeobox protein NANOG, HSPB1 gene, human leukocyte antigen (HLA), human papillomavirus (such as E6, E7) protein, hyaluronic acid, hyaluronidase, hypoxia-inducible factor-1α (HIF1α), imprinted human maternally expressed transcript (H19) gene, mitogen-activated protein kinase kinase kinase kinase kinase 1 (MAP4K1), tyrosine-protein kinase HCK, I-κ-B kinase (IKK, such as IKKbe), IL-1α, IL-1β, IL-12, IL-12 gene, IL-15, IL-17, IL-2 gene, IL-2 receptor α subunit, IL-2, IL-3 receptor, IL-4, IL-6, IL-7, IL-8, immunoglobulins (such as G, G1, G2, K, M), immunoglobulin Fc receptor, immunoglobulin gamma Fc receptor (such as I, III, IIIA), indoleamine 2,3-dioxygenase (IDO, such as IDO1), indoleamine pyrrole 2,3-dioxygenase 1 inhibitor, insulin receptor, insulin-like growth factor (such as 1, 2), integrin α-4 / β-1, integrin α-4 / β-7, integrin α-5 / β-1, integrin α-V / β-3, integrin α-V / β-5, integrin α-V / β-6, intercellular adhesion molecule 1 (ICAM-1), interferon (such as α, α2, β, γ), melanoma interferon-inducible protein 2 (AIM2), interferon type I receptor, interleukin 1 ligand, interleukin 13 receptor α2, interleukin 2 ligand, interleukin-1 receptor associated kinase 4 (IRAK4), interleukin-2, interleukin-29 ligand, isocitrate dehydrogenase (such as IDH1, IDH2), Janus kinase (JAK,Such as JAK1, JAK2), Jun N-terminal kinase, kallikrein-related peptidase 3 (KLK3) gene, killer cell Ig-like receptor, kinase insert domain receptor (KDR), kinase-like protein KIF11, Kirsten rat sarcoma viral oncogene homolog (KRAS) gene, kisspeptin (KiSS-1) receptor, KIT gene, v-kit Hardy Zuckerman 4 feline sarcoma viral oncogene homolog (KIT) tyrosine kinase, lactoferrin, lanosterol-14 demethylase, LDL receptor-associated protein-1, leukotriene A4 hydroxylase, listeriolysin, L-selectin, luteinizing hormone receptor, dissociation enzyme, lymphocyte activation gene 3 protein (LAG-3), lymphocyte antigen 75, lymphocyte function antigen-3 receptor, lymphocyte-specific protein tyrosine kinase (LCK), lymphocyte chemokine, Lyn (Lck / Yes novel) tyrosine kinase, lysine demethylase (such as KDM1, KDM2, KDM4, KDM5, KDM6, A / B / C / D), lysophosphatidate-1 receptor, lysosomal associated membrane protein family (LAMP) gene, lysine oxidase homolog 2, lysine oxidase protein (LOX), lysine oxidase-like protein (LOXL, such as LOXL2), hematopoietic pioneer cell kinase 1 (HPK1), hepatocyte growth factor receptor (MET) gene, macrophage colony stimulating factor (MCSF) ligand, macrophage migration inhibitory factor, MAGEC1 gene, MAGEC2 gene, vault protein, MAPK-activated protein kinase (such as MK2), Mas-related G protein-coupled receptor, matrix metalloproteinase (MMP, such as MMP2, MMP9), Mcl-1 differentiation protein, Mdm2 p53-binding protein, Mdm4 protein, Melan-A (MART-1) melanoma antigen, melanocyte protein Pmel 17, melanocyte stimulating hormone ligand, melanoma antigen family A3 (MAGEA3) gene, melanoma associated antigens (such as 1, 2, 3, 6), membrane copper amine oxidase, mesothelin, MET tyrosine kinase, metabotropic glutamate receptor 1, metalloreductase STEAP1 (prostatic 6-transmembrane epithelial antigen 1), transferrin, methionine aminopeptidase-2, methyltransferase, mitochondrial 3-ketoacyl CoA thiolase, mitogen-activated protein kinase (MAPK), mitogen-activated protein kinase (MEK, such as MEK1, MEK2), mTOR (mechanistic target of rapamycin) (serine / threonine kinase), mTOR complex (such as 1, 2), mucin (such as 1, 5A, 16), mut T homolog (MTH,Such as MTH1), Myc proto-oncogene protein, myeloid cell leukemia 1 (MCL1) gene, octadecyl alanine-rich protein kinase C matrix (MARCKS) protein, NAD ADP ribosyltransferase, natriuretic peptide receptor C, neural cell adhesion molecule 1, neurokinin 1 (NK1) receptor, neurokinin receptor, neuropilin 2, NFκB activating protein, NIMA-associated kinase 9 (NEK9), nitric oxide synthase, NK cell receptor, NK3 receptor, NKG2 AB activated NK receptor, norepinephrine transporter, Notch (such as Notch-2 receptor, Notch-3 receptor, Notch-4 receptor), nuclear erythroid 2-related factor 2, nuclear factor (NF) κB, nucleolin, nucleolar phosphatidylcholine, nucleolar phosphatidylcholine-anaplastic lymphoma kinase (NPM-ALK), 2-oxoglutarate dehydrogenase, 2,5-oligoadenylate synthetase, O-methylguanine DNA methyltransferase, opioid receptor (such as delta), ornithine decarboxylase, orotate phosphoribosyltransferase, orphan nuclear hormone receptor NR4A1, osteocalcin, osteoclast differentiation factor, osteopontin, OX-40 (tumor necrosis factor receptor superfamily member 4 TNFRSF4 or CD134) receptor, P3 protein, p38 kinase, p38 MAP kinase, p53 tumor suppressor protein, parathyroid hormone ligand, peroxisome proliferator-activated receptor (PPAR, such as α, δ, γ), P-glycoprotein (such as 1), phosphatase and contraction homolog (PTEN), phosphatidylinositol 3-kinase (PI3K), phosphoinositide-3 kinase (PI3K, such as α, δ, γ), phosphorylase kinase (PK), PKN3 gene, placental growth factor, platelet-derived growth factor (PDGF, such as α, β), platelet-derived growth factor (PDGF, such as α, β), pleiotropic drug resistance transporter, plexin B1, PLK1 gene, polo-like kinase (PLK), Polo-like kinase 1 , poly ADP ribose polymerase (PARP, such as PARP1, 2 and 3), melanoma preferentially expressed antigen (PRAME) gene, prenyl binding protein (PrPB), possible transcription factor PML, progesterone receptor, progressive cell death 1 (PD-1), progressive cell death ligand 1 inhibitor (PD-L1), activating protein (PSAP) gene, prostaglandin receptor (EP4), prostate specific antigen, prostatic acid phosphatase, proteasome, protein E7, protein farnesyl transferase, protein kinase (PK, such as A, B, C), protein tyrosine kinase, protein tyrosine phosphatase β, proto-oncogene serine / threonine-protein kinase (PIM,such as PIM-1, PIM-2, PIM-3), P-selectin, purine nucleoside phosphorylase, purine receptor P2X ligand gated ion channel 7 (P2X7), pyruvate dehydrogenase (PDH), pyruvate dehydrogenase kinase, pyruvate kinase (PYK), 5-α-reductase, Raf protein kinase (such as 1, B), RAF1 gene, Ras gene, Ras GTPase, RET gene, Ret tyrosine kinase receptor, retinoblastoma-associated protein, retinoic acid receptor (such as γ), retinoid X receptor, Rheb (Ras homolog abundant in brain) GTPase, Rho (Ras homolog) associated protein kinase 2, ribonuclease, ribonucleotide reductase (such as M2 subunit), ribosomal protein S6 kinase, RNA polymerase (such as I, II), Ron (Recepteur d′Origine Nantais) tyrosine kinase, ROS1 (ROS proto-oncogene 1, receptor tyrosine kinase) gene, Ros1 tyrosine kinase, Runt-related transcription factor 3, γ-secretase, S100 calcium-binding protein A9, myoplasmic calcium ATPase, second mitochondrial-derived caspase activator (SMAC) protein, secreted frizzled-related protein-2, semaphorin-4D, serine proteases, serine / threonine kinases (STKs), serine / threonine-protein kinases (TBKs, such as TBK1), signal transduction and transcription (STAT,Such as STAT-1, STAT-3, STAT-5), signaling lymphocytic activation molecule (SLAM) family member 7, six transmembrane epithelial antigen of the prostate (STEAP) gene, SL cytokine ligand, smoothened (SMO) receptor, sodium iodide co-transporter, sodium phosphate co-transporter 2B, somatostatin receptor (such as 1, 2, 3, 4, 5), sonic hedgehog protein, exchange factor (SOS), specific protein 1 (Sp1) transcription factor, sphingomyelin synthase, sphingosine kinase (such as 1, 2), sphingosine-1-phosphate receptor-1, spleen tyrosine kinase (SYK), S RC gene, Src tyrosine kinase, STAT3 gene, steroid sulfatase, interferon gene stimulator (STING) receptor, interferon gene protein stimulator, stromal cell-derived factor 1 ligand, SUMO (small anti-ubiquitin modifier), superoxide dismutase, survivin protein, synapsin 3, syndecan-1, synuclein α, T cell surface glycoprotein CD28, box binding kinase (TBK), TATA box binding protein-associated factor RNA polymerase I subunit B (TAF1B) gene, T cell CD3 glycoprotein ζ chain, T cell differentiation antigen CD6, T cell immunoglobulin containing and mucin domain protein 3 (TIM-3), T cell surface glycoprotein CD8, Tec protein tyrosine kinase, Tek tyrosine kinase receptor, telomerase, telomerase reverse transcriptase (TERT) gene, tenascin, TGFβ2 ligand, thrombopoietin receptor, thymidine kinase, thymidine phosphorylase, thymidylate synthase, thymosin (such as α1), thyroid hormone receptor, thyroid stimulating hormone receptor, tissue factor, TNF-related apoptosis-inducing ligand, TNFR1-related death domain protein, TNF-related apoptosis-inducing ligand (TRAIL) receptor, TNFSF11 gene, TN FSF9 gene, Toll-like receptors (TLRs, such as 1-13), topoisomerases (such as I, II, III), transcription factors, transferases, transferrin, transforming growth factor (TGF, such as β) kinase, transforming growth factor TGF-β receptor kinase, transglutaminase, translocation-associated protein, transmembrane glycoprotein NMB, Trop-2 calcium signaling protein, trophoblast glycoprotein (TPBG) gene, trophoblast glycoprotein, myosin receptor kinase (Trk) receptor (such as TrkA, TrkB, TrkC), tryptophan 5-hydroxylase, tubulin, tumor necrosis factor (TNF,Such as α, β), tumor necrosis factor 13C receptor, tumor progression locus 2 (TPL2), tumor protein 53 (TP53) gene, tumor suppressor candidate 2 (TUSC2) gene, tyrosinase, tyrosine hydroxylase, tyrosine kinase (TK), tyrosine kinase receptor, tyrosine kinase with immunoglobulin and EGF domains (TIE) receptor, tyrosine protein kinase ABL1 inhibitor, ubiquitin, ubiquitin carboxyl hydrolase isozyme L5, ubiquitin thioesterase-14, ubiquitin conjugating enzyme E2I (UBE2I, UBC9), urease (Urease), urokinase plasminogen activator, uterine spheroid Uteroglobin, vanilloid VR1, vascular cell adhesion protein 1, vascular endothelial growth factor receptor (VEGFR), V-domain Ig inhibitor of T cell activation (VISTA), VEGF-1 receptor, VEGF-2 receptor, VEGF-3 receptor, VEGF-A, VEGF-B, vimentin, vitamin D3 receptor, proto-oncogene tyrosine-protein kinase Yes, Wee-1 protein kinase, Wilms' tumor antigen 1, Wilms' tumor protein, X-linked inhibitor of apoptosis protein, zinc finger protein transcription factor, or any combination thereof. 730-29-2,

[0456] Non-limiting examples of other therapeutic agents can be classified by their mechanism of action into, for example, the following groups:

[0457] Antimetabolites / anticancer agents such as the pyrimidine analogs floxuridine, capecitabine, cytarabine, CPX-351 (lipid cytarabine, daunomycin), and TAS-118;

[0458] Purine analogs, folate antagonists (such as pralatrexate) and related inhibitors;

[0459] Antiproliferative / antimitotic agents, including natural products such as vinca alkaloids (vinblastine, vincristine) and microtubule disrupting agents such as taxanes (paclitaxel, docetaxel), vinblastine, nocodazole, epothilone, vinorelbine and epipodophyllotoxins (etoposide, teniposide);

[0460] DNA damaging agents such as actinomycin, amsacrine, busulfan, carboplatin, chlorambucil, cisplatin, cyclophosphamide Actinomycin D, daunomycin, cranberry, epirubicin, ifosfamide, melphalan, dichloromethane, mitomycin C, mitoxantrone, nitrosoureas, procarbazine, paclitaxel, Taxotere, teniposide, etoposide, and triethylthiophosphoramide;

[0461] DNA hypomethylating agents such as guadecitabine (SGI-110), ASTX727;

[0462] Antibiotics, such as actinomycin D, daunomycin, cyproconazole, idarubicin, anthracyclines, mitoxantrone, bleomycins, plicamycin (mithramycin);

[0463] Enzymes such as L-asparaginase that systemically metabolize L-asparagine and deprive cells that do not have the ability to synthesize their own asparagine;

[0464] Antiplatelet agents;

[0465] DNAi oligonucleotides targeting Bcl-2, such as PNT2258;

[0466] Agents that activate or reactivate latent human immunodeficiency virus (HIV), such as panobinostat and romidepsin;

[0467] Asparaginase stimulators, such as crisantaspase and GRASPA (ERY-001, ERY-ASP), calaspargase pegol;

[0468] pan-Trk, ROS1 and ALK inhibitors, such as entrectinib and TPX-0005;

[0469] ALK inhibitors, such as alectinib and ceritinib;

[0470] Antiproliferative / antimitotic alkylating agents such as nitrogen mustard cyclophosphamide and analogs (melphalan, chlorambucil, hexamethylmelamine, and thiotepa), alkyl nitrosoureas (carmustine) and analogs, streptozotocin, and triazenes (dacarbazine);

[0471] antiproliferative / antimitotic antimetabolites, such as folic acid analogs (methotrexate);

[0472] Platinum coordination complexes (cisplatin, oxaliplatin and carboplatin), procarbazine, hydroxyurea, mitotane and aminoglutethimide;

[0473] Hormones, hormone analogs (estrogens, tamoxifen, goserelin, bicalutamide, and nilutamide), and aromatase inhibitors (letrozole and anastrozole);

[0474] Anticoagulants, such as heparin, synthetic heparin salts, and other thrombin inhibitors;

[0475] Fibrinolytic agents, such as tissue plasminogen activator, streptokinase, urokinase, aspirin, dipyridamole, ticlopidine and clopidogrel;

[0476] Anti-migration agents;

[0477] Antisecretory agents (breveldin);

[0478] Immunosuppressants, such as tacrolimus, sirolimus, azathioprine, and mycophenolate;

[0479] growth factor inhibitors, and vascular endothelial growth factor inhibitors;

[0480] Fibroblast growth factor inhibitors, such as FPA14;

[0481] Anti-VEGFR antibodies, such as IMC-3C5, GNR-011, tanibirumab;

[0482] Anti-VEGF / DDL4 antibodies, such as ABT-165;

[0483] Anti-cadherin antibodies, such as HKT-288;

[0484] Anti-CD70 antibodies, such as AMG-172; Anti-leucine-rich repeat 15 (LRRC15) antibodies, such as ABBV-085.ARGX-110;

[0485] Angiotensin receptor blockers, nitric oxide donors;

[0486] Antisense oligonucleotides, such as AEG35156, IONIS-KRAS-2.5Rx, EZN-3042, RX-0201, IONIS-AR-2.5Rx, BP-100 (prexigebersen), IONIS-STAT3-2.5Rx;

[0487] DNA interfering oligonucleotides, such as PNT2258, AZD-9150;

[0488] Anti-ANG-2 antibodies, such as MEDI3617 and LY3127804;

[0489] Anti-ANG-1 / ANG-2 antibodies, such as AMG-780;

[0490] Anti-MET / EGFR antibodies, such as LY3164530;

[0491] Anti-EGFR antibodies, such as ABT-414, AMG-595, necitumumab, ABBV-221, depatuxizumab mafodotin (ABT-414), tomozutuximab, ABT-806, vectibix, modotuximab, RM-1929;

[0492] Anti-CSF1R antibodies, such as emactuzumab, LY3022855, AMG-820, FPA-008 (cabiralizumab);

[0493] Anti-CD40 antibodies, such as RG7876, SEA-CD40, APX-005M, ABBV-428;

[0494] Anti-endoglin antibodies, such as TRC105 (carotuximab);

[0495] Anti-CD45 antibodies, such as 131I-BC8 (lomab-B);

[0496] Anti-HER3 antibodies, such as LJM716 and GSK2849330;

[0497] Anti-HER2 antibodies, such as margetuximab, MEDI4276, BAT-8001;

[0498] Anti-HLA-DR antibodies, such as IMMU-114;

[0499] Anti-IL-3 antibodies, such as JNJ-56022473;

[0500] Anti-OX40 antibodies, such as MEDI6469, MEDI6383, MEDI0562 (tavolixizumab), MOXR0916, PF-04518600, RG-7888, GSK-3174998, INCAGN1949, BMS-986178, GBR-8383, ABBV-368;

[0501] Anti-EphA3 antibodies, such as KB-004;

[0502] Anti-CD20 antibodies, such as obinutuzumab, IGN-002;

[0503] Anti-CD20 / CD3 antibodies, such as RG7828;

[0504] Anti-CD37 antibodies, such as AGS67E, otlertuzumab (TRU-016);

[0505] Anti-ENPP3 antibodies, such as AGS-16C3F;

[0506] Anti-FGFR-3 antibodies, such as LY3076226, B-701;

[0507] Anti-FGFR-2 antibodies, such as GAL-F2;

[0508] Anti-C5 antibodies, such as ALXN-1210;

[0509] Anti-CD27 antibodies, such as varlilumab (CDX-1127);

[0510] Anti-TROP-2 antibodies, such as IMMU-132

[0511] Anti-NKG2a antibodies, such as monalizumab;

[0512] Anti-VISTA antibodies, such as HMBD-002;

[0513] Anti-PVRIG antibodies, such as COM-701;

[0514] Anti-EpCAM antibodies, such as VB4-845;

[0515] Anti-BCMA antibodies, such as GSK-2857916

[0516] Anti-CEA antibodies, such as RG-7813;

[0517] Anti-cluster of differentiation 3 (CD3) antibodies, such as MGD015;

[0518] Anti-folate receptor alpha antibodies, such as IMGN853;

[0519] MCL-1 inhibitors, such as AMG-176, S-64315, AZD-5991, 483-LM, A-1210477, UMI-77, JKY-5-037;

[0520] epha2 inhibitors, such as MM-310;

[0521] Anti-LAG-3 antibodies, such as relatlimab (ONO-4482), LAG-525, MK-4280, REGN-3767;

[0522] Raf kinase / VEGFR inhibitors, such as RAF-265;

[0523] Polycomb (EED) inhibitors, such as MAK683;

[0524] Anti-fibroblast activation protein (FAP) / IL-2R antibodies, such as RG7461;

[0525] Anti-fibroblast activation protein (FAP) / TRAIL-R2 antibodies, such as RG7386;

[0526] Anti-Fucosyl-GM1 antibodies, such as BMS-986012;

[0527] p38 MAP kinase inhibitors, such as ralimetinib;

[0528] PRMT1 inhibitors, such as MS203;

[0529] Sphingosine kinase 2 (SK2) inhibitors, such as opaganib;

[0530] FLT3-ITD inhibitors, such as BCI-332;

[0531] Erythroid 2-related factor 2 stimulators, such as omaveloxolone (RTA-408);

[0532] TRK inhibitors, such as LOXO-195 and ONO-7579;

[0533] Anti-ICOS antibodies, such as JTX-2011, GSK3359609;

[0534] Anti-DR5 (TRAIL2) antibodies, such as DS-8273;

[0535] Anti-GD2 antibodies, such as APN-301;

[0536] Anti-interleukin-17 (IL-17) antibodies, such as CJM-112;

[0537] Anti-carbonic anhydrase IX antibodies, such as TX-250;

[0538] Anti-CD38-atenin, such as TAK573;

[0539] Anti-MUC-1 antibodies, such as gatipotuzumab;

[0540] Mucin 1 inhibitors, such as GO-203-2C;

[0541] MARCKS protein inhibitors, such as BIO-11006;

[0542] Folate antagonists, such as arfolitixorin;

[0543] Galectin-3 inhibitors, such as GR-MD-02;

[0544] Phospho-P68 inhibitors, such as RX-5902;

[0545] CD95 / TNF modulators, such as ofranergene obadenovec;

[0546] PI3K / Akt / mTOR inhibitors, such as ABTL-0812;

[0547] pan-PIM kinase inhibitors, such as INCB-053914;

[0548] IL-12 gene stimulators, such as EGEN-001, tavokinogene telseplasmid;

[0549] Heat shock protein HSP90 inhibitors, such as TAS-116, PEN-866;

[0550] VEGF / HGF antagonists, such as MP-0250;

[0551] SYK tyrosine kinase / FLT3 tyrosine kinase inhibitors, such as TAK-659;

[0552] SYK tyrosine kinase / JAK tyrosine kinase inhibitors, such as ASN-002;

[0553] FLT3 tyrosine kinase inhibitors, such as FF-10101;

[0554] FLT3 tyrosine kinase agonists, such as CDX-301;

[0555] FLT3 / MEK1 inhibitors, such as E-6201;

[0556] IL-24 antagonists, such as AD-IL24;

[0557] RIG-I promoters, such as RGT-100;

[0558] Aeromonas lysin stimulants, such as topsalysin;

[0559] P-glycoprotein 1 inhibitors, such as HM-30181A;

[0560] CSF-1 antagonists, such as ARRY-382 and BLZ-945;

[0561] Anti-mesothelin antibodies, such as SEL-403;

[0562] Thymidine kinase stimulators, such as aglatimagene besadenovec;

[0563] Polo-like kinase 1 inhibitors, such as PCM-075;

[0564] TLR-7 agonists, such as TMX-101 (imiquimod);

[0565] NEDD8 inhibitors, such as pevonedistat (MLN-4924), TAS-4464;

[0566] Pleiotropic pathway modulators, such as avadomide (CC-122);

[0567] FoxM1 inhibitors, such as thiostrepton;

[0568] Anti-MUC1 antibodies, such as Mab-AR-20.5;

[0569] Anti-CD38 antibodies, such as isatuximab, MOR-202;

[0570] UBA1 inhibitors, such as TAK-243;

[0571] Src tyrosine kinase inhibitors, such as VAL-201;

[0572] VDAC / HK inhibitors, such as VDA-1102;

[0573] BRAF / PI3K inhibitors, such as ASN-003;

[0574] Elf4a inhibitors, such as rohinitib, eFT226;

[0575] TP53 gene stimulators, such as ad-p53;

[0576] PD-L1 / EGFR inhibitors, such as GNS-1480;

[0577] Retinoic acid receptor alpha (RARα) inhibitors, such as SY-1425;

[0578] SIRT3 inhibitors, such as YC8-02;

[0579] Stromal cell-derived factor 1 ligand inhibitors, such as olaptesed pegol (NOX-A12);

[0580] IL-4 receptor modulators, such as MDNA-55;

[0581] Arginase-I stimulators, such as pegzilarginase;

[0582] Topoisomerase I inhibitors / hypoxia-inducible factor-1α inhibitors, such as PEG-SN38 (firtecan pegol);

[0583] Hypoxia-inducible factor-1α inhibitors, such as PT-2977, PT-2385;

[0584] CD122 agonists, such as NKTR-214;

[0585] p53 tumor suppressor protein stimulators, such as kevetrin;

[0586] Mdm4 / Mdm2 p53 binding protein inhibitors, such as ALRN-6924;

[0587] Kinesin spindle protein (KSP) inhibitors, such as filansib (ARRY-520);

[0588] CD80-fc fusion protein inhibitors, such as FPT-155;

[0589] Multiple endocrine neoplasia protein and mixed cell line leukemia (MLL) inhibitors, such as KO-539;

[0590] Liver X receptor agonists, such as RGX-104;

[0591] IL-10 agonists, such as AM-0010;

[0592] EGFR / ErbB-2 inhibitors, such as varlitinib;

[0593] VEGFR / PDGFR inhibitors, such as vorolanib;

[0594] IRAK4 inhibitors, such as CA-4948;

[0595] Anti-TLR-2 antibodies, such as OPN-305;

[0596] Calmodulin modulators, such as CBP-501;

[0597] Glucocorticoid receptor antagonists, such as relacorilant (CORT-125134);

[0598] A second mitochondrial-derived activator of caspase (SMAC) protein inhibitor, such as BI-891065;

[0599] Lactoferrin modulators, such as LTX-315;

[0600] Kit tyrosine kinase / PDGF receptor alpha antagonists, such as DCC-2618;

[0601] KIT inhibitors, such as PLX-9486;

[0602] Nuclear exportin 1 inhibitors, such as eltanexor;

[0603] EGFR / ErbB2 / Ephb4 inhibitors, such as tesevatinib;

[0604] Anti-CD33 antibodies, such as IMGN-779;

[0605] Anti-KMA antibodies, such as MDX-1097;

[0606] Anti-TIM-3 antibodies, such as TSR-022, LY-3321367, MBG-453;

[0607] Anti-CD55 antibodies, such as PAT-SC1;

[0608] Anti-PSMA antibodies, such as ATL-101;

[0609] Anti-CD100 antibodies, such as VX-15;

[0610] Anti-EPHA3 antibodies, such as fibatuzumab;

[0611] Anti-Erbb antibodies, such as CDX-3379, HLX-02, seribantumab;

[0612] Anti-APRIL antibodies, such as BION-1301;

[0613] Anti-Tigit antibodies, such as BMS-986207, RG-6058;

[0614] CHST15 gene inhibitors, such as STNM-01;

[0615] RAS inhibitors, such as NEO-100;

[0616] Somatostatin receptor antagonists, such as OPS-201;

[0617] CEBPA gene stimulators, such as MTL-501;

[0618] DKK3 gene modulators, such as MTG-201;

[0619] p70s6k inhibitors, such as MSC2363318A;

[0620] Methionine aminopeptidase 2 (MetAP2) inhibitors, such as M8891, APL-1202;

[0621] Arginine N-methyltransferase 5 inhibitors, such as GSK-3326595;

[0622] Anti-progressive cell death protein 1 (anti-PD-1) antibodies, such as nivolumab ( BMS-936558, MDX-1106), pembrolizumab ( MK-3477, SCH-900475, lambrolizumab (CAS accession number 1374853-91-4), pilizumab, PF-06801591, BGB-A317, GLS-010 (WBP-3055), AK-103 (HX-008), MGA-012, BI-754091, REGN-2810 (semipizumab), AGEN-2034, JS-001, JNJ-63723283, genolimzumab (CBT-501), LZM-009, BCD-100, LY-3300054, SHR-1201, BAT-130 6, and anti-progressive death ligand 1 (anti-PD-L1) antibodies, such as BMS-936559, atezolizumab (MPDL3280A), durvalumab (MEDI4736), avlumab, CK-301 (MSB0010718C), MEDI0680, CX-072, CBT-502, PDR-001 (spartalizumab), TSR-042 (dostarlimab), JTX-4014, BGB-A333, SHR-1316, CS-1001 (WBP-3155, KN-035, IBI-308, FAZ-053, and MDX1105-01);

[0623] PD-L1 / VISTA antagonists, such as CA-170;

[0624] Anti-PD-L1 / TGFβ antibodies, such as M7824;

[0625] Anti-transferrin antibodies, such as CX-2029;

[0626] Anti-IL-8 (interleukin-8) antibodies, such as HuMax-Inflam;

[0627] ATM (ataxia telangiectasia) inhibitors, such as AZD0156;

[0628] CHK1 inhibitors, such as GDC-0575, LY2606368 (prexasertib), SRA737, RG7741 (CHK1 / 2);

[0629] CXCR4 antagonists, such as BL-8040, LY2510924, burixafor (TG-0054), X4P-002, X4P-001-IO;

[0630] EXH2 inhibitors, such as GSK2816126;

[0631] HER2 inhibitors, such as neratinib, tucatinib (ONT-380);

[0632] KDM1 inhibitors, such as ORY-1001, IMG-7289, INCB-59872, GSK-2879552;

[0633] CXCR2 antagonists, such as AZD-5069;

[0634] GM-CSF antibodies, such as lenzilumab;

[0635] DNA-dependent protein kinase inhibitors, such as MSC2490484A (nedisertib), VX-984, AsiDNA (DT-01);

[0636] Protein kinase C (PKC) inhibitors, such as LXS-196, sotrastaurin;

[0637] Selective estrogen receptor downregulators (SERDs), such as fulvestrant RG6046, RG6047, elacestrant (RAD-1901), and AZD9496;

[0638] Selective estrogen receptor covalent antagonists (SERCAs), such as H3B-6545;

[0639] Selective androgen receptor modulators (SARMs), such as GTX-024 and darolutamide;

[0640] Transforming growth factor-β (TGF-β) kinase antagonists, such as galunisertib;

[0641] Anti-transforming growth factor-β (TGF-β) antibodies, such as LY3022859, NIS793, XOMA 089;

[0642] Bispecific antibodies, such as MM-141 (IGF-1 / ErbB3), MM-111 (Erb2 / Erb3), JNJ-64052781 (CD19 / CD3), PRS-343 (CD-137 / HER2), AFM26 (BCMA / CD16A), JNJ-61186372 (EGFR / cMET), AMG-211 (CEA / CD3), RG7802 (CEA / CD3), ERY-974 (CD3 / GPC3), vancizumab (angiopoietin / VEGF), PF-06671008 (cadherin / CD3), AFM-13 (CD16 / CD30), APVO436 (CD123 / CD3), flotezumab (flotet uzumab)(CD123 / CD3), REGN-1979(CD20 / CD3), MCLA-117(CD3 / CLEC12A), MCLA-128(HER2 / HER3), JNJ-0819, JNJ-7564(CD3 / heme), AMG-757(DLL3-CD3), MGD-013(PD-1 / LAG -3), AK-104(CTLA-4 / PD-1), AMG-330(CD33 / CD3), AMG-420(BCMA / CD3), BI-836880(V EFG / ANG2), JNJ-63709178(CD123 / CD3), MGD-007(CD3 / gpA33), MGD-009(CD3 / B7H3);

[0643] Mutant-selective EGFR inhibitors, such as PF-06747775, EGF816 (nazartinib), ASP8273, ACEA-0010, BI-1482694;

[0644] Anti-GITR (glucocorticoid-induced tumor necrosis factor receptor-related protein) antibodies, such as MEDI1873, FPA-154, INCAGN-1876, TRX-518, BMS-986156, MK-1248, GWN-323;

[0645] Anti-delta-like protein ligand 3 (DDL3) antibodies, such as rovalpituzumab tesirine;

[0646] Anti-clusterin antibodies, such as AB-16B5;

[0647] Anti-EFNA4 antibodies, such as PF-06647263;

[0648] Anti-RANKL antibodies, such as denosumab;

[0649] Anti-mesothelin antibodies, such as BMS-986148, anti-MSLN-MMAE;

[0650] Anti-sodium phosphate co-transporter 2B (NaP2B) antibodies, such as lifastuzumab;

[0651] Anti-c-Met antibodies, such as ABBV-399;

[0652] Adenosine A2A receptor antagonists, such as CPI-444, AZD-4635, preladenant, PBF-509;

[0653] α-ketoglutarate dehydrogenase (KGDH) inhibitors, such as CPI-613;

[0654] XPO1 inhibitors, such as selinexor (KPT-330);

[0655] Isocitrate dehydrogenase 2 (IDH2) inhibitors, such as enasidenib (AG-221);

[0656] IDH1 inhibitors, such as AG-120 and AG-881 (IDH1 and IDH2), IDH-305, BAY-1436032;

[0657] Interleukin-3 receptor (IL-3R) modulators, such as SL-401;

[0658] Arginine deiminase stimulators, such as polyethylene glycol arginine deiminase (ADI-PEG-20);

[0659] Antibody-drug conjugates, such as MLN0264 (anti-GCC, guanylate cyclase C), T-DM1 (trastuzumab emtansine, Kadcycla), milatuzumab-hCD74-DOX, brentuximab vedotin, DCDT2980S, polatuzumab vedotin, SGN-CD70A, SGN-CD19A, inotuzumab bozogamicin, lorvotuzumab mertansine, SAR3419, isactuzumab govitecan, enfortumab vedotin vedotin)(ASG-22ME), ASG-15ME, DS-8201(trastuzumab deruxtecan), 225Ac-lintuzumab, U3-1402, 177Lu-tetraxetan-tetuloma, tisotumab vedotin, anetumabravtansine, CX-2009, SAR-566658, W-0101, polatuzumab vedotin, ABBV-085;

[0660] Claudin-18 inhibitors, such as claudiximab;

[0661] β-catenin inhibitors, such as CWP-291;

[0662] Anti-CD73 antibodies, such as MEDI-9447 (oleclumab), CPX-006, IPH-53, BMS-986179;

[0663] CD73 antagonists, such as AB-680, PSB-12379, PSB-12441, PSB-12425;

[0664] CD39 / CD73 antagonists, such as PBF-1662;

[0665] Chemokine receptor 2 (CCR) inhibitors, such as PF-04136309, CCX-872, BMS-813160 (CCR2 / CCR5);

[0666] Thymidylate synthase inhibitors, such as ONX-0801;

[0667] ALK / ROS1 inhibitors, such as lorlatinib;

[0668] Telomerase inhibitors, such as G007-LK;

[0669] Mdm2 p53-binding protein inhibitors, such as CMG-097, HDM-201;

[0670] c-PIM inhibitors, such as PIM447;

[0671] BRAF inhibitors, such as dabrafenib, vemurafenib, encorafenib (LGX818), PLX8394;

[0672] Sphingosine kinase-2 (SK2) inhibitors, such as (ABC294640);

[0673] Cell cycle inhibitors, such as selumetinib (MEK1 / 2) and sapacitabine;

[0674] AKT inhibitors, such as MK-2206, ipatasertib, afuresertib, AZD5363 and ARQ-092, capivasertib, triciribine;

[0675] Anti-CTLA-4 (cytotoxic T-lymphocyte protein-4) inhibitors, such as tremelimumab, AGEN-1884, BMS-986218;

[0676] c-MET inhibitors such as AMG-337, savolitinib, tivantinib (ARQ-197), capmatinib and tepotinib, ABT-700, AG213, AMG-208, JNJ-38877618 (OMO-1), merestinib, HQP-8361;

[0677] c-Met / VEGFR inhibitors, such as BMS-817378, TAS-115;

[0678] c-Met / RON inhibitors, such as BMS-777607;

[0679] BRAF / EGFR inhibitors, such as BGB-283;

[0680] BCR / ABL inhibitors, such as rebastinib and asciminib;

[0681] MNK1 / MNK2 inhibitors, such as eFT-508;

[0682] mTOR inhibitors / cytochrome P450 3A4 stimulators, such as TYME-88;

[0683] Lysine-specific demethylase-1 (LSD1) inhibitors, such as CC-90011;

[0684] Pan-RAF inhibitors, such as LY3009120, LXH254, TAK-580;

[0685] Raf / MEK inhibitors, such as RG7304;

[0686] CSF1R / KIT and FLT3 inhibitors, such as pexidartinib (PLX3397);

[0687] Kinase inhibitors, such as vandetanib;

[0688] E-selectin antagonists, such as GMI-1271;

[0689] Differentiation-inducing agents, such as retinoic acid;

[0690] Epidermal growth factor receptor (EGFR) inhibitors, such as osimertinib (AZD-9291);

[0691] topoisomerase inhibitors such as daunorubicin, daunorubicin, actinomycin D, eniposide, epirubicin, etoposide, idarubicin, irinotecan, mitoxantrone, pixantrone, sobuzoxane, topotecan, irinotecan, MM-398 (lipid irinotecan), vosaroxin and GPX-150, aldoxorubicin, AR-67, mavelertinib, AST-2818, avitinib (ACEA-0010), irofulven (MGI-114);

[0692] Corticosteroids such as cortisone, dexamethasone, hydrocortisone, methylprednisolone, prednisone, prednisolone;

[0693] Growth factor signaling kinase inhibitors;

[0694] Nucleoside analogs, such as DFP-10917;

[0695] Axl inhibitors such as BGB-324 (bemcentinib), SLC-0211;

[0696] BET inhibitors such as INCB-054329, INCB057643, TEN-010, AZD-5153, ABT-767, BMS-986158, CC-90010, GSK525762 (molibresib), NHWD-870, ODM-207, GSK-2820151, GSK-1210151A, ZBC246, ZBC260, ZEN3694, FT-1101, RG-6146, CC-90010, mivebresib, BI-894999, PLX-2853, PLX-51107, CPI-0610, GS-5829;

[0697] PARP inhibitors such as olaparib, veliparib, talazoparib, ABT-767, BGB-290;

[0698] Proteasome inhibitors, such as ixazomib and carfilzomib Marizomib;

[0699] Glutamate inhibitors, such as CB-839;

[0700] Vaccines such as peptide vaccines TG-01 (RAS), GALE-301, GALE-302, nelipepimut-s, SurVaxM, DSP-7888, TPIV-200, PVX-410, VXL-100, DPX-E7, ISA-101, 6MHP, OSE-2101, galinpepimut-S, SVN53-67 / M57-KLH, IMU-131; bacterial vector vaccines such as CRS-207 / GVAX: axalimogene filolisbac (ADXS11-001); adenovirus vector vaccines such as nadofaragene firadenovec); autologous Gp96 vaccines; dendritic cell vaccines such as CVactm, stapuldencel-T, eltrapuldencel-T, SL-701, BSK01TM, rocapuldencel-T (AGS-003), DCVAC, CVac tm 、stapuldencel-T、eltrapuldencel-T、SL-701、BSK01 TM , ADXS31-142; oncolytic vaccines such as talimogene laherparepvec, pexastimogene devacirepvec, GL-ONC1, MG1-MA3, parvovirus H-1, ProstAtak, enadenotucirev, MG1MA3, ASN-002 (TG-1042); therapeutic vaccines such as CVAC-301, CMP-001, PF-06753512, VBI-1901, TG-4010, ProscaVax TM ; Tumor cell vaccines, such as (IND-14205), Oncoquest-L vaccine; live attenuated recombinant serotype 1 poliovirus vaccine, such as PVS-RIPO; Adagloxad simolenin; MEDI-0457; DPV-001, a tumor-derived autophagosome-enriched cancer vaccine; RNA vaccines, such as CV-9209, LV-305; DNA vaccines, such as MEDI-0457, MVI-816, INO-5401; modified poxvirus Ankara vaccine expressing p53, such as MVA-p53; DPX-Survivac; BriaVax TM ;GI-6301;GI-6207;GI-4000;

[0701] Anti-DLL4 (delta-like ligand 4) antibodies, such as demcizumab;

[0702] STAT-3 inhibitors, such as napabucasin (BBI-608);

[0703] ATPase p97 inhibitors, such as CB-5083;

[0704] Smoothened (SMO) receptor inhibitors, such as (sonidegib, formerly LDE-225), LEQ506, vismodegib (GDC-0449), BMS-833923, glasdegib (PF-04449913), LY2940680, and itraconazole;

[0705] Interferon alpha ligand modulators, such as interferon alpha-2b, interferon alpha-2a biosimilars (Biogenomics), ropeginterferon alpha-2b (AOP-2014, P-1101, PEG IFN alpha-2B), Multiferon (Alfanative, Viragen), interferon alpha 1b, Roferon-A (Canferon, Ro-25-3036), interferon alpha-2a follow-up biologicals (Biosidus) (Inmutag, Inter 2A), interferon alpha-2b follow-up biologicals (Biosidus-Bioferon, Citopheron, Ganapar, Beijing Kawin Technology (Kaferon), Alfaferone, pegylated interferon alpha-1b, pegylated interferon alpha-2b follow-on biologic (Amega), recombinant human interferon alpha-1b, recombinant human interferon alpha-2a, recombinant human interferon alpha-2b, veltuzumab-IFNα2b conjugate, Dynavax (SD-101), and interferon alpha-n1 (Humoferon, SM-10500, Sumiferon);

[0706] Interferon gamma ligand modulators, such as interferon gamma (OH-6000, Ogamma 100);

[0707] IL-6 receptor modulators, such as tocilizumab, siltuximab, AS-101 (CB-06-02, IVX-Q-101);

[0708] Telomerase modulators, such as tertomotide (GV-1001, HR-2802, Riavax) and imetelstat (GRN-163, JNJ-63935937);

[0709] DNA methyltransferase inhibitors such as temozolomide (CCRG-81045), decitabine, guadecitabine (S-110, SGI-110), KRX-0402, RX-3117, RRx-001, and azacitidine;

[0710] DNA gyrase inhibitors, such as pixantrone and sobuzoxane;

[0711] BCL-2 family protein inhibitors, such as ABT-263, venetoclax (ABT-199), ABT-737, and AT-101;

[0712] Notch inhibitors such as LY3039478 (crenigacestat), tarextumab (anti-Notch2 / 3), BMS-906024;

[0713] Anti-myostatin inhibitors, such as landogrozumab;

[0714] Hyaluronidase stimulators, such as PEGPH-20;

[0715] Wnt pathway inhibitors, such as SM-04755, PRI-724, WNT-974;

[0716] γ-secretase inhibitors, such as PF-03084014, MK-0752, RO-4929097;

[0717] Grb-2 (growth factor receptor binding protein-2) inhibitors, such as BP1001;

[0718] TRAIL pathway inducing compounds, such as ONC201 and ABBV-621;

[0719] Focal adhesion kinase inhibitors, such as VS-4718, defactinib, GSK2256098;

[0720] Hedgehog inhibitors, such as saridegib, sonidegib (LDE225), glasdegib, and vismodegib;

[0721] Aurora kinase inhibitors, such as alisertib (MLN-8237) and AZD-2811, AMG-900, barasertib, ENMD-2076;

[0722] HSPB1 modulators (heat shock protein 27, HSP27), such as brivudine, apatorsen;

[0723] ATR inhibitors such as BAY-937, AZD6738, AZD6783, VX-803, VX-970 (berzosertib), and VX-970;

[0724] mTOR inhibitors, such as sapanisertib and vistusertib (AZD2014), ME-344;

[0725] mTOR / PI3K inhibitors, such as gedatolisib, GSK2141795, omipalisib, RG6114;

[0726] Hsp90 inhibitors such as AUY922, onalespib (AT13387), SNX-2112, SNX5422;

[0727] Murine double minute (mdm2) oncogene inhibitors, such as DS-3032b, RG7775, AMG-232, HDM201, and idasanutlin (RG7388);

[0728] CD137 agonists, such as urelumab, utomilumab (PF-05082566);

[0729] STING agonists, such as ADU-S100 (MIW-815), SB-11285, MK-1454, SR-8291, AdVCA0848, GSK-532, SYN-STING, MSA-1, SR-8291;

[0730] FGFR inhibitors such as FGF-401, INCB-054828, BAY-1163877, AZD4547, JNJ-42756493, LY2874455, Debio-1347;

[0731] Fatty acid synthase (FASN) inhibitors, such as TVB-2640;

[0732] Anti-KIR monoclonal antibodies, such as lirilumab (IPH-2102), IPH-4102;

[0733] Antigen CD19 inhibitors, such as MOR208, MEDI-551, AFM-11, inebilizumab;

[0734] CD44 binders, such as A6;

[0735] Protein phosphatase 2A (PP2A) inhibitors, such as LB-100;

[0736] CYP17 inhibitors, such as seviteronel (VT-464), ASN-001, ODM-204, CFG920, abiraterone acetate;

[0737] RXR agonists, such as IRX4204;

[0738] Hedgehog / Smoothened (hh / Smo) antagonists, such as taladegib, patidegib;

[0739] Complement C3 modulators, such as Imprime PGG;

[0740] IL-15 agonists, such as ALT-803, NKTR-255, and hetIL-15;

[0741] EZH2 (enhancer of zeste homolog 2) inhibitors, such as tazemetostat, CPI-1205, GSK-2816126;

[0742] Oncolytic viruses, such as pelareorep, CG-0070, MV-NIS therapy, HSV-1716, DS-1647, VCN-01, ONCOS-102, TBI-1401, tasadenoturev (DNX-2401), vocimagene amiretrorepvec, RP-1, CVA21, Celyvir, LOAd-703, OBP-301;

[0743] DOT1L (histone methyltransferase) inhibitors, such as pinometostat (EPZ-5676);

[0744] Toxins, such as cholera toxin, ricin, Pseudomonas exotoxin, Bordetella pertussis adenylate cyclase toxin, diphtheria toxin, and caspase activators;

[0745] DNA plasmids, such as BC-819

[0746] PLK inhibitors of PLK 1, 2, and 3, such as volasertib (PLK1);

[0747] WEE1 inhibitors, such as AZD1775 (adavosertib);

[0748] Rho kinase (ROCK) inhibitors, such as AT13148, KD025;

[0749] ERK inhibitors, such as GDC-0994, LY3214996, MK-8353;

[0750] IAP inhibitors such as ASTX660, debio-1143, birinapant, APG-1387, LCL-161;

[0751] RNA polymerase inhibitors such as lurbinectedin (PM-1183), CX-5461;

[0752] Tubulin inhibitors, such as PM-184, BAL-101553 (lisavanbulin), and OXI-4503, fluorapacin (AC-0001), plinabulin;

[0753] Toll-like receptor 4 (TL4) agonists, such as G100, GSK1795091, and PEPA-10;

[0754] elongation factor 1α2 inhibitors, such as plitidepsin;

[0755] CD95 inhibitors, such as APG-101, APO-010, asunercept;

[0756] WT1 inhibitors, such as DSP-7888;

[0757] Splicing factor 3B subunit 1 (SF3B1) inhibitors, such as H3B-8800;

[0758] PDGFRα / KIT mutant-specific inhibitors, such as BLU-285;

[0759] SHP-2 inhibitors, such as TNO155 (SHP-099), RMC-4550; and

[0760] Retinoid Z receptor gamma (RORγ) agonists, such as LYC-55716.

[0761] In some embodiments, provided herein are methods of treating or preventing a hyperproliferative disorder or cancer in a human or animal suffering from or at risk of suffering from a hyperproliferative disorder or cancer, comprising administering to the human or animal a therapeutically effective amount of a compound of the invention, or a pharmaceutically acceptable salt thereof, in combination with a therapeutically effective amount of one or more (e.g., one, two, three, one or two or one to three) additional therapeutic agents selected from the group consisting of: an apoptosis signal-regulating kinase (ASK) inhibitor; a Bruton's tyrosine kinase (BTK) inhibitor; a cluster of differentiation 47 (CD47) inhibitor; a cyclin-dependent kinase (CDK) inhibitor; a discoidin-dependent kinase (CDK) inhibitor. domain receptor (DDR) inhibitors; histone deacetylase (HDAC) inhibitors; indoleamine-pyrrole-2,3-dioxygenase (IDO1) inhibitors; Janus kinase (JAK) inhibitors; lysine oxidase-like protein (LOXL) inhibitors; matrix metalloproteinase (MMP) inhibitors; mitogen-activated protein kinase (MEK) inhibitors; phosphatidylinositol 3-kinase (PI3K) inhibitors; spleen tyrosine kinase (SYK) inhibitors; Toll-like receptor 8 (TLR8) inhibitors; Toll-like receptor 9 (TLR9) inhibitors; tyrosine kinase inhibitors (TKI) and any combination thereof or a pharmaceutically acceptable salt thereof. Non-limiting examples include:

[0762] Apoptosis signal regulating kinase (ASK) inhibitors: ASK inhibitors include ASK1 inhibitors. Examples of ASK1 inhibitors include (but are not limited to) inhibitors described in WO 2011 / 008709 (Gilead Sciences) and WO 2013 / 112741 (Gilead Sciences);

[0763] Bruton's tyrosine kinase (BTK) inhibitors: Examples of BTK inhibitors include, but are not limited to, (S)-6-amino-9-(1-(but-2-ynyl)pyrrolidin-3-yl)-7-(4-phenoxyphenyl)-7H-purin-8(9H)-one, acalabrutinib (ACP-196), BGB-3111, CB988, HM71224, ibrutinib, ), M-2951 (evobrutinib), M7583, tirabrutinib (ONO-4059), PRN-1008, spebrutinib (CC-292), TAK-020, vecabrutinib, ARQ-531, SHR-1459, DTRMWXHS-12, TAS-5315;

[0764] Cluster of differentiation 47 (CD47) inhibitors: Examples of CD47 inhibitors include, but are not limited to, anti-CD47 mAb (Vx-1004), anti-human CD47 mAb (CNTO-7108), CC-90002, CC-90002-ST-001, humanized anti-CD47 antibody (Hu5F9-G4), NI-1701, NI-1801, RCT-1938, and TTI-621;

[0765] Cyclin-dependent kinase (CDK) inhibitors: CDK inhibitors include inhibitors of CDK1, 2, 3, 4, 6, 7 and 9, such as abemaciclib, alvocidib (HMR-1275, flavopiridol), AT-7519, dinaciclib, ibrance, FLX-925, LEE001, palbociclib, ribociclib, rigosertib, selinexor, UCN-01, SY1365, CT-7001, SY-1365, G1T38, milciclib, trilaciclib and TG-02;

[0766] Discoidin domain receptor (DDR) inhibitors: DDR inhibitors include inhibitors of DDR1 and / or DDR2. Examples of DDR inhibitors include, but are not limited to, inhibitors disclosed in WO 2014 / 047624 (Gilead Sciences), US 2009-0142345 (Takeda Pharmaceutical), US 2011-0287011 (Oncomed Pharmaceuticals), WO 2013 / 027802 (Chugai Pharmaceutical), and WO 2013 / 034933 (Imperial Innovations);

[0767] Histone deacetylase (HDAC) inhibitors: Examples of HDAC inhibitors include, but are not limited to, abexinostat, ACY-241, AR-42, BEBT-908, belinostat, CKD-581, CS-055 (HBI-8000), CUDC-907 (fimepinostat), entinostat, givinostat, mocetinostat, panobinostat, pracinostat, quisinostat (JNJ-26481585), resminostat, ricolinostat, SHP-141, valproic acid (VAL-001), vorinostat, tinostamustine, remetinostat, entinostat;

[0768] Indoleamine-pyrrole-2,3-dioxygenase (IDO1) inhibitors: Examples of IDO1 inhibitors include, but are not limited to, BLV-0801, epacadostat, F-001287, GBV-1012, GBV-1028, GDC-0919, indoximod, NKTR-218, NLG-919-based vaccines, PF-06840003, pyranonaphthoquinone derivatives (SN-35837), resminostat, SBLK-200802, BMS-986205, and shIDO-ST, EOS-200271, KHK-2455, LY-3381916;

[0769] Janus kinase (JAK) inhibitors: JAK inhibitors inhibit JAK1, JAK2, and / or JAK3. Examples of JAK inhibitors include, but are not limited to, AT9283, AZD1480, baricitinib, BMS-911543, fedratinib, filgotinib (GLPG0634), gandotinib (LY2784544), INCB039110 (itacitinib), lestaurtinib, momelotinib (CYT0387), NS-018, pacritinib (SB1518), peficitinib (ASP015K), ruxolitinib, tofacitinib (formerly tasocitinib), INCB052793, and XL019;

[0770] Liposyl oxidase protein (LOXL) inhibitors: LOXL inhibitors include inhibitors of LOXL1, LOXL2, LOXL3, LOXL4 and / or LOXL5. Examples of LOXL inhibitors include, but are not limited to, antibodies described in WO 2009 / 017833 (Arresto Biosciences). Examples of LOXL2 inhibitors include, but are not limited to, antibodies described in WO 2009 / 017833 (Arresto Biosciences), WO 2009 / 035791 (Arresto Biosciences), and WO 2011 / 097513 (Gilead Biologics);

[0771] Matrix metalloproteinase (MMP) inhibitors: MMP inhibitors include inhibitors of MMP1 to MMP 10. Examples of MMP9 inhibitors include, but are not limited to, marimastat (BB-2516), cipemastat (Ro32-3555), GS-5745 (andecaliximab), and the inhibitors described in WO 2012 / 027721 (Gilead Biologics);

[0772] Mitogen-activated protein kinase (MEK) inhibitors: MEK inhibitors include antroquinonol, binimetinib, cobimetinib (GDC-0973, XL-518), MT-144, selumetinib (AZD6244), sorafenib, trametinib (GSK1120212), uprosentib + trametinib, PD-0325901, pimasertib, LTT462, AS703988, CC-90003, and refametinib;

[0773] Phosphatidylinositol 3-kinase (PI3K) inhibitors: PI3K inhibitors include inhibitors of PI3Kγ, PI3Kδ, PI3Kβ, PI3Kα and / or pan-PI3K. Examples of PI3K inhibitors include, but are not limited to, ACP-319, AEZA-129, AMG-319, AS252424, AZD8186, BAY 10824391, BEZ235, buparlisib (BKM120), BYL719 (alpelisib), CH5132799, copanlisib (BAY 80-6946), duvelisib, GDC-0032, GDC-0077, GDC-0941, GDC-0980, GSK2636771, GSK2269557, idelalisib INCB50465, IPI-145, IPI-443, IPI-549, KAR4141, LY294002, LY3023414, MLN1117, OXY111A, PA799, PX-866, RG7604, rigosertib, RP5090, RP6530, SRX3177, taselisib, TG100115, TGR-1202 (umbralisib), TGX221, WX-037, X-339, X-414, XL147 (SAR245408), XL499, XL756, wortmannin, ZSTK474, and WO2005 / 113556 (ICOS), WO Compounds described in WO 2013 / 052699 (Gilead Calistoga), WO 2013 / 116562 (Gilead Calistoga), WO 2014 / 100765 (Gilead Calistoga), WO 2014 / 100767 (Gilead Calistoga) and WO 2014 / 201409 (Gilead Sciences);

[0774] Spleen tyrosine kinase (SYK) inhibitors: Examples of SYK inhibitors include, but are not limited to, 6-(1H-indazol-6-yl)-N-(4-N-morpholinylphenyl)imidazo[1,2-a]pyrazin-8-amine, BAY-61-3606, cerdulatinib (PRT-062607), entospletinib, fostamatinib (R788), HMPL-523, NVP-QAB 205AA, R112, R343, tamatinib (R406), and SYK inhibitors described in US 8450321 (Gilead Connecticut) and SYK inhibitors described in US2015 / 0175616;

[0775] Toll-like receptor 8 (TLR8) inhibitors: Examples of TLR8 inhibitors include, but are not limited to, E-6887, IMO-4200, IMO-8400, IMO-9200, MCT-465, MEDI-9197, motolimod, resiquimod, VTX-1463, and VTX-763;

[0776] Toll-like receptor 9 (TLR9) inhibitors: Examples of TLR9 inhibitors include, but are not limited to, AST-008, IMO-2055, IMO-2125, lefitolimod, litenimod, MGN-1601, and PUL-042; and

[0777] Tyrosine kinase inhibitors (TKIs): TKIs target the epidermal growth factor receptor (EGFR) and receptors for fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), and vascular endothelial growth factor (VEGF). Examples of TKIs include, but are not limited to, afatinib, ARQ-087 (derazantinib), asp5878, AZD3759, AZD4547, bosutinib, brigatinib, cabozantinib, cediranib, crenolanib, dacomitinib, dasatinib, dovitinib, E-6201, erdafitinib, erlotinib, gefitinib, gilteritinib (ASP-2215), FP-1039, HM61713, icot inib), imatinib, KX2-391 (Src), lapatinib, lestaurtinib, lenvatinib, midostaurin, nintedanib, ODM-203, osimertinib (AZD-9291), ponatinib, poziotinib, quizartinib, radotinib, rociletinib, sulfatinib (HMPL-012), sunitinib, tivoanib, and TH-4000 and MEDI-575 (anti-PDGFR antibody).

[0778] As used herein, the term "chemotherapeutic agent" or "chemotherapy" (or "chemotherapy" in the case of treatment with a chemotherapeutic agent) is intended to encompass any non-protein (i.e., non-peptide) compound useful for treating cancer. Examples of chemotherapeutic agents include, but are not limited to: alkylating agents such as thiotepa and cyclophosphamide Alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodepa, carboquone, meturedepa and uredepa; ethyleneimines and methylmelamines including hexamethylmelamine, trothamide, triethylphosphoramide, triethylthiophosphoramide and trimethylmelamine; polyacetyl groups, especially bullatacin and bullatacinone; acinone; camptothecin, including its synthetic analogues topotecan; bryostatin, callystatin; CC-1065, including its synthetic analogues adozelesin, carzelesin and bizelesin; cryptophycin, especially cryptophycin 1 and cryptophycin 8; dolastatin; d the synthetic analogs KW-2189 and CB1-TM1; eleutherobin; 5-azacytidine; pancratistatin; sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cyclophosphamide, glufosfamide, evofosfamide, bendamustine, estramustine, ifosfamide, mechlorethamine, mechlorethamine hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, and uracil mustard. mustard); nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimustine; antibiotics such as enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gamma II and calicheamicin ), dynemicins, including dynemicin A, bisphosphonates such as clodronate, esperamicin, new tumor suppressor protein chromophores and related chromophore enediyne antibiotic chromophores, aclacinomycins, actinomycins, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carrninomycin, carcinoglossin carzinophilin, chromomycins, actinomycin D, daunomycin, detorubicin, 6-diazo-5-oxo-L-norleucine, cranberries (including morpholino-cranberries, cyanomorpholino-cranberries, 2-pyrrolino-cranberries, and deoxycranberries), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycin ns), peplomycin, porfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, and zorubicin; antimetabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as demopterin ), methotrexate, pteropterin and trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, deoxyfluridine, enocitabine and floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane and testolactone;antiadreners, such as aminoglutethimide, mitotane, and trilostane; folic acid supplements, such as folinic acid; radiotherapeutic agents, such as radium-223; trichothecenes, especially T-2 toxin, verracurin A, roridin A, and anguidine; taxoids, such as paclitaxel; Abraxane, docetaxel cabazitaxel, BIND-014, tesetaxel; platinum analogs such as cisplatin and carboplatin, NC-6004 neplatin; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; hestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformthine; elliptinium acetate acetate; epothilone; etoglucid; nitrates; hydroxyurea; lentinan; leucovorin; lonidamine; maytansines, such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet; pirarubicin; losoxantrone; fluoropyrimidines; folate; podophylloic acid; 2-ethylhydrazide; procarbazine ine); polysaccharide-K (PSK); razoxane; rhizoxin; sizofiran; helical germanium; tricine; trabectedin, triaziquone; 2,2′,2″-tricUorotriemylamine; carbamates; vindesine; dacarbazine; mannitol mustard; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; thiopeta; chlorambucil; gemcitabine 6-thioguanine; mercaptopurine; methotrexate; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine Novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeoloda; ibandronate; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DFMO); retinoids such as retinoic acid; capecitabine; NUC-1031; FOLFIRI (fluorouracil, leucovorin and irinotecan); and pharmaceutically acceptable salts, acids or derivatives of any one of the above.

[0779] The definition of "chemotherapeutic agent" also includes anti-hormonal agents such as antiestrogens and selective estrogen receptor modulators (SERMs) used to modulate or inhibit hormonal effects on tumors, aromatase inhibitors, antiandrogens, and pharmaceutically acceptable salts, acids or derivatives of any of the above.

[0780] Antihormonal agents

[0781] Examples of antiestrogens and SERMs include, for example, tamoxifen (including NOLVADEX TM ), raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene

[0782] Aromatase inhibitors regulate estrogen production in the adrenal glands. Examples include 4(5)-imidazole, fenpropimorph, megestrol acetate exemestane, formestane, fadrozole, vorozole Letrozole and anastrozole

[0783] Examples of antiandrogens include apalutamide, abiraterone, enzalutamide, flutamide, galeterone, nilutamide, bicalutamide, leuprolide, goserelin, ODM-201, APC-100, ODM-204.

[0784] Examples of progesterone receptor antagonists include onapristone.

[0785] Anti-angiogenic agents

[0786] Anti-angiogenic agents include, but are not limited to, retinoids and their derivatives, 2-methoxyestradiol, regorafenib, necuparanib, suramin, squalamine, tissue inhibitor of metalloproteinase-1, tissue inhibitor of metalloproteinase-2, plasminogen activator inhibitor-1, plasminogen activator inhibitor-2, cartilage-derived inhibitor, paclitaxel (paclitaxel bound to albumin), platelet factor 4, protamine sulfate (herring protamine), sulfated chitin derivatives (prepared from snow crab shells), sulfated polysaccharide peptidoglycan complex (sp-pg), staurosporine, matrix metabolism regulators (including proline analogs such as l-azetidine-2-carboxylic acid (LACA), cis-hydroxyproline, d,1-3,4-dehydroproline, thioproline), α,α′-bipyridyl, β-aminopropionitrile fumarate, 4-propyl-5- (4-pyridyl)-2(3H)-oxazolone, methotrexate, mitoxantrone, heparin, interferon, 2-macroglobulin-serum, chicken inhibitor of metalloproteinase-3 (ChIMP-3), chymostatin, beta-cyclodextrin tetradecanoate, eponemycin, fumacillin, gold sodium thiomalate, d-penicillamine, beta-1-anticollagenase-serum, alpha-2-antiplasmin, bisantrine, lobenzarit disodium, n-2-carboxyphenyl-4-chloroaminobenzoic acid disodium or "CCA", thalidomide, angiostatic steroids, carboxyamidoimidazoles, metalloproteinase inhibitors (such as BB-94), inhibitors of S100A9 (such as tasquinimod). Other anti-angiogenic agents include antibodies, preferably monoclonal antibodies against such angiogenic growth factors as β-FGF, α-FGF, FGF-5, VEGF isoforms, VEGF-C, HGF / SF, and Ang-1 / Ang-2.

[0787] Antifibrotic agents

[0788] Anti-fibrotic agents include, but are not limited to, compounds such as β-aminopropionitrile (BAPN), and compounds disclosed in US 4965288 relating to inhibitors of lysine acyl oxidase and their use in treating diseases and conditions associated with abnormal deposition of collagen, and compounds disclosed in US 4997854 relating to compounds that inhibit LOX to treat various pathological fibrotic conditions, which applications are incorporated herein by reference. Other exemplary inhibitors are described in US 4943593 related to compounds such as 2-isobutyl-3-fluoro-allylamine, 2-isobutyl-3-chloro-allylamine or 2-isobutyl-3-bromo-allylamine; US 5021456, US 5059714, US 5120764, US 5182297, US 5252608 related to 2-(1-naphthyloxymethyl)-3-fluoroallylamine; and US 2004-0248871, which are incorporated herein by reference.

[0789] Exemplary anti-fibrotic agents also include primary amines that react with the carbonyl group of the active site of the lysine acyl oxidase, and more particularly primary amines that generate a resonance-stabilized product after binding to the carbonyl group, such as the following primary amines: emylenemamine, hydrazine, phenylhydrazine and its derivatives; amine ureas and urea derivatives; aminonitriles, such as BAPN or 2-nitroethylamine; unsaturated or saturated halamines, such as 2-bromo-ethylamine, 2-chloroethylamine, 2-trifluoroethylamine, 3-bromopropylamine and p-halobenzylamine; and selenohomocysteine ​​lactones.

[0790] Other antifibrotic agents are copper chelators that are either cell permeable or non-permeable. Exemplary compounds include indirect inhibitors that block the oxidative deamination of aldehyde derivatives derived from lysine and hydroxylysine residues by lysine oxidase. Examples include thiolamines (particularly D-penicillamine) and their analogs, such as 2-amino-5-mercapto-5-methylhexanoic acid, D-2-amino-3-methyl-3-((2-acetamidoethyl)disulfide)butyric acid, p-2-amino-3-methyl-3-((2-aminoethyldisulfide)butyric acid, sodium sulfide-4-((p-1-dimethyl-2-amino-2-carboxyethyl)disulfide)butane, 2-acetamidoethyl-2-acetamidoethanethiol sulfonate, and sodium-4-mercaptobutanesulfinate trihydrate.

[0791] Immunotherapeutic agents

[0792] Immunotherapeutic agents include, but are not limited to, therapeutic antibodies suitable for treating an individual.Some examples of therapeutic antibodies include abagovomab, ABP-980, adecatumumab, afutuzumab, alemtuzumab, altumomab, amatuximab, anatumomab, arcitumomab, bavituximab, bectumomab, bevacizumab, bivatuzumab, bulimumab blinatumomab, brentuximab, cantuzumab, catumaxomab, CC49, cetuximab, citatuzumab, cixutumumab, clivatuzumab, conatumumab, dacetuzumab, dalotuzumab, daratumumab, detumomab, dinutuximab, drozitumab, duligotumab, dusigitumab, ecoromeximab, elotuzumab, emibetuzumab, ensituximab, ertumaxomab, etaracizumab, farletuzumab, ficlatuzumab, and figitumumab b), flanvotumab, futuximab, ganitumab, gemtuzumab, girentuximab, glembatumumab, ibritumomab, igovomab, imgatuzumab, indatuximab, inotuzumab, intetumumab, ipilimumab (. MDX-010, BMS-734016 and MDX-101), iratumumab, labetuzumab, lexatumumab, lintuzumab, lorvotuzumab, lucatumumab, mapatumumab, matuzumab, milatuzumab, minretumomab, mitumomab, mogamulizumab, moxetumomab, naptumomab, narnatumab, necitumumab, nimotuzumab, novozyme ofetumomab), OBI-833, obinutuzumab, ocaratuzumab, ofatumumab, olaratumab, onartuzumab, oportuzumab, oregovomab, panitumumab, parsatuzumab, pasudotox, patritumab, pemtumomab, pertuzumab, pintumomab, pritumumab, racotumomab, radretumab, ramucirumab rilotumumab, rituximab, robatumumab, samalizumab, satumomab, sibrotuzumab, siltuximab, solitomab, simtuzumab, tacatuzumab, tapitumomab, tenamomab Rituximab is used to treat indolent B-cell cancers, including marginal zone lymphoma, WM, CLL, and small lymphocytic lymphoma. The combination of rituximab and chemotherapeutic agents is particularly effective.

[0793] Exemplary therapeutic antibodies may be further labeled with or combined with radioactive isotope particles such as indium-111, yttrium-90 (90Y-crivotuzumab), or iodine-131.

[0794] Cancer gene therapy and cell therapy

[0795] Cancer gene therapy and cell therapy include inserting a normal gene into a cancer cell to replace a mutated or altered gene; gene modification to silence mutant genes; genetic methods to directly kill cancer cells; infusions of immune cells designed to replace a large portion of an individual's own immune system to enhance the immune response to cancer cells or to activate an individual's own immune system (T cells or natural killer cells) to kill cancer cells or to seek out and kill cancer cells; and genetic methods to modify cellular activity to further alter the endogenous immune response to cancer.

[0796] Gene editing factors

[0797] Examples of genome editing systems include the CRISPR / Cas9 system, the zinc finger nuclease system, the TALEN system, the homing endonuclease system, and the meganuclease system.

[0798] CAR-T cell therapy and TCR-T cell therapy

[0799] CAR-T cell therapy includes a population of immune effector cells engineered to express a chimeric antigen receptor (CAR), wherein the CAR comprises a tumor antigen binding domain. The immune effector cells are T cells or NK cells. TCR-T cell therapy includes TCR-T cells engineered to target tumor-derived peptides present on the surface of tumor cells. The cells may be autologous or allogeneic.

[0800] In some embodiments, the CAR comprises an antigen binding domain, a transmembrane domain, and an intracellular signaling domain.

[0801] In some embodiments, the intracellular domain comprises a primary signaling domain, a costimulatory domain, or both a primary signaling domain and a costimulatory domain.

[0802] In some embodiments, the primary signaling domain comprises a functional signaling domain of one or more proteins selected from the group consisting of: CD3ζ, CD3γ, CD3δ, CD3ε, common FcRγ (FCERIG), FcRβ (FcεRlb), CD79a, CD79b, FcγRIIa, DAP10, and DAP12.

[0803] In some embodiments, the co-stimulatory domain comprises one or more functional domains of a protein selected from the group consisting of CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD1 la, LFA-1, ITGAM, CD1 lb, ITGAX, CD1 lc, ITGB 1. CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRTAM, Ly9(CD229), CD160(BY55), PSGL1, C D100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46 and NKG2D.

[0804] In some embodiments, the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of: α, β or ζ chain of a T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, IL2Rβ, IL2Rγ, IL7R u, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1 ld, ITGAE, CD103, ITGAL, CD1 la, LFA-1, ITGAM, CD1 lb, ITGAX, CD1 lc, ITGB 1. CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRTAM, Ly9(CD229), CD160(BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​PAG / Cbp, NKp44, NKp30, NKp46, NKG2D and NKG2C.

[0805] In some embodiments, the antigen binding domain binds a tumor antigen.

[0806] In some embodiments, the tumor antigen is selected from the group consisting of: CD19; CD123; CD22; CD30; CD171; CS-1 (also known as CD2 subunit 1, CRACC, SLAMF7, CD319 and 19A24); C-type lectin molecule-1 (CLL-1 or CLECLI); CD33; epidermal growth factor receptor variant III (EGFRvlll); ganglioside G2 (GD2); ganglioside GD3 (aNeuSAc(2-8)aNeuSAc(2-3)bDGaip(1-4)bDGIcp(1-1)Cer); B cell maturation TNF receptor family member (BCMA); Tn antigen ((Tn Ag) or (GaINAcu-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (RORI); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A 2); mesothelin; interleukin 11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); protease serine 21 (testosterone or PRSS21); vascular endothelial growth factor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-β); stage-specific embryonic antigen-4 (SSEA-4); CD20; delta-like 3 (DLL3); folate receptor alpha; receptor tyrosine-protein kinase, ERBB2 (Her2 / neu) ; cell surface associated mucin 1 (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); prostatic enzyme; prostatic acid phosphatase (PAP); elongation factor 2 (ELF2M); epinephrine B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX); proteasome (pro, megalin factor) subunit 9 (LMP2); glycoprotein 100 (gp100); by breakpoint cluster Oncogene fusion protein (bcr-abl) composed of BCR and Abelson murine leukemia virus oncogene homolog 1 (Abl); tyrosinase; epirelin type A receptor 2 (EphA2); fucosyl GM1; sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeuSAc(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); glutamine transaminase 5 (TGS5); high molecular weight melanoma associated antigen (HMWMAA);o-Acetyl-GD2 ganglioside (OAcGD2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248); related tumor endothelial marker 7 (TEM7R); six transmembrane epithelial antigen of the prostate 1 (STEAP1); tight junction protein 6 (CLDN6); thyroid stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5 member D (GPRCSD); X chromosome open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide portion of globoH glycosylceramide (GloboH); mammary differentiation antigen (NY-BR-1); urine protein 2 (UPK2); hepatitis A virus cellular receptor 1 (HAVCR1); adrenergic receptor β3 (ADRB3); pan-nexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); locus K9 lymphocyte antigen 6 complex (LY6K); olfactory receptor 51E2 (ORS IE2); TCR gamma alternative reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-la); melanoma-associated antigen 1 (MAGE-A1); ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X antigen family member 1A (XAGE1); angiopoietin binding cell surface receptor 2 (Tie2); melanoma antigen testis-1 (MADCT-1); melanoma antigen testis-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostate protein; survivin; telomerase; prostate cancer tumor antigen- 1 (PCTA-1 or galectin 8), melanoma antigen recognized by T cells 1 (MelanA or MARTI); rat sarcoma (Ras) mutant; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoints; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyl-transferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myelocytomatosis virus oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 1B1 (CYP IBI);CCCTC binding factor (zinc finger protein)-like (BORIS or Brother of the Regulator of Imprinted Sites), squamous cell carcinoma antigen recognized by T cells 3 (SART3); paired box protein Pax-5 (PAX5); pre-acrosome binding protein sp32 (OY-TES I); lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchoring protein 4 (AKAP-4); X-breakpoint synovial sarcoma 2 (SSX2); receptor for advanced glycation end products (RAGE-I); renal ubiquitin 1 (RU1); renal ubiquitin 2 (RU2); legumin; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; mutant heat shock protein 70-2 (mut hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIRI); Fc fragment of IgA receptor (FCAR or CD89); leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like molecule-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); phosphoinositide protein glycan-3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLL1). ;

[0807] In some embodiments, the tumor antigen is selected from CD150, 5T4, ActRIIA, B7, BMCA, CA-125, CCNA1, CD123, CD126, CD138, CD14, CD148, CD15, CD19, CD20, CD200, CD21, CD22, CD23, CD24, CD25, CD26, CD261, CD262, CD30, CD33, CD362, CD37, CD38, CD4, CD40, CD40L, CD44, CD46, CD5, CD52, CD53, CD54, CD56, CD66a-d, CD74, CD8, CD80, CD92, CE7, CS-1 、CSPG4、ED-B fibronectin、EGFR、EGFRvIII、EGP-2、EGP-4、EPHa2、ErbB2、ErbB3、ErbB4、FBP、GD2、GD3、HER1-HER2 combination、HER2-HER3 combination、HERV-K、HIV-1 envelope glycoprotein gp120、HIV-1 envelope glycoprotein gp41、HLA-DR、HM1.24、HMW-MAA、Her2、Her2 / neu、IGF-1R、IL-11Rα、IL-13R-α2、IL-2、IL-22R-α、IL-6、IL-6R、Ia、Ii、L1-CAM、L1-cell adhesion molecule、Lewis Y, Ll-CAM, MAGE A3, MAGE-A1, MART-1, MUC1, NKG2C ligand, NKG2D ligand, NYESO-1, OEPHa2, PIGF, PSCA, PSMA, ROR1, T101, TAC, TAG72, TIM-3, TRAIL-R1, TRAIL-Rl (DR4), TRAIL-R2 (DR5), VEGF, VEGFR2, WT-I, G protein-coupled receptor, alpha-fetoprotein (AFP), angiogenic factors, exogenous cognate binding molecules (ExoCBM), oncogene products, antifolate receptor, c-Met, carcinoembryonic antigen (CEA), cyclin (D 1), ephrin B2, epithelial tumor antigen, estrogen receptor, embryonic acetylcholine receptor, folate binding protein, gp100, hepatitis B surface antigen, kappa chain, kappa light chain, kdr, lambda chain, livin, melanoma-associated antigen, mesothelin, mouse double minute 2 homolog (MDM2), mucin 16 (MUC16), mutant p53, mutant ras, necrosis antigen, carcinoembryonic antigen, ROR2, progesterone receptor, prostate specific antigen, tEGFR, tenascin, P2-microglobulin, Fc receptor-like 5 (FcRL5).

[0808] Non-limiting examples of cell therapy include Algenpantucel-L, Sipuleucel-T, (BPX-501) rivogenlecleucel US9089520, WO2016100236, AU-105, ACTR-087, activated allogeneic natural killer cells CNDO-109-AANK, MG-4101, AU-101, BPX-601, FATE-NK100, LFU-835 hematopoietic stem cells, Aimi Liang Se-T (Imilecleucel-T), baltaleucel-T, PNK-007, UCARTCS1, ET-1504, ET-1501, ET-1502, ET-190, CD19-ARTEMIS, ProHema, bone marrow stem cell therapy treated with FT-1050, CD4CARNK-92 cells, CryoStim, AlloStim, lentiviral-transduced huCART-meso cells, CART-22 cells, EGFRt / 19-28z / 4-1BBL CAR T cells, autologous 4H11-28z / fIL-12 / EFGRt T cells, CCR5-SBC-728-HSPCs, CAR4-1BBZ, CH-296, dnTGFbRII-NY-ESOc259T, Ad-RTS-IL-12, IMA-101, IMA-201, CARMA-0508, TT-18, CMD-501, CMD-503, CMD-504, CMD-502, CMD-601, CMD-602, CSG-005.

[0809] In some embodiments, tumor targeting antigens include: alpha-fetoprotein, such as ET-1402 and AFP-TCR; anthrax toxin receptor 1, such as anti-TEM8 CAR T cell therapy; B cell maturation antigen (BCMA), such as bb-2121, UCART-BCMA, ET-140, KITE-585, MCM-998, LCAR-B38M, CART-BCMA, SEA-BCMA, BB212, UCART-BCMA, ET-140, P-BCMA-101, AUTO-2 (APRIL-CAR); anti-CLL-1 antibodies, such as KITE-79 6; B7 homolog 6, such as CAR-NKp30 and CAR-B7H6; B lymphocyte antigen CD19, such as TBI-1501, CTL-119huCART-19T cells, JCAR-015US7446190, JCAR-014, JCAR-017 (WO2016196388, WO2016033570, WO2015157386), axicabtagene ciloleucel)(KTE-C19), US7741465, US6319494, UCART-19, EBV-CTL, T tisagenlecleucel-T (CTL019), WO2012079000, WO2017049166, CD19CAR-CD28-CD3ζ-EGFRt-expressing T cells, CD19 / 4-1BBL shield CAR T cell T therapy, C-CAR-011, CIK-CAR.CD19, CD19CAR-28-ζT cells, PCAR-019, MatchCART, DSCAR-01, IM19 CAR-T; B lymphocyte antigen CD20, such as ATTCK-20; B lymphocyte cell adhesion, such as UCART-22, JCAR-018WO2016090190; NY-ESO-1, such as GSK-3377794, TBI-1301; carbonic anhydrase, such as DC-Ad-GMCAIX; caspases 9 suicide gene, such as CaspaCIDe DLI, BPX-501; CCR5, such as SB-728; CDw123, such as MB-102, UCART-123; CD20m, such as CBM-C20.1; CD4, such as ICG-122; CD30, such as CART30 (CBM-C30.1; CD33, such as CIK-CAR.CD33; CD38, such as T-007, UCART-38; CD40 ligand, such as BPX-201; CEACAM protein 4 modulator, such as MG7-CART; Claudin 6, such as CSG-002; EBV targeted, such as CMD-003; EGFR, such as autologous 4H11-28z / fIL-12 / EFGRt T cells; endonucleases, such as PGN-514, PGN-201; Epstein-Barr virus-specific T lymphocytes, such as TT-10; Erbb2, such as CST-102, CIDeCAR; ganglioside (GD2), such as 4SCAR-GD2; glutamate carboxypeptidase II, such as CIK-CAR.PSMA, CART-PSMA-TGFβRDN, P-PSMA-101; phosphoinositide protein glycan-3 (GPC3), such as TT-16, GLYCAR; hemoglobin, such as PGN-236; hepatocyte growth factor receptor, such as anti-cMet RNA CAR T; human papillomavirus E7 protein, such as KITE-439; immunoglobulin gamma Fc receptor III, such as ACTR087; IL-12, such as DC-RTS-IL-12; IL-12 agonist / mucin 16, such as JCAR-020; IL-13α2, such as MB-101; IL-2, such as CST-101; K-Ras GTPase, such as anti-KRAS G12V mTCR cell therapy; neural cell adhesion molecule L1 L1CAM (CD171), such as JCAR-023; latent membrane protein 1 / latent membrane protein 2, such as Ad5f35-LMPd1-2-transduced autologous dendritic cells; melanoma associated antigen 10, such as MAGE-A10C796T MAGE-A10 TCR; melanoma associated antigen 3 / melanoma associated antigen 6 (MAGE A3 / A6), such as KITE-718; mesothelin, such as CSG-MESO, TC-210; NKG2D, such as NKR-2; Ntrkr1 tyrosine kinase receptor, such as JCAR-024; T cell receptor, such as BPX-701, IMCgp100; T lymphocyte, such as TT-12; tumor infiltrating lymphocyte, such as LN-144, LN-145; and Wilm's tumor protein, such as JTCR-016, WT1-CTL. .

[0810] Combination therapy for lymphoma or leukemia

[0811] In some embodiments, other therapeutic agents are suitable for treating lymphoma or leukemia. Such agents include aldesleukin, alvocidib, amifostine trihydrate, aminocamptothecin, antineoplaston A10, antineoplaston AS2-1, antithymocyte globulin, arsenic trioxide, Bcl-2 family protein inhibitor ABT-263, beta-alexin, BMS-345541, bortezomib, Bortezomib ( PS-341), bryostatin 1, bulsulfan, campath-1H, carboplatin, carfilzomib carmustine, caspofungin acetate, CC-5103, chlorambucil, CHOP (cyclophosphamide, cranberries, vincristine, and prednisone), cisplatin, cladribine, clofarabine, curcumin, CVP (cyclophosphamide, vincristine, and prednisone), cyclophosphamide, cyclosporine, cytarabine, denileukin diftitox, dexamethasone, docetaxel, dolastatin 10, cranberries, cranberries hydrochloride, DT-PACE (dexamethasone, thalidomide, cisplatin, cranberries, cyclophosphamide, and etoposide), enzastaurin, epoetin alfa alfa), etoposide, everolimus (RAD001), FCM (fludarabine, cyclophosphamide and mitoxantrone), FCR (fludarabine, cyclophosphamide and rituximab), fenretinide, filgrastim, flavopiridol, fludarabine, FR (fludarabine and rituximab), geldanamycin (17-AAG), hyperCVAD (hyperfractionated cyclophosphamide, vincristine, cranberry, dexamethasone, methotrexate and cytarabine), ICE (ifosfamide, carboplatin and etoposide), ifosfamide, irinotecan hydrochloride, interferon α-2b, ixabepilone, lenalidomide ( CC-5013), lymphotrophic hormone activated killer cells, MCP (mitoxantrone, chlorambucil and prednisolone), melphalan, mesna, methotrexate, mitoxantrone hydrochloride, motexafin gadolinium, mycophenolate mofetil, nelarabine, obatoclax (GX15-070), oblimersen, octreotide acetate acetate), omega-3 fatty acids, Omr-IgG-am (WNIG, Omrix), oxaliplatin, paclitaxel, palbociclib (PD0332991), pegfilgrastim, pegylated lipid cranberry hydrochloride, perifosin, prednisolone, prednisone, recombinant flt3 ligand, recombinant human thrombopoietin, recombinant interferon alpha, recombinant interleukin-11, recombinant interleukin-12, rituximab R-CHOP (rituximab and CHOP), R-CVP (rituximab and CVP), R-FCM (rituximab and FCM), R-ICE (rituximab and ICE), and R-MCP (rituximab and MCP), R-roscovitine (seliciclib, CYC202), sargramostim, sildenafil citrate citrate), simvastatin, sirolimus, styryl sulfone, tacrolimus, tanespimycin, temsirolimus (CCl-779), thalidomide, therapeutic allogeneic lymphocytes, thiotepa, tipifarnib, vincristine, vincristine sulfate, vinorelbine hydrogen tartrate, SAHA (suberoylanilide hydroxamic acid or suberoylanilide and hydroxamic acid), vemurafenib Venetoclax (ABT-199).

[0812] One improved approach is radioimmunotherapy, in which monoclonal antibodies are combined with radioisotope particles such as indium-111, yttrium-90, and iodine-131. Examples of combination therapy include, but are not limited to, iodine-131, tositumomab Yttrium-90 ibritumomab tiuxetan and with CHOP.

[0813] The above therapies may be supplemented or combined with stem cell transplantation or treatment. Therapeutic procedures include peripheral blood stem cell transplantation, autologous hematopoietic stem cell transplantation, autologous bone marrow transplantation, antibody therapy, biological therapy, enzyme inhibitor therapy, whole body irradiation, stem cell infusion, bone marrow ablation under stem cell support, ex vivo processed peripheral blood stem cell transplantation, umbilical cord blood transplantation, immunoenzyme technology, low LET cobalt-60 gamma ray therapy, bleomycin, conventional surgery, radiation therapy and non-myeloablative allogeneic hematopoietic stem cell transplantation.

[0814] Combination therapy for non-Hodgkin's lymphoma

[0815] In some embodiments, other therapeutic agents are useful for treating non-Hodgkin's lymphoma (NHL), particularly non-Hodgkin's lymphoma of B-cell origin, including monoclonal antibodies, standard chemotherapy methods (e.g., CHOP, CVP, FCM, MCP and the like), radioimmunotherapy, and combinations thereof, particularly combinations of antibody therapy and chemotherapy.

[0816] Examples of unconjugated monoclonal antibodies for the treatment of NHL / B cell cancer include rituximab, alemtuzumab, human or humanized anti-CD20 antibodies, lumiliximab, anti-TNF-related apoptosis-inducing ligand (anti-TRAIL), bevacizumab, galiximab, epratuzumab, SGN-40, and anti-CD74.

[0817] Examples of experimental antibody agents for treatment of NHL / B cell cancer include: ofavumab, ha20, PRO131921, alemtuzumab, galiximab, SGN-40, CHIR-12.12, epratuzumab, lumizumab, apolizumab, milatuzumab, and bevacizumab.

[0818] Examples of standard regimens for chemotherapy for NHL / B cell cancers include: CHOP, FCM, CVP, MCP, R-CHOP, R-FCM, R-CVP, and R-MCP.

[0819] Examples of radioimmunotherapy for NHL / B-cell cancers include yttrium-90 ibritumomab Iodine-131 tositumomab

[0820] Combination therapy for mantle cell lymphoma

[0821] In some embodiments, other therapeutic agents are suitable for treating mantle cell lymphoma (MCL), including combination chemotherapy such as CHOP, hyperCVAD and FCM. These regimens can also be supplemented with the monoclonal antibody rituximab to form the combination therapy R-CHOP, hyperCVAD-R and R-FCM. Any of the above therapies can be combined with stem cell transplantation or ICE to treat MCL.

[0822] Other examples of therapeutic agents suitable for treating MCL include:

[0823] Immunotherapies, such as monoclonal antibodies (e.g., rituximab) and cancer vaccines, such as GTOP-99, which are based on the genetic makeup of an individual's tumor;

[0824] Radioimmunotherapy, in which monoclonal antibodies are combined with radioisotope particles, such as iodine-131 tositumomab Yttrium-90 Ibritumomab Tiuxetan and Used sequentially with CHOP for treatment;

[0825] Autologous stem cell transplantation combined with high-dose chemotherapy, administration of a proteasome inhibitor such as bortezomib ( or PS-341), or administration of anti-angiogenic agents such as thalidomide, especially in combination with rituximab;

[0826] Drugs that cause the breakdown of Bcl-2 proteins and increase the sensitivity of cancer cells to chemotherapy, such as oblimersen in combination with other chemotherapeutic agents;

[0827] mTOR inhibitors, which can cause inhibition of cell growth and even cell death. Non-limiting examples are sirolimus, temsirolimus ( CCI-779), CC-115, CC-223, SF-1126, PQR-309 (bimiralisib), voxtalisib, GSK-2126458 and temsirolimus and or other combinations of chemotherapeutic agents;

[0828] Other agents, such as flavopiridol, palbociclib (PD0332991), R-rosvetin (Selixib, CYC202), styrylsulfone, obaclava (GX15-070), TRAIL, anti-TRAIL death receptor DR4 and DR5 antibodies, temsirolimus ( CCl-779), everolimus (RAD001), BMS-345541, curcumin, SAHA, thalidomide, lenalidomide ( CC-5013) and geldanamycin (17-AAG).

[0829] Combination therapy for Waldenstrom's macroglobulinemia

[0830] In some embodiments, other therapeutic agents are suitable for treating Waldenstrom's macroglobulinemia (WM), including aldesleukin, alemtuzumab, flavopiridol, amifostine trihydrate, aminocamptothecin, anti-sinoplastin A10, anti-sinoplastin AS2-1, anti-thymocyte globulin, arsenic trioxide, autologous human tumor-derived HSPPC-96, Bcl-2 family protein inhibitor ABT-263, beta-alexin, bortezomib Bryostatin 1, busulfan, Campas-1H, carboplatin, carmustine, caspofungin acetate, CC-5103, cisplatin, clofarabine, cyclophosphamide, cyclosporine, cytarabine, denileukin, dexamethasone, docetaxel, dolastatin 10, cranberry hydrochloride, DT-PACE, enzastaurin, epoetin alfa, epratuzumab (hLL2-anti-CD22 humanized antibody), etoposide, everolimus, filgrastim, fludarabine, ifosfamide, indium-111 monoclonal antibody MN-14, iodine-131 tositumomab, irinotecan hydrochloride, ixabepilone, lymphotrophic hormone activated killer cells, melphalan, mesna, methotrexate, mitoxantrone hydrochloride, monoclonal antibody CD19 (such as tesazinol-T, CART-19, CTL-019), monoclonal antibody CD20, motexafin gadolinium, mycophenolate mofetil, nelarabine, oblimersen, octreotide acetate, omega-3 fatty acids, oxaliplatin, paclitaxel, pefilgrastim, pegylated lipid cranberry hydrochloride, pentostatin, perifosine, prednisone, recombinant flt3 ligand, recombinant human thrombopoietin, recombinant interferon alpha, recombinant interleukin-11, recombinant interleukin-12, rituximab, sargramostim, sildenafil citrate Simvastatin, sirolimus, tacrolimus, tanespiramycin, thalidomide, therapeutic allogeneic lymphocytes, thiotepa, tipifarnib, tositumomab, vetuzumab, vincristine sulfate, vinorelbine hydrogen tartrate, vorinostat, WT1126-134 peptide vaccine, WT-1 analog peptide vaccine, yttrium-90 ibritumomab tiuxetan, yttrium-90 humanized epratuzumab, and any combination thereof.

[0831] Examples of therapeutic procedures used to treat WM include peripheral blood stem cell transplantation, autologous hematopoietic stem cell transplantation, autologous bone marrow transplantation, antibody therapy, biological therapy, enzyme inhibitor therapy, total body irradiation, stem cell infusion, bone marrow ablation with stem cell support, ex vivo processed peripheral blood stem cell transplantation, umbilical cord blood transplantation, immunoenzymatic techniques, low-LET cobalt-60 gamma ray therapy, bleomycin, conventional surgery, radiation therapy, and non-myeloablative allogeneic hematopoietic stem cell transplantation.

[0832] Combination therapy for diffuse large B-cell lymphoma

[0833] In some embodiments, other therapeutic agents are useful for treating diffuse large B-cell lymphoma (DLBCL) and include cyclophosphamide, vinblastine, vincristine, prednisone, anti-CD20 monoclonal antibodies, etoposide, bleomycin, many of the agents listed for WM, and any combination thereof, such as ICE and R-ICE.

[0834] Combination therapy for chronic lymphocytic leukemia

[0835] In some embodiments, other therapeutic agents are useful for treating chronic lymphocytic leukemia (CLL) and include chlorambucil, cyclophosphamide, fludarabine, pentostatin, cladribine, cranberry, vincristine, prednisone, prednisolone, alemtuzumab, many of the agents listed for WM, and combination chemotherapy and chemoimmunotherapy, including the following commonly used combination regimens: CVP, R-CVP, ICE, R-ICE, FCR, and FR.

[0836] Combination therapy for myelofibrosis

[0837] In some embodiments, other therapeutic agents are suitable for treating myelofibrosis, including hedgehog inhibitors, histone deacetylase (HDAC) inhibitors, and tyrosine kinase inhibitors. Non-limiting examples of hedgehog inhibitors are saridgid and vismodegid.

[0838] Examples of HDAC inhibitors include, but are not limited to, pranosastat and pambinostat.

[0839] Non-limiting examples of tyrosine kinase inhibitors are lestaurtinib, bosutinib, imatinib, gilteritinib, radotinib, and cabozantinib.

[0840] Combination therapy for hyperproliferative diseases

[0841] In some embodiments, other therapeutic agents are suitable for treating a hyperproliferative disease and include gemcitabine, nab-paclitaxel, and gemcitabine / nab-paclitaxel with a JAK inhibitor and / or a PI3Kδ inhibitor.

[0842] Combination therapy for bladder cancer

[0843] In some embodiments, other therapeutic agents are suitable for treating bladder cancer and include atezolizumab, carboplatin, cisplatin, docetaxel, cranberry, fluorouracil (5-FU), gemcitabine, idosfamide, interferon alpha-2b, methotrexate, mitomycin, albumin-bound paclitaxel, paclitaxel, pemetrexed, thiotepa, vinblastine, and any combination thereof.

[0844] Breast cancer combination therapy

[0845] In some embodiments, the other therapeutic agents are suitable for treating breast cancer and include nab-paclitaxel, anastrozole, capecitabine, carboplatin, cisplatin, cyclophosphamide, docetaxel, nab-paclitaxel, epirubicin, everolimus, exemestane, fluorouracil, fulvestrant, gemcitabine, ixabepilone, lapatinib, letrozole, methotrexate, mitoxantrone, paclitaxel, pegylated lipotaxel, pertuzumab, tamoxifen, toremifene, trastuzumab, vinorelbine, and any combination thereof.

[0846] Combination therapy for triple-negative breast cancer

[0847] In some embodiments, other therapeutic agents suitable for treating triple-negative breast cancer include cyclophosphamide, docetaxel, paclitaxel, epirubicin, fluorouracil, paclitaxel, and combinations thereof.

[0848] Combination therapy for colorectal cancer

[0849] In some embodiments, the other therapeutic agents are suitable for treating colorectal cancer and include bevacizumab, capecitabine, cetuximab, fluorouracil, irinotecan, leucovorin, oxaliplatin, panitumumab, ziv-aflibercept, and any combination thereof.

[0850] Combination therapy for castration-resistant prostate cancer

[0851] In some embodiments, the other therapeutic agents are suitable for treating castration-resistant prostate cancer and include abiraterone, cabalitaxel, docetaxel, enzalutamide, prednisone, ceprixin-T, and any combination thereof.

[0852] Combination therapy for esophageal and esophagogastric junction cancer

[0853] In some embodiments, other therapeutic agents are suitable for treating esophageal and esophagogastric junction cancer and include capecitabine, carboplatin, cisplatin, docetaxel, epirubicin, fluoropyrimidine, fluorouracil, irinotecan, leucovorin, oxaliplatin, paclitaxel, ramucirumab, trastuzumab, and any combination thereof.

[0854] Combination therapy for gastric cancer

[0855] In some embodiments, other therapeutic agents are suitable for treating gastric cancer and include capecitabine, carboplatin, cisplatin, docetaxel, epirubicin, fluoropyrimidine, fluorouracil, irinotecan, leucovorin, mitomycin, oxaliplatin, paclitaxel, ramucirumab, trastuzumab, and any combination thereof.

[0856] Combination therapy for head and neck cancer

[0857] In some embodiments, the other therapeutic agents are suitable for treating head and neck cancer and include afatinib, bleomycin, capecitabine, carboplatin, cetuximab, cisplatin, docetaxel, fluorouracil, gemcitabine, hydroxyurea, methotrexate, nivolumab, paclitaxel, pembrolizumab, vinorelbine, and any combination thereof.

[0858] Combination therapy for hepatobiliary cancer

[0859] In some embodiments, other therapeutic agents are suitable for treating hepatobiliary cancer and include capecitabine, cisplatin, fluoropyrimidines, 5-fluorouracil, gemecitabine, oxaliplatin, sorafenib, and any combination thereof.

[0860] Combination therapy for hepatocellular carcinoma

[0861] In some embodiments, other therapeutic agents suitable for treating hepatocellular carcinoma include capecitabine, levofloxacin, gemcitabine, sorafenib, and any combination thereof.

[0862] Combination therapy for non-small cell lung cancer

[0863] In some embodiments, the other therapeutic agents are suitable for treating non-small cell lung cancer (NSCLC) and include afatinib, nab-paclitaxel, alectinib, bevacizumab, bevacizumab, cabozantinib, carboplatin, cisplatin, crizotinib, dabrafenib, docetaxel, erlotinib, etoposide, gemcitabine, nivolumab, paclitaxel, pemetrexed, ramucirumab, trametinib, trastuzumab, vandetanib, vemurafenib, vinblastine, vinorelbine, and any combination thereof.

[0864] Combination therapy for small cell lung cancer

[0865] In some embodiments, other therapeutic agents are suitable for treating small cell lung cancer (SCLC) and include bendamustime, carboplatin, cisplatin, cyclophosphamide, docetaxel, cranberry, etoposide, gemcitabine, ipilimumab, irinotecan, nivolumab, paclitaxel, temozolomide, topotecan, vincristine, vinorelbine, and any combination thereof.

[0866] Combination therapy for melanoma

[0867] In some embodiments, the other therapeutic agents are suitable for treating melanoma and include nab-paclitaxel, carboplatin, cisplatin, cobiemtinib, dabrafenib, dacrabazine, IL-2, imatinib, interferon alpha-2b, ipalimab, nitrosoureas, nivolumab, paclitaxel, pembrolizumab, pilimumab, temozolomide, trametinib, vemurafenib, vinblastine, and any combination thereof.

[0868] Combination therapy for ovarian cancer

[0869] In some embodiments, other therapeutic agents are suitable for treating ovarian cancer and include 5-fluorouracil, albumin-bound paclitaxel, altretamine, anastrozole, bevacizumab, capecitabine, carboplatin, cisplatin, cyclophosphamide, docetaxel, cranberries, etoposide, exemestane, gemcibabine, ifosfamide, irinotecan, letrozole, leuprolide acetate, lipid cranberries, megestrol acetate, melphalan, olaparib, oxaliplatin, paclitaxel, pazopanib, pemetrexed, tamoxifen, topotecan, vinorelbine, and any combination thereof.

[0870] Combination therapy for pancreatic cancer

[0871] In some embodiments, the other therapeutic agents are suitable for treating pancreatic cancer and include 5-fluorouracil, nab-paclitaxel, capecitabine, cisplatin, docetaxel, erlotinib, a fluoropyrimidine, gemcitabine, irinotecan, leucovorin, oxaliplatin, paclitaxel, and any combination thereof.

[0872] Combination therapy for renal cell carcinoma

[0873] In some embodiments, the other therapeutic agents are suitable for treating renal cell carcinoma and include axitinib, bevacizumab, cabozantinib, erlotinib, everolimus, levantinib, nivolumab, pazopanib, sorafenib, sunitinib, temsirolimus, and any combination thereof.

[0874] VIII. Set

[0875] The present invention provides a kit comprising a compound of the present invention or a pharmaceutically acceptable salt thereof. The kit may further comprise instructions for use, for example, for treating viral infections. Instructions for use are usually written instructions, but electronic storage media (such as magnetic disks or optical disks) containing instructions are also acceptable.

[0876] The present invention also provides a pharmaceutical kit comprising one or more containers comprising a compound of the present invention or a pharmaceutically acceptable salt thereof. Associated with these containers, as appropriate, may be precautions in the form prescribed by a governmental agency that manages the manufacture, use or sale of pharmaceutical products, which reflect the approval of the manufacturing, use or sales agency for human administration. Each component (if there is more than one component) may be packaged in a separate container, or some components may be combined in one container if cross-reactivity and shelf life permit. The kit may be in unit dosage form, bulk packaging (e.g., multi-dose packaging) or sub-unit dose. The kit may also include multiple unit doses of the compound and instructions for use, and is packaged in sufficient quantities for storage and use in pharmacies (e.g., hospital pharmacies and compounding pharmacies).

[0877] Also provided are articles of manufacture comprising a unit dose of a compound of the invention or a pharmaceutically acceptable salt thereof, in suitable packaging for use in the methods described herein. Suitable packaging is known in the art and includes, for example, vials, containers, ampoules, bottles, cans, flexible packaging, and the like. The articles of manufacture may further be sterilized and / or sealed.

[0878] IX. Examples

[0879] The embodiments also relate to methods and intermediates useful for preparing the subject compounds or pharmaceutically acceptable salts thereof.

[0880] Many general references are available that provide commonly known chemical synthesis schemes and conditions suitable for synthesizing the disclosed compounds (see, e.g., Smith, March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 7th Edition, Wiley-Interscience, 2013.)

[0881] Compounds as described herein can be purified by any means known in the art, including chromatography, such as high performance liquid chromatography (HPLC), preparative thin layer chromatography, flash column chromatography, and ion exchange chromatography. Any suitable stationary phase can be used, including normal and reverse phase and ionic resins. The disclosed compounds are most commonly purified via silica and / or alumina chromatography. See, for example, Introduction to Modern Liquid Chromatography, 2nd Edition, LRSnyder and JJKirkland, eds., John Wiley and Sons, 1979; and Thin Layer Chromatography, E.Stahl (ed.), Springer-Verlag, New York, 1969.

[0882] The compounds were characterized using standard instrumental methods. 1 H, 600.13 MHz) and the Bruker AVANCE-500 instrument with a cryogenic probe ( 31 P, 202.4MHz, 19 F, 470.4 MHz). Mass spectra were obtained in the electrospray ionization (ESI) mode on a Waters Q-Tof Micro. HPLC was obtained on a Waters LC-MS instrument (Waters 600 controller, Waters 3100 mass detector, Waters photodiode array detector) over a Luna C18 column (Phenomenex, 5 μm, 150×4.6 mm) and a Zic-Hilic column (SeQuant, 5 μm, 100×4.6 mm).

[0883] During any process for the preparation of a target compound, it may be necessary and / or desirable to protect sensitive or reactive groups on any molecule involved. This can be achieved with the aid of conventional protecting groups, as described in standard works such as TW Greene and PGM Wuts, "Protective Groups in Organic Synthesis", 4th edition, Wiley, New York 2006. The protecting groups may be removed at a suitable subsequent stage using methods known in the art.

[0884] Exemplary chemical entities suitable for the methods of the embodiments will now be described with reference to illustrative synthetic schemes regarding their general preparation herein and subsequent specific examples. It should be appreciated by those skilled in the art that, in order to obtain the various compounds herein, the starting materials may be appropriately selected so that the final desired substituents will be carried through the reaction process with or without protection as required to produce the desired product. Alternatively, it may be necessary or desirable to utilize a suitable group that can be carried through the reaction process and replaced by the desired substituent when appropriate in the position of the final desired substituent. In addition, it should be appreciated by those skilled in the art that the transformations shown in the following schemes can be performed in any order compatible with the functionality of the particular side groups. Each reaction depicted in the general scheme is preferably run at a temperature of about 0°C to the reflux temperature of the organic solvent used.

[0885] The examples provided herein describe the synthesis of the compounds disclosed herein and the intermediates used to prepare the compounds. It should be understood that the individual steps described herein can be combined. It should also be understood that independent batches of compounds can be combined and then continued in the next synthesis step.

[0886] In the following example descriptions, specific embodiments are described. These embodiments are described in sufficient detail to enable one skilled in the art to implement certain embodiments of the present invention. Other embodiments may be used, and logical and other changes may be made without departing from the scope of the present invention. Therefore, the following description is not intended to limit the scope of the present invention.

[0887] The methods of the present invention generally provide specific enantiomers or diastereomers as desired products, but the stereochemistry of the enantiomers or diastereomers is not determined in all cases. When the stereochemistry of a specific stereocenter among enantiomers or diastereomers is not determined, the compound is drawn without showing any stereochemistry at that specific stereocenter, although the compound may be substantially enantiomerically or diastereomerically pure.

[0888] Representative syntheses of compounds of the invention are described in the following schemes and in the specific examples that follow. The specific examples are named using PerkinElmer ChemDraw Professional Edition 17.0.0.206 (121), PerkinElmer Informatics, Inc.

[0889] Example 1. General Synthesis Method

[0890] The specific 3'3'-cyclic dinucleotides described in detail in the Examples were synthesized according to the general synthetic methods described below.

[0891] List of abbreviations:

[0892] ACN Acetonitrile

[0893] BOMOM Benzoyloxymethoxymethyl

[0894] BSA bovine serum albumin

[0895] Bz Benzoyl

[0896] CPG Controlled Porous Glass

[0897] CSO (-)-(8,8-Dichlorocamphorsulfonyl)-oxaziridine

[0898] DBU 1,8-diazabicyclo[5.4.0]undec-7-ene

[0899] DCA Dichloroacetic acid

[0900] DCM Dichloromethane

[0901] DEA Diethylamine

[0902] DMAM Dimethylaminomethylene

[0903] DMF Dimethylformamide

[0904] DMOCP 2-Chloro-5,5-dimethyl-1,3,2-dioxaphosphinane-2-oxide

[0905] DMSO Dimethyl sulfoxide

[0906] DMTr 4,4-Dimethoxytrityl

[0907] EtOH

[0908] ESI Electrospray Ionization

[0909] ETT Ethylthiotetrazolyl

[0910] FBS Fetal Bovine Serum

[0911] HEPES 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid

[0912] HPLC High Performance Liquid Chromatography

[0913] HRMS High Resolution Mass Spectrometry

[0914] iBu Isobutyl

[0915] iPr Isopropyl

[0916] LCAA Long Chain Amino Alkyl

[0917] MeIm 1-Methylimidazole

[0918] MeOH Methanol

[0919] MOP 4-methoxy-1-oxo-2-pyridylmethyl

[0920] MOP-OH 4-methoxy-1-oxo-2-pyridylmethanol

[0921] MPNO 4-Methoxypyridine-1-oxide

[0922] NMR Nuclear Magnetic Resonance

[0923] Pic 4-methoxy-2-pyridinylmethyl

[0924] Pic-OH 4-methoxy-2-pyridinylmethanol

[0925] Py Pyridine

[0926] TBDMS tert-butyldimethylsilyl

[0927] TBDMSCl tert-butyldimethylsilyl chloride

[0928] tBuOOH tert-butyl peroxide

[0929] TEA Triethylamine

[0930] TEAB Triethylammonium bicarbonate

[0931] THF Tetrahydrofuran

[0932] TIPSCl Triisopropylbenzenesulfonyl chloride

[0933] Ts p-Toluenesulfonyl

[0934] Tzol Tetrazolyl

[0935] Preparation of monomers derived from nucleoside-3′-phosphonic acid methyl esters

[0936] According to Páv,O; I.;Barvík, I.;Pohl, R.; M.; Rosenberg, I. Synthesis of oligoribonucleotides with phosphonate-modified linkages. Org. Biomol. Chem. 2011, 9, 6120-6126 and Páv, O.; Panova, N.; J.; Zborníková, E.; Rosenberg I. Activation of human RNase L by 2′- and 5′-O-methylphosphonate-modified oligoadenylates. Bioorg. Med. Chem. Lett. 2012, 22, 181-185 Preparation of phosphonate and aminophosphonate monomers.

[0937] The 2'-deoxy-2'-fluorophosphonate and phosphoramidite monomers shown as intermediates 1 to 7 in Scheme 1 below were also prepared using the above mentioned protocols from commercially available precursors (Carbosynth).

[0938] Process 1

[0939]

[0940] Compound characterization was consistent with literature values. Exemplary data for adenine (A) intermediate 4 and guanine (G) intermediate 7 are shown in the table below.

[0941]

[0942] Representative syntheses of intermediates are described below.

[0943] Preparation of intermediate 5 : ACN (7.1 mL, 3.2 mmol) containing 0.45 M tetrazole was added to a stirred solution of compound 3 (1.0 g, 1.6 mmol) and N,N,N′,N′-tetraisopropyl diamidophosphonic acid methyl ester (1.4 mL, 4.8 mmol) in DCM (20 mL) under argon. The reaction mixture was stirred at room temperature under argon for 2 h. The reaction mixture was diluted with DCM (300 mL) and extracted with a saturated solution of sodium bicarbonate (3×100 ml). The organic layer was dried over anhydrous sodium sulfate and evaporated. The residue was dissolved in toluene (5 mL) and added dropwise to hexane (300 mL). The precipitate was collected and lyophilized from benzene to give 1.0 g (78%): 31 PNMR(C6D6) δ153.38(d,J=8.5Hz), 152.88(d,J=6.5Hz).

[0944] Preparation of intermediate 6: Sodium hydride (0.72 g, 18.0 mmol) was added to a stirred solution of intermediate 2 (4 g, 6 mmol) in DMF (60 mL) at 4 °C under argon (Scheme 1). The reaction mixture was stirred for an additional 60 min at 4 °C. Diisopropyltoluenesulfonyloxymethyl phosphonate (3.1 g, 9.0 mmol) was added to the reaction mixture, which was stirred for an additional 16 h at room temperature under argon, at which time glacial AcOH (1.0 mL, 18.0 mmol) in DMF (10 mL) was added dropwise to the reaction mixture at 4 °C. The subsequent mixture was evaporated and the crude phosphonate was purified by silica gel chromatography (eluting with a gradient of 0% to 10% ethanol in chloroform) to give 3.5 g (69%) of: C 45 H 49 O9N5FNaP(M+Na) + HRMS (ESI) calculated value 876.31441, experimental value 876.31425.

[0945] Bromotrimethylsilane (2.2 mL; 16.4 mmol) was added to a solution of diisopropylphosphonate (3.5 g; 4.1 mmol) and 2,6-lutidine (3.8 mL; 32.8 mmol) prepared above in ACN (45 mL). The reaction mixture was stirred at room temperature for 16 hours and evaporated. The residue was dissolved in chloroform (0.5 L) and extracted with 0.2 M TEAB (3 x 100 ml). The organic layer was dried over anhydrous sodium sulfate, evaporated and co-evaporated with dioxane and pyridine. The crude nucleoside phosphonic acid was used without further purification.

[0946] DMOCP (3.8 g; 20.5 mmol) was added to a solution of the nucleoside phosphonic acid prepared above, MOP-OH (1.9 g; 12.3 mmol) and MPNO (2.6 g; 20.5 mmol) in pyridine (45 mL). The reaction mixture was stirred at room temperature for 16 hours, quenched by the addition of 2M TEAB (20 mL), and evaporated. The residue was dissolved in chloroform (0.5 L) and extracted with 0.2M TEAB (3 x 100 ml). The organic layer was dried over anhydrous sodium sulfate, evaporated and co-evaporated with dioxane to give the crude diMOP phosphonate, which was used without further purification.

[0947] The above diMOP phosphonate was treated with thiophenol (6 mL) and TEA (8.4 mL) in dioxane (45 mL) at room temperature for 6 hours. The reaction mixture was diluted with ethyl acetate and directly purified by silica gel chromatography (eluting with a gradient of 0% to 100% ethyl acetate / ethanol / acetone / water 4:1:1:1 in ethyl acetate) (TEA-buffered SiO2). The resulting intermediate 6 was lyophilized from dioxane to give 2.2 g (59%) of: C 46 H43 F6O 11 HRMS of P(MH) - : Calculated value 905.27115, experimental value 905.27039; 1 H NMR(DMSO-d6)δ11.25(br s,1H),8.74(s,1H),8.67(s,1H),8.12(d,J=7.2Hz,1H),8.04(m,2H),7.64(m,1H),7.55(m,2H),7.27(m,2H),7.19(m,2H),7.14(m, 4H),7.135(m,1H),7.12(d,J=3.6Hz,1H),6.94(dd,J=7.2,3.6Hz,1H),6.77(m,4H),6.43(dd,J=18.7,1.6Hz,1H),6.01(ddd,J=52. 0,4.0,1.6Hz,1H),4.91(ddd,J=22.2,8.1,4.0Hz,1H),4.87(dd,J=17.2,8.0Hz,1H),4.83(dd,J=17.2,8.2Hz,1H),4.19(ddd,J=8. 1,4.8,2.5Hz,1H),3.76(s,3H),3.68(s,3H),3.67(s,3H),3.62(m,2H),3.29(dd,J=10.9,2.5Hz,1H),3.22(dd,J=10.9,4.8Hz,1H); 31 P NMR (DMSO-d6) δ 12.53; 19 F NMR (DMSO-d6) δ -199.74.

[0948]

[0949] Preparation of intermediate 8 : Sodium hydride (0.72 g, 18.0 mmol) was added to a stirred solution of intermediate 2 (4 g, 6 mmol) in DMF (60 mL) at 4 °C under argon (Scheme 1). The reaction mixture was stirred for an additional 60 min at 4 °C. Diisopropyltoluenesulfonyloxymethyl phosphonate (3.1 g, 9.0 mmol) was added to the reaction mixture, which was stirred for an additional 16 h at room temperature under argon, at which time glacial AcOH (1.0 mL, 18.0 mmol) in DMF (10 mL) was added dropwise to the reaction mixture at 4 °C. The subsequent mixture was evaporated and the crude phosphonate was purified by silica gel chromatography (eluting with a gradient of 0% to 10% ethanol in chloroform) to give 3.5 g (69%) of: C 45 H 49 O9N5FNaP(M+Na) +HRMS (ESI) calculated value 876.31441, experimental value 876.31425.

[0950] Bromotrimethylsilane (2.2 mL; 16.4 mmol) was added to a solution of diisopropylphosphonate (3.5 g; 4.1 mmol) and 2,6-lutidine (3.8 mL; 32.8 mmol) prepared above in ACN (45 mL). The reaction mixture was stirred at room temperature for 16 hours and evaporated. The residue was dissolved in chloroform (0.5 L) and extracted with 0.2 M TEAB (3 x 100 ml). The organic layer was dried over anhydrous sodium sulfate, evaporated and co-evaporated with dioxane and pyridine. The crude nucleoside phosphonic acid was used without further purification.

[0951] DMOCP (3.8 g; 20.5 mmol) was added to a solution of nucleoside phosphonic acid, Pic-OH (1.7 g; 12.3 mmol) and MPNO (2.6 g; 20.5 mmol) in pyridine (45 mL). The reaction mixture was stirred at room temperature for 16 h, quenched by the addition of 2M TEAB (20 mL), and evaporated. The residue was dissolved in chloroform (0.5 L) and extracted with 0.2 M TEAB (3×100 ml). The organic layer was dried over anhydrous sodium sulfate, evaporated and co-evaporated with dioxane. The crude diPic phosphonate was then treated with thiophenol (6 mL) and TEA (8.4 mL) in dioxane (45 mL) at room temperature for 6 h. The reaction mixture was diluted with ethyl acetate and directly purified (TEA-buffered SiO2) by silica gel chromatography (eluting with a gradient of 0% to 100% ethyl acetate / ethanol / acetone / water 4:1:1:1 in ethyl acetate). Intermediate 8 was lyophilized from dioxane to give 2.4 g (66%): C 46 H 43 F6O 10 P(MH) - HRMS (ESI) calculated value 889.27623, found value 889.27583; 1H NMR(DMSO-d6)δ11.25(br s,1H),8.74(s,1H),8.67(s,1H),8.26(d,J=5.7Hz,1H),8.04(m,2H),7.64(m,1H),7.54(m,2H),7.27(m,2H),7.19(m,2H),7 .14(m,5H),7.04(d,J=2.6Hz,1H),6.81(dd,J=5.7,2.6Hz,1H),6.76(m,4H),6.43(dd,J=18.6,1.6Hz,1H),6.01(ddd,J=51.8 ,4.0,1.6Hz,1H),4.90(ddd,J=22.3,8.1,4.0Hz,1H),4.80(dd,J=14.3,7.5Hz,1H),4.78(dd,J=14.3,7.5Hz,1H),4.20(ddd ,J=8.1,5.0,2.5Hz,1H),3.77(s,3H),3.67(s,6H),3.64(m,2H),3.31(dd,J=11.0,2.5Hz,1H),3.22(dd,J=11.0,5.0Hz,1H); 31 P NMR (DMSO-d6) δ 12.48; 19 F NMR (DMSO-d6) δ -199.61.

[0952] Preparation of intermediate 9 Phosphonate 8 (1.3 g, 1.5 mmol) was loaded on a silica gel column in DCM (10 mL). The column was washed with DCA (10 mL, 3% in DCM) and aged at room temperature for 15 min. The column was then washed with a mixture of DCA (25 mL, 3% in DCM) / 10% EtOH in CHCl (25 mL), and then washed with 10% EtOH / CHCl (100 mL). The crude intermediate 9 was eluted from the column with 50% MeOH / H2O (100 mL), evaporated, purified by preparative HPLC (eluted with a gradient of 0 to 50% methanol in water), and lyophilized from water to give 0.54 g (63%): C 25 H 25 FN6O8P(MH) - HRMS (ESI) calculated value 587.14555, found value 587.14561; 1H NMR(DMSO-d6)δ11.23(br s,1H),8.82(s,1H),8.76(s,1H),8.26(d,J=5.6Hz,1H),8.05(m,2H),7.64(m,1H),7.55(m,2H),7.11(d,J=2.6Hz, 1H),6.81(dd,J=5.6,2.6Hz,1H),6.36(d,J=16.1Hz,1H),5.55(dd,J=53.1,3.7Hz,1H),4.82(ddd,J=26.5,9.2,3.7 Hz,1H),4.82(dd,J=14.5,7.7Hz,1H),4.80(dd,J=14.5,7.7Hz,1H),4.00(dt,J=9.2,2.1Hz,1H),3.82(s,3H),3.82 (dd,J=13.2,2.1Hz,1H),3.78(dd,J=13.2,2.1Hz,1H),3.64(dd,J=14.2,8.0Hz,1H),3.60(dd,J=14.2,3.5Hz,1H); 31 P NMR (DMSO-d6) δ 13.65; 19 F NMR (DMSO-d6) δ -198.08.

[0953] Preparation of modified solid support CE-CPG

[0954] according to O. et al., (2008). Collection of Czechoslovak Chemical Communications 73(1):32-43. Preparation of solid support (LCAA-CPG) modified with 12-cyano-13-[(4,4′-dimethoxytrityl)oxy]-3,6,9-trioxatridecane hydrosuccinate (CE-CPG).

[0955] CE-CPG

[0956]

[0957] Synthesis of dinucleotides derived from nucleoside-3′-phosphonic acid methyl esters

[0958] Dinucleotides were synthesized from CE-CPG (20 mg) in the 5'→2' direction by the "trityl off" method on a 1 μmol scale, see Scheme 1. Synthesis schemes for the phosphotriester and phosphamidate methods are shown in Table 1. The end-capping step is optional in many cases. In a typical experiment, six columns were used to prepare CDNs. The synthesis was performed on a MOS oligonucleotide synthesizer (IOCB Prague, Czech Republic). The average yield of the coupling step was in the range of 93 to 95% (conductivity detector, DMTr + ).

[0959] Table 1. Protocols for the synthesis of dinucleotides

[0960]

[0961]

[0962] Cyclization, deprotection and purification of dinucleotides

[0963] To the CE-CPG solid support with bound linear dimer was added 10% Et2NH in ACN (500 μl) and the heterogeneous mixture was shaken at room temperature for 2 h using an Eppendorf Thermomixer Comfort shaker. The solvent was evaporated and a solution of DMOCP (10 mg) in pyridine (400 μl) was added. The heterogeneous mixture was shaken at room temperature for 2 h. Then, 10 μl Et3N and 266 μl water were added to the reaction mixture and shaking was continued at 65 °C for 16 h. The reaction mixture was evaporated.

[0964] Scheme 1. Exemplary synthesis of CDNs derived from nucleoside-3'-phosphonic acid methyl esters.

[0965]

[0966] To the reaction mixture was added 50% aqueous MeOH (600 μl) and the solid support was separated from the solution by decantation and washed with 50% aqueous MeOH (3×200 μl). To the methanol solution was added 33% MeNH2 in EtOH (600 μl) and the mixture was shaken at room temperature for 8 hours. The solvent was then evaporated. The residue was dissolved in 0.1 mol.l -1TEAB (1.5 ml) and applied to a semi-preparative C18 column. The preparative HPLC conditions used for purification were as follows: Luna C18 (5 μm, 250×10 mm, Phenomenex); flow rate 3 mL / min; mobile phase A: 0.1 M TEAB / H2O, mobile phase B: 50% ACN / 0.1 M TEAB / H2O; HPLC method 1: isocratic elution A (15 min), followed by a linear gradient A-30% B (35 min); HPLC method 2: isocratic elution A (15 min), followed by a linear gradient A-20% B (35 min).

[0967] Example 2. 2-amino-9-((2R,3R,3aS,7aR,9R,10R,10aS,15aR)-2-(6-amino-9H-purin-9-yl)-3,5,10,13-tetrahydroxy-5,13-dioxo-decahydro-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-9-yl)-1,9-dihydro-6H-purin-6-one

[0968]

[0969] The product was prepared according to the solid phase method described above without the end-capping step.

[0970] C 21 H 25 N 10 O 13 ESI-MS of P2 (MH) - Calculated value: 687.1; Found value: 687.2; HPLC method 1, retention time (min) = 33.6.

[0971] Example 3. 2-amino-9-((2R,3R,3aS,7aR,9R,10R,10aS,15aR)-9-(6-amino-9H-purin-9-yl)-3,5,10,13-tetrahydroxy-5,13-dioxo-decahydro-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-2-yl)-1,9-dihydro-6H-purin-6-one

[0972]

[0973] The solid phase product was prepared according to the above method without the end-capping step.

[0974] C 21 H 25 N 10 O 13 ESI-MS of P2 (MH)- Calculated value: 687.1; Exp. value: 687.1; HPLC method 1, retention time (min) = 32.3.

[0975] Example 4. 2-amino-9-((2R,3R,3aR,7aR,9R,10R,10aS,15aR)-2-(6-amino-9H-purin-9-yl)-3-fluoro-5,10,13-trihydroxy-5,13-dioxo-decahydro-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-9-yl)-1,9-dihydro-6H-purin-6-one

[0976]

[0977] The solid phase product was prepared according to the above method without the end-capping step.

[0978] C 21 H 24 FN 10 O 12 ESI-MS of P2 (MH) - Calculated value: 689.1; Exp. value: 689.1; HPLC method 2, retention time (min) = 40.4. 1 H and 31 P NMR data:

[0979]

[0980] Example 5. 2-amino-9-((2R,3R,3aR,7aR,9R,10R,10aS,15aR)-9-(6-amino-9H-purin-9-yl)-3-fluoro-5,10,13-trihydroxy-5,13-dioxo-decahydro-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-2-yl)-1,9-dihydro-6H-purin-6-one

[0981]

[0982] The solid phase product was prepared according to the above method without the end-capping step.

[0983] C 21 H 24 FN 10 O 12 ESI-MS of P2 (MH) - Calculated value: 689.1; Exp. value: 689.1; HPLC method 2, retention time (min) = 37.8.1 H and 31 P NMR data (coupling constants in parentheses where appropriate):

[0984]

[0985] Example 6. 9,9′-((2R,3R,3aS,8aR,10R,11R,11aS,16aR)-3,6,11,14-tetrahydroxy-6,14-dioxo-1-dodecahydrodifluoro[3,2-e:3′,2′-1][1,4,8,11]tetraoxa[2,9]diphospha-cyclotetradecane-2,10-diyl)bis(2-amino-1,9-dihydro-6H-purin-6-one)

[0986]

[0987] The solid phase product was prepared according to the above method without the end-capping step.

[0988] C 22 H 27 N 10 O 14 ESI-MS of P2 (MH) - Calculated value: 717.1; Found value: 717.1; HPLC method 1, retention time (min) = 31.5.

[0989] Example 7. 2-amino-9-((2R,3R,3aS,7aR,9R,10R,10aR,15aR)-9-(6-amino-9H-purin-9-yl)-10-fluoro-3,5,13-trihydroxy-5,13-dioxadienyldecahydro-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-2-yl)-1,9-dihydro-6H-purin-6-one

[0990]

[0991] The solid phase product was prepared according to the above method without the end-capping step.

[0992] C 21 H 24 FN 10 O 12 ESI-MS of P2 (MH) - Calculated value: 689.1; Exp. value: 689.1; HPLC method 1, retention time (min) = 44.1. 1 H. 19 F and 31 P NMR data:

[0993]

[0994] Example 8. 2-amino-9-((2R,3R,3aR,7aR,9R,10R,10aR,15aR)-9-(6-amino-9H-purin-9-yl)-3,10-difluoro-5,13-dihydroxy-5,13-dioxo-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-2-yl)-1,9-dihydro-6H-purin-6-one

[0995]

[0996] Using a MOS oligonucleotide synthesizer, the desired solid phase product was prepared on a column at a 1 μmol scale according to the above method without the need for a capping step.

[0997] CE-CPG was treated with 3% DCA / DCM for 2 min and then washed with ACN and DCM. A mixture of phosphonate intermediate 6 in pyridine (0.1 M, 0.1 mL) and TIPSCl in pyridine (0.3 M, 0.1 mL) was added, the mixture was reacted for 10 min and then washed with ACN and DCM.

[0998] CPG was treated with 3% DCA / DCM for 2 min and then washed with ACN and DCM. A mixture of phosphoramidate intermediate 5 in acetonitrile (0.1 M, 0.1 mL) and ETT in acetonitrile (0.3 M, 0.1 mL) was added, the mixture was reacted for 10 min and then washed with ACN and DCM. CPG was then treated with a mixture of 5.5 M tBuOOH in decane and DCM (1 / 4, v / v) for 3 min and then washed with ACN and DCM. CPG was then treated with 3% DCA / DCM for 2 min and then washed with ACN and DCM.

[0999] The column containing the CPG-bound linear dimer was removed from the synthesizer and the CPG was transferred to a 2 mL threaded tube. A 10% solution of Et2NH in ACN (500 μl) was added to the CPG solid support with the bound linear dimer, and the heterogeneous mixture was shaken at room temperature for 2 h with an Eppendorf Thermomixer Comfort Oscillator. The solvent was removed. A solution of DMOCP (10 mg) in pyridine (400 μl) was added to the cannula. The heterogeneous mixture was shaken at room temperature for 2 h. Then, 10 μl of Et3N and 266 μl of water were added to the reaction mixture and continued to shake at 65 ° C for 16 hours. The reaction mixture was concentrated.

[1000] To the reaction mixture was added 50% aqueous MeOH (600 μl) and the solid support was separated from the solution by decantation and washed with 50% aqueous MeOH (3 x 200 μl).The solution was collected in a 2 mL screw tube and evaporated.

[1001] The residue was dissolved in 50% aqueous MeOH (600 μl) and a solution of 33% MeNH2 in EtOH (600 μl) was added. The mixture was shaken at room temperature for 8 hours. The solvent was then removed. The residue was dissolved in 0.1 M TEAB (1.5 ml) and applied to a semi-preparative C18 column (Luna 5 μm C18 250×10 mm). The desired product was isolated by reverse phase chromatography using a linear gradient of acetonitrile in 0.1 M TEAB: C 21 H 23 F2N 10 O 11 ESI-MS of P2 (MH) - Calculated value: 691.1; Exp. value: 691.1; HPLC method 2, retention time (min) = 42.4. 1 H. 19 F and 31 P NMR data (coupling constants in parentheses when available):

[1002]

[1003] Example 9. (2R,3S,3aS,8aR,10R,11S,11aS,16aR)-2,10-bis(6-amino-9H-purin-9-yl)-3,6,11,14-tetrahydroxydodecahydrodifluoro[3,2-e:3′,2′-1][1,4,8,11]tetraoxa[2,9]diphosphitetradecane 6,14-dioxide

[1004]

[1005] The solid phase product was prepared according to the above method without the end-capping step.

[1006] C 22 H 27 N 10 O 12 ESI-MS of P2 (MH) - Calculated value: 685.1; Exp. value: 685.1; HPLC method 1, retention time (min) = 30.6.

[1007] Example 10. (2R,3R,3aR,8aR,10R,11R,11aR,16aR)-2,10-bis(6-amino-9H-purin-9-yl)-3,6,11,14-tetrahydroxydodecahydrodifluoro[3,2-e:3′,2′-1][1,4,8,11]tetraoxa[2,9]diphosphitetradecane 6,14-dioxide

[1008]

[1009] The product was prepared according to the method described above.

[1010] C 22 H 27 N 10 O 12 ESI-MS of P2 (MH) - Calculated value: 685.1; Exp. value: 685.1; HPLC method 1, retention time (min) = 30.8.

[1011] Example 11. 2-amino-9-((2R,3R,3aS,7aR,9R,10R,10aR,15aR)-2-(6-amino-9H-purin-9-yl)-10-fluoro-3,5,13-trihydroxy-5,13-dioxo-decahydro-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-9-yl)-1,9-dihydro-6H-purin-6-one

[1012]

[1013] The solid phase product was prepared according to the above method without the end-capping step.

[1014] C 21 H 24 FN 10 O 12 ESI-MS of P2 (MH) - Calculated value: 689.1; Exp. value: 689.1; HPLC method 2, retention time (min) = 41.6. 1 H. 19 F and 31 P NMR data: 1H NMRδ8.42(s,1H),8.21(s,1H),7.80(s,1H),6.18(d,J=17.3Hz,1H),6.13(d,J=2.2Hz,1H),5.51(dd,J=5 2.1,3.9Hz,1H),4.75(m,1H),4.69(dd,J=4.7,2.2Hz,1H),4.68(ddd,J=21.0,8.6,3.9Hz,1H),4.51(m,1 H),4.44(ddd,J=12.0,4.3,2.5Hz,1H),4.42(m,1H),4.40(dt,J=11.6,2.4Hz,1H),4.37(dt,J=12.0,2.4 Hz,1H),4.22(ddd,J=11.6,3.4,1.6Hz,1H),4.08(dd,J=14.8,6.3Hz,1H),3.91(dd,J=14.8,7.6Hz,1H); 19 F NMRδ-198.94; 31 P NMRδ19.15,-1.37.

[1015] Example 12. 2-amino-9-((2R,3R,3aR,7aR,9R,10R,10aR,15aR)-2-(6-amino-9H-purin-9-yl)-3,10-difluoro-5,13-dihydroxy-5,13-dioxadienyldecahydro-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-9-yl)-1,9-dihydro-6H-purin-6-one

[1016]

[1017] Using a MOS oligonucleotide synthesizer, solid phase products were prepared on a column at a 1 μmol scale according to the above method without the need for a capping step.

[1018] CE-CPG was treated with 3% DCA / DCM for 2 min and then washed with ACN and DCM. A mixture of phosphonate intermediate 7 in pyridine (0.1 M, 0.1 mL) and TIPSCl in pyridine (0.3 M, 0.1 mL) was added, the mixture was reacted for 10 min and then washed with ACN and DCM.

[1019] CPG was treated with 3% DCA / DCM for 2 min and then washed with ACN and DCM. A mixture of phosphoramidate intermediate 4 in acetonitrile (0.1 M, 0.1 mL) and ETT in acetonitrile (0.3 M, 0.1 mL) was added and the resulting mixture was aged for 10 min and then washed with ACN and DCM. CPG was treated with a mixture of 5.5 M tBuOOH in decane and DCM (1 / 4, v / v) for 3 min and then washed with ACN and DCM. CPG was treated with 3% DCA / DCM for 2 min and then washed with ACN and DCM.

[1020] The column containing the CPG-bound linear dimer was removed from the synthesizer and the CPG was transferred to a 2 mL threaded tube. A 10% solution of Et2NH in ACN (500 μl) was added to the CPG solid support with the bound linear dimer, and the heterogeneous mixture was shaken at room temperature for 2 h with an Eppendorf Thermomixer Comfort Oscillator. The solvent was removed. A solution of DMOCP (10 mg) in pyridine (400 μl) was added to the cannula. The heterogeneous mixture was shaken at room temperature for 2 h. Then, 10 μl of Et3N and 266 μl of water were added to the reaction mixture and continued to shake at 65 ° C for 16 hours. The reaction mixture was concentrated on a Speed ​​Vac.

[1021] To the reaction concentrate was added 50% aqueous MeOH (600 μl) and the solid support was separated from the solution by decantation and washed with 50% aqueous MeOH (3×200 μl). The solution was collected in a 2 mL screw tube and concentrated. The residue was dissolved in 50% aqueous MeOH (600 μl) and a solution of 33% MeNH2 in EtOH (600 μl) was added. The mixture was shaken at room temperature for 8 hours before removing the solvent. The residue was dissolved in 0.1 M TEAB (1.5 ml) and purified on a semi-preparative C18 column (Luna 5 μm C18 250×10 mm). The desired product was isolated by reverse phase chromatography using a linear gradient of acetonitrile in 0.1 M TEAB: C 21 H 23 F2N 10 O 11 ESI-MS of P2 (MH) - Calculated value: 691.1; Exp. value: 691.1; HPLC method 2, retention time (min) = 43.2. 1 H. 19 F and 31 P NMR data: 1H NMRδ8.38(s,1H),8.18(s,1H),7.97(s,1H),6.43(d,J=15.6Hz,1H),6.19(d,J=17.0Hz,1H),5.53(dd,J=51.7, 4.0Hz,1H),5.51(dd,J=51.4,4.0Hz,1H),4.89(ddd,J=21.0,9.0,4.0Hz,1H),4.63(ddd,J=22.5,8.8,4.0Hz,1 H),4.55(m,1H),4.52(ddd,J=12.1,4.4,2.1Hz,1H),4.42(m,1H),4.39(dt,J=11.8,2.4Hz,1H),4.33(dt,J=12 .1,1.8Hz,1H),4.19(ddd,J=11.8,3.8,1.8Hz,1H),4.08(dd,J=14.6,5.5Hz,1H),3.86(dd,J=14.6,8.8Hz,1H); 19 F NMRδ-198.84,-199.40; 31 P NMRδ19.05,-1.80.

[1022] Example 13. (2R,3R,3aR,7aR,9R,10R,10aR,15aR)-2,9-bis(6-amino-9H-purin-9-yl)-3,10-difluoro-5,13-dihydroxydecahydro-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecane 5,13-dioxide

[1023]

[1024] The solid phase product was prepared according to the above method without the end-capping step.

[1025] Alternatively, the desired product is prepared in solution according to the following scheme:

[1026]

[1027] ETT (0.1 g; 0.82 mmol) was added to a solution of phosphonate intermediate 9 (0.1 g; 0.17 mmol) and phosphonamidate intermediate 10 (Cat. No. 203-51, purchased from Metkinen, 0.16 g; 0.19 mmol) in DCM (10 mL). The reaction mixture was stirred at room temperature under argon for 2 h. Thereafter, CSO (0.15 g; 0.56 mmol) was added and the mixture was stirred at room temperature for 1 h. Thereafter, the reaction mixture was treated with methanol (10 mL) at room temperature for 1 h and evaporated. The residue was treated with 80% acetic acid / water (10 mL) at room temperature for 2 h. The solution was directly loaded onto a C18 column and the linear phosphonate dimer intermediate 11 was separated using a linear gradient of acetonitrile in 5 mM ammonium bicarbonate. Intermediate 11: C 45 H 43 F2N 12 O 14 P2(MH) - The ESI-MS calculated value was 1075.3, and the experimental value was 1075.3.

[1028] To DMOCP (0.16 g; 0.85 mmol) was added a solution of the linear phosphonate dimer intermediate 11 in pyridine (6 mL) and the reaction mixture was stirred at room temperature for 4 h. Thereafter, water (4 mL) was added and the mixture was stirred at 65 °C for 3 h, evaporated and co-evaporated with methanol (3 x 10 mL). The residue was treated with 10% DEA / ACN at room temperature for 2 h and evaporated. The cyclic dinucleotides were separated using a linear gradient of acetonitrile in 5 mM ammonium bicarbonate and evaporated. The residue was dissolved in 50% ACN / water (10 mL) and 33% methylamine / ethanol (5 mL) was added. The mixture was stirred for 2 h and evaporated. The product was purified using preparative C18 HPLC (eluting with a linear gradient of acetonitrile in 0.1 M TEAB). DOWEX Na + The desired product is converted into a sodium salt and lyophilized from water; C 21 H 23 F2N 10 O 10 ESI-MS of P2 (MH) - Calculated value: 675.1; Exp. value: 675.1; HPLC method 2, retention time (min) = 43.1. 1 H. 19 F and 31 P NMR data: 1H NMRδ8.36(s,1H),8.31(s,1H),8.20(s,1H),8.19(s,1H),6.41(d,J=15.9Hz,1H),6.38(d,J=15.3Hz,1 H),5.54(dd,J=51.4,3.8Hz,1H),5.44(dd,J=51.8,3.7Hz,1H),4.86(m,1H),4.56(m,1H),4.56(ddd,J =9.0,2.2,1.6Hz,1H),4.53(m,1H),4.49(m,1H),4.47(dt,J=12.0,2.2Hz,1H),4.33(dt,J=11.8,1.6H z,1H),4.24(ddd,J=12.0,3.4,1.6Hz,1H),4.09(dd,J=14.9,5.4Hz,1H),3.84(dd,J=14.9,8.4Hz,1H); 19 F NMRδ-198.64,-199.19; 31 P NMRδ19.46,-2.05.

[1029] Example 14. 2-amino-9-((2R,3R,3aR,7aR,9R,10aS,15aR)-2-(6-amino-9H-purin-9-yl)-3-fluoro-5,13-dihydroxy-5,13-dioxo-decahydro-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-9-yl)-1,9-dihydro-6H-purin-6-one

[1030]

[1031] The solid phase product was prepared according to the above method without the end-capping step.

[1032] C 21 H 24 FN 10 O 11 ESI-MS of P2 (MH) - Calculated value: 673.1; Exp. value: 673.1; HPLC method 2, retention time (min) = 39.5.

[1033] Example 15. 2-amino-9-((2R,3aS,7aR,9R,10R,10aR,15aR)-9-(6-amino-9H-purin-9-yl)-10-fluoro-5,13-dihydroxy-5,13-dioxo-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-2-yl)-1,9-dihydro-6H-purin-6-one

[1034]

[1035] The solid phase product was prepared according to the above method without the end-capping step.

[1036] C 21 H 24 FN 10 O 11 ESI-MS of P2 (MH) - Calculated value: 673.1; Found value: 673.1; HPLC method 2, retention time (min) = 47.5.

[1037] Example 16. 9,9′-((2R,3R,3aR,7aR,9R,10R,10aR,15aR)-3,10-difluoro-5,13-dihydroxy-5,13-dioxo-2H-difluoro[3,2-d:3′,2′-k][1,3,7,10]tetraoxa[2,8]diphosphacyclotridecan-2,9-diyl)bis(2-amino-1,9-dihydro-6H-purin-6-one)

[1038]

[1039] The solid phase product was prepared according to the above method without the end-capping step.

[1040] C 21 H 23 F2N 10 O 12 ESI-MS of P2 (MH) - Calculated value: 707.1; Exp. value: 707.1; HPLC method 2, retention time (min) = 37.1.

[1041] Example 17. Biological Evaluation

[1042] Cyclic dinucleotides were judged to be STING agonists: (A) if they were demonstrated to bind to the AQ allele form of the human STING protein with a thermal shift >0.5°C in the STING differential scanning fluorimetry assay (DSF), and (B) if they were demonstrated to bind to the AQ allele form of the human STING protein with a thermal shift >0.5°C in the EC 50 <100 μmol.l -1In this case, we demonstrated STING activation via IRF-3-dependent expression of a firefly luciferase reporter.

[1043] ISRE reporter plasmid (pGL64.27-4xISRE)

[1044] Two complementary oligonucleotides of the sequence AAAGATCTTGGAAAGTGAAACCTTGGAAAACGAAACTGGACAAAGGGAAACTGCAGAAACTGAAACAAAGCTTAA (SEQ ID NO: 1) and TTAAGCTTTGTTTCAGTTTCTGCAGTTTCCCTTTGTCCAGTTTCGTTTTCCAAGGTTTCACTTTCCAAGATCTTT (SEQ ID NO: 2) containing four interferon sensitivity response elements (ISREs) were synthesized by Sigma Aldrich (Czech Republic, Prague). The oligonucleotides were mixed in equimolar amounts, hybridized and cleaved by restriction endonucleases HindIII (Cat. No. R0104S, NEB, Ipswich, USA) and BglII (Cat. No. R0144S, NEB, Ipswich, USA). Finally, they were joined to plasmid pGL4.27 (Cat. No. E6651, Promega, Madison, USA) linearized by the same enzymes. Therefore, a sequence with four ISRE sites was placed upstream of the minimal promoter of the firefly luciferase reporter gene.

[1045] 293T wtSTING-FL reporter cells

[1046] One day before transfection, 293T cells (Catalog No. CRL-3216, ATCC, Manassas, USA) were seeded at a density of 125,000 cells / cm2 in six-well plates coated with poly-D-lysine (Catalog No. P6407, Sigma Aldrich, Czech Republic) in antibiotic-free DMEM with high glucose (Catalog No. D5796, Sigma Aldrich, Czech Republic) supplemented with 10% heat-inactivated FBS (Catalog No. S1520, Biowest, Riverside, USA). On the day of transfection, 2.5 μg of plasmid pUNO1-hSTING-WT (Cat. No. punol-hstingwt, InvivoGen, San Diego, USA) encoding human wild-type STING (WT STING) was diluted in 125 μL OptiMEM medium (Cat. No. 31985062, ThermoFisher, Waltham, USA) and mixed with the same 125 μL medium containing 12.5 μL lipofectamine 2000 (Cat. No. 11668019, ThermoFisher, Waltham, USA). After incubation at room temperature (RT) for 5 minutes, 250 μL of the mixture was added dropwise to the cells in one well. The cells were incubated at 37° C., 5% CO 2 for 36 hours and then detached with 0.05% trypsin and 0.22 g / L EDTA (Cat. No. L0941, Biowest, Riverside, USA).

[1047] The transfected cells were plated at a density of 50,000 cells / cm2 in DMEM medium with high glucose containing 10% heat-inactivated FBS, 30 μg / mL blasticidin (Catalog No. ant-bl-05, InvivoGen, San Diego, USA), 0.06 mg / ml penicillin G and 0.1 mg / ml streptomycin sulfate (Catalog No. L0018, Biowest, Riverside, USA). The medium was replenished every 3-4 days until visible cell colonies resistant to blasticidin were formed.

[1048] Blasticidin-resistant cells stably expressing WT STING were further transfected with pGL64.27-4xISRE plasmids according to the same procedure as described above. Transfected cells were selected for resistance to 300 μg / mL hygromycin (Cat. No. 10687010, ThermoFisher, Waltham, USA) in DMEM with high glucose containing 10% heat-inactivated FBS, 30 μg / mL blasticidin, 0.06 mg / ml penicillin G, and 0.1 mg / ml streptomycin sulfate. Homogenous cultures of stably doubly transfected cells were prepared by limiting dilution of cells in 96-well plates, and wells with cells derived from a single cell were selected. These cells were expanded and the expression of WT STING was confirmed by western blot using monoclonal mouse anti-STING antibodies (Cat. No. MAB7169, 1:1000 dilution; 2° antibody Cat. No. HAF007, 1:2000 dilution, both from R&D Systems, Minneapolis, USA) and by inducing firefly luciferase expression in the presence of 50 μM STING agonist 2′3′ cGAMP (Cat. No. tlrl-nacga23, InvivoGen, San Diego, USA). Genomic DNA from transfected cells was amplified with primers pUNO1_Seq_F (TGCTTGCTCAACTCTACGTC) (SEQ ID NO: 3) and pUNO1_Seq_R (GTGGTTTGTCCAAACTCATC) (SEQ ID NO: 4) complementary to the pUNO1 plasmid, and the presence of the WT STING gene in the transfected cells was confirmed by DNA sequencing.

[1049] Digitonin assay using 293T wtSTING-FL reporter cells

[1050] 293T wtSTING-FL cells were seeded at 250,000 cells / cm2 in 100 μl DMEM with high glucose supplemented with 10% heat-inactivated FBS on a 96-well plate coated with poly-D-lysine. The next day, the medium was removed and three-fold serial dilutions of the compounds in digitonin buffer containing the following were added to the cells: 50 mmol.l -1 HEPES (Cat. No. H3375, Sigma Aldrich, Czech Republic) pH 7.0, 100 mmol.l - 1 KCl, 3mmol.l -1 MgCl2, 0.1mmol.l -1DTT (Catalog No. D0632, Sigma Aldrich, Czech Republic), 85 mmol.l -1 Sucrose (Catalog No. S7903, Sigma Aldrich, Republic), 0.2% BSA (Catalog No. A2153, Sigma Aldrich, Czech Republic), 1 mmol.l -1 ATP (Catalog No. A1852, Sigma Aldrich, Czech Republic), 0.1 mmol.l -1 GTP (Catalog No. G8877, Sigma Aldrich, Czech Republic) and 10 μg / mL digitonin A (Catalog No. D141, Sigma Aldrich, Czech Republic). After incubation at 37°C, 5% CO2 for 30 minutes, the buffer was removed, the cells were washed once with 100 μl of medium, and 100 μl of medium was added to each well. The culture plate with cells was incubated at 37°C, 5% CO2 for 5 hours, 50 μl of medium was removed and 30 μl of ONE-Glo was added to each well. TM Luciferase assay system reagent (Cat. No. E6120, Promega, Madison, USA). Luminescence was read with Synergy H1 (Biotek, Winooski, USA). 50% effective concentration (EC) was calculated from an 8-point dose-response curve using GraphPad Prism (San Diego, CA USA). 50 The control compounds 3′3′-c-di-GMP (Catalog No. tlrl-nacdg), 3′3′-c-di-AMP (Catalog No. tlrl-nacda), 3′3′-cGAMP (Catalog No. tlrl-nacga), 2′3′-cGAMP (Catalog No. tlrl-nacga23) and 2′2′-cGAMP (Catalog No. tlrl-nacga22) were purchased from Invivogen (San Diego, USA).

[1051] WT STING and AQ STING proteins

[1052] Using PCR ( High-fidelity DNA polymerase, catalog number M0530S, NEB, Ipswich, USA), and oligonucleotides hSTING140-BamH-For (GTGGGATCCGCCCCAGCTGAGATCTCTGCAG) (SEQ ID NO: 5) and hSTING379-Not-Rev3 (TATGCGGCCGCCTATTACACAGTAACCTCTTCCTTTTC) (SEQ ID NO: 6) from pUNO1-hSTING-WT (catalog number puno1-hstingwt, InvivoGen, San Diego, USA) and pUNO1-hSTING-HAQ plasmids (puno1-hsting-haq, InvivoGen, San Diego, USA) were used to amplify WT and AQ human STING (G230A-R293Q) cDNAs. The purified PCR product was cleaved with restriction enzymes BamHI (Cat. No. R0136S, NEB, Ipswich, USA) and NotI (Cat. No. R0189S, NEB, Ipswich, USA) and cloned into the pSUMO vector linearized with the same enzymes. The plasmid pSUMO was generated by introducing the 8-His-SUMO sequence between the NdeI and BamHI sites of the pHis-parallel2 plasmid (Clontech, Mountain View, USA). Thus, the pSUMO-STING WT or pSUMO-STING AQ plasmids encode truncated human WT STING or AQ STING (amino acid residues 140-343) with an N-terminal 8xHis and SUMO tag.

[1053] Recombinant WT STING and AQ STING proteins were overexpressed in Rosetta-gami B (DE3) competent cells (Cat. No. 71136-3, Merck Millipore, Billerica, USA). The bacterial pellet was resuspended in 50 mmol / l PBS using a Dounce homogenizer. -1 TrisCl (Cat. No. T1503, Sigma Aldrich, Czech Republic) pH 8.0, 300 mmol.l -1 NaCl, 3mmol.l -1 β-Mercaptoethanol (Catalog No. M6250, Sigma Aldrich, Czech Republic), 10% glycerol (Catalog No. G5516, Sigma Aldrich, Czech Republic) and 20 mmol.l -1DNase I (Catalog No. D5025, Sigma Aldrich, Czech Republic) and RNase A (Catalog No. R6513, Sigma Aldrich, Czech Republic) (final concentration 50 μg / ml) and MgCl2 (final concentration 5 mmol.l) were added to the homogenate. -1 ) and use French Press GM TM The bacteria were lysed using a high pressure cell compression homogenizer (1500 psi, 3 cycles). The lysate was spun at 30,000 g for 20 minutes and the supernatant was gently stirred with Ni-NTA resin (Cat. No. 745400.25, Macherey-Nagel, Düren, Germany) for 30 minutes. The resin was poured into a chromatography column and washed with 50 ml of buffer A (50 mmol.l -1 TrisCl (pH 8.0), 800mmol.l -1 NaCl, 3mmol.l -1 β-Mercaptoethanol; 10% glycerol; 20mmol.l -1 imidazole) and washed with 300 mmol.l -1 The 8-His-SUMO-tagged STING protein was eluted with 15 ml of buffer A containing imidazole. The eluted protein was cleaved with recombinant SUMO protease (80 μg / ml protein solution, catalog number 12588018, ThermoFisher, Waltham, USA). -1 50mmol.l of NaCl and 10% glycerol -1 The protein was further purified by size exclusion chromatography using HiLoad 16 / 60 Superdex 75 (Cat. No. 28989333, GE Healthcare Bio-Sciences, Pittsburgh, USA) in Tris Cl buffer, pH 7.4. The samples were concentrated using an Ultra-1510K apparatus (Cat. No. UFC901008, Merck Millipore, Billerica, USA) and flash frozen in liquid N2.

[1054] DNA sequence of 8-His-SUMO

[1055] (SEQ ID NO:7).

[1056] Amino acid sequence of 8-His-SUMO

[1057]

[1058] (SEQ ID NO:8).

[1059] Amino acid sequence of truncated WT STING

[1060] (SEQ ID NO:9).

[1061] Amino acid sequence of truncated AQ STING

[1062] (SEQ ID NO: 10).

[1063] Differential scanning fluorescence assay with WT STING and AQ STING

[1064] The WT and AQ allele forms of STING protein were expressed in the presence of 150 mmol.l -1 NaCl, 1:500 SYPROOrange (Cat. No. S6650, ThermoFisher, Waltham, USA) and 150 μM CDN or 100 mmol.l of water -1 Dilute to a final concentration of 0.1 mg / ml in TrisCl buffer pH 7.4. 20 μL of the reaction mixture was pipetted in triplicate into a 96-well optical reaction plate and PCR cycled in a PCR cycler ( Thermal denaturation of the samples was performed using a 480 Instrument II-Roche, Basel, Switzerland. The first differential of the thermal denaturation curve was performed to calculate the denaturation temperatures of the STING-CDN complex and the STING apoprotein. The thermal offset of each CDN was calculated by subtracting the average denaturation temperature of the STING apoprotein from the average denaturation temperature of the STING CDN complex.

[1065] Table 2. Biological evaluation of CDN

[1066]

[1067] Although the foregoing invention has been described in considerable detail by way of illustration and example for purposes of clarity of understanding, it will be appreciated by those skilled in the art that certain changes and modifications may be practiced within the scope of the appended claims. In addition, each reference provided herein is incorporated herein by reference in its entirety to the same extent as if each reference were individually incorporated by reference. In the event of a conflict between the present application and the references provided herein, the present application shall prevail. Sequence Listing <110> Institute of Organic Chemistry and Biochemistry, Czech Republic <120> 3'3'-cyclic dinucleotide <130> 052838-541001US <150> 62 / 654,058 <151> 2018-04-06 <160> 10 <170> PatentIn version 3.5 <210> 1 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Synthetic constructs <400> 1 aaagatcttg gaaagtgaaa ccttggaaaa cgaaactgga caaagggaaa ctgcagaaac 60 tgaaacaaag cttaa 75 <210> 2 <211> 75 <212> DNA <213> Artificial sequence <220> <223> Synthetic constructs <400> 2 ttaagctttg tttcagtttc tgcagtttcc ctttgtccag tttcgttttc caaggtttca 60 ctttccaaga tcttt 75 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic constructs <400> 3 tgcttgctca actctacgtc 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic constructs <400> 4 gtggtttgtc caaactcatc 20 <210> 5 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Synthetic constructs <400> 5 gtgggatccg ccccagctga gatctctgca g 31 <210> 6 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic constructs <400> 6 tatgcggccg cctattacac agtaacctct tccttttc 38 <210> 7 <211> 330 <212> DNA <213> Artificial sequence <220> <223> Synthetic constructs <400> 7 atgtcgcatc accatcatca tcaccaccat gggatgtcgg actcagaagt caatcaagaa 60 gctaagccag aggtcaagcc agaagtcaag cctgagactc acatcaattt aaaggtgtcc 120 gatggatctt cagagatctt cttcaagatc aaaaagacca ctcctttaag aaggctgatg 180 gaagcgttcg ctaaaagaca gggtaaggaa atggactcct taagattctt gtacgacggt 240 attagaattc aagctgatca gacccctgaa gatttggaca tggaggataa cgatattatt 300 gaggctcacc gcgaacagat tggtggatcc 330 <210> 8 <211> 110 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Construct <400> 8 Met Ser His His His His His His His His Gly Met Ser Asp Ser Glu 1 5 10 15 Val Asn Gln Glu Ala Lys Pro Glu Val Lys Pro Glu Val Lys Pro Glu 20 25 30 Thr His Ile Asn Leu Lys Val Ser Asp Gly Ser Ser Glu Ile Phe Phe 35 40 45 Lys Ile Lys Lys Thr Thr Pro Leu Arg Arg Leu Met Glu Ala Phe Ala 50 55 60 Lys Arg Gln Gly Lys Glu Met Asp Ser Leu Arg Phe Leu Tyr Asp Gly 65 70 75 80 Ile Arg Ile Gln Ala Asp Gln Thr Pro Glu Asp Leu Asp Met Glu Asp 85 90 95 Asn Asp Ile Ile Glu Ala His Arg Glu Gln Ile Gly Gly Ser 100 105 110 <210> 9 <211> 204 <212> PRT <213> artificial sequence <220> <223> composite structure <400> 9 Ala Pro Ala Glu Ile Ser Ala Val Cys Glu Lys Gly Asn Phe Asn Val 1 5 10 15 Ala His Gly Leu Ala Trp Ser Tyr Tyr Ile Gly Tyr Leu Arg Leu Ile 20 25 30 Leu Pro Glu Leu Gln Ala Arg Ile Arg Thr Tyr Asn Gln His Tyr Asn 35 40 45 Asn Leu Leu Arg Gly Ala Val Ser Gln Arg Leu Tyr Ile Leu Leu Pro 50 55 60 Leu Asp Cys Gly Val Pro Asp Asn Leu Ser Met Ala Asp Pro Asn Ile 65 70 75 80 Arg Phe Leu Asp Lys Leu Pro Gln Gln Thr Gly Asp Arg Ala Gly Ile 85 90 95 Lys Asp Arg Val Tyr Ser Asn Ser Ile Tyr Glu Leu Leu Glu Asn Gly 100 105 110 Gln Arg Ala Gly Thr Cys Val Leu Glu Tyr Ala Thr Pro Leu Gln Thr 115 120 125 Leu Phe Ala Met Ser Gln Tyr Ser Gln Ala Gly Phe Ser Arg Glu Asp 130 135 140 Arg Leu Glu Gln Ala Lys Leu Phe Cys Arg Thr Leu Glu Asp Ile Leu 145 150 155 160 Ala Asp Ala Pro Glu Ser Gln Asn Asn Cys Arg Leu Ile Ala Tyr Gln 165 170 175 Glu Pro Ala Asp Asp Ser Ser Phe Ser Leu Ser Gln Glu Val Leu Arg 180 185 190 His Leu Arg Gln Glu Glu Lys Glu Glu Val Thr Val 195 200 <210> 10 <211> 204 <212> PRT <213> artificial sequence <220> <223> composite structure <400> 10 Ala Pro Ala Glu Ile Ser Ala Val Cys Glu Lys Gly Asn Phe Asn Val 1 5 10 15 Ala His Gly Leu Ala Trp Ser Tyr Tyr Ile Gly Tyr Leu Arg Leu Ile 20 25 30 Leu Pro Glu Leu Gln Ala Arg Ile Arg Thr Tyr Asn Gln His Tyr Asn 35 40 45 Asn Leu Leu Arg Gly Ala Val Ser Gln Arg Leu Tyr Ile Leu Leu Pro 50 55 60 Leu Asp Cys Gly Val Pro Asp Asn Leu Ser Met Ala Asp Pro Asn Ile 65 70 75 80 Arg Phe Leu Asp Lys Leu Pro Gln Gln Thr Ala Asp Arg Ala Gly Ile 85 90 95 Lys Asp Arg Val Tyr Ser Asn Ser Ile Tyr Glu Leu Leu Glu Asn Gly 100 105 110 Gln Arg Ala Gly Thr Cys Val Leu Glu Tyr Ala Thr Pro Leu Gln Thr 115 120 125 Leu Phe Ala Met Ser Gln Tyr Ser Gln Ala Gly Phe Ser Arg Glu Asp 130 135 140 Arg Leu Glu Gln Ala Lys Leu Phe Cys Gln Thr Leu Glu Asp Ile Leu 145 150 155 160 Ala Asp Ala Pro Glu Ser Gln Asn Asn Cys Arg Leu Ile Ala Tyr Gln 165 170 175 Glu Pro Ala Asp Asp Ser Ser Phe Ser Leu Ser Gln Glu Val Leu Arg 180 185 190 His Leu Arg Gln Glu Glu Lys Glu Glu Val Thr Val 195 200

Claims

1. A compound of formula (I): or a pharmaceutically acceptable salt thereof, in L 1 for -O-; L 2 is -O-CH2-, wherein the CH2 group is attached to the phosphorus atom; Y 1 and Y 2 Each is -O-; X 1 and X 3 Each independently is OR 13 or SR 13 ; X 2 and X 4 Each independently is O or S; R 1 , R 5 , R 8 , R 2 , R 4 , R 9 , R 11 and R 12 Each is H; R 3 and R 10 Each independently is H, OH or F; Each R 13 are independently H or C1-C6 alkyl; Base 1 and bases 2 Each independently is:

2. The compound according to claim 1, wherein X 2 and X 4 is O, and X 1 and X 3 Each independently is OR 13 .

3. The compound according to claim 1, wherein the compound of formula (I) has the structure of formula (Ia-2): or a pharmaceutically acceptable salt thereof.

4. The compound according to claim 1, wherein the compound of formula (I) has the structure of formula (Ic): or a pharmaceutically acceptable salt thereof.

5. The compound according to claim 1, wherein the compound has the following structure: or a pharmaceutically acceptable salt thereof. 6 . A pharmaceutical composition comprising the compound according to claim 1 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

7. Use of the pharmaceutical composition according to claim 6 for the preparation of a medicament for activating STING adaptor protein and inducing the production of type I interferon, cytokine and / or chemokine that is dependent on STING adaptor protein.

8. Use of the pharmaceutical composition according to claim 6 for the preparation of a medicament for activating the STING adaptor protein, wherein the medicament is used to treat or prevent hepatitis B virus infection or HIV infection in humans or animals.

9. Use of a compound according to any one of claims 1 to 5 or a pharmaceutically acceptable salt thereof for preparing a medicament for activating a STING adaptor protein.

10. Use of a compound according to any one of claims 1 to 5 or a pharmaceutically acceptable salt thereof for the preparation of a medicament for activating a STING adaptor protein, wherein the medicament is used to treat or prevent hepatitis B virus infection or HIV infection in a human or animal in need thereof.

11. Use according to any one of claims 9 to 10, wherein the compound is administered together with another therapeutically active agent.

12. Use of a compound according to any one of claims 1 to 5 or a pharmaceutically acceptable salt thereof in combination with one or more additional therapeutically active agents for the preparation of a medicament for activating the STING adaptor protein, wherein the medicament is used to treat or prevent hepatitis B virus infection or HIV infection in humans or animals.

Images