A transcription factor SrMYC2 for delaying stevia flowering time, its expression protein and application

Abstract

The present invention discloses a transcription factor SrMYC2 for delaying the flowering time of stevia, its expression protein and application, and belongs to the technical field of plant genetic engineering. The transcription factor SrMYC2, its nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown in SEQ ID NO.2. Yeast activity experiments show that the transcription factor has transcriptional activation activity, and more specifically, the 1-300aa segment of the protein has transcriptional activation activity; subcellular localization shows that the protein encoded by the gene is mainly located in the nucleus. Based on the functional identification of Arabidopsis transgenic plants, it was found that the transgenic strain has a late flowering phenotype. Based on this characteristic, it can provide a certain reference for extending the vegetative growth time of stevia and thus increasing the yield of stevia leaves and glycosides.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and more specifically relates to a transcription factor SrMYB1 for delaying the flowering time of stevia, an expression protein thereof and an application thereof. Background Art

[0002] Obesity and its complications caused by excessive sugar intake are receiving more and more attention, and the use of low-calorie sugar substitutes has gradually become a trend in healthy living. Although both have the characteristics of high sweetness and low calories, plant-derived natural sweeteners such as stevioside are more popular with consumers than artificial sweeteners (such as aspartame and acesulfame potassium), and are currently widely used in food, beverages, and medicine.

[0003] Stevioside is a kind of glycoside rich in the perennial herbaceous plant Stevia rebaudiana ( Stevia rebaudiana Bertoni) leaves. More than 30 types of glycosides have been discovered so far, of which RA glycosides are the main type used in the market. With the popularization of healthy eating habits, the consumption of steviosides has also been increasing year by year, so how to increase the production of glycosides to meet market demand has become an important research direction in this field. Because glycosides are mainly accumulated in stevia leaves and the content in other tissues is very small, and through the study of stevia's growth and development, it was found that glycoside accumulation reaches a peak in the bud stage and gradually decreases after flowering. Therefore, how to delay the flowering time of stevia and prolong its vegetative growth is regarded as an effective means to increase the yield of stevia leaves and thus increase the yield of glycosides.

[0004] MYC2 transcription factor belongs to the bHLH family and is a key transcription factor in the jasmonic acid signal transduction pathway. It is involved in various life processes of plants, including biotic and abiotic stresses, secondary metabolic synthesis and aging regulation. However, its function in stevia has not been reported. Summary of the invention

[0005] The purpose of the present invention is to provide a transcription factor gene for delaying the flowering time of stevia SrMYB1 The invention provides a selectable candidate gene for regulating the flowering time of stevia, and can extend the vegetative growth time and thus increase the yield of stevia leaves and glycosides by overexpressing the gene in stevia, thus having a good application prospect.

[0006] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0007] A kind of stevia SrMYC2 The gene has a nucleotide sequence as shown in SEQ ID NO.1.

[0008] Stevia SrMYC2The amino acid sequence of the expressed protein of the gene is shown in SEQ ID NO.2.

[0009] For cloning SrMYC2 The primer pair of the gene, the primer sequence of the primer pair is:

[0010] SrMYC2-F: ACAGTAAGCTTCTCCGTCGC;

[0011] SrMYC2-R:GGGGTACATTAGCACAACCG.

[0012] Containing the stevia SrMYC2 Gene vector or host bacteria.

[0013] The present invention also provides an application of a transcription factor SrMYC2 in delaying the flowering time of stevia.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention provides a new gene that regulates flowering time in stevia SrMYC2 The gene is 1815 bp long and encodes 604 amino acid residues. Yeast activation experiments showed that the protein has transcriptional activation activity, and the transcriptional activation activity segment is located in the 1-300 aa segment; subcellular localization studies showed that the protein is mainly located in the nucleus. Overexpression of this gene in Arabidopsis has the function of delaying flowering time. Therefore, Stevia SrMYC2 The gene and its encoded protein can be used for genetic improvement of stevia leaf yield and steviol glycoside content. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the structure of SrMYC2 (A) and analysis of transcriptional activity (B);

[0017] Figure 2 This is the localization map of SrMYC2 protein in tobacco epidermal cells;

[0018] Figure 3 for SrMYC2 Identification of gene overexpression phenotype: A: RT-PCR detection of wild-type and transgenic Arabidopsis positive lines (#1, #2); B: Flowering phenotype of wild-type and transgenic lines; C: Statistics of total leaf numbers of wild-type and transgenic lines at flowering; The significant symbol ** indicates P<0.01. DETAILED DESCRIPTION

[0019] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0020] Plant material:

[0021] The stevia leaves used for gene cloning were obtained from the Stevia Germplasm Resource Garden of the Institute of Botany, Chinese Academy of Sciences, Jiangsu Province. The tobacco used for subcellular localization was Nicotiana benthamiana, and the Arabidopsis thaliana used for gene function verification was Columbia type. They were all planted in an artificial climate incubator with a culture medium of vermiculite: nutrient soil = 1:1 (v / v), culture conditions of 16 h light / 8 h dark, and day and night temperatures of 23°C / 18°C.

[0022] Strains and vectors:

[0023] Escherichia coli DH5α and Agrobacterium tumefaciens EHA105 The competent strains were purchased from Weidi (Shanghai) Company. AH109 The strains, pGBKT7 and pGADT7 vectors were purchased from TaKaRa Biotechnology (Beijing) Co., Ltd. (TaKaRa, Dalian), and the pEASY-Blunt vector was purchased from Beijing Quanshijin Biotechnology Co., Ltd. The subcellular localization and Arabidopsis overexpression vector pCAMBIA1305 were stored in the laboratory.

[0024] Embodiment 1:

[0025] (1) Stevia SrMYB1 Gene cloning

[0026] The total RNA of stevia leaves was extracted using the MiniBEST Plant RNA Extraction Kit from TaKaRa, and then reverse transcribed into cDNA. SrMYC2 The full-length gene sequence was obtained, and full-length primers were designed. Then, PCR amplification was performed using KOD high-fidelity enzyme from TOYOBO. The amplified product was recovered and purified after confirmation by agarose gel electrophoresis. The purified product was then ligated with pEASY-Blunt and transformed into Escherichia coli after the reaction was completed. DH5α Competent cells were then plated on LB solid medium containing kanamycin and incubated at 37°C overnight for 12-16 h. Single clones were selected and sequenced by a sequencing company (Qingke) to obtain SrMYC2 Full-length gene sequence.

[0027] clone SrMYC2 The primers used were as follows:

[0028] SrMYC2-F: ACAGTAAGCTTCTCCGTCGC;

[0029] SrMYC2-R:GGGGTACATTAGCACAACCG.

[0030] (2) Analysis of SrMYC2 transcriptional activation activity

[0031] The full-length SrMYC2 protein was submitted to NCBI for sequence analysis, and it was found that it has two domains located in the F (1-300 aa) and R (301-604 aa) segments ( Figure 1 A). According to the location of the domain, we designed relevant primers with adapters to construct the full-length, F and R segments of the pGBKT7 vector, and transformed these three constructs and the pGBKT7 empty vector with the pGADT7 empty vector into yeast competent cells according to the operation method of the Clontech yeast transformation kit. AH109 , and then spread on SD / -Trp-Leu yeast defective medium. After inverted culture at 30℃ for about 3 days, single clones were picked and dissolved in 0.9% NaCl solution, and then spread on SD / -Trp-Leu and SD / -Trp-Leu-His-Ade yeast defective medium at different concentration gradients and inverted culture at 30℃. The results showed that the transformation progressed SrMYC2 Yeast expressing the full-length gene and the F segment could grow on SD / -Trp-Leu-His-Ade deficient medium, while yeast expressing the empty vector and the R segment could not, indicating that SrMYC2 has transcriptional activation activity and the activation segment is located in the 1-300 aa segment.

[0032] The primer sequences for adding adapters are as follows (lowercase letters represent vector homology arms):

[0033] SrMYC2-BD-F: catggaggccgaattcATGAACCACTGGACTTCCGA;

[0034] SrMYC2-BD-R: tagttatgcggccgctgcagTCATAACGGATCTGAAAATC (for full-length amplification);

[0035] SrMYC2-BD-F1: catggaggccgaattcATGAACCACTGGACTTCCGA;

[0036] SrMYC2-BD-R1: tagttatgcggccgctgcagTCAGTTAAACGATTGATTGT (for F segment amplification);

[0037] SrMYC2-BD-F2: catggaggccgaattcATGGGAACAACCGGTGGCAG;

[0038] SrMYC2-BD-R2: tagttatgcggccgctgcagTCATAACGGATCTGAAAATC (for R segment amplification).

[0039] (2) Analysis of subcellular localization of SrMYC2 protein

[0040] Using primer pairs with adapters SrMYC2 The full-length gene sequence was amplified with high fidelity, and TaKaRa Xgf The pCAMBIA1305 vector was digested with a single enzyme, and the fragment amplification product and the vector digestion product were recovered and purified by agarose gel electrophoresis, and then recombined using the recombinase of Novozymes. The recombinant product was transformed into Escherichia coli DH5α Competent cells were then plated on LB medium containing kanamycin, cultured overnight at 37°C, single clones were picked and sequenced by a sequencing company (Qingke). After sequencing, the correct construct was transformed into Agrobacterium competent cells. EHA105 Competent cells were then transfected with pCAMBIA1305- SrMYC2 The Agrobacterium containing pBAMBIA1305 and pBAMBIA1305 was transiently injected into healthy tobacco leaves grown for 3-5 weeks and labeled. After 2-3 days of normal culture, the labeled tissue was taken and the fluorescence was observed under a laser confocal microscope (Leica TCS SP5). The results showed that, unlike the empty vector, fluorescence was generated in both the nucleus and the cytoplasm. SrMYC2 The fluorescence signal of tobacco epidermal cells is mainly concentrated in the cell nucleus ( Figure 2 ), indicating that SrMYC2 protein is mainly localized in the nucleus, which is consistent with its function as a transcription factor.

[0041] The primer sequences for adding adapters are as follows (lowercase letters represent vector homology arms):

[0042] SrMYC2-GFP-F: cggagctagctctgaATGAACCACTGGACTTCCGA;

[0043] SrMYC2-GFP-R: tcgagacgtctctagaTAACGGATCTGAAAATCTTT.

[0044] (3) SrMYC2 Phenotypic identification of transgenic Arabidopsis

[0045] Using the pollen tube pathway method, the pCAMBIA1305- SrMYC2 Plasmid EHA105Agrobacterium was used to infect Columbia-type Arabidopsis, and then the plants were cultured in the dark for 20-24 hours before being cultured normally. After one week, the plants were infected again according to the same procedure, and then the seeds were collected after the pods matured. The collected seeds were sown on MS medium containing 20 mg / L hygromycin to screen T1 positive plants. The T1 positive plants were self-fertilized to obtain T2 generation and the seeds were harvested from individual plants to obtain T3 positive strains. The pure T3 strains were selected to extract RNA and reverse transcribed into cDNA for RT-PCR detection. The results showed that both wild-type and transgenic strains could amplify the reference genes of Arabidopsis. AtActin2 fragment, but only the transgenic strains can amplify SrMYC2 A fragment of Figure 3 A), indicating that the selected #1 and #2 strains are indeed SrMYC2 Gene overexpression strains. Wild-type and transgenic Arabidopsis were sown on MS medium and grown for about 10 days before being transplanted into a nutrient medium until flowering. The total number of leaves at flowering was counted, and the results showed that the total number of leaves of the transgenic strain at flowering was significantly more than that of the wild type ( Figure 3 BC), indicating overexpression SrMYC2 It has the function of delaying flowering.

[0046] The detection primer sequences are as follows:

[0047] SrMYC2-test-F:ACTTCGAGTGGCAGTAACGA;

[0048] SrMYC2-test-R: CGGAATCCGCTTTGGTCAAT. Sequence Listing <110> Institute of Botany, Chinese Academy of Sciences, Jiangsu Province <120> A transcription factor SrMYC2 for delaying stevia flowering time, its expression protein and application <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1815 <212> DNA <213> Stevia (Stevia rebaudiana) <400> 1 atgaaccact ggacttccga caaaaacgcg tcaatgatgg acgcctttat cacctccgac 60 ttgacatcca tttgggctaa tccgacgaac accgcggcga cgacggtcta cacggcgtca 120 tcatccgctt ccacctctgt tatcaacgac ttcaatcaag acacgttaca gcaacgatta 180 caaggtttga ttgatactgc acctgagtca tggacttatg ctattttctg gcaatcatca 240 attgtcgagt attccggtcc tcggatgcta gcttggggag acgggtacta caagggggag 300 atgaacaagc ttaaaacgac gccgtcggca gcttcgttgg ccgagcaaca gtaccggaaa 360 aaagtgctcc gggaactcaa ttcattgatc tccgacgtgc aggcaccgga aaatgatgtt 420 gtggatgagg aagttactga taccgagtgg ttttatctca tctccatgac gcagtctttt 480 ctcaacggcg acggacttcc tggtcaagcg gcgttgacca atcaaccggt ttgggttgtc 540 gggcgggaac ggctgatgac gtctcactgc gagagagttc gtcaaggtca agttttcggg 600 ttacagacga tggtgtgtat accatctgcc ggtggggtta ttgaattagg ttcaacagac 660 ttgatttttc agagtttgga tgtgatgaag aaagttaggg tttcgtttaa taccaatttt 720 aacgatgcaa tgcaaaccaa cacaaatcaa gtcaccggag gtgacactga tccgttgccg 780 tttctgttaa cggatccggt agctcatct gatgtgacga caagcgtcat tccatcaatc 840 aaccctaaat cattatctga caacctga tctgttctta actacaatca atcgtttaac 900 ggaacaaccg gtggcaggaa tggtattct acggataata aaccggaatc tggcaagtt 960 ttgaatttca cgggagcagt ggagaataat atacgaaca agagagag atccccgact 1020 tcgagtggca gtaacgaaca cgggatggat actttctcg ccggcgtgct tccatcgtct 1080 ggtactgtga aatccggcgg tggcgcattg accaagcgg attccggcaa atccgacctc 1140 aatgcagctg taatccgaga agtgaaagcc agcacagtgg tggaactgga gagaaaccg 1200 agaaaaagag gagaaaacc ggcgaacggg agagagac cattgaatca tgttgaagca 1260 gagagacaaa gagagagaa actaaaccaa cgattctacg cgctccgtgc agtcgtcccc 1320 accgtcacaa aaatggacaa agcatctctc ctcggtgacg ccatttata catcaacgag 1380 ctcaaaaaa aggtcgagaa cagtgatggt gaaaagaag aactgaaaa ccaattgaa 1440 tcattaaaaa aggaattaat cataaatgc cccacaat catctcatc tatcacctgc 1500 ataccagacg acatgaaaaa atccaccacc accaccacca acaacaacaa ccaccttcca 1560 atgacggatt tggatgtaga tgtgaaggtg atcggttggg acgccatgat tggaatccaa 1620 tctaacaaaa ggttccaccc tgcagcccgg tttatggctg cattgaagga gcttgattta 1680 gaagtgaacc atgcgagtgt gtcggtggtg aatgacatga tgatccaaca agctaccgtg 1740 aaaatgggtg gtcagttgta cagtgaagat cagctccggt tagccttaac aaaaagattt 1800 tcagatccgt tatga 1815 <210> 2 <211> 604 <212> PRT <213> Stevia rebaudiana <400> 2 Met Asn His Trp Thr Ser Asp Lys Asn Ala Ser Met Met Asp Ala Phe 1 5 10 15 Ile Thr Ser Asp Leu Thr Ser Ile Trp Ala Asn Pro Thr Asn Thr Ala 20 25 30 Ala Thr Thr Val Tyr Thr Ala Ser Ser Ser Ala Ser Thr Ser Val Ile 35 40 45 Asn Asp Phe Asn Gln Asp Thr Leu Gln Gln Arg Leu Gln Gly Leu Ile 50 55 60 Asp Thr Ala Pro Glu Ser Trp Thr Tyr Ala Ile Phe Trp Gln Ser Ser 65 70 75 80 Ile Val Glu Tyr Ser Gly Pro Arg Met Leu Ala Trp Gly Asp Gly Tyr 85 90 95 Tyr Lys Gly Glu Met Asn Lys Leu Lys Thr Thr Pro Ser Ala Ala Ser 100 105 110 Leu Ala Glu Gln Gln Tyr Arg Lys Lys Val Leu Arg Glu Leu Asn Ser 115 120 125 Leu Ile Ser Asp Val Gln Ala Pro Glu Asn Asp Val Val Asp Glu Glu 130 135 140 Val Thr Asp Thr Glu Trp Phe Tyr Leu Ile Ser Met Thr Gln Ser Phe 145 150 155 160 Leu Asn Gly Asp Gly Leu Pro Gly Gln Ala Ala Leu Thr Asn Gln Pro 165 170 175 Val Trp Val Val Gly Arg Glu Arg Leu Met Thr Ser His Cys Glu Arg 180 185 190 Val Arg Gln Gly Gln Val Phe Gly Leu Gln Thr Met Val Cys Ile Pro 195 200 205 Ser Ala Gly Gly Val Ile Glu Leu Gly Ser Thr Asp Leu Ile Phe Gln 210 215 220 Ser Leu Asp Val Met Lys Lys Val Arg Val Ser Phe Asn Thr Asn Phe 225 230 235 240 Asn Asp Ala Met Gln Thr Asn Thr Asn Gln Val Thr Gly Gly Asp Thr 245 250 255 Asp Pro Leu Pro Phe Leu Leu Thr Asp Pro Val Ala Ser Ser Asp Val 260 265 270 Thr Thr Ser Val Ile Pro Ser Ile Asn Pro Lys Ser Leu Ser Asp Asn 275 280 285 Pro Arg Ser Val Leu Asn Tyr Asn Gln Ser Phe Asn Gly Thr Thr Gly 290 295 300 Gly Arg Asn Gly Asn Ser Thr Asp Asn Lys Pro Glu Ser Gly Lys Val 305 310 315 320 Leu Asn Phe Thr Gly Ala Val Glu Asn Asn Asn Thr Asn Lys Lys Lys 325 330 335 Arg Ser Pro Thr Ser Ser Gly Ser Asn Glu His Gly Met Asp Thr Phe 340 345 350 Phe Ala Gly Val Leu Pro Ser Ser Gly Thr Val Lys Ser Gly Gly Gly 355 360 365 Ala Leu Thr Lys Ala Asp Ser Gly Lys Ser Asp Leu Asn Ala Ala Val 370 375 380 Ile Arg Glu Val Lys Ala Ser Thr Val Val Glu Leu Glu Lys Lys Pro 385 390 395 400 Arg Lys Arg Gly Arg Lys Pro Ala Asn Gly Arg Glu Glu Pro Leu Asn 405 410 415 His Val Glu Ala Glu Arg Gln Arg Arg Glu Lys Leu Asn Gln Arg Phe 420 425 430 Tyr Ala Leu Arg Ala Val Val Pro Thr Val Thr Lys Met Asp Lys Ala 435 440 445 Ser Leu Leu Gly Asp Ala Ile Leu Tyr Ile Asn Glu Leu Lys Thr Lys 450 455 460 Val Glu Asn Ser Asp Gly Glu Lys Glu Glu Leu Thr Asn Gln Ile Glu 465 470 475 480 Ser Leu Lys Lys Glu Leu Ile Asn Lys Cys Pro Gln Gln Ser Ser Ser 485 490 495 Ser Ile Thr Cys Ile Pro Asp Asp Met Lys Lys Ser Thr Thr Thr Thr 500 505 510 Thr Asn Asn Asn Asn His Leu Pro Met Thr Asp Leu Asp Val Asp Val 515 520 525 Lys Val Ile Gly Trp Asp Ala Met Ile Gly Ile Gln Ser Asn Lys Arg 530 535 540 Phe His Pro Ala Ala Arg Phe Met Ala Ala Leu Lys Glu Leu Asp Leu 545 550 555 560 Glu Val Asn His Ala Ser Val Ser Val Val Asn Asp Met Met Ile Gln 565 570 575 Gln Ala Thr Val Lys Met Gly Gly Gln Leu Tyr Ser Glu Asp Gln Leu 580 585 590 Arg Leu Ala Leu Thr Lys Arg Phe Ser Asp Pro Leu 595 600

Claims

1. A Stevia SrMYC2 gene, characterized in that: The nucleotide sequence of the Stevia SrMYC2 gene is shown in SEQ ID NO.

1.

2. The protein expressed by the Stevia SrMYC2 gene according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. A vector or host bacteria containing the Stevia SrMYC2 gene according to claim 1.

4. Use of the Stevia SrMYC2 gene according to claim 1 in delaying the flowering time of Arabidopsis thaliana.

Images