A kit for simultaneous detection of seven influenza viruses

Abstract

The present invention relates to a kit for simultaneously detecting seven influenza viruses, the kit comprising primer probes and other related reagents. The beneficial effects of the present invention are as follows: 1. The kit can simultaneously detect influenza A virus (IFV-A, H1N1, H1N2, H3N2); influenza B virus (IFV-B); respiratory syncytial virus (RSV-A, RSV-B) in clinical samples. 2. Detection sensitivity: 5×10 3 3. The compliance rate and precision test are both 100%. 4. There is no cross-reaction between the test items of this kit; a small amount of blood, purulent secretions, low-concentration antibiotics, antiviral drugs and other potential interferences have no obvious effect on the test results.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to the technical field of a kit for simultaneously detecting seven influenza viruses. Background Art

[0002] Influenza A virus (IFV-A, H1N1, H1N2, H3N2) belongs to the genus Influenza A virus of the family Orthomyxoviridae. Influenza A virus is a common influenza virus. Influenza A virus is most likely to mutate. The subtype of Influenza A virus is called "bird flu". Bird flu is an acute infectious disease caused by avian influenza virus. After the virus gene mutates, it can infect humans. The symptoms after infection are mainly high fever, cough, runny nose, myalgia, etc. Most of them are accompanied by severe pneumonia. In severe cases, multiple organ failure such as heart and kidney leads to death, and the mortality rate is very high. The disease can be transmitted through multiple pathways such as the digestive tract, respiratory tract, skin damage and conjunctiva. The movement of people and vehicles is an important factor in the spread of the disease.

[0003] Influenza B virus (abbreviated as IFV-B) belongs to the genus Influenza B virus of the family Orthomyxoviridae. Influenza virus (family Orthomyxoviridae) is a single-stranded RNA membrane virus, and its RNA contains eight segments. The genetic structure of influenza virus enables it to continuously exchange gene segments and thus form dominant mutations. According to the nucleoprotein and membrane surface protein antigens, influenza viruses are divided into three types: A, B, and C. Pigs and poultry can carry influenza A, while human influenza B and C are only transmitted between humans. The clinical symptoms of influenza A and influenza B are similar, but the hospitalization rate caused by influenza A virus is four times that of influenza B virus. Influenza B usually has myositis and gastrointestinal symptoms.

[0004] Respiratory syncytial virus (RSV-A, B) is an RNA virus belonging to the family Paramyxoviridae. Respiratory syncytial virus infection is distributed worldwide, with frequent occurrences in winter and spring, and sometimes periodic epidemics, with the peak of epidemics from January to March. Outbreaks are prone to occur in families, kindergartens and nurseries. The disease is transmitted through air droplets and close contact. It is more common in newborns and infants under 6 months old. The incubation period is 3 to 7 days. Infants and young children have more severe symptoms, which may include high fever, rhinitis, pharyngitis and laryngitis, and later manifest as bronchiolitis and pneumonia. A small number of sick children may have complications such as otitis media, pleurisy and myocarditis. After infection, adults and older children mainly present with upper respiratory tract infections. Clinical diagnosis can be made by isolating the virus and performing serum binding and neutralization experiments, and using immunofluorescence technology to examine viral antibodies in rhinitis secretions, which can be quickly diagnosed.

[0005] The above viruses need to be accurately detected and there are time requirements. Therefore, it is necessary to design a test kit that can detect the above seven viruses at the same time, which becomes a technical problem that needs to be solved. Summary of the invention

[0006] The present invention is to solve the above problems and defects and provides a kit for simultaneously detecting seven influenza viruses.

[0007] The present invention is implemented by the following technical solution.

[0008] A kit for simultaneously detecting seven influenza viruses, the kit comprising the following primer pairs and probes:

[0009] IFV-AF: 5'-CGGAGGACTTGAATGGAATGGTAAC-3';

[0010] IFV-AR-cy3: 5'-CTGCTCTGGAGGTAGTGAAGGTC-3';

[0011] IFV-A-Probe: 5'-GAGATTCGCTTGGAGAAACTGTGATGAGA-3';

[0012] IFV-BF: 5'-GGAAGGCTTGTTGCCTAAACTTGTTG-3';

[0013] IFV-BR-cy3: 5'-CTGGTGATAATCGGTGCTCTTGAC-3';

[0014] IFV-B-Probe: 5'-CTCAACTCACTCTTCGAGCGTCTTAATGA-3';

[0015] H1N1-H1-F-1-R: 5'-TGCTGGATCTGGTATTATC-3';

[0016] H1N1-H1-R-1-CY3-R: 5'-TGGGAGGCTGGTGTTTATAG-3';

[0017] H1N1-H1-Probe: 5'-GCAATACAACTTGTCAGACACCCAAGGG-3';

[0018] H1N2-HA-F-1-R: 5'-CACAATGGGAAGCTGTGC-3';

[0019] <h2 style=";text-align:left;direction:ltr">H1N2-HA-R-1-CY3-R:5'-TGATTTTCTTGGAAATCAGTGAT-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0020] <h2 style=";text-align:left;direction:ltr"> H1N2-HA-Probe:5'-GCGTTGCTGGATGGATATTAGGAAACCC-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0021] <h2 style=";text-align:left;direction:ltr"> H3N2-H3-F-1-R:5'-GCAGCAAAGCCTACAGCAAC-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0022] <h2 style=";text-align:left;direction:ltr"> H3N2-H3-R-1-CY3-R:5'-CCGGATGAGGCAACTAGTGA-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0023] <h2 style=";text-align:left;direction:ltr"> H3N2-H3-Probe:5'-CCTTATGATGTGCCCGGATTATGCCTCC-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0024] <h2 style=";text-align:left;direction:ltr"> H3N2-N2-F-1-R:5'-TGGGAACCAAACAAGTGTGC-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0025] <h2 style=";text-align:left;direction:ltr"> H3N2-N2-R-1-CY3-R:5'-TATCATCCCCAGTGACACAG-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0026] <h2 style=";text-align:left;direction:ltr"> H3N2-N2-Probe:5'-CCAGCTCAAGTTGCCATGATGGGAAAG-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0027] <h2 style=";text-align:left;direction:ltr"> RSV-AF:5'-GCCACATTTACATTCCTGGTCAAC-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0028] <h2 style=";text-align:left;direction:ltr"> RSV-AR-cy3:5'-GTGTGTGCTTTGTAGGCTTAATGC-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0029] <h2 style=";text-align:left;direction:ltr"> RSV-A-Probe:5'-GAAATGAAACTATTGCACAAAGTGGGAAGC-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0030] <h2 style=";text-align:left;direction:ltr"> RSV-BF:5'-AGATGAAGCTATTTGCACAAAGTAGG-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0031] <h2 style=";text-align:left;direction:ltr"> RSV-BR-cy3:5'-ACCCGCCATGATTGATAAATATAGG-3';<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0032] <h2 style=";text-align:left;direction:ltr"> RSV-B-Probe:5'-ACCAAATACAAGAAATACACTGAATATAATACA-3'。<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0033] The kit of the present invention comprises the following primer pairs and probes:

[0034] IC-F: 5'-GGGGTGTTGAAGGTCTCAAA-3';

[0035] IC-R-CY3: 5'-GGCATCCTCACCCTGAAGTA-3';

[0036] IC-probe: 5'-GCTCATTGTAGAAGGTGTGGTGCCAGA-3'.

[0037] The kit of the present invention comprises the following probes: HC-probe: 5'-ACTTCAGGGTGAGGATGCC-3'.

[0038] The kit of the present invention comprises a gene chip.

[0039] The kit of the present invention comprises a PCR amplification reagent mixture: dNTP and a buffer system.

[0040] The kit of the present invention comprises an enzyme mixture: Hot start Taq enzyme and reverse transcriptase.

[0041] The kit of the present invention comprises a hybridization buffer solution: Tris-Hcl, TritonX-100, and NaCl.

[0042] The kit of the present invention comprises negative reference substances: purified water and positioning points.

[0043] The kit of the present invention comprises 20×SSC and 10% SDS.

[0044] The kit of the present invention comprises operating instructions.

[0045] The beneficial effects of the present invention are as follows: 1. The kit can simultaneously detect influenza A virus (IFV-A, H1N1, H1N2, H3N2); influenza B virus (IFV-B); respiratory syncytial virus (RSV-A, RSV-B) in clinical samples. 2. Detection sensitivity: 5×10 3 3. The compliance rate and precision test are both 100%. 4. There is no cross-reaction between the test items of this kit; a small amount of blood, purulent secretions, low-concentration antibiotics, antiviral drugs and other potential interferences have no obvious effect on the test results.

[0046] The present invention is further explained below in conjunction with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 This is a diagram of the detection results of the gene chip of the present invention.

[0048] Figure 2 This is a diagram of the detection results of the gene chip of the present invention.

[0049] Figure 3 This is a diagram of the detection results of the gene chip of the present invention.

[0050] Figure 4 This is a diagram of the detection results of the gene chip of the present invention.

[0051] Figure 5 This is a diagram of the detection results of the gene chip of the present invention.

[0052] Figure 6 This is a diagram of the detection results of the gene chip of the present invention.

[0053] Figure 7 This is a diagram of the detection results of the gene chip of the present invention.

[0054] Figure 8 This is a diagram of the detection results of the gene chip of the present invention.

[0055] Fig. 9 This is a diagram of the detection results of the gene chip of the present invention.

[0056] Fig.10 This is a diagram of the detection results of the gene chip of the present invention.

[0057] Fig.11 This is a diagram of the detection results of the gene chip of the present invention.

[0058] Fig.12 This is a diagram of the detection results of the gene chip of the present invention.

[0059] Fig.13 This is a diagram of the detection results of the gene chip of the present invention.

[0060] Fig.14 This is a diagram of the detection results of the gene chip of the present invention.

[0061] Fig.15 This is a diagram of the detection results of the gene chip of the present invention.

[0062] Fig.16 This is a diagram of the detection results of the gene chip of the present invention.

[0063] Fig.17 This is a diagram of the detection results of the gene chip of the present invention.

[0064] Fig.18 This is a diagram of the detection results of the gene chip of the present invention.

[0065] Fig.19 This is a diagram of the detection results of the gene chip of the present invention.

[0066] Fig. 20 This is a diagram of the detection results of the gene chip of the present invention.

[0067] Fig.21 This is a probe layout diagram of the gene chip of the present invention. DETAILED DESCRIPTION

[0068] This kit uses DNA polymerase chain reaction (PCR) technology to amplify and fluorescently label the sample to be tested, hybridize the amplified labeled product with the specific probe on the gene chip, obtain the hybridization data through a fluorescent scanning device, and analyze the test data to determine whether the sample to be tested contains influenza A virus (IFV-A, H1N1, H1N2, H3N2), influenza B virus (IFV-B), respiratory syncytial virus (RSV-A, B), so as to perform qualitative analysis.

[0069]

Sample requirements

[0070] 1. Collection: respiratory specimens.

[0071] 1.1 Throat swab sampling: Ask the patient to tilt his head back slightly, open his mouth wide, and make an "ah" sound to expose the pharyngeal tonsils on both sides. Hold the swab and wipe the pharyngeal tonsils on both sides of the patient with a little force back and forth at least 3 times, then wipe up and down the posterior pharyngeal wall at least 3 times, and place the swab into the sampling tube.

[0072] 2 Storage: The samples to be tested should not be stored for more than 24 hours at 2-8℃, and should not be stored for more than three months at -18℃ or below; they should be stored for a long time at -70℃. Repeated freezing and thawing should be avoided.

[0073] 3. Transportation: Use ice in curling bottles or sealed foam boxes with ice for transportation.

[0074]

Test method

[0075] 1Instruments and consumables

[0076] 1.1 Sterile operating table and biological safety cabinet;

[0077] 1.2 Gene amplification (PCR) instrument (applicable to 0.2ml PCR thin-walled tube);

[0078] 1.3 Sampler (0.5-10μl, 40-200μl, 200-1000μl);

[0079] 1.4 Benchtop centrifuge (speed up to 12,000rpm);

[0080] 1.5 Adjustable 42℃ constant temperature hot plate

[0081] 1.6 Water bath chip elution instrument (can maintain constant temperature at 42°C);

[0082] 1.7 Slide rack;

[0083] 1.8 chip laser scanner (Axon GenePix 4000A / B);

[0084] 1.9 Disposable consumables required for PCR amplification.

[0085] 2. Preparation before testing

[0086] 2.1 Preparation of chip eluent (If 10% SDS shows white flocculent precipitation, please heat it at 42°C until the solution is transparent before use)

[0087] 2.1.1 Prepare eluent I in the chip elution container according to the ratio of distilled water (or purified water): 20×SSC:10%SDS=100:5:1. The total volume of the eluent should be sufficient to immerse the chip;

[0088] 2.1.2 Prepare eluent II in the chip elution container according to the ratio of distilled water (or purified water): 20×SSC:10%SDS=400:1:4. The total volume of the eluent should be sufficient to immerse the chip;

[0089] 2.1.3 The eluent can be used continuously for 15 days after being prepared once.

[0090] 3. Sample processing

[0091] The following only describes the thermal lysis method for extracting the target DNA. Commercially available magnetic beads or centrifugal column nucleic acid extraction kits can also be used.

[0092] 3.1 Add 1 ml of 1×TE solution to the sampling tube and shake thoroughly to mix;

[0093] 3.2 Transfer all the liquid into a sterile 1.5 ml centrifuge tube and centrifuge at 12,000 rpm for 5 minutes;

[0094] 3.3 Discard the supernatant, add 100 μl of nucleic acid extraction solution to the precipitate (or 5 μl of negative reference), shake and mix (for more than 30 seconds), and then keep at 100°C for 10 minutes (the error should not exceed 1 minute);

[0095] 3.4 After oscillation and mixing (more than 30 seconds), centrifuge at 12,000 rpm for 5 minutes. The supernatant is the clinical sample DNA (or reference sample template);

[0096] 4 PCR amplification and labeling

[0097] The amplification-labeling reaction system was prepared according to the table below, and amplification and labeling were performed in a 0.2 ml PCR thin-walled tube according to the cycle parameters.

[0098]

[0099] 5. Hybridization

[0100] 5.1 The constant temperature hot plate is raised to a constant temperature of 42°C, and the chip is fixed using the hybridization module preheated at 42°C.

[0101] 5.2 Heat the PCR product to 95°C (in a PCR instrument) for 5 min and immediately place it in an ice bath for 3 min.

[0102] 5.3 Take 75 μl of hybridization buffer and add it to the clinical sample amplification reaction tube and mix thoroughly. Add the mixture from the sample addition hole into the corresponding microarray reaction chamber (do not touch the microarray area during the operation to avoid dripping the mixed solution onto the hybridization module surface) and hybridize for 60 minutes.

[0103] 6. Elution

[0104] Before elution, preheat the elution solution at 37°C, carefully remove the chip from the hybridization module, immediately place it in the elution container, and wash at 42°C.

[0105] Elution process: Elution solution I, elution by shaking for 1 minute; Elution solution II, elution by shaking for 1 minute. After elution, let the chip dry naturally or spin dry at a low speed before scanning.

[0106] 7 Scanning and result determination

[0107] 7.1 Place the dried chip in a laser scanner and scan with a 532nm wavelength laser (follow the instructions) to obtain scanning spectra and data.

[0108] 7.2 Analyze the test data according to the requirements of the instructions and generate a test report (to simplify the operation, data interpretation can be carried out using data-assisted analysis software).

[0109] [Positive judgment value]

[0110] 1 judgment value

[0111] 1.1 Chip probe layout Fig.21 As shown, BC is a blank point, IC is an extraction control and positive control probe, HC is a hybridization control probe, IFV-A, H1N1, H1N2, H3N2 are detection probes for influenza A virus; IFV-B is a detection probe for influenza B virus; RSV-A is a detection probe for respiratory syncytial virus A; RSV-B is a detection probe for respiratory syncytial virus B;

[0112]

[0113]

[0114] 1.2 For any probe site, if the median fluorescence value is ≥1.5 times the median fluorescence background value, the site is judged as "positive", otherwise the site is judged as "negative".

[0115] 2. Result interpretation steps

[0116] 2.1 Determine NC: If both repeat sites are negative, proceed to step 2.2, otherwise the result is "failed";

[0117] 2.2 Determine IC: If both repeat sites are positive, proceed to step 2.3, otherwise the result is "failed";

[0118] 2.3 HC judgment: If both of its two repeat sites are positive, proceed to step 2.4 for interpretation, otherwise the result is judged as "failure";

[0119] 2.4 Determination of pathogen detection probes: For example, if the IFV-B probe has two repeat sites that are both positive, the result of influenza B virus detection is judged to be "positive", otherwise the result is judged to be "negative";

[0120] 2.5 Repeat step 2.4 to interpret the scanning data of the pathogen probe;

[0121] 2.6 Organize the interpretation results and generate the test report.

[0122]

[0123]

[0124] Interpretation of test results

[0125] 1. The NC (negative control probe) does not meet the requirements and is caused by a problem in the detection system.

[0126] 2. If the IC (extraction control and internal control probe) is judged as "positive", it means that the sample contains human genomic RNA; if the probe is judged as "negative", it means that insufficient human exfoliated cells may have been collected during sample collection or there may be problems with the nucleic acid extraction and PCR amplification system. It is recommended to resample and test.

[0127] 3. The reading is "failed" due to the HC (hybridization positive control probe) not meeting the requirements, which is caused by problems in the hybridization system.

[0128] 4. When testing negative quality control, the IC reading should be positive and the other pathogen probes should be negative, otherwise it indicates that the amplification system is contaminated.

[0129] 5. For a pathogen detection probe, if only one of the two repeated sites meets the "positive" requirement, retesting is required; if this problem occurs repeatedly, please contact the kit manufacturer.

[0130]

Special instructions for this kit

[0131] 1The test result only indicates whether the specimen contains pathogen nucleic acid and cannot distinguish between active and inactive pathogens.

[0132] 2. Improper specimen collection, storage and transportation or pathogen concentration below the detection limit may lead to false negative results.

[0133] The above are only some specific embodiments of the present invention, and the known specific contents or common sense in the scheme are not described in detail here. It should be pointed out that the above embodiments do not limit the present invention in any way. For those skilled in the art, any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims. <110> Jilin University <120> A kit for simultaneous detection of seven influenza viruses <160> 28 <210> 1 <211> 25 <212> DNA <213> Artificial sequence <400> 1 CGGAGGACTTGAATGGAATGGTAAC <210> 2 <211> twenty three <212> DNA <213> Artificial sequence <400> 2 CTGCTCTGGAGGTAGTGAAGGTC <210> 3 <211> 25 <212> DNA <213> Artificial sequence <400> 3 GGAAGGCTTGTTGCTAAACTTGTTG <210> 4 <211> twenty four <212> DNA <213> Artificial sequence <400> 4 CTGGTGATAATCGGTGCTCTTGAC <210> 5 <211> 19 <212> DNA <213> Artificial sequence <400> 5 TGCTGGATCTGGTATTATC <210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 TGGGAGGCTGGTGTTTATAG <210> 7 <211> 18 <212> DNA <213> Artificial sequence <400> 7 CACAATGGGAAGCTGTGC <210> 8 <211> twenty two <212> DNA <213> Artificial sequence <400> 8 TGATTTCTTGGAAATCAGTGAT <210> 9 <211> 20 <212> DNA <213> Artificial sequence <400> 9 GCAGCAAAGCCTACAGCAAC <210> 10 <211> 20 <212> DNA <213> Artificial sequence <400> 10 CCGGATGAGGCAACTAGTGA <210> 11 <211> 20 <212> DNA <213> Artificial sequence <400> 11 TGGGAACCAAACAAGTGTGC <210> 12 <211> 20 <212> DNA <213> Artificial sequence <400> 12 TATCATCCCCAGTGACACAG <210> 13 <211> twenty four <212> DNA <213> Artificial sequence <400> 13 GCCACATTTACATTCCTGGTCAAC <210> 14 <211> twenty four <212> DNA <213> Artificial sequence <400> 14 GTGTGTGCTTTGTAGGCTTAATGC <210> 15 <211> 25 <212> DNA <213> Artificial sequence <400> 15 AGATGAAGCTATTGCACAAAGTAGG <210> 16 <211> 25 <212> DNA <213> Artificial sequence <400> 16 ACCCGCCATGATTGATAAATATAGG <210> 17 <211> 20 <212> DNA <213> Artificial sequence <400> 17 GGGGTGTTGAAGGTCTCAAA <210> 18 <211> 20 <212> DNA <213> Artificial sequence <400> 18 GGCATCCTCACCCTGAAGTA <210> 19 <211> 29 <212> DNA <213> Artificial sequence <400> 19 GAGATTCGCTTGGAGAAACTGTGATGAGA <210> 20 <211> 29 <212> DNA <213> Artificial sequence <400> 20 CTCAACTCACTCTTCGAGCGTCTTAATGA <210> twenty one <211> 30 <212> DNA <213> Artificial sequence <400> twenty one GAAATGAAACTATTGCACAAAGTGGGAAGC <210> twenty two <211> 33 <212> DNA <213> Artificial sequence <400> twenty two ACCAAATACAAGAAATACACTGAATATAATACA <210> twenty three <211> 28 <212> DNA <213> Artificial sequence <400> twenty three GCAATACAACTTGTCAGACACCCAAGGG <210> twenty four <211> 28 <212> DNA <213> Artificial sequence <400> twenty four GCGTTGCTGGATGGATATTAGGAAACCC <210> 25 <211> 27 <212> DNA <213> Artificial sequence <400> 25 CCTTATGATGTGCCGGATTATGCCTCC <210> 26 <211> 27 <212> DNA <213> Artificial sequence <400> 26 CCAGCTCAAGTTGCCATGATGGGAAAG <210> 27 <211> 27 <212> DNA <213> Artificial sequence <400> 27 GCTCATTGTAGAAGGTGTGGTGCCAGA <210> 28 <211> 19 <212> DNA <213> Artificial sequence <400> 28 ACTTCAGGGTGAGGATGCC

Claims

1. A kit for simultaneously detecting seven viruses, characterized in that: The kit contains the following primers and probes: IFV-AF: 5'-CGGAGGACTTGAATGGAATGGTAAC-3'; IFV-AR-cy3: 5'-CTGCTCTGGAGGTAGTGAAGGTC-3'; IFV-A-Probe: 5'-GAGATTCGCTTGGAGAAACTGTGATGAGA-3'; IFV-BF: 5'-GGAAGGCTTGTTGCTAAACTTGTTG-3'; IFV-BR-cy3:5'-CTGGTGATAATCGGTGCTCTTGAC-3'; IFV-B-Probe: 5'-CTCAACTCACTCTTCGAGCGTCTTAATGA-3'; H1N1-H1-F-1-R:5'-TGCTGGATCTGGTATTATC-3'; H1N1-H1-R-1-CY3-R:5'-TGGGAGGCTGGTGTTTATAG-3'; H1N1-H1-Probe: 5'-GCAATACAACTTGTCAGACACCAAGGG-3'; H1N2-HA-F-1-R:5'-CACAATGGGAAGCTGTGC-3'; H1N2-HA-R-1-CY3-R: 5'-TGATTTCTTGGAAATCAGTGAT-3'; H1N2-HA-Probe: 5'-GCGTTGCTGGATGGATATTAGGAAACCC-3'; H3N2-H3-F-1-R:5'-GCAGCAAAGCCTACAGCAAC-3'; H3N2-H3-R-1-CY3-R:5'-CCGGATGAGGCAACTAGTGA-3'; H3N2-H3-Probe: 5'-CCTTATGATGTGCCGGATTATGCCTCC-3'; H3N2-N2-F-1-R:5'-TGGGAACCAAACAAGTGTGC-3'; H3N2-N2-R-1-CY3-R:5'-TATCATCCCCAGTGACACAG-3'; H3N2-N2-Probe: 5'-CCAGCTCAAGTTGCCATGATGGGAAAG-3'; RSV-AF: 5'-GCCACATTTACATTCCTGGTCAAC-3'; RSV-AR-cy3: 5'-GTGTGTGCTTTTGTAGGCTTAATGC-3'; RSV-A-Probe: 5'-GAAATGAAACTATTGCACAAAGTGGGAAGC-3'; RSV-BF: 5'-AGATGAAGCTATTGCACAAAGTAGG-3'; RSV-BR-cy3:5'-ACCCGCCATGATTGATAAATATAGG-3'; RSV-B-Probe: 5'-ACCAAATACAAGAAATACACTGAATATAATACA-3'.

2. The kit according to claim 1, characterized in that The kit comprises the following primer pairs and probes: IC-F: 5'-GGGGGTTGAAGGTCTCAAA-3'; IC-R-CY3:5'-GGCATCCTCACCCTGAAGTA-3'; IC-probe: 5'- GCTCATTGTAGAAGGTGTGGGTGCCAGA-3'.

3. The kit according to claim 1, characterized in that The kit contains the following probes: HC-probe: 5'-ACTTCAGGGTGAGGATGCC-3'.

4. The kit according to claim 1, characterized in that The kit comprises a gene chip.

5. The kit according to claim 1, characterized in that The kit comprises a PCR amplification reagent mixture, which includes dNTP and a buffer system.

6. The kit according to claim 1, characterized in that The kit comprises an enzyme mixture, which includes Hot start Taq enzyme and reverse transcriptase.

7. The kit according to claim 1, characterized in that The kit comprises a hybridization buffer, which includes Tris-Hcl, TritonX-100 and NaCl.

8. The kit according to claim 1, characterized in that The kit contains a negative reference: purified water.

9. The kit according to claim 1, characterized in that The kit contains 20× SSC and 10% SDS.

10. The kit according to claim 1, characterized in that The kit includes operating instructions.

Images