Identification methods of Vietnamese camellia, fragrant flower camellia, small fruit camellia and common camellia
Through the whole genome sequencing and comparative analysis of chloroplasts of oil tea species, SNP and Indel tag combinations were developed, and specific primers were designed for PCR amplification and sequencing, the problem of oil tea species was solved, rapid and accurate identification was achieved, and oil tea was improved Efficiency and accuracy of breeding.
Patent Information
- Application Number
- CN202210131330.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-02-14
- Publication Date
- 2025-02-07
- Estimated Expiration
- 2042-02-14
AI Technical Summary
It is difficult to quickly and efficiently identify oil tea species in the existing technology, especially when the morphology is similar in the seedling stage, which leads to inconvenient oil tea breeding and affects industrial development.
Through the whole genome sequencing and comparative analysis of chloroplasts of small fruit oil tea, ordinary oil tea, fragrant flower oil tea and Vietnam oil tea, single-base variant sites and insertion/deletion sites that can be used for identification were screened out, and the combination of SNP markers and Indel markers was developed. Specific primers were designed for PCR amplification and sequencing to achieve rapid identification.
The rapid and accurate identification of four oil tea species is achieved, and environmental impact and plant flowering and fruiting requirements are avoided. Only a trace of fresh tissue samples are required, which significantly improves the efficiency and accuracy of oil tea breeding.
Smart Images
Figure CN114574614B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology and plant molecular breeding, and specifically relates to an identification method for Vietnamese camellia, fragrant flower camellia, small-fruit camellia and common camellia. Background Art
[0002] Camellia oleifera, along with coconut, olive and oil palm, is one of the four major woody oil crops in the world. It is a woody oil crop that China focuses on developing and is a major oil crop in China. The unsaturated fatty acid content of camellia oil in camellia oleifera can reach about 90%, making it a high-grade health edible oil. The current cultivation area of camellia oleifera in China is about 70 million mu. The camellia oleifera cultivated in China involves multiple species of the genus Camellia in the Theaceae family, including the common camellia oleifera, small-fruit camellia oleifera, Vietnamese camellia oleifera, and fragrant flower camellia oleifera. These four species have many similarities in morphology, especially the morphological identification in the seedling stage is difficult; at the same time, these four species are planted in different habitats, and the morphology of leaves and other forms will also vary greatly. All of these have a great impact on the production of camellia oleifera and are not conducive to the development of China's camellia oleifera industry. At the same time, in the breeding of camellia oleifera, it is often necessary to accurately identify the parents and to conduct early identification of the hybrid offspring between different species. The similarity in morphology, especially the difficulty in distinguishing the morphology in the seedling stage, has brought great inconvenience to the breeding of camellia oleifera. Therefore, it is particularly urgent to establish technology or methods to quickly and efficiently identify Camellia oleifera germplasm materials. Summary of the invention
[0003] In order to overcome some of the defects in the prior art, the present invention performs chloroplast whole genome sequencing and comparative analysis on one germplasm of each of four species: small-fruit camellia, common camellia, fragrant flower camellia, and Vietnamese camellia, screens out single-base variation sites and insertion / deletion sites that can be used to identify these four species, develops SNP marker and Indel marker combinations, and detection primers and methods.
[0004] The first object of the present invention is to provide chloroplast genome SNP sites and InDel sites for identifying germplasm resources of four Camellia oleifera species.
[0005] The second object of the present invention is to provide specific primers for identifying germplasm resources of four oil-tea camellia species. Specific chloroplast genome SNP sites and InDel sites of the four oil-tea camellia germplasm resources can be detected by amplification with specific primers.
[0006] The third object of the present invention is to provide a method for identifying or assisting in identifying the germplasm of four Camellia oleifera species to be tested.
[0007] In order to achieve the above object, the present invention is implemented by the following scheme:
[0008] S1. Extract the total genomic DNA of the tested common camellia, small-fruit camellia, fragrant flower camellia, and Vietnamese camellia germplasm resources;
[0009] S2, using the DNA of the sample to be tested extracted in step S1 as an amplification template and ycf1-5 primers as amplification primers to perform PCR amplification;
[0010] S3. Detection of PCR amplification products: The PCR amplification products were electrophoresed on 1.5% agarose gel (containing 8% Goldview nucleic acid dye) in 0.5×TBE buffer at 100 V for 40 min. The gel running results were photographed and recorded in a gel imaging system. With 100 bp DNA as the marker, there was only one amplification product with a size of approximately 827 bp, which was the target band.
[0011] S4, sequencing the PCR product of S3, the sequencing method is Sanger first generation conventional sequencing, the 404th and 645th positions of the amplified target fragment are SNP 1 and SNP 2, if the bases at these two points of the germplasm material to be tested are both "T", and other tested species have "C" on SNP 1 and "A" on SNP 2, based on which the germplasm material can be accurately identified as Camellia oleifera; the 715-720th position of the amplified target fragment is InDel 1, if the germplasm material to be tested lacks the "TCTTTT" sequence at this position, based on which the germplasm material can be accurately identified as Camellia oleifera;
[0012] S5. When the germplasm material to be tested is excluded as not belonging to Camellia oleifera and Camellia oleifera based on the test result of S4, continue to perform PCR amplification using the DNA of the sample to be tested extracted in step S1 as an amplification template and ZDJ-190 primer as an amplification primer;
[0013] The PCR amplification method was the same as that of S2. The amplified product was only one band, and the band size was about 520 bp, which was the target band;
[0014] S6, sequencing the PCR product in S5, the sequencing method is the first generation Sanger conventional sequencing. The 216-220th position of the amplified fragment is the InDel 2 position, and the germplasm material to be tested that lacks the "AGTAC" sequence at this position is Vietnamese Camellia oleifera, and the one that does not lack the "AGTAC" sequence is common Camellia oleifera.
[0015] Further, in the PCR amplification method:
[0016] PCR reaction system (30 μL): ddH2O 23.0 μL, 10× Taq Buffer 3.0 μL (Mg2+ plus), dNTPs Mix 0.6 μL (10 mM each), Taq DNA Polymerase 0.6 μL (5U / μl), ycf1-5 forward primer 0.4 μL (10 μM), ycf1-5 reverse primer 0.4 μL (10 μM), or ZDJ-190 forward primer 0.4 μL (10 μM), ycf1-5 reverse primer 0.4 μL (10 μM), template DNA 2.0 μL (20 ng);
[0017] Reaction amplification program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 2 min, for 40 cycles; finally extension at 72°C for 10 min and storage at 4°C.
[0018] Specific primers for identifying four Camellia oleifera species, including amplification primer ycf1-5 and amplification primer ZDJ-190, wherein the amplification primer ycf1-5 is used to detect SNP1, SNP2 and InDel 1, and the amplification primer ZDJ-190 is used to detect InDel2;
[0019] The ycf1-5 includes:
[0020] Forward primer (No. 1): 5'TGACCTCTTAACCAGTTTTTCCA3'
[0021] Reverse primer (no. 2): 5′TGGATTATCAAGGGCATTCCGT′;
[0022] The ZDJ-190 includes:
[0023] Forward primer (No. 3): 5'AAAGAGCGTGGAGGTTCGAG3'
[0024] Reverse primer (no. 4): 5'GACTGGGTGGTCGAGTCATG'.
[0025] The benefits of the present invention are that the specific molecular markers are not affected by the environment, do not require the plants to bloom and bear fruit, and only require a trace amount of fresh tissue samples or silica gel rapid drying tissue samples to accurately and efficiently identify plant germplasm resources. Through chloroplast genome sequencing and comparative analysis of four species, including small-fruit camellia, common camellia, fragrant flower camellia, and Vietnamese camellia, the present invention has developed two chloroplast sequence SNP markers and two InDels markers for the identification of Vietnamese camellia, fragrant flower camellia, small-fruit camellia, and common camellia resources. By detecting these marker combinations, small-fruit camellia, common camellia, fragrant flower camellia, and Vietnamese camellia germplasm materials can be quickly and accurately identified. This patent provides technical support for the healthy development of China's camellia industry, and is of great significance in studying the origin and evolution of camellia resources and molecular breeding of camellia.
[0026] In order to make the above and other purposes, features and advantages of the present invention more obvious and easy to understand, preferred embodiments are specifically cited below and described in detail with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0028] Figure 1 This is a gel image of the amplified product of ycf1-5 in the embodiment;
[0029] Figure 2 This is a gel image of the amplified product of ZDJ-190 in the example;
[0030] Figure 3 It is the result diagram of the base peak of the marked sequencing part;
[0031] Figure 4 This is the UPGMA cluster tree analysis result diagram. DETAILED DESCRIPTION
[0032] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0033] Example 1: Molecular identification of germplasm resources of different Camellia oleifera species
[0034] 1. Select experimental materials
[0035] Camellia oleifera species distributed in South China were selected, including Camellia oleifera from 7 populations in Hainan Province, 2 populations in Guangdong Province and 3 populations in Guangxi Zhuang Autonomous Region, Camellia oleifera from 1 population in Guangxi Zhuang Autonomous Region, Camellia oleifera from 2 populations in Guangxi Zhuang Autonomous Region, Camellia oleifera from 2 populations in Guangxi Zhuang Autonomous Region and 1 population in Jiangxi Province. Five samples were sequenced from each population, for a total of 90 samples. They were used for SNP and Indel specific marker verification.
[0036] 2.SNP and Indel marker detection
[0037] 2.1 The total DNA of the above-mentioned experimental materials, Camellia oleifera samples, was extracted using the modified CTAB method;
[0038] 2.2 The DNA of the oil-tea camellia sample extracted in step 2.1 was used as the amplification template and the specific marker primers ycf1-5 were developed.
[0039] and ZDJ-190 as amplification primers for PCR amplification;
[0040] 2.3 PCR reaction system (30 μL): 23.0 μL ddH2O, 3.0 μL 10× Taq Buffer (Mg2+plus), 0.6 μL dNTPs Mix (10 mM each), 0.6 μL Taq DNA Polymerase (5U / μl), 0.4 μL ycf1-5 forward primer (10 μM), 0.4 μL ycf1-5 reverse primer (10 μM), or 0.4 μL ZDJ-190 forward primer (10 μM), 0.4 μL ycf1-5 reverse primer (10 μM), 2.0 μL template DNA (20 ng); reaction amplification program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 2 min, for 40 cycles; final extension at 72°C for 10 min, and storage at 4°C.
[0041] The PCR amplification products were electrophoresed on 1.5% agarose gel (containing 8% Goldview nucleic acid dye) in 0.5×TBE buffer at 100 V for 40 min. The gel running results were photographed and recorded in a gel imaging system.
[0042] 2.5 The above PCR products were sequenced using the conventional Sanger first generation sequencing method.
[0043] Specific primers for identifying four Camellia oleifera species, including amplification primer ycf1-5 and amplification primer ZDJ-190, wherein the amplification primer ycf1-5 is used to detect SNP1, SNP2 and InDel 1, and the amplification primer ZDJ-190 is used to detect InDel2;
[0044] The ycf1-5 includes:
[0045] Forward primer (No. 1): 5'TGACCTCTTAACCAGTTTTTCCA3'
[0046] Reverse primer (no. 2): 5′TGGATTATCAAGGGCATTCCGT′;
[0047] The ZDJ-190 includes:
[0048] Forward primer (No. 3): 5'AAAGAGCGTGGAGGTTCGAG3'
[0049] Reverse primer (no. 4): 5'GACTGGGTGGTCGAGTCATG'.
[0050] 3. Identification results. The sequencing results were analyzed to find the SNPs and InDels mentioned above, and to identify the Vietnamese camellia, fragrant flower camellia, small fruit camellia and common camellia germplasm materials. The test results are shown in Table 1. Figure 1 , Figure 2 and Figure 3 As shown:
[0051] Table 1 Specific SNP and Indel analysis table for identifying different Camellia oleifera species resources
[0052]
[0053]
[0054]
[0055] Table 1 clearly shows that: in the 90 test materials, the 404th and 645th positions of the target fragment amplified by primer ycf1-5 are both "T" bases, and the other test species are "C" and "A" respectively, based on which the germplasm material can be accurately identified as Camellia oleifera; the 715-720th position of the target fragment amplified is InDel 1, and if the germplasm material to be tested lacks the "TCTTTT" sequence at this position, the germplasm material can be accurately identified as Camellia oleifera. When the test material excludes the test germplasm material from Camellia oleifera and Camellia oleifera based on the sequencing results of the amplified product of primer ycf1-5, PCR amplification is continued with the DNA of the test sample as the amplification template and the ZDJ-190 primer as the amplification primer. The 216-220th position of the amplified fragment is InDel 2 after sequencing. The test germplasm material with the "AGTAC" sequence missing at this position is Camellia oleifera, and the one without the "AGTAC" sequence is Camellia oleifera.
[0056] Depend on Figure 1 , Figure 2 and Figure 3 It can be clearly shown that: The results show that the length of the chloroplast gene fragment amplified by primer ycf1-5 is about 827 bp, and the length of the chloroplast gene fragment amplified by primer ZDJ-190 is about 520 bp (see Appendix Figure 1 ). The chloroplast gene fragment amplified by primer ycf1-5 has two SNP sites (SNP1 and SNP2) and one InDel site (InDel 1). The sites of the amplified target fragments SNP1 and SNP2 are both "T" bases, based on which the germplasm material can be accurately identified as Camellia oleifera; the 715-720 sites of the amplified target fragment are InDel 1. If the germplasm material to be tested lacks the "TCTTTT" sequence at this site, the germplasm material can be accurately identified as Camellia oleifera. The chloroplast gene fragment amplified by primer ZDJ-190 has InDel2, which can effectively distinguish between common Camellia oleifera and Vietnamese Camellia oleifera. Vietnamese Camellia oleifera lacks the "AGTAC" sequence at this site, while those without the missing "AGTAC" sequence are common Camellia oleifera (see attached). Figure 2 ). The results show that the amplification primers ycf1-5 and ZDJ-190 specific markers invented in this patent can identify four species of Camellia oleifera resources.
[0057] Figure 4The results of UPGMA cluster tree analysis were used to construct a cluster tree of 18 populations. When the genetic distance was 0.002, small-fruited camellia (CKX and HCX) clustered into group Ⅰ; common camellia (HZP, TPY and YML) clustered into group Ⅱ; when the genetic distance was 0.001, fragrant flower camellia (SNH) and Vietnamese camellia (XYL, ZX, WSG, TJG, MP, MNL, LS, LJTL, JX and FH) were distinguished. The results showed that this method can effectively identify the germplasm resources of small-fruited camellia, common camellia, fragrant flower camellia and Vietnamese camellia, and the invented ycf1-5 and ZDJ190 specific SNP markers and Indel markers are effective, accurate and reliable.
[0058] The present invention uses specific embodiments to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core idea. At the same time, for those skilled in the art, according to the idea of the present invention, there will be changes in the specific implementation methods and application scope. In summary, the content of this specification should not be understood as a limitation on the present invention. SEQUENCE LISTING <110> Institute of Tropical Horticulture, Hainan Academy of Agricultural Sciences <120> Identification methods of Vietnamese camellia, fragrant flower camellia, small fruit camellia and common camellia <130> 2024.12.05 <160> 4 <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> DNA <213> Synthesis <400> 1 tgacctctta accagttttt cca 23 <210> 2 <211> twenty two <212> DNA <213> Synthesis <400> 2 tggattatca agggcattcc gt 22 <210> 3 <211> 20 <212> DNA <213> Synthesis <400> 3 aaagagcgtg gaggttcgag 20 <210> 4 <211> 20 <212> DNA <213> Synthesis <400> 4 gactgggtgg tcgagtcatg 20
Claims
1. A specific primer set for identifying SNP sites and InDel sites in the chloroplast genome of four Camellia oleifera species germplasm materials, namely, Camellia oleifera, Camellia oleifera, Camellia oleifera and Camellia oleifera, characterized in that: The primer set includes the following primer pairs: The primer pair ycf1-5 included, forward primer: 5'TGACCTCTTAACCAGTTTTTCCA3', reverse primer: 5'TGGATTATCAAGGGCATTCCGT3'; Primer pair ZDJ-190 included, forward primer: 5′AAAGAGCGTGGAGGTTCGAG3′, reverse primer: 5′GACTGGGTGGTCGAGTCATG3′; Among them, the SNP sites include SNP1 and SNP2, the InDel sites include InDel 1 and InDel 2, SNP1 and SNP2 are located in the ycf1 gene region, InDel 1 is located in the ycf1 gene region, the primer pair ycf1-5 identifies SNP1, SNP2 and InDel1, the InDel 2 is located in the ycf15_trnL-CAA gene interval sequence, and the primer pair ZDJ-190 identifies InDel 2.
2. A method for identifying or assisting in identifying Vietnamese camellia, fragrant flower camellia, small fruit camellia, and common camellia, characterized in that: The steps include: S1. Extract the total genomic DNA of the tested common camellia, small-fruit camellia, fragrant flower camellia, and Vietnamese camellia germplasm resources; S2, using the DNA of the sample to be tested extracted in step S1 as an amplification template, and using the primer pair ycf1-5 described in claim 1 to perform PCR amplification on the DNA of the sample to be tested; S3. Detection of PCR amplification products: The PCR amplification products were electrophoresed on 1.5% agarose gel in 0.5×TBE buffer at 100 V for 40 min. The agarose gel contained 8% Goldview nucleic acid dye. The gel running results were photographed and recorded in a gel imaging system. With 100 bp DNA as the marker, there was only one amplification product band with a band size of about 827 bp, which was the target band. S4, sequencing the PCR product of S3, the sequencing method is Sanger first generation conventional sequencing, the 404th and 645th positions of the amplified target fragment are SNP 1 and SNP 2, if the bases at these two points of the germplasm material to be tested are both "T", based on this, the germplasm material can be accurately identified as Camellia oleifera, and other tested species have "C" on SNP 1 and "A" on SNP 2; the 715-720th position of the amplified target fragment is InDel 1, if the germplasm material to be tested lacks the "TCTTTT" sequence at this position, based on this, the germplasm material can be accurately identified as Camellia oleifera; S5. When the germplasm material to be tested is excluded as not belonging to Camellia oleifera and Camellia oleifera based on the test result of S4, continue to use the DNA of the sample to be tested extracted in step S1 as an amplification template and use the primer pair ZDJ-190 described in claim 1 to perform PCR amplification on the DNA of the sample to be tested; The PCR amplification method was the same as that of S2. The amplified product was only one band, and the band size was about 520 bp, which was the target band. S6. Sequence the PCR product in S5 using the conventional Sanger first generation sequencing method. The 216-220th position of the amplified fragment is the InDel 2 position. The germplasm material to be tested that lacks the "AGTAC" sequence is Vietnamese camellia oleifera, and the one that does not lack the "AGTAC" sequence is common camellia oleifera.
3. The method for identifying or assisting in identifying Vietnamese camellia, fragrant flower camellia, small fruit camellia, and common camellia according to claim 2, characterized in that: In the PCR amplification method: PCR reaction system: volume is 30 μL, including 23.0 μL of ddH2O, 3.0 μL of 10× Taq Buffer, 0.6 μL of dNTPs Mix, 0.6 μL of Taq DNA Polymerase, 0.4 μL of ycf1-5 forward primer, 0.4 μL of ycf1-5 reverse primer, or 0.4 μL of ZDJ-190 forward primer, 0.4 μL of ycf1-5 reverse primer, and 2.0 μL of template DNA; PCR amplification program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 2 min, for 40 cycles; finally extension at 72°C for 10 min and storage at 4°C.