Polymer-coated magnetic microspheres and methods for their preparation
By designing a three-layer structure consisting of a porous polymer microsphere core, a silicon oxide layer, and an acrylic cross-linked polymer layer on submicron or micron-sized magnetic spheres, the problems of magnetic microsphere stability and non-specific adsorption are solved, achieving high stability and multifunctionality, making it suitable for biomedical materials.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEAVERNANO TECH
- Filing Date
- 2021-11-11
- Publication Date
- 2026-06-19
Smart Images

Figure BDA0003349218050000101 
Figure BDA0003349218050000111 
Figure HDA0003349218060000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of polymer synthesis technology, and particularly relates to a polymer-coated magnetic microsphere and its preparation method. Background Technology
[0002] Submicron or micron-sized magnetic spheres, due to their superparamagnetism, rapid magnetic response, high throughput, monodispersity, and submicron-scale particle size, can be functionally modified and covalently coupled with biological ligands, making them important carrier tools in medical and molecular biology research. Simple solid microspheres can only adsorb, precipitate, or covalently combine some magnetic particles through their surface properties, which is far from sufficient for the diverse applications of biomaterials.
[0003] Wang Weicai et al. used glycidyl methacrylate (GMA) as a monomer to polymerize microspheres, and then uniformly dispersed the synthesized microspheres on Fe. 2+ / Fe 3+ Fe3O4 was deposited on the surface of microspheres in a salt solution under an inert gas atmosphere via the action of a precipitant, and then reacted with functionalized groups to obtain a bioactive product. This method seems to be able to synthesize the target product well, but it has considerable limitations. First, the magnetic content cannot be guaranteed. Second, the magnetic material being supported does not have a large number of covalent bonds, resulting in weak stability and easy weakening or loss of magnetism due to changes in the system environment (Wang Weicai et al. Chinese Science Bulletin, 53, 1165-1170).
[0004] Currently, the synthesis of magnetic microspheres mainly focuses on two approaches: The first approach involves synthesizing nanoscale ferrite clusters via hydrothermal or solvothermal methods. Since nanoscale products are unstable and prone to aggregation, a layer of SiO2 needs to be coated onto the surface of the nanoscale ferrite before functionalization to obtain functional magnetic spheres. The second approach uses monomer polymerization to form a core, modifies the core surface with a hydrophilic reagent, then covalently coats the polymer sphere surface with ferrite, and then coats it with another layer of SiO2 or polymer, effectively protecting the stability of the magnetic material. Finally, functionalization is performed on the SiO2 or polymer surface to obtain magnetic microspheres with special properties.
[0005] For example, Chinese patent CN109012518A discloses a method for preparing magnetic spheres with ferrite as the magnetic core and vinylsiloxane hydrolysis products as the shell. The ferrite used is nanoscale. During the reaction with vinylsiloxane, the concentrations of both are relatively high in the early stage, which easily generates disordered microspheres with uneven distribution of surface functional groups. In the later polymerization reaction, this causes agglomeration and non-specific adsorption between magnetic beads, making it difficult to obtain monodisperse and stable magnetic spheres.
[0006] Therefore, for submicron or micron-sized magnetic spheres, ensuring their mechanical stability, magnetic responsiveness, and functional diversity is a prerequisite. On this basis, by combining physical and chemical methods to reduce non-specific adsorption on the surface of the magnetic spheres, a product with market competitiveness can be obtained. Summary of the Invention
[0007] In view of this, the technical problem to be solved by the present invention is to provide a polymer-coated magnetic microsphere with low surface non-specific adsorption and a method for preparing the same.
[0008] This invention provides a polymer-coated magnetic microsphere, comprising:
[0009] A porous polymer microsphere core; magnetic iron oxide is disposed in the channels of the porous polymer microsphere core;
[0010] A silicon oxide layer encapsulating the core of porous polymer microspheres;
[0011] An acrylic cross-linked polymer layer encapsulating a silicon oxide layer.
[0012] Preferably, the particle size of the porous polymer microsphere core is 1–30 μm; the thickness of the silicon oxide layer is 100–500 nm; the thickness of the acrylic crosslinked polymer layer is 200–1000 nm; and the degree of crosslinking of the acrylic crosslinked polymer layer is 20%–80%.
[0013] Preferably, the acrylic crosslinked polymer layer is formed by crosslinking acrylic compounds with a crosslinking agent or by crosslinking acrylic compounds with a crosslinking agent followed by functionalization modification; the acrylic compounds are selected from one or more of methacrylic acid, methacrylate and glycidyl methacrylate; the crosslinking agent is selected from one or more of divinylbenzene, diacetone bisacrylamide, methylene dipropylamide and carbodiimide.
[0014] This invention also provides a method for preparing polymer-coated magnetic microspheres, comprising:
[0015] S1) After sulfonation treatment, porous polymer microspheres are obtained;
[0016] S2) Sulfonated porous polymer microspheres, ferrous salts and / or ferric salts, silane coupling agents and precipitants are reacted in a protective atmosphere to obtain silanized modified magnetic microspheres.
[0017] S3) In a protective atmosphere, the silanized magnetic microspheres, acrylic compounds, crosslinking agents and initiators are subjected to a reflux precipitation polymerization reaction to obtain polymer-coated magnetic microspheres.
[0018] Preferably, the porous polymer microspheres in step S1) are prepared according to the following method:
[0019] The first monomer was emulsion polymerized to obtain seed spheres;
[0020] The seed spheres, pore-forming agent, second monomer, and initiator are reacted in the presence of surfactant and stabilizer to obtain crude porous microspheres.
[0021] The porous microspheres crude product is cleaned of the pore-forming agent to obtain porous polymer microspheres.
[0022] Preferably, the first monomer is selected from styrene; the particle size of the seed pellets is 400-1500 nm;
[0023] The pore-forming agent is selected from one or more of dioctyl phthalate, dioctyl phthalate, dibutyl phthalate and diisodecyl phthalate;
[0024] The second monomer is selected from divinylbenzene;
[0025] The initiator is selected from benzoyl peroxide;
[0026] The surfactant is selected from alkyl sulfates;
[0027] The stabilizer is selected from polyvinylpyrrolidone;
[0028] The mass ratio of the seed ball to the second monomer is 1:(3-6);
[0029] The mass of the porogen is 40% to 95% of the mass of the second monomer.
[0030] Preferably, the mass ratio of the sulfonated porous polymer microspheres to the ferrous salt and / or ferric salt is 1:(0.5-1.5); the ratio of the sulfonated porous polymer to the silane coupling agent is 1g:(0.5-2)mL.
[0031] Preferably, the ferrous salt is selected from ferrous chloride; the ferric salt is selected from ferric chloride; the silane coupling agent is selected from one or more of methyl orthosilicate, ethyl orthosilicate, propyl orthosilicate, butyl orthosilicate and KH570; the precipitant is selected from ammonia; the reaction temperature in step S2) is 60℃~100℃; and the reaction time is 3~8h.
[0032] Preferably, the acrylic compound is selected from one or more of methacrylic acid, methacrylates, and glycidyl methacrylate;
[0033] The crosslinking agent is selected from one or more of divinylbenzene, diacetone bisacrylamide, methylene dipropylamide, and carbodiimide;
[0034] The initiator is selected from azo initiators;
[0035] The volume of the acrylic compound is 5% to 20% of the total volume of the reflux precipitation polymerization reaction system;
[0036] The mass ratio of the silanized magnetic microspheres to the acrylic compound is 1:(0.5-2);
[0037] The volume of the crosslinking agent is 10% to 80% of the volume of the acrylic compound;
[0038] The initiator is 1% to 20% of the mass of the acrylic compound.
[0039] Preferably, the reaction in step S3) is carried out in a solvent; the solvent is selected from one or more of ethanol, acetonitrile, and water;
[0040] In step S3), the silanized magnetic microspheres, acrylic compounds, crosslinking agents and initiators are first mixed and stirred in a solvent for 30-60 minutes in a protective atmosphere, and then the temperature is raised to 70-110°C and reacted for 1-36 hours.
[0041] This invention provides a polymer-coated magnetic microsphere, comprising: a porous polymer microsphere core; magnetic iron oxide disposed in the pores of the porous polymer microsphere core; a silicon oxide layer surrounding the porous polymer microsphere core; and an acrylic cross-linked polymer layer surrounding the silicon oxide layer. Compared with the prior art, the polymer-coated magnetic microsphere provided by this invention has a three-layer structure. Its core is a porous microsphere incorporating ferrite, which has abundant pore volume and a large specific surface area, allowing for the ion bonding of a large amount of ferrite. The middle layer is a silicon oxide layer, which can effectively prevent the loss of ferromagnetic materials in subsequent modification reactions. The outer layer is a polymer coating layer with active end groups, which can further strengthen the protection of ferrite, effectively reduce the non-specific adsorption of magnetic microspheres, and provide active centers for convenient functional modification, ensuring the stability of the magnetic sphere's various properties.
[0042] Furthermore, this invention employs an RPP polymerization method, where monomers are uniformly dispersed in a solvent without the need for stabilizers. After heating, the monomers polymerize onto the surface of the magnetic spheres under the action of an initiator. Subsequently, functionalization is achieved through other nucleophilic reagents, introducing amino and carboxyl groups onto the surface of the magnetic spheres. The production process involved in this invention is simple, using inexpensive and readily available raw materials, facilitating industrial implementation. The resulting product can be used in biomedical applications, such as immunoassay and chemiluminescence. Attached Figure Description
[0043] Figure 1This is a scanning electron microscope image of the silanized magnetic microspheres obtained in Example 1 of the present invention;
[0044] Figure 2 This is a scanning electron microscope image of the surface carboxyl-modified magnetic microspheres obtained in Example 1 of the present invention. Detailed Implementation
[0045] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0046] The present invention provides a polymer-coated magnetic microsphere, comprising: a porous polymer microsphere core; magnetic iron oxide disposed in the channels of the porous polymer microsphere core; a silicon oxide layer surrounding the porous polymer microsphere core; and an acrylic crosslinked polymer layer surrounding the silicon oxide layer.
[0047] The polymer-coated magnetic microspheres provided by this invention have a three-layer structure, with porous polymer microspheres as the core. In this invention, the particle size of the porous polymer microsphere core is preferably 1-30 μm, more preferably 1-20 μm, even more preferably 1-10 μm, and more specifically, can be 1.5 μm, 2.5 μm, 3.5 μm, 4.5 μm, 5.5 μm, or 6.5 μm. The porous polymer microspheres are preferably polystyrene cross-linked divinylbenzene porous microspheres. Magnetic iron oxides are disposed in the channels of the porous polymer microsphere core. The magnetic iron oxides are preferably Fe3O4 and / or γ-Fe2O3.
[0048] The porous polymer microspheres are coated with a silicon oxide layer; the silicon oxide layer is obtained by hydrolysis of a silane coupling agent; the thickness of the silicon oxide layer is preferably 100-500 nm, more preferably 100-300 nm; the surface of the silicon oxide layer has a large number of hydroxyl groups and carbon-carbon unsaturated bond groups, which are provided by hydrolysis of siloxane and silane coupling agent, respectively.
[0049] The silicon oxide layer is wrapped with an acrylic crosslinked polymer layer; the degree of crosslinking of the acrylic crosslinked polymer layer is preferably 20% to 80%; the thickness of the acrylic crosslinked polymer layer is preferably 200 to 1000 nm, more preferably 300 to 600 nm; the acrylic crosslinked polymer layer is preferably formed by crosslinking an acrylic compound with a crosslinking agent or by crosslinking an acrylic compound with a crosslinking agent followed by functionalization modification; the acrylic compound is preferably one or more of methacrylic acid, methacrylate, and glycidyl methacrylate; the crosslinking agent is preferably one or more of divinylbenzene, diacetone bisacrylamide, methylene dipropylamide, and carbodiimide. The functionalization modification is preferably hydroxylation, amylation, or carboxylation modification; in this invention, most preferably, the acrylic crosslinked polymer layer is a crosslinked polyglycidyl methacrylate layer and / or a crosslinked polyglycidyl methacrylate functionalized derivative layer.
[0050] The polymer-coated magnetic microspheres provided by this invention have a three-layer structure. The core is a porous microsphere incorporating ferrite, which has abundant pore volume and a large specific surface area, allowing for the ion bonding of a large amount of ferrite. The middle layer is a silicon oxide layer, which can effectively prevent the loss of ferromagnetic materials in subsequent modification reactions. The outer layer is a polymer coating layer with active end groups, which can further strengthen the protection of ferrite, effectively reduce the non-specific adsorption of magnetic microspheres, and provide active centers for convenient functional modification, thus ensuring the stability of the magnetic spheres in all aspects.
[0051] The present invention also provides a method for preparing the above-mentioned polymer-coated magnetic microspheres, comprising: S1) sulfonating porous polymer microspheres to obtain sulfonated porous polymer microspheres; S2) reacting the sulfonated porous polymer microspheres, ferrous salt and / or ferric salt, silane coupling agent and precipitant in a protective atmosphere to obtain silanized modified magnetic microspheres; S3) subjecting the silanized modified magnetic microspheres, acrylic compound, crosslinking agent and initiator to a reflux precipitation polymerization reaction in a protective atmosphere to obtain polymer-coated magnetic microspheres.
[0052] In this invention, there are no special restrictions on the source of any raw materials; they can be commercially available.
[0053] Porous polymer microspheres are obtained by sulfonation treatment; the porous polymer microspheres are preferably polystyrene cross-linked divinylbenzene porous microspheres; the porous polymer microspheres are preferably obtained by swelling seed spheres with a pore-forming agent and cross-linking a second monomer; the seed spheres are preferably polystyrene; the particle size of the seed spheres is preferably 400-1500 nm, more preferably 500-1200 nm, and even more preferably 500-1000 nm; in this invention, the particle size of the seed spheres can specifically be 500 nm, 600 nm, 700 nm, 800 nm, 900 nm, or 1000 nm; the pore-forming agent is preferably one or more of dioctyl adipate, dioctyl phthalate, dibutyl phthalate, and diisodecyl phthalate; The porogen is preferably 40% to 95% of the mass of the second monomer, more preferably 60% to 95%, even more preferably 70% to 95%, even more preferably 85% to 95%, and most preferably 88% to 92%; the second monomer is preferably divinylbenzene; the mass ratio of the seed sphere to the second monomer is preferably 1:(3 to 6), more preferably 1:(3.5 to 5.5), even more preferably 1:(4 to 5), and most preferably 1:(4 to 4.5); in this invention, this step is more preferably specifically: the first monomer is emulsion polymerized to obtain seed spheres; the seed spheres, porogen, second monomer and initiator are reacted in the presence of surfactant and stabilizer to obtain crude porous microspheres; the porogen is removed from the crude porous microspheres to obtain porous polymer microspheres.
[0054] In this invention, a first monomer is first emulsion polymerized to obtain seed spheres; the first monomer is preferably styrene; the initiator used in the emulsion polymerization is preferably an azo initiator, more preferably AIBN; the mass of the initiator during emulsion polymerization is preferably 1% to 20% of the mass of the first monomer, more preferably 1% to 10%, and even more preferably 2% to 5%; the emulsifier used in the emulsion polymerization is preferably polyvinylpyrrolidone, more preferably PVP-K30 and / or PVP-124; the mass of the emulsifier is preferably 10% to 50% of the mass of the first monomer, more preferably 20% to 40%, and even more preferably 30%; the solvent used in the emulsion polymerization is preferably an alcohol solution, more preferably an ethanol solution, and even more preferably a 75% to 80% ethanol solution; the temperature of the emulsion polymerization is preferably 60℃ to 100℃, more preferably 70℃ to 90℃, and even more preferably 80℃; the time of the emulsion polymerization is preferably 2 to 10 hours, more preferably 4 to 8 hours, and even more preferably 6 to 8 hours.
[0055] The seed spheres, pore-forming agent, second monomer, and initiator are reacted in the presence of a surfactant and a stabilizer to obtain crude porous microspheres. The surfactant is preferably an alkyl sulfate, more preferably a dodecyl sulfate, and even more preferably sodium dodecyl sulfate. The mass of the surfactant is preferably 0.1%–0.5% of the mass of the reaction solvent, more preferably 0.2%–0.3%. The stabilizer is preferably polyvinylpyrrolidone. The mass of the stabilizer is preferably 0.5%–2% of the mass of the reaction solvent, more preferably 1%–1.5%. The reaction temperature is preferably 60℃–100℃, more preferably 70℃–90℃, and even more preferably 70℃–80℃. The reaction time is preferably 10–30 h, more preferably 15–25 h, and even more preferably 20–24 h. After the reaction, centrifugation, washing with alcohol and water, filtration, and drying are preferred to obtain crude porous microspheres.
[0056] The porogen is removed from the crude porous microspheres; in this invention, an organic solvent is preferably used to remove the porogen; the organic solvent is preferably furan; after removing the porogen, the product is preferably washed with alcohol and then dried to obtain porous polymer microspheres.
[0057] Porous polymer microspheres are sulfonated to obtain sulfonated porous polymer microspheres. The sulfonation treatment can be any method known to those skilled in the art and is not particularly limited. In this invention, a mixture of glacial acetic acid and concentrated sulfuric acid is used as the sulfonation reagent. The volume ratio of glacial acetic acid to concentrated sulfuric acid is preferably (0.1-0.5):1, more preferably (0.2-0.4):1, and even more preferably 0.3:1. The sulfonation treatment temperature is preferably 60℃-100℃, more preferably 70℃-90℃, and even more preferably 70℃-80℃. The sulfonation treatment time is preferably 1-10h, more preferably 3-8h, even more preferably 4-7h, and most preferably 5-6h.
[0058] Sulfonated porous polymer microspheres, ferrous salts and / or ferric salts, silane coupling agents, and precipitants are reacted in a protective atmosphere to obtain silanized magnetic microspheres. The ferrous salt is preferably ferrous chloride; the ferric salt is preferably ferric chloride; the mass ratio of the sulfonated porous polymer microspheres to the ferrous salt and / or ferric salt is preferably 1:(0.5–1.5), more preferably 1:(0.8–1.2), and even more preferably 1:(0.8–0.9); the silane coupling agent is preferably one or more of methyl orthosilicate, ethyl orthosilicate, propyl orthosilicate, butyl orthosilicate, and KH570; the ratio of the sulfonated porous polymer to the silane coupling agent is preferably 1 g:(0.5–2) mL, more preferably 1 g:(0.8–1.5) mL, and even more preferably 1 g:(0.8–1.5) mL. The ratio of g to ammonia is (0.8–1.2) mL, most preferably 1 g to 1 mL; the precipitant is preferably an alkaline substance, more preferably ammonia; the mass concentration of the ammonia is preferably 10%–20%, more preferably 14%–18%; the volume ratio of the silane coupling agent to ammonia is preferably 1:(20–60), more preferably 1:(30–50), even more preferably 1:(35–45), and most preferably 1:40; the protective atmosphere can be any protective atmosphere known to those skilled in the art, and there are no special limitations, but nitrogen is preferred in this invention; the reaction temperature is preferably 60℃–100℃, more preferably 70℃–90℃, and even more preferably 80℃; the reaction time is preferably 3–8 h, more preferably 4–7 h, and even more preferably 5–6 h. The porous microspheres, after being modified with ionic groups, react with Fe... 2+ / Fe 3+ Under the action of a precipitant, salt can form a strong Fe-O bond in both the core channels and the surface, while simultaneously employing... The method involves synthesizing the material on the surface of magnetic spheres and grafting unsaturated double bonds onto the surface of the silicon oxide layer.
[0059] In a protective atmosphere, the silanized magnetic microspheres, acrylic compounds, crosslinking agents, and initiators are subjected to a reflux precipitation polymerization reaction to obtain polymer-coated magnetic microspheres. The protective atmosphere can be any atmosphere known to those skilled in the art and is not particularly limited; nitrogen is preferred in this invention. The mass ratio of the silanized magnetic microspheres to the acrylic compounds is preferably 1:(0.5-2), more preferably 1:(0.5-1.5), even more preferably 1:(0.8-1.2), and most preferably 1:1. The acrylic compounds are preferably one or more of methacrylic acid, methacrylate, and glycidyl methacrylate. The volume of the acrylic compounds is 5%-20% of the total volume of the reflux precipitation polymerization system. The crosslinking agent is preferably one or more of divinylbenzene, diacetone bisacrylamide, methylene dipropylamide, and carbodiimide. The volume of the crosslinking agent is preferably that of acrylic acids. The compound comprises 10% to 80% of its volume, more preferably 20% to 60%, even more preferably 30% to 50%, and most preferably 40%; the initiator is preferably an azo initiator, more preferably AIBN; the mass of the initiator is preferably 1% to 20% of the mass of the acrylic compound, more preferably 2% to 15%, and even more preferably 5% to 10%; the reaction is preferably carried out in a solvent; the solvent is preferably one or more of ethanol, acetonitrile, and water; the reaction time is preferably 1 to 36 h, more preferably 4 to 30 h, even more preferably 4 to 20 h, even more preferably 6 to 15 h, and most preferably 8 to 10 h; in this invention, this step is preferably specifically as follows: first, in a protective atmosphere, the silanized magnetic microspheres, acrylic compound, crosslinking agent, and initiator are mixed and stirred in a solvent for 30 to 60 min, and then the temperature is raised to 70°C to 110°C and reacted for 1 to 36 h; vigorous reflux is maintained throughout the reaction.
[0060] After the reaction is complete, it is preferable to cool down and wash with an alcohol solvent to obtain polymer-coated magnetic microspheres.
[0061] In this invention, the above-mentioned products can also be functionalized; the functionalization modification is preferably hydroxylation, amination or carboxylation modification.
[0062] This invention employs RPP polymerization, where monomers are uniformly dispersed in a solvent without the need for stabilizers. After heating, the monomers polymerize onto the surface of magnetic spheres under the action of an initiator. Subsequently, functionalization is achieved through the use of other nucleophiles, introducing amino and carboxyl groups onto the surface of the magnetic spheres. The production process involved in this invention is simple, using inexpensive and readily available raw materials, facilitating industrial implementation. The resulting product can be used in biomedical applications, such as immunoassay and chemiluminescence.
[0063] To further illustrate the present invention, the following describes in detail, with reference to embodiments, a polymer-coated magnetic microsphere and its preparation method provided by the present invention.
[0064] All reagents used in the following examples are commercially available.
[0065] Example 1
[0066] 30g of styrene and 9g of PVP-K30 were uniformly dispersed in 750mL of 75% (v / v) ethanol solution and added to a 1000mL three-necked flask. The mixture was heated to 80℃ with mechanical stirring, and then 0.6g of AIBN was added. The reaction was continued at this temperature for 6 hours. After centrifugation and washing with alcohol and water, the product was dispersed in a 0.25% sodium dodecyl sulfate aqueous solution to obtain monodisperse seed spheres with a particle size of 1000±50nm.
[0067] 10g of the synthesized seed spheres, 40g of DOP, 45g of divinylbenzene, and 0.25g of BPO were uniformly dispersed in 2000mL of 0.25% sodium dodecyl sulfate solution (containing 1% PVP) and transferred to a 3L three-necked flask. The mixture was mechanically stirred and heated to 70℃ for 24h. After centrifugation, washing with alcohol and water, and filtration through a sintered glass funnel, the product was dried at 50℃ to obtain crude porous microspheres. The crude product was then dispersed in furan and shaken on a shaker for 6–24h. After extraction, the product was washed with alcohol and dried to obtain porous spheres with a particle size of 3±0.1μm.
[0068] 100g of the porous microspheres were placed in a 2L flask, and 300mL of glacial acetic acid and 1L of concentrated sulfuric acid were added. The mixture was heated to 80℃ and reacted for 6 hours with mechanical stirring. The reaction product was transferred to crushed ice, cooled, separated, and dried. 10g of the dried sulfonated microspheres were weighed and uniformly dispersed in 150mL of deionized water. 6.18g of FeCl3·6H2O, 2.57g of FeCl2·4H2O, and 10mL of KH570 solution were introduced into the solution. The reaction apparatus was placed in an ice-water bath under a N2 atmosphere. Subsequently, 400mL of 14% (v / v) ammonia water was introduced, and the reaction temperature was raised to 80℃ and maintained for 5 hours. After centrifugation and washing with alcohol and water, silanized magnetic microspheres were obtained.
[0069] 10g of the synthesized silanized magnetic spheres were uniformly dispersed in a 50% ethanol-acetonitrile mixture. 10g of glycidyl methacrylate, 4g of N,N-methylenebisacrylamide, and 0.5g of AIBN were then introduced and dispersed evenly. The mixture was stirred under a nitrogen atmosphere for 30–60 min, and then the temperature was raised to 90℃ for 8 h, maintaining vigorous reflux throughout the reaction. After the reaction was complete, the heat source was removed, and the mixture was cooled. After washing several times with anhydrous ethanol, the mixture was finally dispersed in DMF.
[0070] Finally, 10g of the above product was added to a DMF system, along with 5mL of triethylamine and 5g of succinic anhydride. After stirring at room temperature for 48h, surface carboxyl-modified magnetic microspheres were obtained, denoted as S1.
[0071] The silanized magnetic microspheres and the carboxyl-modified magnetic microspheres obtained in Example 1 were analyzed using scanning electron microscopy, and their scanning electron micrographs are shown below. Figure 1 and Figure 2 As shown. Among them. Figure 1 Magnetic microspheres modified with silanization Figure 2 These are magnetic microspheres with carboxyl groups modified on their surface.
[0072] Example 2
[0073] 20g of styrene and 16g of PVA-124 were uniformly dispersed in 600mL of 75% (v / v) ethanol solution and added to a 1000mL three-necked flask. The mixture was heated to 80℃ with mechanical stirring, and then 0.5g of AIBN was added. The reaction was continued at this temperature for 8 hours. After centrifugation and washing with alcohol and water, the product was dispersed in a 0.25% sodium dodecyl sulfate aqueous solution to obtain monodisperse seed beads.
[0074] 15g of the synthesized seed spheres, 60g of (DOP+DBP) (20g DOP, 40g DBP), 65g of divinylbenzene, and 0.36g of BPO were uniformly dispersed in 2000mL of 0.25% sodium dodecyl sulfate solution (containing 1% PVP) and transferred to a 3L three-necked flask. The mixture was heated to 70℃ and reacted for 24h under mechanical stirring. The product was centrifuged, washed with alcohol and water, filtered through a sintered glass funnel, and dried at 50℃ to obtain crude porous microspheres. The crude product was then dispersed in furan and shaken on a shaker for 6–24h. The extracted product was washed with alcohol and dried to obtain porous spheres with uniform particle size.
[0075] 50 g of the porous microspheres were placed in a 1 L flask, and 150 mL of glacial acetic acid and 500 mL of concentrated sulfuric acid were added. The mixture was heated to 80 °C for 6 h with mechanical stirring. The reaction product was transferred to crushed ice, cooled, separated, and dried. 10 g of the dried sulfonated microspheres were weighed and uniformly dispersed in 150 mL of deionized water. 6.18 g of FeCl3·6H2O, 2.57 g of FeCl2·4H2O, and 10 mL of KH570 solution were introduced into the solution. The reaction apparatus was placed in an ice-water bath under a N2 atmosphere. Subsequently, 400 mL of 14% (v / v) ammonia water was introduced, and the reaction temperature was raised to 80 °C and maintained for 5 h. After centrifugation and washing with alcohol and water, silanized magnetic microspheres were obtained.
[0076] 10g of the synthesized silanized magnetic spheres were uniformly dispersed in a 50% ethanol-acetonitrile mixture. Then, 10g of glycidyl methacrylate, 2g of N,N-methylenebisacrylamide, 2g of divinylbenzene, and 0.5g of AIBN were introduced and dispersed evenly. The mixture was stirred under a nitrogen atmosphere for 30–60 min, and then the temperature was raised to 90℃ for 8 h, maintaining vigorous reflux throughout the reaction. After the reaction was completed, the heat source was removed, and the mixture was cooled down. After washing several times with anhydrous ethanol, the mixture was finally dispersed in DMF.
[0077] Finally, 10g of the above product was added to a DMF system, along with 5mL of triethylamine and 5g of succinic anhydride. After stirring at room temperature for 48h, surface carboxyl-modified magnetic microspheres were obtained, denoted as S2.
[0078] The specific adsorption capacity of the surface carboxyl-modified magnetic microspheres obtained in Examples 1 and 2 for binding biotinylated nucleic acids was tested, and the results are shown in Table 1.
[0079] Table 1. Specific and non-specific adsorption capacity of samples to biotinylated nucleic acids
[0080]
[0081]
[0082] Note: "Standard" refers to Dynabeads. TM MyOne TM Streptomycin T1 (reference).
[0083] Conjugation process: Carboxylated magnetic beads were adjusted to the target concentration (10 mg / mL). The beads were then washed and activated using conjugation buffer. SA protein (0.2 mg / 2 mg magnetic beads) was added to the activated beads and incubated for 2 hours. After protein grafting, blocking was performed. Finally, the beads were washed with preservation solution and stored quantitatively. Binding performance was then tested by incubation with biotin-probe (0.2 nmol / mL) and non-biotin-probe (0.2 nmol / mL) for 2 hours. The biotin-probe oligonucleotides were: CCCTAACCCTAACCCTAACCCTAA.
[0084] Non-biotin oligonucleotide: CCCTAACCCTAACCCTAACCCTAA;
[0085] Biotin and non-biotin have the same sequence arrangement.
Claims
1. A polymer-coated magnetic microsphere, characterized in that, include: Porous polymer microsphere core; The porous polymer microsphere core contains magnetic iron oxide in its pores. A silicon oxide layer encapsulating the core of porous polymer microspheres; An acrylic cross-linked polymer layer encapsulating a silicon oxide layer; The porous polymer microsphere core has a particle size of 1~30 μm; the silicon oxide layer has a thickness of 100~500 nm; the acrylic crosslinked polymer layer has a thickness of 200~1000 nm; and the acrylic crosslinked polymer layer has a crosslinking degree of 20%~80%. The silicon oxide layer is obtained by hydrolysis of a silane coupling agent.
2. The polymer-coated magnetic microspheres according to claim 1, characterized in that, The acrylic crosslinked polymer layer is formed by crosslinking acrylic compounds with a crosslinking agent or by crosslinking acrylic compounds with a crosslinking agent followed by functionalization modification; the acrylic compounds are selected from one or more of methacrylic acid, methacrylate and glycidyl methacrylate; the crosslinking agent is selected from one or more of divinylbenzene, diacetone bisacrylamide, methylene dipropylamide and carbodiimide.
3. A method for preparing polymer-coated magnetic microspheres, characterized in that, include: S1) After sulfonation treatment, porous polymer microspheres are obtained; S2) Sulfonated porous polymer microspheres, ferrous salts and / or ferric salts, silane coupling agents and precipitants are reacted in a protective atmosphere to obtain silanized modified magnetic microspheres. S3) First, in a protective atmosphere, the silanized magnetic microspheres, acrylic compounds, crosslinking agents and initiators are mixed and stirred in a solvent for 30-60 min, and then the temperature is raised to 70℃-110℃ and reacted for 1-36 h to obtain polymer-coated magnetic microspheres.
4. The preparation method according to claim 3, characterized in that, The porous polymer microspheres in step S1) are prepared according to the following method: The first monomer was emulsion polymerized to obtain seed spheres; The seed spheres, pore-forming agent, second monomer, and initiator are reacted in the presence of surfactant and stabilizer to obtain crude porous microspheres. The porous microspheres crude product is cleaned of the pore-forming agent to obtain porous polymer microspheres.
5. The preparation method according to claim 4, characterized in that, The first monomer is selected from styrene; the particle size of the seed pellets is 400~1500 nm; The pore-forming agent is selected from one or more of dioctyl phthalate, dioctyl phthalate, dibutyl phthalate and diisodecyl phthalate; The second monomer is selected from divinylbenzene; The initiator is selected from benzoyl peroxide; The surfactant is selected from alkyl sulfates; The stabilizer is selected from polyvinylpyrrolidone; The mass ratio of the seed ball to the second monomer is 1:(3~6). The mass of the porogen is 40% to 95% of the mass of the second monomer.
6. The preparation method according to claim 3, characterized in that, The mass ratio of the sulfonated porous polymer microspheres to ferrous salt and / or ferric salt is 1:(0.5~1.5); the ratio of the sulfonated porous polymer to silane coupling agent is 1 g:(0.5~2) mL.
7. The preparation method according to claim 3, characterized in that, The ferrous salt is selected from ferrous chloride; the ferric salt is selected from ferric chloride; the silane coupling agent is selected from one or more of methyl orthosilicate, ethyl orthosilicate, propyl orthosilicate, butyl orthosilicate and KH570; the precipitant is selected from ammonia; the reaction temperature in step S2) is 60℃~100℃; the reaction time is 3~8 h.
8. The preparation method according to claim 3, characterized in that, The acrylic compound is selected from one or more of methacrylic acid, methacrylates and glycidyl methacrylate; The crosslinking agent is selected from one or more of divinylbenzene, diacetone bisacrylamide, methylene dipropylamide, and carbodiimide; The initiator is selected from azo initiators; The volume of the acrylic compound is 5% to 20% of the total volume of the reflux precipitation polymerization reaction system; The mass ratio of the silanized magnetic microspheres to the acrylic compound is 1:(0.5~2). The volume of the crosslinking agent is 10% to 80% of the volume of the acrylic compound; The initiator is 1% to 20% of the mass of the acrylic compound.
9. The preparation method according to claim 3, characterized in that, The reaction in step S3) is carried out in a solvent; the solvent is selected from one or more of ethanol, acetonitrile and water.