Methods for attaching adaptors to single-stranded regions of double-stranded polynucleotides

Abstract

A method for attaching an adapter to a polynucleotide, comprising: providing a double-stranded polynucleotide comprising a single-stranded break point within its polynucleotide sequence; contacting the double-stranded polynucleotide with a nuclease to form a single-stranded region starting at the break point; and attaching an adapter to the single-stranded region.

Description

Technical Field

[0001] The present invention generally relates to methods for attaching adaptors to polynucleotides. Attachment of adaptors to polynucleotides prepares polynucleotides for characterization. The present invention also generally relates to methods for characterizing adaptorized polynucleotides, and to reagents and kits for attaching adaptors to polynucleotides and / or for characterizing adaptorized polynucleotides. Background Art

[0002] There are many commercial situations where it is necessary to prepare nucleic acid libraries. This is often achieved using transposases. Depending on the transposase used to prepare the library, it may be necessary to repair in vitro translocations before the library can be used, for example, for sequencing.

[0003] Rapid and inexpensive polynucleotide (eg, DNA or RNA) sequencing and identification technologies are currently needed for a wide range of applications.

[0004] Transmembrane pores (nanopores) have great potential as direct electronic biosensors of polymers and various small molecules. Specifically, nanopores have recently attracted attention as a potential technology for DNA sequencing.

[0005] WO 2015 / 022544 discloses the use of MuA transposase and a population of MuA substrates to produce a plurality of shorter, modified double-stranded polynucleotides from a template double-stranded polynucleotide. Summary of the Invention

[0006] The present inventors have shown that sequencing can start from the single-strand break points in the polynucleotide. In particular, the present inventors have shown that the exonuclease that can start at the breakpoint of the double-stranded polynucleotide can be used to expose the single-stranded region of the polynucleotide. The adapter can then be bound to the exposed single-stranded region. The adapter can be a random adapter that hybridizes with any polynucleotide sequence (such as any DNA sequence), or a directional adapter that is bound to a specific one or more sequences. The 3' end of the adapter can be bound to the single-stranded region exposed by the polynucleotide and leave a free 5' end. Once the 3' end of the adapter is covalently attached to the 5' end of the polynucleotide at the adjacent exposed single-stranded region, the free 5' end of the adapter can be used as a primer site for amplification or as an attachment site for sequencing adapters.

[0007] The advantages of the new method are that it provides a fragmentation-free method for preparing sequencing samples. The method can target specific regions of polynucleotides or it can be non-targeted. The method is extremely rapid and involves very few steps. The method can be performed without a cleanup step. All of these factors contribute to sequencing long reads with fewer liquid handling steps. In one aspect, the method can be semi-directional and used to probe unknown regions of polynucleotides starting from known sequence motifs, which can be conserved sequence motifs.

[0008] Thus, provided herein is a method for attaching an adaptor to a polynucleotide, comprising: providing a double-stranded polynucleotide comprising a single-strand break within its polynucleotide sequence; contacting the double-stranded polynucleotide with an enzyme having exonuclease activity to form a single-stranded region beginning at the break; and attaching an adaptor to the single-stranded region. The adaptor is typically attached by hybridizing the adaptor to the single-stranded region and covalently attaching only the 3' end of the adaptor to the free 5' end of the double-stranded region in the polynucleotide adjacent to the single-stranded region.

[0009] Also provided is a method of providing a double-stranded polynucleotide comprising exposed single-stranded regions flanked by double-stranded regions; and attaching an adaptor to the exposed single-stranded polynucleotide stretch.

[0010] The method may further comprise covalently attaching an adaptor to the double-stranded polynucleotide and / or attaching a sequencing adaptor to the adaptor or hybridizing a primer to the adaptor.

[0011] Also available:

[0012] A method of characterizing a polynucleotide comprising:

[0013] attaching an adaptor to a polynucleotide by the methods disclosed herein;

[0014] attaching sequencing adaptors to the adaptors attached to the polynucleotide;

[0015] contacting the adaptorized polynucleotide with a nanopore, thereby translocating the polynucleotide through the nanopore; and

[0016] As the polynucleotide moves relative to the nanopore, one or more measurements are taken, wherein the measurements are indicative of one or more characteristics of the polynucleotide and thereby characterize the polynucleotide.

[0017] A method for amplifying a polynucleotide, comprising:

[0018] attaching an adaptor to a polynucleotide by the methods disclosed herein;

[0019] hybridizing a primer to the adaptor attached to the polynucleotide;

[0020] performing an amplification reaction;

[0021] - a kit comprising an enzyme having exonuclease activity and an adaptor, wherein the adaptor comprises a 5' end and a 3' end, wherein the 3' end comprises a universal sequence of 3 to 15 bases; and

[0022] - A DNA comprising an adaptor attached within a telomere, wherein the adaptor comprises a 5' end and a 3' end, wherein the 3' end hybridizes to the DNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] It should be understood that the drawings are for illustration purposes only and are not intended to be limiting.

[0024] Figure 1 is a schematic diagram of how adapters are attached to single-strand breaks in polynucleotides. A shows a single-strand break point (1) in a polynucleotide, which can be, for example, a random cut or a targeted cut (e.g., a cut induced by Cas9) in a high molecular weight (HMW) DNA. B shows how a 3'-5' exonuclease (2) cuts back from the break point, thereby exposing single-stranded DNA (ssDNA). C shows the hybridization of an intermediate adapter (3) with the exposed ssDNA. In this figure, a polymerase (4) without chain displacement activity extends the adapter in the 5'-3' direction, although this extension is not required when the adapter is attached so that there is no gap between the 3' end of the adapter and the 5' end of the leading chain. D shows the attachment (5) of the 3' end of the adapter to the 5' end of the leading chain. Attachment can be achieved, for example, using a ligase or click chemistry.

[0025] Figure 2 is an Nx graph showing the percentage of bases (x-axis) in reads greater than N bases in length (y-axis) in an E. coli genomic DNA sequencing library that has undergone adapter addition at the nick site using DNA polymerase I to open the nick and perform nick translation in the presence of dNTPs.

[0026] Figure 3 Shown is a plot of read length distribution for S. cervisiae sequences prepared using DNA polymerase I to nick genomic DNA, and DNA polymerase I with dNTPs and Sololobus polymerase for nick translation and gap filling.

[0027] Figure 4 is a schematic diagram of how an adapter is attached to a single-stranded DNA region in the telomeric region of a chromosome. A depicts the structure of a telomere. For clarity, B shows a linear form of DNA including a telomeric repeat sequence (2). The single-stranded DNA overhang is at position (1). C shows an intermediate adapter to which a hexamer sequence (3) having universal nucleotides (u) and a click group (4) that binds to the single-stranded DNA through hybridization of the universal nucleotides is added. If hybridization leaves a gap between the 3' end of the adapter universal sequence and the 5' end of the telomere, a polymerase can be used to fill the gap (e.g., a polymerase with 5'-3' exonuclease activity can extend into the 5' end of the telomere).

[0028] Figure 5 is a DNA sequence alignment showing the sequence alignment of sequences starting within the telomeric region of a Saccharomyces cerevisiae chromosome. Most reads were sequenced from the telomeres toward the centromeres.

[0029] Figure 6 The proportional abundance of reads of a given sequence length is shown compared to the Oxford Nanopore SQL-LSK108 sequencing kit using E. coli genomic DNA as a template. Exonuclease III was used for nicking, and DNA polymerase I was used for nick translation from the 3' end of the tailed random hexamer in the presence of dNTPs. Replicates of each preparation were used to generate the data.

[0030] Figure 7 Results of experiments testing a variety of different surfactants in an attempt to "loosen up" the DNA to facilitate the interaction of enzymes and adaptors with the center of the DNA molecule are shown. The surfactant Brij showed a modest increase in read length compared to the other surfactants and controls.

[0031] Figure 8 Shown are the read statistics of sequencing libraries prepared by adding adapters at the nicking sites in E. coli DNA treated with formamidopyrimidine [fapy]-DNA glycosylase (FPG) (FPG introduces nicks at damaged bases) and E. coli DNA that had not been treated with FPG (no FPG).

[0032] Figure 9 Shown is the result of DNA polymerase T7 (a), exonuclease III (b), and T4 (c) introduction into a 3221 bp plasmid using the nicking restriction endonuclease Nt.BspQI (NEB). Read lengths obtained when a single nick site in the PCR product is nicked back (Promega). T7 DNA polymerase provides the shortest reads, followed by Exonuclease III, while T4 DNA polymerase produces the longest reads.

[0033] Figure 10 Depicted is the accumulation of reads generated by sequencing run after alignment or by sequencing starting from a single nick introduced into DNA isolated from bacteriophage lambda (NEB) that is 48,502 base pairs in length using a nicking mutant nuclease variant of Cas9 (D10A) (NEB), following nicking back from this nick site using exonuclease III to generate a stretch of single-stranded bases (ssDNA), followed by hybridization of a complementary intermediate DNA adapter to the target site, ligation of the adapter to the 5' end of the exposed nick site, and ligation of the 5' end of the intermediate adapter to the sequencing adapter. Reads can be seen starting from a single site at the 3' end of the reference, demonstrating that this approach allows for directed sequencing and enrichment of targets.

[0034] Figure 11 Schematic diagram of how an adaptor is attached to a single-strand break in a polynucleotide. (1) A single-strand break in a polynucleotide is shown, which can be, for example, a random nick or a targeted nick (e.g., a nick induced by Cas9) in high molecular weight (HMW) DNA. (2) An extended gap created by a 5'-3' or 3'-5' exonuclease is shown. (3) Hybridization of the adaptor to the ssDNA exposed in the gap is shown. (4) Binding of a polymerase to the 3' end of the introduced adaptor is shown. (5) Extension of the double-stranded portion of the adaptor using a polymerase with 5' exonuclease activity is shown, such that the native strand is displaced and digested. (6) Dissociation of the polymerase and sealing of the break to covalently attach the adaptor to the target polynucleotide is shown. Attachment can be achieved, for example, using a ligase or click chemistry. DETAILED DESCRIPTION

[0035] It should be understood that different applications of the disclosed methods and products can be customized according to specific needs in the art. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments of the methods and products only and is not intended to be limiting.

[0036] Additionally, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes two or more polynucleotides, reference to "an anchor" refers to two or more anchors, reference to "a helicase" includes two or more helicases, and reference to "a transmembrane pore" includes two or more pores, etc.

[0037] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

[0038] Methods of attaching adaptors

[0039] Provided herein is a method of attaching a sequencing adaptor to a double-stranded polynucleotide, the method comprising:

[0040] (a) providing a double-stranded polynucleotide comprising a single-strand break;

[0041] (b) contacting the double-stranded polynucleotide with an exonuclease to form a single-stranded region starting from the break point; and

[0042] (c) Attaching an adaptor to the single-stranded region.

[0043] A single-strand break can be a nick in a polynucleotide, i.e., a break in the backbone of a polynucleotide, such as a break due to the loss of a phosphodiester bond between adjacent nucleotides in one strand of a double-stranded polynucleotide. Thus, in one embodiment, a single-strand break is a gap in the backbone of one strand of a double-stranded polynucleotide.

[0044] A single-strand break can be a gap in one strand of a double-stranded polynucleotide. For example, one strand of a polynucleotide may be missing 1, 2, 3, 4, or more nucleotides at the breakpoint. Double-stranded polynucleotides can be treated to facilitate access of exonucleases to the breakpoint. For example, double-stranded polynucleotides can be contacted with a surfactant such as Brij, Triton, or Tween.

[0045] In one embodiment, the breakpoint occurs at the junction between the double-stranded DNA and the telomere.For example, the breakpoint can be a single-stranded region at the junction between the double-stranded DNA and the telomere.

[0046] Single-strand breakpoints can be at random positions in the polynucleotide, or at a target position in the polynucleotide. A double-stranded polynucleotide comprising single-strand breakpoints can comprise multiple breakpoints, for example 2, 3, 4, 5, 6, 7, 8 or 9 to about 50, about 40, about 30, about 20 or about 10 breakpoints. In the case where a double-stranded polynucleotide comprises multiple breakpoints, at least one breakpoint can be random, and at least one breakpoint can be at the target position. Multiple breakpoints can comprise one or two breakpoints at the single-stranded region of the telomere site, and one or more breakpoints along the length of the chromosome. One or more breakpoints along the length of the chromosome can be naturally occurring or artificially introduced.

[0047] The double-stranded polynucleotide comprising at least one single-strand break point can be a natural polynucleotide comprising one or more single-strand break points. Therefore, in one embodiment, breakpoint is naturally occurring. The double-stranded polynucleotide can have at least one artificially introduced single-strand break point. DNA damage may cause natural or artificial breakpoints. Breakpoints can be introduced at random points in double-stranded polynucleotides, for example, by mechanical force or by radiation. Mechanical force can be, for example, shearing force, which occurs when, for example, pipetting double-stranded polynucleotides. Breakpoints can be introduced at random positions in double-stranded polynucleotides by enzymes such as DNase 1, S1 nuclease or formamidopyrimidine [fapy]-DNA glycosylase (FPG).

[0048] Breakpoints can be introduced at the target point in a double-stranded polynucleotide. For example, enzymes can be used to introduce single-strand breaks at the target position in a polynucleotide. Examples of suitable enzymes include Cas9 nickases and nicking endonucleases.

[0049] The method may further comprise generating a double-stranded polynucleotide comprising at least one single-strand break. A double-stranded polynucleotide comprising at least one single-strand break can be generated by introducing the single-strand break using any of the methods described above. For example, a double-stranded polynucleotide comprising at least one single-strand break within its polynucleotide sequence can be generated by contacting the double-stranded polynucleotide with an enzyme that introduces single-strand breaks into the polynucleotide.

[0050] To introduce breakpoints into a double-stranded polynucleotide, the double-stranded polynucleotide can be contacted with the enzyme for about 10 seconds to about 1 hour, for example, 15, 20, 30, 40, or 50 seconds up to about 30 minutes, 20 minutes, 10 minutes, 5 minutes, or 1 minute. A skilled person will be able to determine the exact time based on the enzyme used, and particularly in the case where the enzyme introduces breakpoints at random positions, based on the desired number of breakpoints. Suitable reaction conditions for enzyme activity can be readily determined by one skilled in the art.

[0051] Also provided is a method of providing a double-stranded polynucleotide comprising single-stranded polynucleotide regions flanked by double-stranded polynucleotide regions; and attaching an adaptor to the exposed single-stranded polynucleotide sequence segment.

[0052] The single-stranded polynucleotide region may be an exposed single-stranded region naturally present in a chromosome, such as a single-stranded region at the end of a chromosome within a telomere.

[0053] The single-stranded region is an exposed single-stranded polynucleotide sequence segment usually flanked by a double-stranded polynucleotide region. The single-stranded region usually has a length of at least about 3 nucleotides, for example, a length of at least about 4, 5, 6, 7, 8, 9 or 10 nucleotides. The upper limit of the length of the single-stranded region is not particularly limited. However, for characterization methods, when the length of the single-stranded region is equal to or roughly equal to the adapter region that hybridizes to the single-stranded region, such as when 1, 2, 3, 4, 5 or 6 nucleotides longer than the adapter region, a larger coverage of polynucleotides can be generally achieved. Therefore, the single-stranded region can usually have a length of up to about 6, 10, 15 or 20 nucleotides. The length of the single-stranded region can be controlled by the reaction conditions used for step (b), such as exonuclease has active temperature and / or time. For example, the double-stranded polynucleotide comprising at least one single-strand break point can be contacted with an endonuclease for about 10 seconds to about 1 hour, for example, about 15, 20 or 30 seconds to about 30 minutes, 20 minutes, 10 minutes, 5 minutes and 1 minute. Determining an appropriate time period is within the routine skills of those skilled in the art.

[0054] In some embodiments, exonuclease digestion can be performed in the presence of a surfactant. Examples of suitable surfactants include Brj, Tween 20, and Triton X-100.

[0055] Exonucleases are any enzymes having exonuclease activity. Exonucleases can act in either direction. Exonucleases can be 3'-5' exonucleases or 5'-3' exonucleases. Exonucleases can have both 3'-5' exonuclease activity and 5'-3' exonuclease activity. Preferably, the exonuclease is a 3'-5' exonuclease. Any exonuclease or enzyme having exonuclease activity can be used. Examples of suitable exonucleases include exonuclease III, DNA polymerase I, T4 DNA polymerase, and T7 DNA polymerase. Other examples of exonucleases include the following polymerases having 3'-5' exonuclease activity: Deep VentR TM DNA polymerase, Escherichia coli DNA polymerase I, TaqDNA polymerase, polymerase, phi29 DNA polymerase, High-fidelity DNA polymerase, DNA polymerase, Taq polymerase, T4 DNA polymerase, T7 DNA polymerase and DNA polymerases. Among these enzymes, Taq polymerase and E. coli DNA polymerase I have both 3'-5' exonuclease activity and 5'-3' exonuclease activity. Adapters are typically attached to single-stranded regions by hybridization.

[0056] Methods for repairing single-stranded gaps in double-stranded constructs are known in the art. For example, gaps can be repaired using a polymerase (such as DNA polymerase) and a ligase (such as DNA ligase). Alternatively, gaps can be repaired using random oligonucleotides of sufficient length to bridge the gap and a ligase.

[0057] After the adaptor has hybridized to the single-stranded region to close the gap between the 3' end of the adaptor and the 5' end of the flanking double-stranded DNA, a polymerase that acts in the 5' to 3' direction can be used to extend the end of the adaptor. Suitable polymerases that act in the 5' to 3' direction include Taq polymerase (e.g., Taq DNA polymerase), Escherichia coli DNA polymerase I, Klenow fragment, Bst DNA polymerase (e.g., full-length Bst DNA polymerase or large fragment Bst DNA polymerase), M-MuLV reverse transcriptase, phi29 polymerase, T4 DNA polymerase, T7 DNA polymerase, Vent and Deep Vent DNA polymerase (e.g., DNA polymerase, (exo-)DNA polymerase, Deep VentR TM DNA polymerase or Deep VentR TM Other examples of (exo-) DNA polymerases include Bsu DNA polymerase (e.g., large fragment), Hot start flexible DNA polymerase*, High-fidelity DNA polymerase*, Hot-start DNA polymerases, Sulfolobus DNA polymerase IV, and Therminator TM DNA polymerase. In some embodiments, the polymerase can have a 5' exonuclease activity that destroys the leading strand (e.g., Bst DNA polymerase, E. coli DNA polymerase I, Taq polymerase (e.g., In some embodiments, the polymerase does not have strand displacement activity (eg, T4 DNA polymerase or Sulfolobus DNA polymerase IV), thereby allowing ligation to the 5' end of the leading strand.

[0058] The method may further comprise covalently attaching an adaptor to the double-stranded polynucleotide. Typically, the 3' terminal nucleotide of the adaptor is covalently attached to the 5' terminal nucleotide adjacent to the single-stranded region. Covalent attachment can be achieved by any suitable means, such as by ligation or click chemistry.

[0059] In some embodiments, the method of the present invention can be used to attach the adapter covalently, for example, to a double-stranded polynucleotide. For example, a ligase such as T4 DNA ligase can be added to the sample to attach the adapter to the double-stranded polynucleotide. The adapter can be attached to the double-stranded polynucleotide in the absence of ATP or using γ-S-ATP (ATPγS) instead of ATP. The example of an operable ligase includes T4 DNA ligase, Escherichia coli DNA ligase, Taq DNA ligase, Tma DNA ligase, and 9°N DNA ligase. The adapter can be attached using a topoisomerase. A topoisomerase can be, for example, a member of any one of the Moiety Classification (EC) groups 5.99.1.2 and 5.99.1.3.

[0060] Also provided is a method for preparing a double-stranded polynucleotide for sequencing, the method comprising:

[0061] (a) providing a double-stranded polynucleotide comprising a single-strand break;

[0062] (b) contacting the double-stranded polynucleotide with an enzyme having exonuclease activity to form a single-stranded region starting from the break point; and

[0063] (C)(i) hybridizing a sequencing adaptor comprising a single-stranded portion to the single-stranded region and covalently attaching the 3' end of the sequencing adaptor to the exposed 5' end of the top strand of the double-stranded region adjacent to the single-stranded region; or

[0064] (ii) hybridizing an intermediate adapter to the single-stranded region and covalently attaching the 3' end of the intermediate adapter to the exposed 5' end of the top strand of the double-stranded region adjacent to the single-stranded region, and then covalently attaching a sequencing adapter to the intermediate adapter. The sequencing adapter can be attached to the intermediate adapter by hybridizing the single-stranded region of the sequencing adapter to the 5' portion of the intermediate adapter and covalently attaching the sequencing adapter to the intermediate adapter. Preferably, the 3' end of the sequencing adapter or the 3' end of the top strand of the sequencing adapter is covalently attached to the 5' end of the intermediate adapter.

[0065] Step (c) of the method may further comprise filling the gap between the 3' end of the sequencing adaptor or the intermediate adaptor and the 5' end of the top strand of the double-stranded region prior to covalent attachment. This may be achieved, for example, using a polymerase.

[0066] Methods for attaching adapters to breakpoints within double-stranded polynucleotides produce polynucleotides for further manipulation and characterization. The polynucleotides produced by the methods described generally comprise a 5' end adapter connected to the target polynucleotide. For example, a DNA molecule is provided herein comprising an adapter attached to a telomere, wherein the adapter comprises a 5' end and a 3' end, wherein the 3' end hybridizes with DNA.

[0067] adapter

[0068] An adaptor typically comprises a 3' portion or region and a 5' portion or region. The 3' portion of the adaptor comprises a 3' single-stranded polynucleotide sequence segment that hybridizes to the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide.

[0069] The 3' single-stranded polynucleotide sequence segment in the adaptor can be from about 3 to about 15 nucleotides in length or more, eg, from about 4, 5, 6, or 7 to about 12, 10, or 8 nucleotides in length.

[0070] In one embodiment, the 3' single-stranded polynucleotide sequence segment in the adaptor comprises universal nucleotides that can hybridize to any polynucleotide sequence in the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide. This is typically the case when the breakpoint is at a random position within the double-stranded polynucleotide.

[0071] In one embodiment, the 3' single-stranded polynucleotide sequence segment in the adapter comprises a sequence that is at least about 80% complementary, such as at least about 90% or 95%, to the polynucleotide sequence in the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide. For example, the 3' single-stranded polynucleotide sequence segment in the adapter may comprise a sequence that is completely complementary to the polynucleotide sequence in the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide. This may be the case when the breakpoint is at the target position within the double-stranded polynucleotide. However, when the breakpoint is at the target position within the double-stranded polynucleotide, an adapter comprising a universal sequence in the 3' portion may be used.

[0072] In one embodiment, the 3' single-stranded polynucleotide sequence segment in the adapter hybridizes with the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide, thereby causing the nucleotide at the 3' end of the 3' portion of the adapter to hybridize with the nucleotide at the 5' end of the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide. This results in the 3' end of the adapter being adjacent to the 5' end of the top strand of the double-stranded region of the target polynucleotide. The 3' end of the adapter can then be directly connected to the 5' end of the top strand of the target polynucleotide.

[0073] The length of the 3' single-stranded polynucleotide sequence segment in the adapter can be the same as the length of the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide, or the length of the 3' single-stranded polynucleotide sequence segment in the adapter can be shorter than the length of the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide.

[0074] The 5' portion of the adaptor does not hybridize with the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide. The 5' portion can be double-stranded or single-stranded. Typically, the 5' portion is single-stranded or comprises a single-stranded region. The single-stranded region in the 5' portion of the adaptor can, for example, be used to attach the adaptor to another polypeptide, such as a sequencing adaptor or other adaptor or primer. The 5' portion can be designed to facilitate sequencing of the target polynucleotide. For example, the adaptor that hybridizes with the single-stranded sequence segment in the target polynucleotide can be a sequencing adaptor, such as a sequencing adaptor for nanopore sequencing, or can be an intermediate adaptor for attaching a sequencing adaptor.

[0075] The 5' portion can have a length of about 3 to about 45 nucleotides, such as about 6, 8, 10 or 15 to about 30, 25 or 20 nucleotides. The single-stranded region of the 5' portion can be the entire 5' portion, which is typically at least about 3, 6, 8, 10 or 15 nucleotides in length.

[0076] Adaptors typically have a length of about 10 to about 50 nucleotides, such as about 15 to about 40 nucleotides or about 20 to about 30 nucleotides.

[0077] Adaptors are typically polynucleotides and can comprise DNA, RNA, modified DNA (e.g., basic DNA), RNA, PNA, LNA, BNA, and / or PEG. Adaptors preferably comprise single-stranded and / or double-stranded DNA and / or RNA.

[0078] The adaptor may further comprise a chemical group for attaching the 5' portion of the adaptor to another adaptor (e.g., click chemistry) and / or a chemical group for attaching the 3' portion of the adaptor to a double-stranded polynucleotide (e.g., click chemistry). Thus, the adaptor may comprise a chemical group at either the 5' end or the 3' end. The chemical group at the 3' end may be the same as the chemical group at the 5' end, but is preferably different.

[0079] The adaptor may further comprise a reactive group in the 3' portion and / or in the 5' portion. The reactive group in the 3' portion may be used to covalently attach the adaptor to a double-stranded polynucleotide, and / or the reactive group in the 5' portion may be used to covalently attach the adaptor to another adaptor. The reactive group at the 5' end may be the same as or different from the reactive group at the 5' end.

[0080] Reactive groups can be used to connect fragments to overhangs using click chemistry. Click chemistry is a term first introduced by Kolb et al. in 2001 to describe an expanding set of powerful, selective and modular components that work reliably in both small-scale and large-scale applications (Kolb HC, Finn, MG, Sharpless KB, Click chemistry: diverse chemical function from a few good reactions, Angew. Chem. Int. Ed. 40 (2001) 2004-2021). They have defined a strict set of criteria for click chemistry, as shown below: "The reactions must be modular, broad in scope, very high in yield, produce only harmless byproducts that can be removed by non-chromatographic methods, and be stereospecific (but not necessarily enantioselective). Desired process features include simple reaction conditions (ideally, the process should be insensitive to oxygen and water), readily available starting materials and reagents, the use of no solvents or benign solvents (such as water) or easily removable solvents, and simple product isolation. Purification must be possible by non-chromatographic methods such as crystallization or distillation, if necessary, and the product must be stable under physiological conditions."

[0081] Suitable examples of click chemistry include, but are not limited to, the following:

[0082] (a) A copper-free variant of the 1,3-dipolar cycloaddition reaction in which an azide reacts with an alkyne under strain, such as in a cyclooctane ring;

[0083] (b) reaction of an oxygen nucleophile on one linker with an epoxide or aziridine reactive moiety on the other linker; and

[0084] (c) Staudinger ligation, in which the alkyne moiety can be replaced by an aryl phosphine, leading to a specific reaction with an azide to produce an amide bond.

[0085] Any reactive group may be used in the present invention. The reactive group may be a group suitable for click chemistry. The reactive group may be any of those disclosed in WO 2010 / 086602, specifically, any of those disclosed in Table 4 of said application. A specific example of a reactive group for click chemistry is the commercially available DBCO (Dibenzoryclooctyl).

[0086] In one embodiment, the adapter attached to the double-stranded polynucleotide can be a sequencing adapter. The sequencing adapter can be connected to the double-stranded polynucleotide. The adapter can be connected to the double-stranded polynucleotide in the absence of ATP or using γ-S-ATP (ATPγS) instead of ATP. Preferably, the adapter is connected to the polynucleotide in the absence of ATP, wherein the adapter is a sequencing adapter combined with a nucleic acid processing enzyme. In this embodiment, the sequencing adapter can include a single-stranded portion that hybridizes to a single-stranded polynucleotide sequence segment in the double-stranded polynucleotide.

[0087] Sequencing adapters are known in the art. Sequencing adapters can be modified for use in the present invention by adding a single-stranded region for hybridization with an exposed single-stranded sequence segment in the target polynucleotide. The single-stranded region is typically at the end of the 3' end of one strand of the adapter. The sequencing adapter can be a Y adapter as described below.

[0088] Add sequencing adapters

[0089] In one embodiment, the method further comprises attaching a sequencing adaptor to the 5' portion of the adaptor.Thus, the adaptor can serve as a first adaptor or an intermediate adaptor.

[0090] The sequencing adapter can comprise a single-stranded portion that hybridizes to the single-stranded polynucleotide sequence segment in the 5' portion of the first adapter.

[0091] After hybridization, the sequencing adapter can be covalently attached to the adapter using a ligase or by click chemistry. The ligase can be, for example, T4 DNA ligase, E. coli DNA ligase, Taq DNA ligase, Tma DNA ligase, and 9°N DNA ligase. The adapter can be attached using a topoisomerase. The topoisomerase can be, for example, a member of any of the partial classification (EC) groups 5.99.1.2 and 5.99.1.3.

[0092] The sequencing adapter can comprise a single-stranded portion that hybridizes to all or part of the 5' region of the adapter attached to the target polynucleotide (ie, the intermediate adapter). In this embodiment, the sequencing adapter is typically hybridized to the intermediate adapter prior to covalent attachment.

[0093] The sequencing adapter can be attached to the adapter after the adapter has been attached to the double-stranded polynucleotide. Thus, the method can comprise the steps of attaching the adapter to the exposed single-stranded polynucleotide sequence segments in the double-stranded polynucleotide, typically by hybridization and ligation, and the sequential steps of attaching the sequencing adapter to the adapter. Thus, the (intermediate) adapter can be added to the sample before the sequencing adapter is added to the sample.

[0094] The sequencing adapter can be attached to the adapter before the adapter is attached to the double-stranded polynucleotide. Alternatively, the method can comprise attaching the adapter to the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide and attaching the sequencing adapter to the 5' single-stranded polynucleotide sequence segment in the adapter in a single step. Thus, the sequencing adapter and the (intermediate) adapter can be added to the sample simultaneously.

[0095] Add primers

[0096] In one embodiment, the method further comprises using at least one primer that hybridizes to the 5' portion of the adapter to amplify a portion of the double-stranded polynucleotide. The primer can hybridize to all or part of the 5' portion of the adapter. Methods for designing suitable primers are well known in the art. The region of the double-stranded polynucleotide attached to the adapter can then be amplified, for example, by an isothermal amplification method. Suitable amplification reactions, such as isothermal amplification methods, are known in the art.

[0097] Thus, provided herein is a method of amplifying a polynucleotide, comprising attaching an adaptor to the polynucleotide by the methods disclosed herein; hybridizing a primer to the adaptor attached to the polynucleotide; and performing an amplification reaction.

[0098] Reagent test kit

[0099] Also provided is a kit for attaching an adapter to a breakpoint in a double-stranded polynucleotide. The kit comprises an enzyme having exonuclease activity and an adapter, wherein the adapter comprises a 3' portion and a 5' portion, and the 3' portion comprises a universal sequence of 3 to 15 nucleotides. The universal sequence is capable of hybridizing to any single-stranded polynucleotide sequence. The adapter may have any of the characteristics described above.

[0100] The kit may further comprise a polymerase and / or a ligase.

[0101] The kit may further comprise a device for introducing breakpoints into the double-stranded polynucleotide. For example, the kit may comprise an enzyme for introducing random breakpoints into the double-stranded polynucleotide, such as DNase I, S1 nuclease, and / or FPG. For example, the kit may comprise an enzyme for introducing targeted breakpoints into the double-stranded polynucleotide, such as Cas9 nickase and / or nicking endonuclease.

[0102] The kit may further comprise a surfactant, such as Brij, Triton or Tween.

[0103] The kit may further include a sequencing adapter. The sequencing adapter is capable of hybridizing with the 5' portion of the first adapter. The sequencing adapter may include a single-stranded portion having a sequence complementary to the single-stranded region of the 5' portion of the first adapter or a sequence at least 80% identical to the complementary sequence of the single-stranded region of the 5' portion of the first adapter. In one embodiment, the sequencing adapter may be a Y-adapter. Y-adapters for nanopore sequencing are described in the art. The Y-adapter typically includes a 5' leader sequence, a double-stranded region, and a 3' single-stranded region attached or attachable to a membrane tether on a chain opposite to the leader sequence, comprising a single-stranded polynucleotide. Membrane tethers are described in the art and may be, for example, lipids, fatty acids, sterols, carbon nanotubes, polypeptides, proteins, or amino acids, such as cholesterol, palmitate, or tocopherol. The membrane tether may include thiol, biotin, or a surfactant. Suitable membrane tethers and methods for attaching membrane tethers to adapters are disclosed in WO 2012 / 164270. The membrane tether can be attached directly to the single-stranded region, or can be attached to a polynucleotide that hybridizes to a portion of the single-stranded region. As disclosed in WO 2014 / 135838, a nucleic acid processing polynucleotide (typically a helicase) can be pre-bound to the 5' leader sequence of the Y-adapter and parked at the spacer.

[0104] In addition, the Y adaptor comprises a single-stranded region at the 5' end of the chain opposite to the leader sequence that is capable of hybridizing to the (middle) adaptor attached to the double-stranded polynucleotide. This single-stranded region at the 5' end of the chain opposite to the leader sequence can, for example, have a length of about 3 to about 15 nucleotides, such as about 6, 8, 10 or 12 nucleotides.

[0105] The kit may include a primer. The primer may have a sequence that is complementary to the 5' region of the adaptor or a sequence that is at least 80% identical to the complementary sequence of the 5' region of the adaptor.

[0106] Test kit of the present invention can additionally comprise one or more other reagents or instruments that enable any one of the embodiments mentioned above to be carried out.Such reagent or instrument include one or more of the following: suitable buffer (aqueous solution), a device for obtaining a sample from a subject (such as a container or an instrument comprising a needle), a device for amplifying and / or expressing polynucleotides, a film as defined above or voltage clamp or patch clamp equipment. Reagent can be present in the test kit in a dry state so that the fluid sample resuspends the reagent. Test kit can also optionally comprise the instructions for enabling the test kit to be used for attaching an adaptor to the breakpoint in a double-stranded polynucleotide or the details of which patient can be used for the method. Test kit can optionally comprise nucleotides.

[0107] Characterization methods

[0108] A method for characterizing a polynucleotide, comprising: attaching an adaptor to a polynucleotide by a method disclosed herein; attaching a sequencing adaptor to the adaptor attached to the polynucleotide; contacting the adaptorized polynucleotide with a nanopore, thereby causing the polynucleotide to translocate through the nanopore; and taking one or more measurements as the polynucleotide moves relative to the nanopore, wherein the measurements are indicative of one or more characteristics of the polynucleotide, and thereby characterizing the polynucleotide.

[0109] Any number of polynucleotides can be studied. For example, the methods of the present invention can involve characterizing two or more polynucleotides, such as 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 20 or more, 30 or more, 50 or more, 100 or more, 500 or more, or 1,000 or more polynucleotides. The polynucleotides can be naturally occurring or artificial.

[0110] The method may involve measuring two, three, four, or five or more characteristics of each polynucleotide. The one or more characteristics are preferably selected from: (i) the length of the polynucleotide, (ii) the identity of the polynucleotide, (iii) the sequence of the polynucleotide, (iv) the secondary structure of the polynucleotide, and (v) whether the polynucleotide is modified.

[0111] The method can be performed using any sequencing device, including, for example, a device comprising a nanopore (e.g., a transmembrane protein pore or a solid-state pore). For example, the device can comprise a chamber divided into a cis segment and a trans segment, the chamber comprising an aqueous solution. A skilled artisan can readily select a suitable device from those available in the art.

[0112] Also provided is a method for sequencing a polynucleotide, the method comprising attaching an adapter to the polynucleotide by the method disclosed herein, wherein the adapter is a sequencing adapter or the adapter is an intermediate adapter, and the method further comprises attaching a sequencing adapter to the intermediate adapter and sequencing the polynucleotide.

[0113] Any method can be used for sequencing. Typically, next generation sequencing methods are used, such as any method for overall or single molecule sequencing. Examples of suitable sequencing methods include standard sequencing by synthesis (SBS) sequencing methods, such as Genia, PacBio, Illumina, Helicos, Solid or 454 methods; and single molecule sequencing methods, which can be direct methods or indirect methods. These methods can use nanopores, such as the sequencing technology using Oxford Nanopore Technologies; or by any other known methods, such as AFM, hybridization sequencing or Stratos expansion sequencing. The sequencing adapters used in these methods are known in the art.

[0114] sample

[0115] The sample may be any suitable sample comprising polynucleotides. The polynucleotides may, for example, comprise products of a PCR reaction, genomic DNA, products of endonuclease digestion and / or a DNA library.

[0116] The sample can be a biological sample. The present invention can be performed on samples obtained or extracted from any organism or microorganism. The organism or microorganism is typically an archaeon, a prokaryotic, or a eukaryotic organism, and typically belongs to one of the following five kingdoms: Plants, Animals, Fungi, Prokaryotes, and Protista. The present invention can be performed in vitro on samples obtained or extracted from any virus.

[0117] The sample is preferably a fluid sample. The sample typically comprises a body fluid. The body fluid can be obtained from a human or an animal. The human or animal may be suffering from a disease, suspected of having a disease, or at risk of a disease. The sample can be urine, lymph, saliva, mucus, semen, or amniotic fluid, but is preferably whole blood, plasma, or serum. Typically, the sample is derived from a human, but alternatively, it can be from another mammal, for example, from a commercially farmed animal such as a horse, cattle, sheep, or pig, or alternatively, it can be a pet such as a cat or dog.

[0118] Alternatively, plant-derived samples are typically obtained from cash crops such as cereals, legumes, fruits or vegetables, for example wheat, barley, oats, rapeseed, corn, soybeans, rice, bananas, apples, tomatoes, potatoes, grapes, tobacco, beans, lentils, sugarcane, cocoa, cotton, tea or coffee.

[0119] The sample may be a non-biological sample. The non-biological sample is preferably a fluid sample. Examples of non-biological samples include surgical fluid; water, such as drinking water, seawater, or river water; and reagents used in laboratory tests.

[0120] The sample may be processed prior to performing the method, for example by centrifugation or by passing it through a membrane that filters out unwanted molecules or cells (e.g., red blood cells). The method may be performed on the sample immediately after collection. The sample may also be stored, preferably below -70°C, prior to the method.

[0121] The sample may comprise genomic DNA. The genomic DNA may be fragmented. Preferably, the genomic DNA is not fragmented. The genomic DNA may be from any organism. The genomic DNA may be human genomic DNA.

[0122] Universal nucleotides

[0123] Universal nucleotides are nucleotides that will hybridize to some extent with all nucleotides in the template polynucleotide. Universal nucleotides are preferably nucleotides that will hybridize to some extent with nucleotides comprising nucleoside adenine (A), thymine (T), uracil (U), guanine (G) and cytosine (C). The intensity of hybridization of universal nucleotides to some nucleotides may be greater than the intensity of hybridization to other nucleotides. For example, the universal nucleotide (I) comprising nucleoside 2'-deoxyinosine will show a preferential pairing order of IC>IA>IG approximately=IT. It is only necessary for the universal nucleotides used in the adapter to hybridize to all nucleotides in the double-stranded polynucleotide. For example, when the double-stranded polynucleotide is DNA, the universal nucleotides in the adapter only need to combine A, C, G and T.

[0124] The universal nucleotide may comprise one of the following nucleobases: hypoxanthine, 4-nitroindole, 5-nitroindole, 6-nitroindole, 3-nitropyrrole, nitroimidazole, 4-nitropyrazole, 4-nitrobenzimidazole, 5-nitroindazole, 4-aminobenzimidazole or phenyl (C6-aromatic ring). The universal nucleotide more preferably comprises one of the following nucleosides: 2'-deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 7-deaza-inosine, 2-aza-deoxyinosine, 2-aza-inosine, 4-nitroindole 2'-deoxyribonucleoside, 4-nitroindole ribonucleoside, 5-nitroindole 2'-deoxyribonucleoside, 5-nitroindole ribonucleoside, 6-nitroindole 2'-deoxyribonucleoside, 6-nitroindole ribonucleoside, 3-nitropyrrole 2'-deoxyribonucleoside, 3-nitropyrrole ribonucleoside. glycosides, acyclic sugar analogs of hypoxanthine, nitroimidazole 2'-deoxyribonucleoside, nitroimidazole ribonucleoside, 4-nitropyrazole 2'-deoxyribonucleoside, 4-nitropyrazole ribonucleoside, 4-nitrobenzimidazole 2'-deoxyribonucleoside, 4-nitrobenzimidazole ribonucleoside, 5-nitroindazole 2'-deoxyribonucleoside, 5-nitroindazole ribonucleoside, 4-aminobenzimidazole 2'-deoxyribonucleoside, 4-aminobenzimidazole ribonucleoside, phenyl C-ribonucleoside or phenyl C-2'-deoxyribosyl nucleoside.

[0125] The following examples illustrate the method.

[0126] Example 1: Attachment of adapters to natural DNA in E. coli genomic DNA using a single enzyme (DNA polymerase I) approach Natural incision

[0127] Eight parallel 25 μl reactions containing 1 μg of genomic DNA and 10 units of DNA polymerase I (New England Biolabs) were set up in 1× NEB buffer 2, 0.05% Brij surfactant (Sigma-Aldrich) and incubated at room temperature for 10 minutes. Heat-denatured oligo hexamer with rapid attachment chemistry (5′-2GCTTGGGTGTTTAACC5555ACTTACGCGTGCGCAGGCCG6NNN*N*N*N-3′, where 2=DBCO (click chemistry reactive group), 5=nitroindole (universal base), 6=HEG (spacer), and *=phosphorothioate bond) (ATD Bio) was added to a final concentration of 68 μM, and dNTPs (New England Biolabs) were added to a final concentration of 68 mM. The sample was incubated at room temperature for 10 minutes, followed by addition of 5 μl NebNext Quick ligase, 10 μl 5xNebNext Quick ligase buffer (New England Biolabs), and made up to 50 μl with nuclease-free water. The sample was incubated at room temperature for 15 minutes, and then 20 units of exonuclease I (New England Biolabs) were added to each reaction, and incubated at room temperature for 10 minutes. 0.4x Agencourt Ampure XP (Beckman Coulter) beads were purified with 1x70% ethanol washing solution and 1x109 washing buffer (Oxford Nanopore Technologies), and DNA was eluted from beads at room temperature in a buffer solution containing 100mM NaCl and 20mM Tris pH 8 for 10 minutes. Individual reactions were collected and thermally denatured at 85°C for 3 minutes, then rapidly cooled on ice for 2 minutes. 40 μl of RAP adapter (Oxford Nanopore Technologies) was added and incubated for 20 minutes at room temperature with gentle mixing. 0.4X Agencourt Ampure XP bead cleanup was performed according to the manufacturer's instructions, but the ethanol wash was replaced with 109 wash buffer (Oxford Nanopore Technologies). DNA was eluted in 24.75 of 109 elution buffer and combined with 37.5 μl of SQB, 11.75 of LLB, and 1 μl of SQT (Oxford Nanopore Technologies) and then loaded onto a 9.4.1 Oxford Nanopore flow cell according to the manufacturer's instructions.

[0128] The length of the sequenced polynucleotides is shown in Figure 2 middle.

[0129] Example 2: Using a single enzyme (DNA polymerase I) approach and gap filling (Sulfolobus DNA polymerase IV Attaching adapters to natural nicks in Saccharomyces cerevisiae genomic DNA

[0130] Eight parallel 25 μl reactions containing 1 μg of genomic DNA and 10 units of DNA polymerase I (New England Biolabs) were set up in 1× NEB buffer 2, 0.05% Brij surfactant (Sigma-Aldrich) and incubated at room temperature for 10 minutes. Heat-denatured oligo hexamer with rapid attachment chemistry (5′-2GCTTGGGTGTTTAACC5555ACTTACGCGTGCGCAGGCCG6NNN*N*N*N-3′, where 2=DBCO, 5=nitroindole, 6=HEG, and *=phosphorothioate bond) (ATD Bio) was added to a final concentration of 68 μM, and dNTPs (New England Biolabs) were added to a final concentration of 68 mM, and 4 units of Sulfolobus DNA polymerase IV (New England Biolabs) were added. The samples were incubated at room temperature for 10 minutes, after which 5 μl of NebNext Quick Ligase, 10 μl of 5x NebNextQuick Ligase Buffer (New England Biolabs) were added and made up to 50 μl with nuclease-free water. The samples were incubated at room temperature for 15 minutes, after which 20 units of Exonuclease I (New England Biolabs) were added to each reaction and incubated at room temperature for 10 minutes. 0.4x Agencourt Ampure XP (Beckman Coulter) beads were cleaned with 1x70% ethanol wash and 1x109 wash buffer (Oxford Nanopore Technologies), and DNA was eluted from the beads in 80 μl of buffer containing 100 mM NaCl and 20 mM Tris pH 8 for 10 minutes at room temperature. Individual reactions were pooled and heat denatured at 85°C for 3 minutes, followed by rapid cooling on ice for 2 minutes. 40 μl of RAP adapters (Oxford Nanopore Technologies) were added and incubated at room temperature for 20 minutes with gentle mixing. A 0.4X Agencourt Ampure XP bead cleanup was performed according to the manufacturer's instructions, except that the ethanol wash was replaced with 109 wash buffer (Oxford Nanopore Technologies). DNA was eluted in 24.75 of 109 elution buffer and combined with 37.5 μl of SQB, 11.75 of LLB, and 1 μl of SQT (Oxford Nanopore Technologies) before loading onto a 9.4.1 Oxford Nanopore flow cell according to the manufacturer's instructions.

[0131] The length of the sequenced polynucleotides is shown in Figure 3 middle. Figure 5 It is shown that some reads start within the telomeric region of the chromosome.

[0132] Example 3: Attachment of adapters to E. coli using a dual enzyme (DNA polymerase I and exonuclease III) approach Natural nicks in genomic DNA

[0133] Eight parallel 25 μl reactions containing 1 μg of genomic DNA and 100 units of exonuclease III (New England Biolabs) were set up in 1x NEB buffer 2, 0.05% Brij surfactant (Sigma-Aldrich) and incubated at room temperature for 45 seconds. The reaction was terminated by adding ETDA (Sigma-Aldrich) to a final concentration of 5 mM. The exonuclease III was then heat-inactivated at 70°C for 20 minutes. Heat-denatured oligohexamer with rapid attachment chemistry (5'-2GCTTGGGTGTTTAACC5555ACTTACGCGTGCGCAGGCCG6NNN*N*N*N-3', where 2 = DBCO, 5 = nitroindole, 6 = HEG, and * = phosphorothioate bond) (ATD Bio) was added to a final concentration of 68 μM, and dNTPs (New England Biolabs) were added to a final concentration of 68 mM, and 10 units of DNA polymerase I (New England Biolabs) were added. The samples were incubated at room temperature for 10 minutes, after which 5 μl of NebNext Quick Ligase, 10 μl of 5x NebNext Quick Ligase Buffer (New England Biolabs) were added and made up to 50 μl with nuclease-free water. The samples were incubated at room temperature for 15 minutes, and then 20 units of Exonuclease I (New England Biolabs) were added to each reaction and incubated at room temperature for 10 minutes. 0.4x Agencourt Ampure XP (Beckman Coulter) beads were cleaned up with 1x70% ethanol wash and 1x10 wash buffer (Oxford Nanopore Technologies), and DNA was eluted from the beads in 80 μl of 100 mM NaCl and 20 mM Tris pH 8 buffer at room temperature for 10 minutes. Individual reactions were pooled and heat denatured at 85°C for 3 minutes, followed by rapid cooling on ice for 2 minutes. 40 μl of RAP adapter (Oxford Nanopore Technologies) were added and incubated at room temperature for 20 minutes with gentle mixing. 0.4x Agencourt Ampure XP bead cleanup was performed according to the manufacturer's instructions, but the ethanol wash was replaced with 10 wash buffer (Oxford Nanopore Technologies). DNA was eluted in 24.75 of 109 elution buffer and combined with 37.5 μl of SQB, 11.75 of LLB and 1 μl of SQT (Oxford Nanopore Technologies) and then loaded onto a 9.4.1 Oxford Nanopore flow cell according to the manufacturer's instructions.

[0134] Figure 6The proportional abundance of read lengths of different sequence lengths is shown compared to the number of reads of the same length obtained using the commercially available SQK-LSK108 sequencing kit (Oxford Nanopore Technologies). When using the method of the present invention, the number of shorter reads is reduced, while the number of longer reads is increased relative to prior art methods.

[0135] Example 4: Using surfactants

[0136] The method of Example 3 was performed exactly as described above in the presence of the surfactants Brij (3) (Sigma-Aldrich), Tween 20 (Sigma-Aldrich), Triton X-100 (Sigma-Aldrich), or nuclease-free water. The final concentration of each surfactant was 0.05%.

[0137] The results are shown in Figure 7 The surfactant Brij showed a modest increase in read length compared to the other surfactants and the control.

[0138] Example 5: Attachment of adaptors to nicks induced in E. coli genomic DNA

[0139] The method of Example 1 was repeated using E. coli DNA treated with formamidopyrimidine [fapy]-DNA glycosylase (FPG) (FPG introduces nicks at damaged bases), and the results were compared with those when the sequencing library was prepared using untreated E. coli DNA. The results are shown in Figure 8 When FPG-treated DNA (where the number of nicks is high) is used to prepare the library, the read length is reduced.

[0140] Example 6: Attaching adapters to nicks introduced using restriction nicking enzymes

[0141] A single nick was introduced into the 3221 bp plasmid using the nicking restriction endonuclease Nt.BspQI (NEB). (Promega). The nicking endonuclease cleaves the DNA phosphate backbone on one strand at a base downstream of the recognition site (GCTCTTCN^). A 3'-5' exonuclease then cuts back from this nick site, creating a single-stranded base (ssDNA) sequence.

[0142] In this experiment, the exonuclease activity of three different exonucleases was compared: exonuclease III (NEB), T4 DNA polymerase (NEB), and T7 DNA polymerase (NEB). After the ssDNA sequence segment was exposed, an intermediate DNA adapter complementary to the known site was hybridized and ligated to the 5' end of the exposed nicking site. At the 5' end of the intermediate adapter, there was an overhang site specific for the sequencing adapter. The ligated products were then sequenced using the MinION from Oxford Nanopore Technologies, and the read lengths were compared.

[0143] Figure 9 The read lengths for the three experiments are plotted, with T7 DNA polymerase providing the shortest reads, followed by Exonuclease III, and T4 DNA polymerase producing the longest reads. Read lengths can be used to infer the exonuclease activity of the three enzymes, as reads can only initiate from the site of the Nt.BspQI-induced nick, and alignment with the reference sequence confirms this.

[0144] Example 7: Attaching adapters to nicks introduced using restriction nicking enzymes

[0145] A single nick was introduced into DNA isolated from bacteriophage lambda (NEB) using a nicking mutant nuclease variant of Cas9 (D10A) (NEB), which is 48,502 base pairs long. The nicking enzyme specifically uses a guide RNA complementary to a site with a 3'NGG protospacer adjacent motif (PAM) to cleave the DNA phosphate backbone on the opposite strand. Once the nick is induced, a sequence segment of single-stranded bases (ssDNA) is generated by cutting back from the nick site using a 3'-5' exonuclease.

[0146] In this experiment, exonuclease III (NEB) was used to generate ssDNA target sites. After the ssDNA sequence segment was exposed, an intermediate DNA adapter complementary to the known site was hybridized and ligated to the 5' end of the exposed nicking site. At the 5' end of the intermediate adapter, there was an overhang specific for the sequencing adapter, which was connected to the intermediate adapter. This ligated product was then sequenced using the Oxford Nanopore Technologies MinION, and the reads were aligned with a known reference of Lambda phage.

[0147] Figure 10 Depicts the accumulation of reads generated by sequencing run after alignment. It can be seen that the reads initiate from a single site at the 3' end of the reference, demonstrating that this approach allows for targeted sequencing and enrichment of the target.

Claims

1. A method of characterizing a polynucleotide comprising attaching an adaptor to the polynucleotide by the following steps: (a) providing a double-stranded polynucleotide comprising a single-strand break within its polynucleotide sequence; (b) contacting the double-stranded polynucleotide with an enzyme having exonuclease activity to form a single-stranded region starting at the break point; (c) hybridizing an adaptor to the single-stranded region, wherein The adaptor comprises a 5' single-stranded polynucleotide sequence segment that does not hybridize to the exposed single-stranded polynucleotide sequence segment in the double-stranded polynucleotide; (d) covalently attaching only the 3' end of the adaptor to the double-stranded region of the polynucleotide adjacent to the single-stranded region, wherein the 3' end is covalently attached to the free 5' end of the double-stranded region; and (e) attaching a sequencing adaptor to the 5' single-stranded polynucleotide sequence segment in the adaptor; contacting the adaptorized polynucleotide with a nanopore, thereby causing the polynucleotide to translocate through the nanopore; and making one or more measurements as the polynucleotide moves relative to the nanopore, wherein the measurements are indicative of one or more characteristics of the polynucleotide and thereby characterizing the polynucleotide.

2. The method of claim 1, wherein the breakpoint is naturally occurring.

3. The method of claim 2, wherein the break point is a break in the backbone of one strand of the double-stranded polynucleotide. The method of claim 2 , wherein the breakpoint is a single-stranded region within a telomere. The method of claim 1 , wherein the breaking points are introduced by mechanical force or radiation. The method of claim 1 , wherein the breakpoints are introduced using an enzyme.

7. The method of claim 1, wherein the breakpoints are at random positions in the polynucleotide. The method of claim 6 , wherein the enzyme is DNase 1 or S1 nuclease.

9. The method of claim 6, wherein the enzyme introduces a single-strand break at a target position in the polynucleotide.

10. The method of claim 9, wherein the enzyme is a Cas9 nickase or a nicking endonuclease.

11. The method of claim 1, further comprising initially generating the double-stranded polynucleotide comprising at least one single-strand break within its polynucleotide sequence.

12. The method of claim 11, wherein the double-stranded polynucleotide comprising at least one single-strand break within its polynucleotide sequence is produced by contacting the double-stranded polynucleotide with an enzyme that introduces a single-strand break into the polynucleotide. The method according to claim 12 , wherein the double-stranded polynucleotide is contacted with the enzyme for 10 seconds to 1 hour. The method of claim 1 , wherein the exonuclease activity is a 3′ to 5′ exonuclease activity. 15 . The method according to claim 14 , wherein the enzyme having exonuclease activity is exonuclease III, DNA polymerase I, T4 DNA polymerase or T7 DNA polymerase. The method according to claim 15 , wherein the double-stranded polynucleotide comprising at least one single-strand break is contacted with the enzyme having exonuclease activity for 10 seconds to 1 hour.

17. The method of claim 1, wherein the single-stranded region is at least 3 nucleotides in length. The method of claim 17 , wherein the single-stranded region is at least 6 nucleotides in length.

19. The method of claim 1, wherein the adaptor comprises a 3' single-stranded polynucleotide sequence segment that hybridizes to the single-stranded region in the double-stranded polynucleotide.

20. The method of claim 19, wherein the 3' single-stranded polynucleotide sequence segment in the adaptor hybridizes with the single-stranded region in the double-stranded polynucleotide such that the base at the 3' end of the 3' single-stranded polynucleotide sequence segment in the adaptor hybridizes with the base at the 5' single-stranded region in the double-stranded polynucleotide. 21 . The method of claim 19 or 20 , wherein the length of the 3′ single-stranded polynucleotide sequence segment in the adaptor is the same as the length of the single-stranded region in the double-stranded polynucleotide.

22. The method of claim 19, wherein the 3' single-stranded polynucleotide sequence segment in the adaptor is 3 to 15 nucleotides in length.

23. The method of claim 22, wherein the 3' single-stranded polynucleotide sequence segment in the adaptor is 5 to 8 nucleotides in length.

24. The method of claim 19, wherein the 3' single-stranded polynucleotide sequence segment in the adaptor comprises a universal base capable of hybridizing to any polynucleotide sequence in the single-stranded region in the double-stranded polynucleotide.

25. The method of claim 19, wherein the 3' single-stranded polynucleotide sequence segment in the adaptor comprises a sequence that is at least 80% complementary to a polynucleotide sequence in the single-stranded region in the double-stranded polynucleotide.

26. The method of claim 25, wherein the 3' single-stranded polynucleotide sequence segment in the adaptor comprises a sequence that is fully complementary to a polynucleotide sequence in the single-stranded region in the double-stranded polynucleotide.

27. The method of claim 1, further comprising covalently attaching the adaptor to the double-stranded polynucleotide.

28. The method of claim 27, wherein the adaptor is covalently attached to the double-stranded polynucleotide by ligation or click chemistry. The method of claim 28 , wherein the 3′ end of the adaptor is ligated to the 5′ terminal nucleotide adjacent to the single-stranded region.

30. The method of claim 28 or 29, wherein ligation is achieved using a ligase.

31. The method of claim 30, wherein the ligase is T4 DNA ligase.

32. The method of claim 1, wherein the sequencing adapter comprises a single-stranded portion that hybridizes to the 5' single-stranded polynucleotide sequence segment in the adapter.

33. The method of claim 32, wherein the sequencing adaptor is covalently attached to the adaptor using a ligase or by click chemistry.

34. The method of claim 33, wherein the ligase is T4 DNA ligase.

Images